[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 832.60 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk099-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk099-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk099.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.0 = TCTCATATCGCAAACT-1

using 465 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[464]
surviving nonsolo ucounts = 1[464]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2 = TCTCATATCGGAGCAA-1

using 229 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 221]
surviving nonsolo ucounts = 1[221]
ids = [2]

====================================================================================

UMI info for barcode TCTCATATCGGAGCAA-1 contig 1 = GCTGGGGTCT...
umi GAGCTTTTAA = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=2)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-465 ==> 0-36 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSSYAGSNNLVF at 365, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 41, 242, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.9 = TCTCATATCTCGAGTA-1

using 267 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [1]

====================================================================================

UMI info for barcode TCTCATATCTCGAGTA-1 contig 1 = CTCCTCAGTT...
umi TCTGGACCCC = 253 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=472]
0-22 ==> 8-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
22-382 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
419-472 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPVTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 22, 55, 91, 179, 341, 361, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.12 = TCTCATATCTGTACGA-1

using 930 reads

====================================================================================

graph has 1106 edges initially, 12 edges after simplification

total ucounts = 301
nonsolo ucounts = 147[2^53, 3^28, 4^22, 5^16, 6^9, 7^11, 8^3, 11^2, 12^2, 217]
surviving nonsolo ucounts = 1[217]
ids = [259]

====================================================================================

UMI info for barcode TCTCATATCTGTACGA-1 contig 1 = AGTCCCAACC...
umi TGAGACGTAT = 206 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=489]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
405-489 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYDNLPTF at 347, score = 9 + 8
umis assigned: [259]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.13 = TCTCATATCTTAACCT-1

using 1118 reads

====================================================================================

graph has 1296 edges initially, 18 edges after simplification

total ucounts = 422
nonsolo ucounts = 170[2^68, 3^45, 4^18, 5^17, 6^5, 7^5, 8^6, 9, 10^2, 11^2, 274]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.19 = TCTCTAAAGAGATGAG-1

using 242 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 6, 224]
surviving nonsolo ucounts = 1[224]
ids = [6]

====================================================================================

UMI info for barcode TCTCTAAAGAGATGAG-1 contig 1 = AGAGCTCTGG...
umi TCGCGCATGC = 201 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=522]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
429-522 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSLGTF at 368, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.37 = TCTCTAAAGGTGATTA-1

using 339 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 7, 318]
surviving nonsolo ucounts = 1[318]
ids = [7]

====================================================================================

UMI info for barcode TCTCTAAAGGTGATTA-1 contig 1 = TGGGGAGGAG...
umi CGGTGAATAC = 323 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=553]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYSTPSF at 359, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 32, 38, 94, 107, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.46 = TCTCTAAAGTGTCTCA-1

using 107 reads

====================================================================================

graph has 142 edges initially, 6 edges after simplification

total ucounts = 17
nonsolo ucounts = 14[2^2, 3, 4^3, 5^2, 7, 8, 10, 14, 15, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.47 = TCTCTAAAGTTACCCA-1

using 16780 reads

====================================================================================

graph has 8485 edges initially, 150 edges after simplification

total ucounts = 1284
nonsolo ucounts = 628[2^206, 3^123, 4^83, 5^44, 6^37, 7^25, 8^18, 9^11, 10^5, 11^6, 12^2, 13^2, 15, 17^2, 18, 30, 48, 60, 61, 66, 71, 80, 91, 104, 113, 116, 120, 121, 126, 131, 137, 139, 163, 166, 167^2, 172, 182, 184^2, 186, 187, 188, 194^2, 196, 204, 208, 209^2, 212, 215, 216, 217^2, 218, 219, 220, 226, 230, 232, 235^2, 241^2, 244, 250, 269, 273, 285, 336, 441, 526, 577, 645, 740, 984]
surviving nonsolo ucounts = 57[30, 60, 61, 66, 71, 91, 104, 113, 116, 120, 121, 126, 131, 137, 139, 163, 166, 167^2, 172, 182, 184^2, 187, 188, 194^2, 196, 204, 208, 209^2, 212, 215, 216, 217^2, 218, 219, 220, 226, 230, 232, 235^2, 241^2, 244, 250, 269, 285, 336, 441, 526, 577, 740, 984]
ids = [477, 869, 1085, 1140, 753, 637, 122, 22, 945, 305, ...]

====================================================================================

UMI info for barcode TCTCTAAAGTTACCCA-1 contig 1 = GGGGGCAGCG...
umi AACTCGCTTT = 287 reads: +394 validated
umi AAGCACCGGA = 186 reads: +394 validated
umi AATTTGCCTA = 204 reads: +394 validated
umi ACATATTGAT = 231 reads: +394 validated
umi ACCCCTCCTT = 101 reads: +394 validated
umi ACTTTCAATT = 235 reads: +394 validated
umi AGTTGCAACA = 179 reads: +394 validated
umi ATCCCATTCA = 121 reads: +254 -3XX +1 -1XX +2 -1XX +2 -2X +1 -5XX +2 -2XX +2 -6XX +1 -1XX +108 invalidated
umi ATTTGCTTGT = 209 reads: +394 validated
umi CAAGTACTCC = 121 reads: +394 validated
umi CAATTTCGTG = 994 reads: -360X +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CATAAGCCCC = 218 reads: +394 validated
umi CCCCGCGCGG = 527 reads: -212X +1 -4X +1 -5X +2 -2XX +167 invalidated
umi CCTCAATTGT = 663 reads: -274X +1 -3XX +1 -3XX +1 -8XX +1 -2XX +1 -2XX +2 -1XX +1 -3XX +1 -1XX +88 invalidated
umi CCTGTGTTAA = 210 reads: +326 -2X +1 -2X +1 -2XX +60 invalidated
umi CCTTATAACA = 92 reads: +394 validated
umi CCTTCCATTA = 239 reads: +394 validated
umi CCTTTGAGTG = 168 reads: +394 validated
umi CGCGTGATAC = 218 reads: +394 validated
umi CGTATTCTAT = 218 reads: +394 validated
umi CTATCCCCTT = 247 reads: +394 validated
umi CTCACACCTC = 191 reads: +394 validated
umi CTCGGACGGC = 164 reads: +394 validated
umi CTCTTACACC = 212 reads: +394 validated
umi CTGTGCCGAG = 272 reads: +394 validated
umi CTTCCTAAAG = 184 reads: +394 validated
umi CTTTACTTTT = 126 reads: +394 validated
umi GACGCTGCCG = 134 reads: +394 validated
umi GCCCCGGCCG = 115 reads: +394 validated
umi GCCTGGTTTT = 164 reads: +394 validated
umi GCTAATAACC = 174 reads: +394 validated
umi GCTATAGGTT = 186 reads: +394 validated
umi GGCTGCATAG = 218 reads: +394 validated
umi GTCTGACCTA = 34 reads: -12X +1 -2XX +3 -1XX +19 -2XX +1 -2XX +21 -2XX +11 -2XX +4 -1XX +1 -1XX +7 -1XX +1 -1XX +2 -1XX +1 -254X +1 -5XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi GTTCCAAACA = 209 reads: +394 validated
umi TCACCTTGCA = 217 reads: +394 validated
umi TCCCAGCTCC = 168 reads: +394 validated
umi TGTTGTGTAT = 245 reads: +394 validated
umi TTTCCCTGGA = 214 reads: +394 validated

UMI info for barcode TCTCTAAAGTTACCCA-1 contig 2 = AGCTCTGGGA...
umi AACATCATGC = 112 reads: +430 validated
umi ACCTCCTTGC = 243 reads: +430 validated
umi CACCCTCCCC = 189 reads: +430 validated
umi CACGTAACCG = 222 reads: +430 validated
umi CATTTGCTCC = 241 reads: +430 validated
umi CCCCATAGCA = 228 reads: +430 validated
umi CCTCCATTGA = 47 reads: -19 +2 -1XX +16 -1XX +3 -1XX +10 -1XX +41 -1XX +2 -1XX +3 -1XX +19 -2XX +3 -2XX +1 -300 invalidated
umi CTTTCTTTCC = 61 reads: +377 -2 +2 -1 +6 -2 +3 -3 +8 -1 +2 -23 non-validated
umi GAGTTTGCAG = 220 reads: +430 validated
umi GCCCGATGCT = 130 reads: +430 validated
umi GTCCTTACCA = 61 reads: +430 validated
umi TCTTCTCCAT = 197 reads: +430 validated
umi TTTTATCATC = 137 reads: +420 -10 non-validated

GOOD CONTIGS

TIG 1[bases=634]
29-356 ==> 0-327 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=13)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
423-634 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 36 umis using 1166 reads
cdr3 = CSSYTSSTTLVYVF at 353, score = 8 + 8
umis assigned: [32, 39, 71, 100, 122, 204, 266, 305, 367, 383] and 29 others
of which 38 are surviving nonsolos
reads assigned: 8700
start codons at 29, 165, 186, 240, 387, 555
confident = true

TIG 2[bases=670]
0-80 ==> 0-80 on |107|IGHV3-13|5'UTR| [len=80] (mis=1)
80-430 ==> 0-350 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=24)
447-510 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
510-670 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 10 umis using 171 reads
cdr3 = CTIGGGYTYGFTYFYYMDVW at 419, score = 9 + 7
umis assigned: [22, 138, 406, 413, 498, 540, 610, 869, 908, 947] and 3 others
of which 12 are surviving nonsolos
reads assigned: 2058
start codons at 80, 297, 354, 380, 444, 467, 564
confident = true

REJECT CONTIGS

TIG 1[bases=382]
0-49 ==> 0-49 on |208|IGHV7-4-1|5'UTR| [len=49] (mis=1)
0-49 ==> 5951-6000 on rc of segment after IGHV7-4-1 exon 1 [len=6000] (mis=1)
35-67 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
49-96 ==> 0-47 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=5)
49-92 ==> 0-43 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=1)
92-150 ==> 57-115 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=3)
96-178 ==> 61-143 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=11)
200-382 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
umis assigned: [254, 667, 674]
of which 2 are surviving nonsolos
reads assigned: 1250
start codons at 49, 182, 191
confident = false
did not find CDR3

TIG 2[bases=925]
5-581 ==> 1719-2295 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=2)
589-751 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
751-789 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
789-925 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [453, 477, 753, 1140, 1262]
of which 5 are surviving nonsolos
reads assigned: 910
start codons at 72, 121, 128, 188, 273, 338, 370, 405, 429, 506, 559, 614, 619, 732, 831
confident = false
did not find CDR3
now this is a cell
paired!

