[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.26 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk102-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk102-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk102.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.0 = TGCTACCCAAGCCGCT-1

using 1951 reads

====================================================================================

graph has 2368 edges initially, 58 edges after simplification

total ucounts = 1019
nonsolo ucounts = 401[2^188, 3^101, 4^37, 5^26, 6^18, 7^14, 8^7, 9^2, 11^3, 12^3, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.7 = TGCTACCCACAGATTC-1

using 132 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 128]
surviving nonsolo ucounts = 1[128]
ids = [0]

====================================================================================

UMI info for barcode TGCTACCCACAGATTC-1 contig 1 = GAGCCTTAGC...
umi AGCGTGTCAT = 129 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=552]
0-66 ==> 13-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
66-419 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=19)
467-511 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
511-552 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARASGDIVIVPATMSYFFPMDVW at 408, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 66, 222, 369, 450, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.10 = TGCTACCCACCAGATT-1

using 17633 reads

====================================================================================

graph has 6817 edges initially, 118 edges after simplification

total ucounts = 1506
nonsolo ucounts = 608[2^274, 3^128, 4^61, 5^30, 6^20, 7^11, 8^9, 9^2, 10^3, 11^3, 13^2, 15, 21, 26, 33, 35, 43, 67, 92, 96, 106, 119, 137, 141, 155, 159, 160, 169, 176^2, 178, 189, 191, 206, 210, 213, 215, 219, 225^3, 227, 228, 230, 232, 236, 242, 243, 245, 257^2, 260, 264, 270, 278, 286, 290, 293^2, 294^2, 301, 304, 305, 307, 311, 312, 336, 347, 351, 355, 358, 402, 444, 529, 629]
surviving nonsolo ucounts = 58[67, 92, 96, 106, 137, 141, 155, 159, 160, 169, 176^2, 178, 189, 191, 206, 210, 213, 215, 219, 225^3, 227, 228, 230, 232, 236, 242, 243, 245, 257^2, 260, 264, 270, 278, 286, 290, 293^2, 294^2, 301, 304, 305, 307, 311, 312, 336, 347, 351, 355, 358, 402, 444, 529, 629]
ids = [705, 1339, 820, 1143, 1352, 868, 745, 437, 526, 419, ...]

====================================================================================

UMI info for barcode TGCTACCCACCAGATT-1 contig 1 = AGGAGTCAGA...
umi ACACCACCCA = 228 reads: +388 validated
umi AGAGCAACCC = 243 reads: +388 validated
umi AGGACCTTCA = 213 reads: +388 validated
umi ATTTCCCTTT = 266 reads: +388 validated
umi CACATGCCTC = 287 reads: +388 validated
umi CACTCAACCT = 178 reads: +388 validated
umi CAGGCGTCGG = 168 reads: +388 validated
umi CATCGGTAGG = 158 reads: +388 validated
umi CATTCACTGC = 262 reads: +388 validated
umi CCCGTTGGTC = 274 reads: +388 validated
umi CCGCACCCTC = 301 reads: +388 validated
umi CCTAAGGATG = 340 reads: +388 validated
umi CCTTATTGGC = 211 reads: +388 validated
umi CGAGTAATTT = 306 reads: +388 validated
umi CGATGGGTCT = 312 reads: +187 -2XX +1 -14XX +2 -4XX +1 -2XX +1 -3XX +1 -4XX +1 -135X +1 -2XX +1 -3XX +2 -2XX +1 -2XX +3 -1XX +1 -2XX +1 -8XX invalidated
umi CGTGCTGGCA = 346 reads: +388 validated
umi CTACTTACGG = 466 reads: +188 -1XX +1 -2XX +2 -2XX +2 -2XX +2 -6XX +3 -150XX +2 -3XX +1 -6XX +1 -5XX +1 -1XX +1 -4XX +1 -1XX invalidated
umi CTTCGACGTT = 151 reads: +388 validated
umi GACCCAGGCT = 228 reads: +388 validated
umi GACTTAACAT = 296 reads: +388 validated
umi GGCTATCTAT = 353 reads: +388 validated
umi GGTGCAAGGA = 296 reads: +388 validated
umi GTATATGCTC = 305 reads: +388 validated
umi GTATTAAGTG = 307 reads: +388 validated
umi GTCTGAGCAG = 190 reads: +388 validated
umi GTTATTCACA = 309 reads: +388 validated
umi TAAAAGATGC = 267 reads: +388 validated
umi TACGCTCGTG = 356 reads: +388 validated
umi TACGTTCATA = 256 reads: +388 validated
umi TATGTAACAG = 106 reads: +388 validated
umi TCACCTTGGA = 261 reads: +388 validated
umi TCGTTGCTGT = 224 reads: +388 validated
umi TGCTCAGTCA = 307 reads: +388 validated
umi TGGTCCTACT = 295 reads: +388 validated
umi TGTTACACTG = 227 reads: +388 validated
umi TTAAGCGACT = 308 reads: +388 validated
umi TTCTTCACTG = 288 reads: +388 validated
umi TTTGTGTACG = 351 reads: +388 validated