GTCTATTACTGTACAATAGGGGGAGGATACACCTATGGTTTCACCTACTTCTACTATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCTCCTCATATACAAGTAGCACCACTCTCGTCTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.54 = TCTCTAACAAAGGTGC-1

using 414 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 409]
surviving nonsolo ucounts = 1[409]
ids = [3]

====================================================================================

UMI info for barcode TCTCTAACAAAGGTGC-1 contig 1 = AGCCCCAGCC...
umi TCTATTCCCA = 392 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=522]
0-66 ==> 170-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
66-397 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
438-475 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
475-522 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CTNLYHFGSEVW at 408, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 389
start codons at 66, 222, 283
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.57 = TCTCTAACAAGCCGCT-1

using 37 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 1[34]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.64 = TCTCTAACAATTGCTG-1

using 79 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 70]
surviving nonsolo ucounts = 1[70]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.67 = TCTCTAACACCAGGCT-1

using 209 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode TCTCTAACACCAGGCT-1 contig 1 = AAAAACCACA...
umi AACAACACAC = 201 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=489]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.78 = TCTCTAACAGCCTTTC-1

using 25067 reads

====================================================================================

graph has 9210 edges initially, 98 edges after simplification

total ucounts = 1242
nonsolo ucounts = 654[2^248, 3^116, 4^75, 5^52, 6^29, 7^12, 8^5, 9^11, 10^9, 11^4, 12^3, 14, 15, 16, 17, 23, 29, 33, 48, 55, 74, 94, 96^2, 109, 113, 117, 118, 121, 143, 147, 148, 161, 166, 169, 171, 173, 180, 181^2, 183, 186, 188, 193, 194^2, 195, 196, 201, 204, 206, 207^2, 212, 215, 219, 221^2, 222, 224^2, 229, 235^2, 237, 238, 239, 241, 243, 244, 246, 247, 248^3, 251, 258, 260^2, 270, 274, 277, 285, 286, 287^2, 295, 308, 309, 316, 326, 342, 357, 380, 504, 567, 700, 703, 731, 883, 2093]
surviving nonsolo ucounts = 80[48, 74, 94, 96^2, 109, 113, 117, 118, 143, 147, 148, 161, 166, 169, 173, 180, 181^2, 183, 186, 188, 193, 194^2, 195, 196, 201, 204, 206, 207^2, 212, 215, 219, 221^2, 222, 224^2, 229, 235^2, 237, 238, 239, 241, 243, 244, 246, 247, 248^3, 251, 258, 260^2, 270, 274, 277, 285, 286, 287^2, 295, 308, 309, 316, 326, 342, 357, 380, 504, 567, 700, 703, 731, 883, 2093]
ids = [1155, 257, 170, 681, 996, 54, 833, 220, 7, 709, ...]

====================================================================================

UMI info for barcode TCTCTAACAGCCTTTC-1 contig 1 = GGAGTCTCCC...
umi AAACCCTTTA = 119 reads: +361 -22 +29 non-validated
umi AAGATCCATA = 326 reads: +412 validated
umi AAGATCGGTT = 109 reads: +403 -9 non-validated
umi AAGTACTGTG = 201 reads: +400 -2 +7 -2 +1 non-validated
umi AAGTCTTCGT = 299 reads: +412 validated
umi AATTCTTCTT = 237 reads: +412 validated
umi ACGCACGGAA = 244 reads: +412 validated
umi ACTCAGCATG = 95 reads: +412 validated
umi AGCTTAGGTT = 106 reads: -361X +1 -4X +1 -3X +1 -1XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi ATAATATGCG = 74 reads: +412 validated
umi ATATTGGGTA = 209 reads: +388 -24 non-validated
umi CAACTACGTT = 280 reads: +412 validated
umi CCTAGGTCCG = 291 reads: +412 validated
umi CCTCACGTCT = 284 reads: +412 validated
umi CGCTCTCTCT = 342 reads: +412 validated
umi CTGTCTTCCT = 309 reads: +412 validated
umi GACTTATTCG = 155 reads: +101 -1XX +297 -1 +12 invalidated
umi GCAGTATTTA = 196 reads: +412 validated
umi GCATTCGTTT = 91 reads: +355 -1 +19 -4 +33 non-validated
umi GCTTTGCGCG = 737 reads: -121X +1 -1XX +289 invalidated
umi GGTCATACTC = 321 reads: +412 validated
umi GTTACAATAA = 115 reads: +403 -1 +1 -7 non-validated
umi TACAATATAC = 220 reads: +412 validated
umi TACTGATATA = 245 reads: +412 validated
umi TCCTAATCAA = 99 reads: +412 validated
umi TCGCCGGCCG = 203 reads: +412 validated
umi TGGTGGTAAC = 225 reads: +412 validated
umi TTCGGTACGC = 45 reads: +412 validated

UMI info for barcode TCTCTAACAGCCTTTC-1 contig 2 = GCTCTGCTTC...
umi AACCGAGCGC = 239 reads: +394 validated
umi AACTCCGTCA = 244 reads: +394 validated
umi AAGATGTCGC = 159 reads: +394 validated
umi AAGCACTCTC = 30 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi AAGTGGAGTC = 224 reads: +394 validated
umi AATGGACTAC = 179 reads: +394 validated
umi AATTGTGCCC = 190 reads: +394 validated
umi ACCCATACCG = 7 reads: -339X +1 -4X +1 -3X +1 -7X +6 -1X +23 -8 invalidated
umi ACGTACTTAC = 179 reads: +394 validated
umi ACTTCGTGCG = 224 reads: +394 validated
umi ACTTGTGGTT = 559 reads: -357 +5 -1XX +31 invalidated
umi AGATGGTTAC = 194 reads: +394 validated
umi AGCCACACAA = 2113 reads: -343 +1 -2XX +2 -6XX +1 -3XX +4 -1XX +31 invalidated
umi ATCCCTTTAA = 6 reads: -339X +1 -4X +1 -3X +1 -7X +6 -1XX +31 invalidated
umi ATTATGTACA = 169 reads: +394 validated
umi ATTCTATGGT = 289 reads: +394 validated
umi ATTGCGAACA = 24 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi ATTGTGCTTA = 71 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi CACTGTTTCG = 230 reads: +394 validated
umi CAGATATCGA = 248 reads: +394 validated
umi CCAACTTACT = 876 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi CCTGCCGTGT = 52 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi CGCAATGCGT = 24 reads: -339X +1 -4XX +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi CGCATTTGGG = 248 reads: +394 validated
umi CGCTGGATTT = 196 reads: +394 validated
umi CGGATTGTTA = 239 reads: +394 validated
umi CTAATTTTCG = 200 reads: +394 validated
umi GAACAGCAAA = 166 reads: +394 validated
umi GATAATACCT = 237 reads: +394 validated
umi GATAGCAGTC = 251 reads: +394 validated
umi GATCTGGGAC = 210 reads: +394 validated
umi GCCAAGGACT = 179 reads: +394 validated
umi GCGCCCTGTC = 145 reads: +394 validated
umi GGATCTACCA = 195 reads: +394 validated
umi GGGGGAATAC = 355 reads: +394 validated
umi GTAAACCACT = 717 reads: -343X +1 -3X +1 -6XX +1 -3XX +4 -1XX +31 invalidated
umi GTAGCCCTTG = 225 reads: +394 validated
umi GTAGCCGGGT = 217 reads: +394 validated
umi GTATTTATCA = 265 reads: +394 validated
umi GTCAGGCCCG = 243 reads: +394 validated
umi TAAACTTGTG = 188 reads: +394 validated
umi TAATATATGC = 261 reads: +394 validated
umi TACCAACCGG = 18 reads: -232 +2 -1X +10 -1X +11 -1 +8 -1X +2 -2X +11 -1X +1 -1X +3 -51 +1 -4X +1 -3XX +1 -7XX +6 -1XX +31 invalidated
umi TACTTGCGAC = 277 reads: +394 validated
umi TAGTTTCTTC = 143 reads: +394 validated
umi TCCACACGAA = 274 reads: +394 validated
umi TCCCACTTTG = 211 reads: +394 validated
umi TGTCGTCACA = 308 reads: +394 validated
umi TTAACGGGGG = 189 reads: +394 validated
umi TTCTAGGACC = 501 reads: +394 validated
umi TTGCCAGTTT = 705 reads: -359 +3 -1XX +31 invalidated

GOOD CONTIGS

TIG 1[bases=542]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=4)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 21 umis using 421 reads
cdr3 = CGRLIPDTGFDYW at 401, score = 8 + 7
umis assigned: [7, 52, 54, 66, 67, 91, 146, 170, 220, 257] and 18 others
of which 28 are surviving nonsolos
reads assigned: 6081
start codons at 59, 233, 257, 392
confident = true

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
445-656 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 38 umis using 1308 reads
cdr3 = CQSYDISLSGSGVF at 375, score = 8 + 8
umis assigned: [38, 45, 55, 57, 68, 84, 92, 124, 157, 182] and 41 others
of which 51 are surviving nonsolos
reads assigned: 13662
start codons at 51, 205, 208, 259, 358, 385
confident = true
now this is a cell
paired!

CTGAAGGCCTCGGACACCGCCATGTATTACTGTGGGAGACTCATCCCGGATACGGGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACATCAGCCTGAGTGGTTCGGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.81 = TCTCTAACAGGAACGT-1

using 204 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 6, 7, 185]
surviving nonsolo ucounts = 1[185]
ids = [0]

====================================================================================

UMI info for barcode TCTCTAACAGGAACGT-1 contig 1 = TGAGCGCAGA...
umi AAGACAGGGT = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
424-537 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CETWDSSLSAGIF at 357, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.82 = TCTCTAACAGGGCATA-1

using 295 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2^2, 3^2, 4, 5^2, 6, 7, 11, 242]
surviving nonsolo ucounts = 1[242]
ids = [11]

====================================================================================

UMI info for barcode TCTCTAACAGGGCATA-1 contig 1 = CTCAGGAAGC...
umi GCACCGTCAG = 235 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-31 ==> 55-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
31-384 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=12)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-535 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDNNNLWVF at 358, score = 6 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 31, 94, 185, 236, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.90 = TCTCTAACATCAGTCA-1

using 696 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[10, 682]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.93 = TCTCTAACATCGGACC-1

using 11923 reads

====================================================================================

graph has 3845 edges initially, 78 edges after simplification

total ucounts = 392
nonsolo ucounts = 177[2^60, 3^26, 4^11, 5^9, 6^2, 7^11, 8^3, 9^3, 10^5, 11^3, 13, 14, 18, 32, 37, 79, 148, 175, 178, 187, 189, 202, 205, 211, 213, 231, 239, 240, 242, 243, 244^2, 246, 247, 251^2, 253^2, 254, 265, 281, 293, 297, 306, 308^2, 313, 353, 410, 441, 519, 538, 594, 633]
surviving nonsolo ucounts = 38[148, 175, 178, 187, 189, 202, 205, 211, 213, 231, 239, 240, 242, 243, 244^2, 246, 247, 251^2, 253^2, 254, 265, 281, 293, 297, 306, 308^2, 313, 353, 410, 441, 519, 538, 594, 633]
ids = [128, 270, 310, 69, 303, 290, 140, 350, 118, 220, ...]

====================================================================================

UMI info for barcode TCTCTAACATCGGACC-1 contig 1 = ACTTTCTGAG...
umi ACAACACCTG = 257 reads: +412 validated
umi AGGATACGTT = 252 reads: +412 validated
umi CATTTCGTCT = 435 reads: -351X +61 invalidated
umi GAAGAGCGCG = 316 reads: +412 validated
umi GGAACTTGGT = 269 reads: +412 validated
umi GTTCTGCTGG = 248 reads: +412 validated
umi TAGTAGACTT = 244 reads: +412 validated
umi TCATAACCTA = 188 reads: +412 validated
umi TCGTTTGACA = 244 reads: +412 validated
umi TGTTTGCTGC = 213 reads: +412 validated

UMI info for barcode TCTCTAACATCGGACC-1 contig 2 = AGGAGTCAGA...
umi AAAAACTGCC = 301 reads: +388 validated
umi AGCTTTTGGC = 246 reads: +388 validated
umi ATAATGTTAA = 357 reads: +388 validated
umi CATGCGCCCT = 286 reads: +388 validated
umi CCGACCACCT = 211 reads: +388 validated
umi CGAACTCCTT = 146 reads: +388 validated
umi CGTGAGCCCT = 242 reads: +388 validated
umi CGTGAGTCGT = 205 reads: +388 validated
umi CTCACGTAGG = 241 reads: +388 validated
umi GAATTAGCTC = 255 reads: +388 validated
umi TACACGCAAT = 177 reads: +388 validated
umi TAGTTATCCG = 304 reads: +388 validated
umi TATACTTCCG = 203 reads: +388 validated
umi TCAGATACGA = 238 reads: +388 validated
umi TCCCCGCGCT = 176 reads: +388 validated
umi TCCCTAGCTT = 305 reads: +388 validated
umi TCGTGACTCT = 253 reads: +388 validated
umi TTCAGGACAG = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=607]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
397-447 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
447-607 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 9 umis using 232 reads
cdr3 = CARCKAAQYAFDIW at 374, score = 9 + 8
umis assigned: [33, 61, 109, 169, 216, 256, 286, 303, 324, 350]
of which 10 are surviving nonsolos
reads assigned: 2624
start codons at 35, 79, 159, 229, 382, 428, 501
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 682 reads
cdr3 = CQQYNSYWWTF at 354, score = 8 + 8
umis assigned: [0, 60, 73, 107, 118, 128, 139, 140, 146, 172] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4372
start codons at 27, 33, 89, 102, 238, 334, 457
confident = true

REJECT CONTIGS

TIG 1[bases=553]
5-77 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
29-382 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=8)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [42, 69, 91, 136, 220, 252, 281, 292]
of which 8 are surviving nonsolos
reads assigned: 2991
start codons at 29, 35, 91, 339, 372, 459
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTCTATTACTGTGCGAGATGTAAAGCAGCCCAATACGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.94 = TCTCTAACATCGGTTA-1

using 1425 reads

====================================================================================

graph has 1901 edges initially, 10 edges after simplification

total ucounts = 590
nonsolo ucounts = 273[2^96, 3^68, 4^36, 5^22, 6^12, 7^10, 8^8, 9^6, 10^3, 11^3, 12^4, 14, 16^2, 18, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.95 = TCTCTAACATCTACGA-1

using 43 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^3, 3^2, 4, 5, 6, 14]
surviving nonsolo ucounts = 1[4]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.100 = TCTCTAACATGCCTTC-1

using 6677 reads

====================================================================================

graph has 3867 edges initially, 28 edges after simplification

total ucounts = 804
nonsolo ucounts = 345[2^117, 3^94, 4^47, 5^29, 6^20, 7^7, 8^6, 9, 10^2, 11, 12, 16, 39, 61, 103, 105, 112, 133, 195, 224, 240, 245, 246, 257, 277, 292, 313, 314, 352, 360, 1216]
surviving nonsolo ucounts = 19[39, 61, 103, 105, 112, 133, 195, 224, 240, 245, 246, 257, 277, 292, 313, 314, 352, 360, 1216]
ids = [199, 166, 746, 77, 235, 555, 101, 484, 648, 693, ...]

====================================================================================

UMI info for barcode TCTCTAACATGCCTTC-1 contig 1 = AGGAGTCAGA...
umi ACATCCGTAT = 292 reads: +388 validated
umi AGGCTAAGCC = 833 reads: -351 +1 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +5 -1XX +1 invalidated
umi ATGTCGCGCT = 39 reads: +261 -1 +126 non-validated
umi CCCACTTTGG = 245 reads: +388 validated
umi CTCCACTCCC = 274 reads: +388 validated
umi GGAATGGGTT = 253 reads: +388 validated
umi GTCTTTTCCT = 222 reads: +388 validated
umi TAGCGCTACC = 135 reads: +388 validated
umi TCATCGGCAA = 313 reads: +388 validated
umi TCTTCGCTGG = 243 reads: +388 validated
umi TGTCTACCCC = 247 reads: +388 validated
umi TTGCCTGTTA = 360 reads: +388 validated
umi TTGTATTACG = 318 reads: +388 validated

UMI info for barcode TCTCTAACATGCCTTC-1 contig 2 = GCACTAGAAG...
umi ACTCCACCTC = 193 reads: +430 validated
umi ATACGTTCGA = 14 reads: -392 +1 -4X +3 -1X +2 -8X +1 -2X +1 -3X +1 -5X +1 -2X +3 invalidated
umi GACTCTTTCC = 357 reads: -132X +298 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 434 reads
cdr3 = CQQYSSYPRTF at 354, score = 8 + 8
umis assigned: [68, 146, 199, 262, 309, 432, 484, 555, 590, 648] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3724
start codons at 27, 33, 89, 102, 238, 334, 457
confident = true

TIG 2[bases=671]
0-59 ==> 21-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
59-273 ==> 0-214 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=1)
276-413 ==> 214-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=7)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
489-671 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 108 reads
cdr3 = CAKGQDSSGYDRDPFDYW at 404, score = 9 + 6
umis assigned: [101, 166, 364]
of which 3 are surviving nonsolos
reads assigned: 546
start codons at 59, 210, 215, 273, 276, 279, 365
confident = true
see insertion of ATG at pos 214 on |124|IGHV3-30|L-REGION+V-REGION|
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAAGGGCCAGGATAGTAGTGGCTACGATCGCGACCCCTTTGACTACTGGGGCCAGGGAATCCTGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAGTAGTTATCCCAGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.108 = TCTCTAAGTAAGCACG-1

using 114 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[110]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.110 = TCTCTAAGTACCGTTA-1

using 944 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2, 9, 15, 293, 615]
surviving nonsolo ucounts = 3[15, 293, 615]
ids = [2, 11, 8]

====================================================================================

UMI info for barcode TCTCTAAGTACCGTTA-1 contig 1 = AGAGCTCTGG...
umi CAGCGTCTTG = 15 reads: +4 -1 +17 -2 +61 -21 +279 non-validated
umi GCTAAGCTTT = 614 reads: +385 validated

UMI info for barcode TCTCTAAGTACCGTTA-1 contig 2 = TGGGGCTTTC...
umi TCTGAGCCGT = 291 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 91 reads
cdr3 = CQQYNNWPLYTF at 365, score = 9 + 8
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 625
start codons at 44, 113, 249, 471
confident = true

TIG 2[bases=528]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=24)
429-457 ==> 24-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARGTDRSATVIIDYW at 378, score = 8 + 6
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 18, 39, 83, 169, 339, 369
confident = true
now this is a cell
paired!