UMI info for barcode TGCTACCCACCAGATT-1 contig 2 = AGCTCTGAGA...
umi AACAATGGCT = 158 reads: -412X +2 -3X +1 -7XX +2 -2XX +1 -4XX +1 -7XX +3 invalidated
umi ACCTAGTCGG = 219 reads: +445 validated
umi ACTCTTTGCC = 225 reads: +445 validated
umi AGAGCTTCCT = 242 reads: +445 validated
umi AGTAGCTCTG = 189 reads: +430 -15 non-validated
umi CAAATCTGTG = 179 reads: +445 validated
umi CCCTTTGAGA = 160 reads: +445 validated
umi CGATAATAGT = 614 reads: -413X +1 -2XX +1 -1XX +3 -6XX +1 -1XX +1 -1XX +1 -3XX +1 -8XX +1 invalidated
umi CTCTCGTTAC = 66 reads: +426 -19 non-validated
umi CTTTCGCTAA = 251 reads: +445 validated
umi GATTATACAC = 95 reads: +445 validated
umi GCGGTACAGG = 139 reads: +445 validated
umi GCTCCCAACC = 238 reads: +445 validated
umi TAATACGGGT = 229 reads: +445 validated
umi TACCATCGGT = 497 reads: -412X +3 -3XX +1 -3XX +2 -1XX +1 -3XX +1 -6XX +1 -3XX +2 -2XX +1 invalidated
umi TCATTATTGT = 209 reads: +445 validated
umi TCGGCGGGGT = 227 reads: +445 validated
umi TCGTGTAACC = 204 reads: +445 validated
umi TGGCGCTAGT = 93 reads: +429 -16 non-validated
umi TGTAGGACTA = 140 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=13)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 36 umis using 1480 reads
cdr3 = CQQYNSYSQTF at 354, score = 8 + 8
umis assigned: [97, 198, 218, 345, 373, 400, 419, 437, 448, 517] and 28 others
of which 38 are surviving nonsolos
reads assigned: 10084
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true

TIG 2[bases=684]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=19)
480-524 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
524-684 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 14 umis using 250 reads
cdr3 = CARASGDIVIVPATMSYFFPMDVW at 421, score = 9 + 7
umis assigned: [22, 139, 177, 199, 232, 357, 526, 581, 705, 767] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4301
start codons at 79, 235, 382, 463, 481, 578
confident = true
now this is a cell
paired!

GCGAGAGCCTCGGGGGATATTGTCATAGTGCCAGCTACTATGTCCTACTTCTTCCCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCAGACGTTCGGGCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.16 = TGCTACCCAGACGCAA-1

using 304 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 293]
surviving nonsolo ucounts = 1[293]
ids = [2]

====================================================================================

UMI info for barcode TGCTACCCAGACGCAA-1 contig 1 = GAAGAGCTGC...
umi CAGGGCACTT = 277 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=490]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-490 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQYYGSPLWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 33, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.21 = TGCTACCCAGCAGTTT-1

using 11 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.23 = TGCTACCCAGCCTTTC-1

using 271 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 258]
surviving nonsolo ucounts = 1[258]
ids = [5]

====================================================================================

UMI info for barcode TGCTACCCAGCCTTTC-1 contig 1 = GCTGGGGTCT...
umi TAATTTCCTG = 244 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=576]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-380 ==> 0-339 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
435-576 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CSSYTGTNTLDVLF at 365, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 41, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.26 = TGCTACCCAGGAACGT-1

using 846 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 329, 511]
surviving nonsolo ucounts = 2[329, 511]
ids = [3, 0]

====================================================================================

UMI info for barcode TGCTACCCAGGAACGT-1 contig 1 = GGGGAGGAAT...
umi AAGGTCTCGA = 513 reads: +388 validated
umi CAACTACTGG = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 123 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 830
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.33 = TGCTACCCATAGTAAG-1

using 341 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.37 = TGCTACCCATCGATTG-1

using 932 reads

====================================================================================

graph has 1204 edges initially, 14 edges after simplification

total ucounts = 438
nonsolo ucounts = 209[2^98, 3^48, 4^22, 5^13, 6^11, 7^7, 8^4, 9^2, 10^3, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.40 = TGCTACCCATGCCACG-1

using 239 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [0]

====================================================================================