GCGGACGCGGCTATGTATTATTGTGCGAGGGGGACTGACCGGTCCGCTACAGTAATTATTGACTACTGGAGTCAGGGCACCCTGGTCACCGTCTCCTCAC <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.113 = TCTCTAAGTAGAGTGC-1

using 361 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 354]
surviving nonsolo ucounts = 1[354]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.119 = TCTCTAAGTATCAGTC-1

using 582 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3^2, 162, 404]
surviving nonsolo ucounts = 2[162, 404]
ids = [2, 9]

====================================================================================

UMI info for barcode TCTCTAAGTATCAGTC-1 contig 1 = GGGGAGGAAT...
umi AGCATCTCTC = 162 reads: +388 validated
umi GCGTATCCCT = 402 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 2 umis using 96 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2, 9]
of which 2 are surviving nonsolos
reads assigned: 558
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.123 = TCTCTAAGTCCCTACT-1

using 395 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[390]
surviving nonsolo ucounts = 1[390]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=483]
0-36 ==> 61-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
36-85 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
81-327 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=3)
325-347 ==> 17-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
347-483 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 36, 187, 323, 389
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.129 = TCTCTAAGTCTTTCAT-1

using 21 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 16]
surviving nonsolo ucounts = 1[16]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.131 = TCTCTAAGTGACAAAT-1

using 89 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 85]
surviving nonsolo ucounts = 1[85]
ids = [1]

====================================================================================

UMI info for barcode TCTCTAAGTGACAAAT-1 contig 1 = AAGAACCTGC...
umi ATCTTAACTA = 81 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=439]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-398 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=8)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 10 reads
cdr3 = CQAWDSSTVVF at 367, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 52, 57, 113, 198, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.135 = TCTCTAAGTGGTACAG-1

using 71 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 66]
surviving nonsolo ucounts = 1[66]
ids = [2]

====================================================================================

UMI info for barcode TCTCTAAGTGGTACAG-1 contig 1 = ATCACATAAC...
umi TGCACACAAT = 67 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=495]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=21)
426-461 ==> 14-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
461-495 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDPGAGPW at 400, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 64
start codons at 58, 274, 355, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.139 = TCTCTAAGTGTAATGA-1

using 476 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[207, 265]
surviving nonsolo ucounts = 2[207, 265]
ids = [2, 4]

====================================================================================

UMI info for barcode TCTCTAAGTGTAATGA-1 contig 1 = AGCTTCAGCT...
umi CCATTTCTAG = 203 reads: +388 validated

UMI info for barcode TCTCTAAGTGTAATGA-1 contig 2 = GGGGAGGAAC...
umi CGTGCCTGCG = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-567 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=488]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
424-488 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWPPEVTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.149 = TCTCTAAGTTATTCTC-1

using 1096 reads

====================================================================================

graph has 360 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[5, 9, 12^2, 1053]
surviving nonsolo ucounts = 1[1053]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=382]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-78 ==> 0-31 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
74-136 ==> 291-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
133-171 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
171-382 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 104, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 1042
start codons at 47, 87, 112, 117
confident = false
not full
full length transcript of length 382
VJ delta = 286
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.165 = TCTCTAATCAGTACGT-1

using 390 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 3, 377]
surviving nonsolo ucounts = 1[377]
ids = [6]

====================================================================================

UMI info for barcode TCTCTAATCAGTACGT-1 contig 1 = GGAGGAACTG...
umi GCGATGGCTA = 375 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQQRSNWPPVTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.180 = TCTCTAATCCCGACTT-1

using 82 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 12, 63]
surviving nonsolo ucounts = 1[63]
ids = [4]

====================================================================================

UMI info for barcode TCTCTAATCCCGACTT-1 contig 1 = GCTCTGCTTC...
umi TCATAAATGG = 60 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=469]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-469 ==> 0-27 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.188 = TCTCTAATCCTCCTAG-1

using 340 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 333]
surviving nonsolo ucounts = 1[333]
ids = [0]

====================================================================================

UMI info for barcode TCTCTAATCCTCCTAG-1 contig 1 = GGGGAGGAAT...
umi CCTACAACCT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-503 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.200 = TCTCTAATCGGACAAG-1

using 59 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^3, 3^3, 4^3, 5, 8, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.202 = TCTCTAATCGGTTAAC-1

using 368 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2, 3, 5^2, 344]
surviving nonsolo ucounts = 1[344]
ids = [11]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.212 = TCTCTAATCTGTACGA-1

using 1010 reads

====================================================================================

graph has 256 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[1010]
surviving nonsolo ucounts = 1[1010]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.213 = TCTCTAATCTGTCCGT-1

using 527 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 514]
surviving nonsolo ucounts = 1[514]
ids = [2]

====================================================================================

UMI info for barcode TCTCTAATCTGTCCGT-1 contig 1 = ACCCAAAAAC...
umi CGTGGCACGC = 526 reads: +229 -1XX +2 -3XX +210 invalidated

GOOD CONTIGS

TIG 1[bases=510]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
436-499 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARGPLLRFGELRDYYYYYGMDVW at 396, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.231 = TCTGAGAAGGAGTACC-1

using 297 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 56, 239]
surviving nonsolo ucounts = 2[56, 239]
ids = [2, 0]

====================================================================================

UMI info for barcode TCTGAGAAGGAGTACC-1 contig 1 = GGAATCAGTC...
umi AATATGCTGC = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-362 ==> 0-336 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-497 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYVTYPWTF at 353, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 26, 32, 101, 363, 456
confident = false

REJECT CONTIGS

TIG 1[bases=358]
0-61 ==> 5939-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
21-67 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
28-358 ==> 0-330 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 48
start codons at 28, 61, 97, 185, 248, 347
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.245 = TCTGAGACAAAGGAAG-1

using 433 reads

====================================================================================

graph has 122 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[88, 344]
surviving nonsolo ucounts = 2[88, 344]
ids = [0, 2]

====================================================================================

UMI info for barcode TCTGAGACAAAGGAAG-1 contig 1 = GAATCAGTCC...
umi CCGCTATGCT = 89 reads: +388 validated

UMI info for barcode TCTGAGACAAAGGAAG-1 contig 2 = ATCACATAAC...
umi TTGAGTTTAC = 302 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 87
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=521]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
418-464 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
464-521 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDDSSSGYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 58, 209, 256, 355, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.255 = TCTGAGACAATGGACG-1

using 151 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 4, 140]
surviving nonsolo ucounts = 1[140]
ids = [6]

====================================================================================

UMI info for barcode TCTGAGACAATGGACG-1 contig 1 = GAGAAGAGCT...
umi TTTCGTTTGG = 127 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
417-512 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYGSSRTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 35, 243, 369, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.256 = TCTGAGACAATTGCTG-1

using 1247 reads

====================================================================================

graph has 447 edges initially, 14 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 275, 407, 558]
surviving nonsolo ucounts = 3[275, 407, 558]
ids = [4, 3, 5]

====================================================================================

UMI info for barcode TCTGAGACAATTGCTG-1 contig 1 = TGAGCGCAGA...
umi GCGCTGTGCT = 530 reads: +388 validated

UMI info for barcode TCTGAGACAATTGCTG-1 contig 2 = GAGGAGTCAG...
umi GACTCCGATC = 248 reads: +385 validated

UMI info for barcode TCTGAGACAATTGCTG-1 contig 3 = GGGGTCACAA...
umi CTCTACTCCT = 392 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=564]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-564 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 523
start codons at 36, 241, 365
confident = false

TIG 2[bases=480]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-480 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 28, 34, 90, 103, 239, 455
confident = false

TIG 3[bases=563]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=26)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
423-563 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 57 reads
cdr3 = CFSYGNTGRVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 38, 249, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.257 = TCTGAGACACACATGT-1

using 271 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 263]
surviving nonsolo ucounts = 1[263]
ids = [2]

====================================================================================

UMI info for barcode TCTGAGACACACATGT-1 contig 1 = GCAGCTCTGG...
umi CTTAAGTTCT = 238 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=505]
0-81 ==> 140-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
81-431 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=2)
443-493 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 19 reads
cdr3 = CARESDYEFAFDIW at 420, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 81, 237, 381, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.260 = TCTGAGACACCCTATC-1

using 295 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 293]
surviving nonsolo ucounts = 1[293]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=446]
0-349 ==> 2-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
348-386 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
386-446 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 325, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 4, 73, 209, 428
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.264 = TCTGAGACAGACGCAA-1

using 10254 reads

====================================================================================

graph has 4188 edges initially, 84 edges after simplification

total ucounts = 481
nonsolo ucounts = 212[2^67, 3^32, 4^25, 5^17, 6^12, 7^7, 8^3, 9^8, 11^2, 13, 14, 43, 52, 58, 67, 82, 105, 121, 133, 135, 145, 149, 153, 167, 178, 214, 218, 230, 238, 240, 243, 248, 249, 251, 267, 273, 278, 284, 301, 307^2, 349, 427, 486, 547, 559, 597, 603]
surviving nonsolo ucounts = 34[52, 58, 82, 105, 121, 133, 135, 145, 149, 153, 167, 214, 218, 230, 238, 240, 243, 248, 249, 251, 267, 273, 278, 284, 301, 307^2, 349, 427, 486, 547, 559, 597, 603]
ids = [450, 250, 104, 114, 229, 158, 122, 452, 475, 395, ...]

====================================================================================

UMI info for barcode TCTGAGACAGACGCAA-1 contig 1 = GGGGGCTGGG...
umi AATATAACCG = 216 reads: +388 validated
umi CAATCAGTCC = 282 reads: +388 validated
umi CATGTTTAGA = 310 reads: +388 validated
umi CCATGTGCAA = 271 reads: +388 validated
umi CCCTAGCCAA = 250 reads: +388 validated
umi CCTGTGTACC = 248 reads: +388 validated
umi CGACCGCATT = 271 reads: +388 validated
umi CGTCTCATGT = 115 reads: +388 validated
umi GAAGCAATGG = 304 reads: +388 validated
umi TACCACCCTC = 243 reads: +388 validated
umi TCAATAGCCT = 238 reads: +388 validated
umi TCAGAACGTC = 154 reads: +388 validated
umi TTACACCCTT = 49 reads: -11 +279 -4 +94 non-validated

UMI info for barcode TCTGAGACAGACGCAA-1 contig 2 = GGAGCCCCAG...
umi ATGGTCACTC = 82 reads: +395 -16 +7 -1 +14 non-validated
umi CAAATGGGAC = 102 reads: +433 validated
umi CACATAGCTC = 134 reads: +433 validated
umi CACGCCCTCT = 165 reads: +433 validated
umi CCTACGGATT = 229 reads: +433 validated
umi CTATTGACCT = 56 reads: +304 -1 +128 non-validated
umi GCGTTCGGAT = 238 reads: +433 validated
umi TAACCCTCCT = 249 reads: +433 validated
umi TTACCCGTTA = 144 reads: +433 validated
umi TTTCGAATGC = 144 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=644]
45-391 ==> 0-346 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 451 reads
cdr3 = CSSYTTSTTWVF at 369, score = 8 + 8
umis assigned: [23, 120, 151, 165, 180, 207, 212, 229, 281, 369] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2906
start codons at 45, 196, 202, 253, 256
confident = true

TIG 2[bases=598]
0-68 ==> 168-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
68-421 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=18)
455-501 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
501-598 ==> 0-97 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 8 umis using 116 reads
cdr3 = CARVFRPGYSLGDQAAIDYW at 410, score = 9 + 7
umis assigned: [104, 114, 122, 129, 194, 250, 316, 358, 452, 475]
of which 10 are surviving nonsolos
reads assigned: 1513
start codons at 68, 224, 285, 371, 555
confident = true

REJECT CONTIGS

TIG 1[bases=634]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=19)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [158, 442]
of which 2 are surviving nonsolos
reads assigned: 408
start codons at 36, 365
confident = false
did not find CDR3

TIG 2[bases=417]
4-84 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
34-88 ==> 0-54 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=1)
88-281 ==> 68-261 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=5) [SHIFT!]
281-417 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [66, 86, 291, 370, 441]
of which 5 are surviving nonsolos
reads assigned: 2399
start codons at 34, 67, 89, 177, 180, 323
confident = false
did not find CDR3
now this is a cell
paired!

GTCTATTACTGTGCAAGAGTCTTTCGTCCTGGATACAGCTTGGGGGATCAAGCAGCGATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAACCAGCACCACTTGGGTGTTCGGCGGAGGGACCAAGGTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.267 = TCTGAGACAGCTGCTG-1

using 240 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [1]

====================================================================================

UMI info for barcode TCTGAGACAGCTGCTG-1 contig 1 = GCTCTGCTTC...
umi ATCCAATTCG = 231 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=557]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-557 ==> 0-112 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.268 = TCTGAGACAGTCAGCC-1

using 722 reads

====================================================================================

graph has 962 edges initially, 14 edges after simplification

total ucounts = 322
nonsolo ucounts = 109[2^43, 3^27, 4^13, 5^7, 6^6, 7, 9^4, 10, 11^5, 13, 98]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.271 = TCTGAGACATACAGCT-1

using 923 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 913]
surviving nonsolo ucounts = 1[913]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.277 = TCTGAGAGTAACGACG-1

using 9610 reads

====================================================================================

graph has 4028 edges initially, 58 edges after simplification

total ucounts = 519
nonsolo ucounts = 242[2^70, 3^50, 4^30, 5^23, 6^13, 7^8, 8^4, 9^2, 10^2, 11^2, 12, 13, 16, 36, 46, 94, 101, 110, 127, 128, 129, 152, 160, 179, 200, 213, 215, 218, 221, 237^2, 239, 241, 246, 254, 258, 269, 271^2, 272, 278, 285, 324, 330, 351, 355, 721, 773]
surviving nonsolo ucounts = 32[46, 94, 101, 128, 129, 152, 160, 179, 200, 213, 215, 218, 221, 237^2, 239, 241, 246, 254, 258, 269, 271^2, 272, 278, 285, 324, 330, 351, 355, 721, 773]
ids = [41, 451, 383, 475, 370, 515, 20, 502, 93, 458, ...]

====================================================================================

UMI info for barcode TCTGAGAGTAACGACG-1 contig 1 = AGGAATCAGA...
umi AACATGCTAC = 215 reads: +388 validated
umi AAGCACATGC = 329 reads: +388 validated
umi ACTAGATGGA = 654 reads: -354X +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi AGTGCGAGAA = 224 reads: +388 validated
umi CAAATATATC = 284 reads: +388 validated
umi CCAATTCCCG = 320 reads: +388 validated
umi GAATGTGCGT = 267 reads: +388 validated
umi GATATTACAT = 238 reads: +388 validated
umi GCCACGGGTC = 249 reads: +388 validated
umi GCTTGTAATC = 239 reads: +388 validated
umi GGTTGGGCGC = 236 reads: +388 validated
umi GGTTTGGTGC = 272 reads: +388 validated
umi GTAACCTCAC = 269 reads: +388 validated
umi TAAGGGCTCA = 526 reads: -354X +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi TCCGTGTACG = 350 reads: +388 validated
umi TGAAGGGGTT = 252 reads: +388 validated
umi TGCCCGCATG = 216 reads: +388 validated
umi TTATCTGAGC = 219 reads: +388 validated
umi TTTGTTTTAT = 152 reads: +388 validated

UMI info for barcode TCTGAGAGTAACGACG-1 contig 2 = AGCTCTGAGA...
umi AACCCCAGTC = 109 reads: +424 validated
umi AATGCAATCA = 46 reads: +378 -46 non-validated
umi AGCCGACGCC = 187 reads: +424 validated
umi AGCTGGCCGA = 215 reads: +424 validated
umi CAAGGGCAGA = 276 reads: +424 validated
umi GGCTTACTGA = 266 reads: -382X +1 -3X +38 invalidated
umi GTCCGAACAA = 359 reads: +424 validated
umi GTGGTACCTA = 123 reads: +424 validated
umi GTTTCTGCTC = 101 reads: +424 validated
umi TGATATGTTA = 91 reads: -370 +1 -1X +2 -1X +1 -2XX +1 -3XX +1 -1XX +40 invalidated
umi TGTGCCAGGA = 115 reads: +424 validated
umi TTTAAGTTTT = 157 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 710 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [16, 31, 74, 106, 153, 190, 284, 298, 311, 328] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5435
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=605]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
503-605 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 146 reads
cdr3 = CARATYYYSSSWSFDYW at 421, score = 9 + 7
umis assigned: [20, 41, 93, 96, 157, 335, 365, 370, 383, 451] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2005
start codons at 79, 235, 382, 521, 582
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGCCACTTACTACTATAGCAGCAGCTGGTCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCCCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.283 = TCTGAGAGTAGAAGGA-1

using 525 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 155, 367]
surviving nonsolo ucounts = 2[155, 367]
ids = [1, 3]

====================================================================================

UMI info for barcode TCTGAGAGTAGAAGGA-1 contig 1 = GAGCTGCTCA...
umi CCGCCTGAGC = 157 reads: +385 validated
umi TGCTCCACAC = 373 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CQQYGSSPFNF at 354, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 518
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.293 = TCTGAGAGTGACTACT-1

using 552 reads

====================================================================================

graph has 223 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 11, 249, 283]
surviving nonsolo ucounts = 2[249, 283]
ids = [0, 7]

====================================================================================

UMI info for barcode TCTGAGAGTGACTACT-1 contig 1 = GCTCTGCTTC...
umi AATGCAGACC = 238 reads: +394 validated

UMI info for barcode TCTGAGAGTGACTACT-1 contig 2 = GAAGAGCTGC...
umi GTATTGAACC = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-548 ==> 0-103 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=489]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-489 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYTNSRTF at 357, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.298 = TCTGAGAGTTAAAGAC-1

using 321 reads

====================================================================================

graph has 123 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 308]
surviving nonsolo ucounts = 1[308]
ids = [5]

====================================================================================

UMI info for barcode TCTGAGAGTTAAAGAC-1 contig 1 = GTCAGTCTCA...
umi TTAGTGTCTC = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.304 = TCTGAGAGTTCCCTTG-1

using 195 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [1]

====================================================================================

UMI info for barcode TCTGAGAGTTCCCTTG-1 contig 1 = ACCCAAAAAC...
umi CGGTAATATC = 187 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=470]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 20 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.308 = TCTGAGAGTTCGGGCT-1

using 12208 reads

====================================================================================

graph has 4420 edges initially, 86 edges after simplification

total ucounts = 476
nonsolo ucounts = 195[2^71, 3^37, 4^16, 5^5, 6^10, 7^4, 9^4, 10^3, 11, 13^2, 20, 26, 50, 54, 74^2, 88, 103, 120, 122, 142, 146, 157, 166, 184^2, 191, 197, 205, 206, 208, 213, 216, 222, 233, 238, 252, 254, 278, 282, 287, 296^2, 324, 328, 346, 479, 725, 812, 838, 860, 898]
surviving nonsolo ucounts = 30[146, 157, 184^2, 191, 197, 205, 206, 208, 213, 216, 222, 233, 238, 252, 254, 278, 282, 287, 296^2, 324, 328, 346, 479, 725, 812, 838, 860, 898]
ids = [326, 405, 232, 370, 347, 388, 213, 407, 413, 244, ...]