UMI info for barcode TGCTACCCATGCCACG-1 contig 1 = GGGGTCACAA...
umi TGCTATACCT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=522]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-522 ==> 0-96 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CCSYAGSSTWVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.47 = TGCTACCGTAAGAGAG-1

using 965 reads

====================================================================================

graph has 1385 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[964]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.53 = TGCTACCGTAGAGTGC-1

using 2307 reads

====================================================================================

graph has 2512 edges initially, 42 edges after simplification

total ucounts = 774
nonsolo ucounts = 347[2^129, 3^81, 4^48, 5^27, 6^24, 7^7, 8^6, 9^7, 10^4, 11^5, 12, 13^3, 14^3, 38, 521]
surviving nonsolo ucounts = 1[521]
ids = [14]

====================================================================================

UMI info for barcode TGCTACCGTAGAGTGC-1 contig 1 = GAGAAGAGCT...
umi AAAGTCAGCT = 532 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CQQYGNSVWTF at 359, score = 8 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 519
start codons at 35, 246, 350, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.54 = TGCTACCGTAGCCTAT-1

using 183 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[183]
surviving nonsolo ucounts = 1[183]
ids = [0]

====================================================================================

UMI info for barcode TGCTACCGTAGCCTAT-1 contig 1 = CTGATTTGCA...
umi AACATTTCTA = 180 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-114 ==> 0-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
114-467 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
464-502 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
502-538 ==> 0-36 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CAAWDDSLNGRVF at 435, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 9, 13, 36, 114, 418, 443, 448, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.55 = TGCTACCGTAGCCTCG-1

using 224 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[8, 211]
surviving nonsolo ucounts = 1[211]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=559]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 36, 244, 370, 465
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.64 = TGCTACCGTCATGCAT-1

using 325 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode TGCTACCGTCATGCAT-1 contig 1 = AGTCAGACCC...
umi ACCGTACGCA = 293 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=480]
0-30 ==> 23-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
30-375 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
384-412 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
412-480 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYSYPRTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 24, 30, 86, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.72 = TGCTACCGTCTGCGGT-1

using 302 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 290]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TGCTACCGTCTGCGGT-1 contig 1 = ATCACTCAAC...
umi CCTCATTATA = 289 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=538]
58-411 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=13)
433-467 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
467-538 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CATGLLAGPIYW at 400, score = 9 + 7
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 286
start codons at 58, 209, 256, 261, 265, 293, 322, 340, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.73 = TGCTACCGTCTGGTCG-1

using 239 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=478]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
6-47 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 33, 102, 238, 456
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.75 = TGCTACCGTGAAAGAG-1

using 80 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 4^2, 5, 62]
surviving nonsolo ucounts = 1[62]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.84 = TGCTACCGTTCCACTC-1

using 511 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 503]
surviving nonsolo ucounts = 1[503]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
20-220 ==> 153-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=15)
269-303 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
303-463 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 209, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 494
start codons at 65, 70, 87, 131, 164, 357
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.87 = TGCTACCGTTTACTCT-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.88 = TGCTACCGTTTCGCTC-1

using 181 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 176]
surviving nonsolo ucounts = 1[176]
ids = [4]

====================================================================================

UMI info for barcode TGCTACCGTTTCGCTC-1 contig 1 = ATCACATAAC...
umi TGCTAGTGTA = 167 reads: +466 validated

GOOD CONTIGS

TIG 1[bases=532]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
426-463 ==> 0-37 on |19|IGHD3-16|D-REGION| [len=37] (mis=7)
478-524 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARGIRAPHNYDYVWGSYRSYPVSVGGMDVW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 58, 209, 256, 355, 431, 481
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.94 = TGCTACCTCACGATGT-1

using 709 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 334, 362]
surviving nonsolo ucounts = 2[334, 362]
ids = [10, 4]

====================================================================================

UMI info for barcode TGCTACCTCACGATGT-1 contig 1 = GAGAGCATCA...
umi TTGGCAATCC = 333 reads: +418 validated

UMI info for barcode TGCTACCTCACGATGT-1 contig 2 = GCTGGGGTCT...
umi CTAATTTCCA = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
436-482 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARTPGGSGSQWDYW at 406, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 64, 220, 262, 267, 299, 328, 361, 438
confident = false

TIG 2[bases=568]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-568 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 102.97 = TGCTACCTCAGCTGGC-1

using 753 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 4, 98, 137, 504]
surviving nonsolo ucounts = 2[137, 504]
ids = [2, 4]

====================================================================================

UMI info for barcode TGCTACCTCAGCTGGC-1 contig 1 = GAAGCTCAGC...
umi CTCACTGGGT = 138 reads: +391 validated
umi CTGATACGCT = 510 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=655]
0-53 ==> 3-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
53-404 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
406-444 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
444-655 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 117 reads
cdr3 = CAAWDDSLSGFVVF at 374, score = 7 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 638
start codons at 53, 207, 357, 382, 387
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk102-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk102-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

5.698 seconds used processing barcodes, peak mem = 0.23