====================================================================================

UMI info for barcode TCTGAGAGTTCGGGCT-1 contig 1 = AGCTCTGAGA...
umi ACTTCGGGCT = 259 reads: +409 validated
umi AGATTCCCCA = 214 reads: +409 validated
umi ATTCTTCAAG = 240 reads: +409 validated
umi CCTGTTCCTC = 301 reads: +409 validated
umi CTGTGGCTGC = 187 reads: +409 validated
umi CTTGTCGCAC = 215 reads: +356 -1 +21 -1 +7 -1 +22 non-validated
umi GGTACACCCT = 592 reads: +409 validated
umi GTCCGTGTTG = 298 reads: +409 validated
umi GTTAGCATCC = 118 reads: +409 validated
umi TACACCAATG = 189 reads: +361 -1 +47 non-validated
umi TACTGTTACC = 288 reads: +409 validated
umi TATAATTTCT = 182 reads: +409 validated
umi TCGGCCTCTC = 260 reads: +409 validated
umi TGAATTTCGG = 208 reads: +409 validated
umi TTTATCTCCG = 197 reads: +409 validated

UMI info for barcode TCTGAGAGTTCGGGCT-1 contig 2 = AGGAGTCAGA...
umi ACCCGGCTGG = 257 reads: +391 validated
umi CAGTAGTCCT = 2 reads: -391 non-validated
umi CGCCCTTCCT = 328 reads: +391 validated
umi CTAGGTTTGC = 204 reads: +391 validated
umi CTTACTAGTT = 280 reads: +391 validated
umi GGTGCCCTTG = 322 reads: +391 validated
umi TCATATTTCC = 199 reads: +391 validated
umi TCTAGGACAA = 156 reads: +391 validated
umi TCTGACCTCG = 210 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=8)
452-488 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 306 reads
cdr3 = CAKEYSGYDSNW at 421, score = 8 + 7
umis assigned: [59, 64, 109, 177, 232, 244, 306, 320, 326, 347] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3664
start codons at 79, 230, 235
confident = true

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 299 reads
cdr3 = CQQYNSYSQKTF at 354, score = 8 + 8
umis assigned: [45, 135, 187, 213, 236, 311, 388, 405, 407]
of which 9 are surviving nonsolos
reads assigned: 1923
start codons at 27, 33, 89, 102, 334, 460
confident = true
now this is a cell
paired!

AGCCTGAGAGCCGAGGACACGGCCTTTTATTACTGTGCGAAAGAATATAGTGGCTACGACTCCAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCAGAAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.310 = TCTGAGAGTTGTCTTT-1

using 4880 reads

====================================================================================

graph has 1900 edges initially, 44 edges after simplification

total ucounts = 331
nonsolo ucounts = 117[2^41, 3^27, 4^8, 5^11, 6^4, 7^3, 8^2, 9^2, 10^2, 83, 151, 188, 189, 212, 213, 223, 225, 230, 231, 239, 252, 258, 316, 420, 424, 462]
surviving nonsolo ucounts = 16[151, 188, 189, 212, 213, 223, 225, 230, 231, 239, 252, 258, 316, 420, 424, 462]
ids = [161, 242, 78, 225, 73, 246, 285, 96, 88, 125, ...]

====================================================================================

UMI info for barcode TCTGAGAGTTGTCTTT-1 contig 1 = AAATTCAGGT...
umi CTCATCTACA = 148 reads: +454 validated
umi TACTGCGCTT = 181 reads: +454 validated

UMI info for barcode TCTGAGAGTTGTCTTT-1 contig 2 = AGCTTCAGCT...
umi AGATACACTT = 419 reads: +391 validated
umi ATGTTAGAGT = 213 reads: +391 validated
umi ATTGCTCAAT = 188 reads: +391 validated
umi CACTCAATCG = 232 reads: +391 validated
umi CAGGGCCCTT = 227 reads: +391 validated
umi CCCTAAGCTC = 242 reads: +391 validated
umi GGCTTCGTCG = 475 reads: +258 -1XX +1 -4XX +1 -3XX +2 -2XX +2 -5XX +1 -111 invalidated
umi TGCAGTATAA = 227 reads: +391 validated
umi TGTCGTAATA = 253 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=534]
0-64 ==> 81-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
64-414 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=12)
457-518 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=6)
junction support: 2 umis using 32 reads
cdr3 = CARVRSREGDSGTWRAPPKKYYYYMDVW at 403, score = 9 + 7
umis assigned: [161, 242]
of which 2 are surviving nonsolos
reads assigned: 329
start codons at 20, 64, 108, 281, 475
confident = true

TIG 2[bases=649]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
438-649 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 338 reads
cdr3 = CAAWDDSLSGSYVF at 368, score = 7 + 8
umis assigned: [40, 73, 78, 88, 96, 125, 209, 285, 302]
of which 9 are surviving nonsolos
reads assigned: 2432
start codons at 47, 351, 376, 381, 402, 570
confident = true

REJECT CONTIGS

TIG 1[bases=587]
0-47 ==> 128-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
47-191 ==> 0-144 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
191-409 ==> 145-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20) [SHIFT!]
412-451 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
451-587 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [30, 42, 225]
of which 3 are surviving nonsolos
reads assigned: 299
start codons at 47, 116, 368, 493
confident = false
did not find CDR3
now this is a cell
paired!

TCTCGTGAGGGTGATTCGGGGACTTGGCGCGCGCCTCCCAAAAAGTACTACTACTACATGGACGTCTGGGGCAAAGGGAGCTCGGTCACCGTCTCCTCAG <==> CTCCACTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTAAGTGGTTCTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTGG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.311 = TCTGAGAGTTGTTTGG-1

using 113 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 26
nonsolo ucounts = 19[2^7, 4^2, 5^3, 6^3, 9^2, 12, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.312 = TCTGAGAGTTTGCATG-1

using 349 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 342]
surviving nonsolo ucounts = 1[342]
ids = [2]

====================================================================================

UMI info for barcode TCTGAGAGTTTGCATG-1 contig 1 = GTCAGTCCCA...
umi CTGAAGGTCA = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
411-488 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDNLPPAF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.316 = TCTGAGATCAGCCTAA-1

using 163 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[161]
surviving nonsolo ucounts = 1[161]
ids = [1]

====================================================================================

UMI info for barcode TCTGAGATCAGCCTAA-1 contig 1 = AGAGCTGCTC...
umi TAGCGTTCAT = 147 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=486]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-486 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSLIF at 355, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 31, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.321 = TCTGAGATCCAAACTG-1

using 1447 reads

====================================================================================

graph has 344 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 329, 1108]
surviving nonsolo ucounts = 2[329, 1108]
ids = [0, 1]

====================================================================================

UMI info for barcode TCTGAGATCCAAACTG-1 contig 1 = GAAGAGCTGC...
umi ACACCTATTT = 332 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=16)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQLYDNSPPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 33, 82, 241, 367, 463
confident = false

REJECT CONTIGS

TIG 1[bases=301]
12-45 ==> 304-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=2)
52-90 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
90-301 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 1098
start codons at 
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.325 = TCTGAGATCCGTTGCT-1

using 110 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 17[2^3, 3^2, 4, 5^2, 6^2, 7^2, 8, 10, 12^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.330 = TCTGAGATCCTGCTTG-1

using 75 reads

====================================================================================

graph has 101 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 16[2^6, 4^2, 5^2, 6^3, 7, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.335 = TCTGAGATCGGGAGTA-1

using 536 reads

====================================================================================

graph has 156 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 256, 273]
surviving nonsolo ucounts = 2[256, 273]
ids = [0, 2]

====================================================================================

UMI info for barcode TCTGAGATCGGGAGTA-1 contig 1 = GGGGAGGAAC...
umi ACACGCCGCG = 262 reads: +388 validated

UMI info for barcode TCTGAGATCGGGAGTA-1 contig 2 = GGGACTGATC...
umi CCAATACGTC = 271 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSDWPPGVTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 36, 241, 244, 466
confident = false

TIG 2[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-380 ==> 0-344 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=12)
399-436 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQTLQIRELTF at 372, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 36, 69, 193, 217, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.336 = TCTGAGATCGTATCAG-1

using 737 reads

====================================================================================

graph has 850 edges initially, 14 edges after simplification

total ucounts = 348
nonsolo ucounts = 144[2^61, 3^33, 4^13, 5^13, 6^8, 7^6, 8, 9^4, 10^3, 12, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.337 = TCTGAGATCGTGACAT-1

using 222 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [2]

====================================================================================

UMI info for barcode TCTGAGATCGTGACAT-1 contig 1 = GCTACAACAG...
umi CTGTATCGCA = 209 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=459]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
431-459 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYYSTPPYTF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 28, 97, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.339 = TCTGAGATCGTTGCCT-1

using 14 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.342 = TCTGAGATCTCCAGGG-1

using 144 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[144]
surviving nonsolo ucounts = 1[144]
ids = [0]

====================================================================================

UMI info for barcode TCTGAGATCTCCAGGG-1 contig 1 = GAGAGAGGAG...
umi GGACTACACT = 146 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=534]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-534 ==> 0-37 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.343 = TCTGAGATCTCGTATT-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.355 = TCTGGAAAGAGATGAG-1

using 70 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 67]
surviving nonsolo ucounts = 1[67]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAAAGAGATGAG-1 contig 1 = ACTCAGGACA...
umi CAAAGTTAGT = 63 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
14-365 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
364-402 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
402-459 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CLQYSSSPWTF at 341, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 14, 20, 89, 225, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.367 = TCTGGAAAGCTGCGAA-1

using 326 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode TCTGGAAAGCTGCGAA-1 contig 1 = GGAGTCAGTC...
umi CCGTTAACAG = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-495 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPWTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.373 = TCTGGAAAGGCCCTCA-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.377 = TCTGGAAAGGGTCGAT-1

using 198 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

UMI info for barcode TCTGGAAAGGGTCGAT-1 contig 1 = AGGAGTCAGA...
umi CAATAACTCG = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYSLTF at 354, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.388 = TCTGGAACAAAGTCAA-1

using 401 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 8^2, 11, 366]
surviving nonsolo ucounts = 1[366]
ids = [6]

====================================================================================

UMI info for barcode TCTGGAACAAAGTCAA-1 contig 1 = GAGAAGAGCT...
umi GTCTAAGTGG = 298 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=501]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-501 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSPYTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.389 = TCTGGAACAACAACCT-1

using 307 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 295]
surviving nonsolo ucounts = 1[295]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAACAACAACCT-1 contig 1 = GGAGTCAGTC...
umi CAGCCTGTTC = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.391 = TCTGGAACAACGATCT-1

using 615 reads

====================================================================================

graph has 214 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[224, 387]
surviving nonsolo ucounts = 2[224, 387]
ids = [5, 2]

====================================================================================

UMI info for barcode TCTGGAACAACGATCT-1 contig 1 = GGGAATCAGT...
umi GTGTTTAAGG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 27, 33, 102, 238, 457
confident = false

REJECT CONTIGS

TIG 1[bases=558]
0-33 ==> 64-97 on |291|IGKV3D-20|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
33-381 ==> 0-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=6)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 383
start codons at 33, 241, 244, 367, 464
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.398 = TCTGGAACAAGTCTAC-1

using 223 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2^3, 3^3, 6, 17, 179]
surviving nonsolo ucounts = 1[179]
ids = [6]

====================================================================================

UMI info for barcode TCTGGAACAAGTCTAC-1 contig 1 = ACCCAAAAAC...
umi CATCGTCAAA = 169 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=571]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-571 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.400 = TCTGGAACAAGTTCTG-1

using 291 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3^2, 5, 273]
surviving nonsolo ucounts = 1[273]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAACAAGTTCTG-1 contig 1 = GATCAGGACT...
umi AGTCACGTGC = 267 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.401 = TCTGGAACAAGTTGTC-1

using 246 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 239]
surviving nonsolo ucounts = 1[239]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAACAAGTTGTC-1 contig 1 = GGGGGTCTCA...
umi CGCTCATCCT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
39-389 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-579 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CSSYTSSSTVWF at 363, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.402 = TCTGGAACAATCAGAA-1

using 39 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 8, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.407 = TCTGGAACACATCTTT-1

using 10 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.410 = TCTGGAACACCGATAT-1

using 33 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 7, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.423 = TCTGGAACAGCCTGTG-1

using 9855 reads

====================================================================================

graph has 5256 edges initially, 108 edges after simplification

total ucounts = 890
nonsolo ucounts = 524[2^106, 3^94, 4^81, 5^53, 6^33, 7^28, 8^31, 9^14, 10^16, 11^11, 12^2, 13^9, 14^4, 15, 16^4, 17, 20, 23, 28, 44, 96, 110, 119, 121, 138, 140, 145, 155, 156, 161, 162, 163, 167, 176, 199, 206, 215, 222^2, 233, 245, 262, 275, 289, 303^2, 305, 317, 327, 332, 338, 347]
surviving nonsolo ucounts = 33[28, 44, 96, 110, 119, 121, 138, 140, 155, 156, 161, 162, 163, 167, 176, 199, 206, 215, 222^2, 233, 245, 262, 275, 289, 303^2, 305, 317, 327, 332, 338, 347]
ids = [425, 318, 759, 237, 102, 385, 656, 660, 853, 519, ...]

====================================================================================

UMI info for barcode TCTGGAACAGCCTGTG-1 contig 1 = GGAGTGTGCT...
umi ACAAATGCGA = 212 reads: +466 validated
umi ACTTCTCATC = 167 reads: +466 validated
umi AGCTCCTGGT = 186 reads: +466 validated
umi AGGATATTGC = 125 reads: +466 validated
umi ATTCAGCCCG = 174 reads: +466 validated
umi CAATCGCTAA = 96 reads: +466 validated
umi CCGAGCACTA = 45 reads: -28 +438 non-validated
umi CCGCTCTGGT = 217 reads: +466 validated
umi CCTGCAAGGA = 268 reads: +466 validated
umi CTGAGTTATG = 24 reads: -466 non-validated
umi CTTATTAGTC = 134 reads: +466 validated
umi CTTGTTCGCA = 176 reads: +466 validated
umi GCCAAGCCTT = 198 reads: -419X +2 -2XX +2 -1XX +3 -2XX +35 invalidated
umi GCCCCGCACC = 150 reads: -455 +2 -1 +8 non-validated
umi TAGGTTTAGA = 135 reads: +466 validated
umi TATTCGTGCC = 160 reads: +418 -20 +28 non-validated
umi TGATGTTGGG = 5 reads: -398X +1 -20X +2 -2XX +2 -1XX +3 -2XX +35 invalidated
umi TTACGCATCA = 180 reads: +466 validated
umi TTGAAAGCAT = 131 reads: +466 validated
umi TTGCGTGTTA = 166 reads: +466 validated

UMI info for barcode TCTGGAACAGCCTGTG-1 contig 2 = GGAGTCAGAC...
umi ACGTGTGCTT = 331 reads: +388 validated
umi CATGACACCG = 238 reads: +388 validated
umi CGAATTTCAT = 341 reads: +388 validated
umi GAACACTCAG = 269 reads: +388 validated
umi GCATAAGGGA = 353 reads: +388 validated
umi GCGCTGGCAT = 306 reads: +388 validated
umi TAGTTGGTGG = 142 reads: +388 validated
umi TATAGTGATA = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
395-422 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=2)
439-487 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
487-589 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 15 umis using 214 reads
cdr3 = CARGLYYYGSGSYYNRRPRGPFDYW at 381, score = 9 + 7
umis assigned: [53, 118, 140, 145, 215, 237, 318, 323, 342, 425] and 10 others
of which 20 are surviving nonsolos
reads assigned: 2918
start codons at 21, 42, 86, 172, 403, 505, 566
confident = true

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 327 reads
cdr3 = CQQYNSYPETF at 353, score = 8 + 8
umis assigned: [95, 280, 359, 461, 503, 532, 660, 664]
of which 8 are surviving nonsolos
reads assigned: 2236
start codons at 26, 32, 88, 101, 333, 456
confident = true
now this is a cell
paired!

AGAGGTCTCTATTACTATGGTTCAGGGAGTTATTATAACCGCCGGCCCCGGGGGCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCGGAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.426 = TCTGGAACAGGCGATA-1

using 445 reads

====================================================================================

graph has 266 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^4, 6, 188, 235]
surviving nonsolo ucounts = 2[188, 235]
ids = [2, 13]

====================================================================================

UMI info for barcode TCTGGAACAGGCGATA-1 contig 1 = GGGAAATACT...
umi CCACAGCGTC = 178 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=509]
0-42 ==> 103-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
42-392 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=29)
435-481 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
481-509 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARVGSVPGAAPDTYDFFGMDVW at 381, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 42, 86, 253, 303, 438
confident = false

REJECT CONTIGS

TIG 1[bases=630]
4-40 ==> 5964-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
24-56 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
40-56 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
40-64 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
40-65 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
83-162 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
83-111 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
253-360 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
256-359 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
336-361 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSTWDYSHVVF at 358, score = 7 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 40, 191, 241, 366, 380
confident = false
not full
full length stopped transcript of length 630
frameshifted full length stopped transcript of length 630
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.427 = TCTGGAACAGGCTGAA-1

using 247 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^4, 3, 4, 5, 220]
surviving nonsolo ucounts = 1[220]
ids = [9]

====================================================================================

UMI info for barcode TCTGGAACAGGCTGAA-1 contig 1 = GGGGCGGGGG...
umi TATCCGTCGC = 220 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=642]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=3)
28-397 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=5)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-642 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CMLWHSSAWVF at 370, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 28, 170, 302, 314, 353, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.429 = TCTGGAACAGTACACT-1

using 296 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 4, 282]
surviving nonsolo ucounts = 1[282]
ids = [0]

====================================================================================

UMI info for barcode TCTGGAACAGTACACT-1 contig 1 = ACTTTCTGAG...
umi AATAGTTGGG = 261 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=537]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
35-238 ==> 0-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=10)
435-477 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
477-537 ==> 0-60 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARVQQIKRGAISTTFYYNALDVW at 374, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 35, 79, 429, 495
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.437 = TCTGGAACATTCTTAC-1

using 203 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.448 = TCTGGAAGTCGAGATG-1

using 235 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 223]
surviving nonsolo ucounts = 1[223]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=538]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-27 ==> 5973-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-27 ==> 5269-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-27 ==> 782-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-27 ==> 9983-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-27 ==> 786-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-403 ==> 0-26 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
402-538 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSFSWTF at 354, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 444
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.449 = TCTGGAAGTCTAAACC-1

using 3671 reads

====================================================================================

graph has 3662 edges initially, 93 edges after simplification

total ucounts = 713
nonsolo ucounts = 539[2^100, 3^69, 4^55, 5^56, 6^47, 7^26, 8^36, 9^33, 10^29, 11^25, 12^12, 13^11, 14^9, 15^9, 16^5, 17^4, 18^4, 19^4, 20^2, 22, 24, 46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.458 = TCTGGAAGTGGCCCTA-1

using 711 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 706]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.459 = TCTGGAAGTGTCAATC-1

using 353 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 153, 193]
surviving nonsolo ucounts = 2[153, 193]
ids = [3, 7]

====================================================================================

UMI info for barcode TCTGGAAGTGTCAATC-1 contig 1 = GAATCAGTCC...
umi ATCGCTTTAC = 1 reads: -388 non-validated
umi TTCGCTTTAG = 172 reads: +388 validated

UMI info for barcode TCTGGAAGTGTCAATC-1 contig 2 = GGACTCCTGT...
umi GCGCATCCTT = 122 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=492]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-492 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0, 7]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=510]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-510 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 18, 174, 241, 333, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.476 = TCTGGAATCAACGGCC-1

using 280 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================

UMI info for barcode TCTGGAATCAACGGCC-1 contig 1 = GAGAGAACTC...
umi ATCCTCGGTA = 227 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=511]
13-366 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=2)
374-405 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=3)
413-461 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
461-511 ==> 0-50 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAKVLRRITMIVVVIPKPSYYFDYW at 355, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 13, 164, 169, 316, 382, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.477 = TCTGGAATCAAGAAGT-1

using 43 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[43]
surviving nonsolo ucounts = 1[43]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.479 = TCTGGAATCACAGTAC-1

using 292 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2^2, 3^2, 4, 5, 6, 7^2, 249]
surviving nonsolo ucounts = 1[249]
ids = [9]

====================================================================================

UMI info for barcode TCTGGAATCACAGTAC-1 contig 1 = AGGTCTGGGA...
umi GTGGCGGCCG = 242 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=552]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=6)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=40)
462-525 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
525-552 ==> 0-27 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAKDEGYSGYRGGGYYSYYGMDIW at 422, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 80, 225, 231, 236, 315, 383, 432, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.480 = TCTGGAATCACATGCA-1

using 361 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 355]
surviving nonsolo ucounts = 1[355]
ids = [4]

====================================================================================

UMI info for barcode TCTGGAATCACATGCA-1 contig 1 = GAAGTCTCTC...
umi TATTTCGTCG = 356 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
26-342 ==> 0-316 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=17)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQKHDTAPWTF at 353, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 26, 32, 88, 101, 291, 336, 363, 376, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.481 = TCTGGAATCACCCTCA-1

using 428 reads

====================================================================================

graph has 176 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[10, 20, 396]
surviving nonsolo ucounts = 1[396]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=508]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
32-56 ==> 204-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
40-79 ==> 0-39 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
79-255 ==> 161-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0) [SHIFT!]
259-297 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
297-508 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CNSRDSSGNPVI at 233, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 390
start codons at 40, 117, 216
confident = false
not full
frameshifted full length stopped transcript of length 508
VJ delta = 134
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.484 = TCTGGAATCACTCCTG-1

using 255 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAATCACTCCTG-1 contig 1 = ATCATCCAAC...
umi CGACATCTCG = 238 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=524]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-524 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.485 = TCTGGAATCACTTCAT-1

using 380 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3, 8, 37, 325]
surviving nonsolo ucounts = 1[325]
ids = [6]

====================================================================================

UMI info for barcode TCTGGAATCACTTCAT-1 contig 1 = GGGAATCAGT...
umi GTCATGCACT = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-473 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.496 = TCTGGAATCCACGTGG-1

using 284 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.498 = TCTGGAATCCACTGGG-1

using 14165 reads

====================================================================================

graph has 4324 edges initially, 42 edges after simplification

total ucounts = 302
nonsolo ucounts = 155[2^40, 3^17, 4^11, 5^11, 6^3, 7^4, 8, 9, 10^2, 12, 14, 16^2, 17, 47, 50, 58, 79, 97, 101, 104, 108, 112, 120, 127, 136, 155^2, 156, 163, 170, 178, 199, 204, 207, 208, 211, 212, 214, 219, 227, 228, 230, 232^2, 238, 239^2, 250, 254, 258, 260, 268, 270, 272, 273^2, 278, 283, 291, 299, 311, 314, 317, 331^2, 336, 338, 346, 352, 358, 365, 366, 380]
surviving nonsolo ucounts = 58[50, 58, 79, 97, 101, 104, 108, 112, 120, 127, 136, 155^2, 156, 163, 170, 178, 199, 204, 207, 208, 211, 212, 214, 219, 227, 228, 230, 232^2, 238, 239, 250, 254, 258, 260, 268, 270, 272, 273^2, 278, 283, 291, 299, 311, 314, 317, 331^2, 336, 338, 346, 352, 358, 365, 366, 380]
ids = [32, 3, 278, 267, 265, 285, 21, 202, 55, 292, ...]

====================================================================================

UMI info for barcode TCTGGAATCCACTGGG-1 contig 1 = GGGGGCTGGG...
umi AAAGAGTTTA = 212 reads: +394 validated
umi AAGGGTTGTT = 228 reads: +394 validated
umi AGCTAGATCC = 163 reads: +394 validated
umi AGGGGCCCGT = 16 reads: -394 non-validated
umi ATTCGCCATA = 274 reads: +394 validated
umi CAAATCCATG = 271 reads: +394 validated
umi CATAATCAAC = 233 reads: +394 validated
umi CCATACCTCA = 206 reads: +394 validated
umi CCGCCGGTTC = 268 reads: +394 validated
umi CTCCTTTTGT = 199 reads: +394 validated
umi GATATTGCGA = 164 reads: +394 validated
umi TAAACCGCCA = 181 reads: +394 validated
umi TACATGGATA = 146 reads: +35 -1XX +1 -6XX +351 invalidated
umi TCAAACCGGG = 211 reads: +394 validated
umi TGAATTACGC = 264 reads: +189 -2XX +203 invalidated
umi TGACACATTT = 102 reads: +394 validated
umi TTCGCGTGCG = 127 reads: +394 validated

UMI info for barcode TCTGGAATCCACTGGG-1 contig 2 = GAAGAGCTGC...
umi AAATATTCTA = 59 reads: -11 +379 -1 non-validated
umi AAGAGTTACC = 329 reads: +391 validated
umi AAGAGTTGGC = 329 reads: +391 validated
umi AATAAGCTTC = 312 reads: +391 validated
umi ACTGCATACA = 298 reads: +391 validated
umi ATACAGTACT = 312 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -6XX +2 -2 +10 -1XX +7 invalidated
umi ATCTAGCGAC = 335 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -5XX +15 -1XX +7 invalidated
umi ATCTATCGGG = 284 reads: +391 validated
umi CAACCGCTTT = 363 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +3 -3X +15 -1XX +7 invalidated
umi CAGGAAGTGT = 335 reads: +391 validated
umi CGGTTCGGTT = 295 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -5X +15 -1XX +7 invalidated
umi CTGTGGGGGT = 258 reads: +391 validated
umi GGCTACATAC = 266 reads: +20 -1XX +325 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -6XX +2 -4X +8 -1XX +7 invalidated
umi GTTAAGCGTC = 158 reads: +391 validated
umi GTTTATTCGC = 361 reads: +391 validated
umi TATTTAGGGT = 346 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -5XX +15 -1XX +7 invalidated
umi TGCGGCCCCG = 377 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2X +1 -1 +2 -2XX +15 -1XX +7 invalidated
umi TTCGGTGAGT = 321 reads: +391 validated
umi TTTCTAGATC = 342 reads: +346 -3XX +1 -3XX +1 -1XX +3 -1XX +1 -2XX +1 -5XX +15 -1XX +7 invalidated

UMI info for barcode TCTGGAATCCACTGGG-1 contig 3 = AGTGCTTTCT...
umi AATCTTGCAT = 109 reads: +431 -25 +4 non-validated
umi ACTACACTAG = 43 reads: +456 -4 non-validated
umi ATCGTTCCAC = 123 reads: +445 -3 +11 -1 non-validated
umi CATACTTAGT = 241 reads: +460 validated
umi CCAACCATGC = 208 reads: +460 validated
umi CCGCATTTGG = 185 reads: +460 validated
umi CGATACAATC = 279 reads: +460 validated
umi CTCTATGAGG = 276 reads: +460 validated
umi GCGTCCCGTC = 140 reads: +431 -29 non-validated
umi GTACAATCGG = 113 reads: +460 validated
umi GTACCCCCGT = 237 reads: +460 validated
umi TAAATAGAGT = 152 reads: +460 validated
umi TACCCATTGT = 263 reads: +460 validated
umi TATGCTGCTA = 214 reads: +460 validated
umi TCCCATTCGA = 198 reads: +460 validated
umi TGATAAGTAG = 97 reads: +426 -1X +1 -1X +1 -1X +6 -2X +6 -1 +1 -1 +1 -1 +10 invalidated
umi TGCTTGCTAG = 261 reads: +460 validated
umi TGGCGGACTA = 66 reads: +354 -3X +76 -1 +17 -9 invalidated
umi TGTCTAAACT = 356 reads: +460 validated
umi TGTTTTACAA = 228 reads: +460 validated
umi TTAGCCCAGG = 105 reads: +425 -1 +11 -23 non-validated
umi TTGTTAGGAT = 166 reads: +460 validated
umi TTTCTCAGTT = 232 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=650]
45-406 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
401-439 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
439-650 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 513 reads
cdr3 = CSSYTSSSTLNWVF at 369, score = 8 + 8
umis assigned: [1, 13, 43, 45, 67, 73, 87, 99, 107, 134] and 7 others
of which 16 are surviving nonsolos
reads assigned: 3201
start codons at 45, 202, 246, 253, 256
confident = true

TIG 2[bases=560]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 413 reads
cdr3 = CQQYGSSPLTWTF at 357, score = 9 + 8
umis assigned: [3, 10, 11, 15, 35, 50, 56, 57, 76, 85] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5583
start codons at 33, 241, 367, 466
confident = true

TIG 3[bases=548]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
394-421 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=0)
429-477 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 16 umis using 281 reads
cdr3 = CARGCWYYYGSGSYYNRYYFDYW at 377, score = 9 + 7
umis assigned: [21, 32, 55, 88, 95, 106, 115, 136, 182, 202] and 13 others
of which 23 are surviving nonsolos
reads assigned: 4230
start codons at 17, 38, 82, 168, 402
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.504 = TCTGGAATCCGCGTTT-1

using 215 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 210]
surviving nonsolo ucounts = 1[210]
ids = [2]

====================================================================================

UMI info for barcode TCTGGAATCCGCGTTT-1 contig 1 = GGGCACAAGA...
umi CGTATCTAGT = 196 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=491]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-391 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-491 ==> 0-62 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 359, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 35, 189, 192, 243, 342, 369, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.508 = TCTGGAATCCTGCCAT-1

using 18924 reads

====================================================================================

graph has 7388 edges initially, 72 edges after simplification

total ucounts = 995
nonsolo ucounts = 480[2^177, 3^106, 4^51, 5^31, 6^28, 7^8, 8^10, 9^5, 10^5, 11^4, 13^2, 14, 15, 18, 26, 38, 42, 46^2, 123, 126, 136, 152, 158, 167, 169, 174, 214, 216, 218^2, 221, 226, 227, 231, 235, 241, 245, 248, 249, 250, 258, 274, 281, 286, 289, 297, 301, 306, 312, 451, 510, 536, 540^2, 593, 624, 628, 672, 782, 789, 831, 996, 1124]
surviving nonsolo ucounts = 44[42, 46, 136, 152, 158, 167, 169, 174, 214, 216, 218^2, 221, 227, 231, 235, 241, 245, 248, 249, 250, 258, 274, 281, 286, 289, 297, 301, 306, 312, 451, 510, 536, 540^2, 593, 624, 628, 672, 782, 789, 831, 996, 1124]
ids = [935, 776, 185, 370, 10, 584, 326, 877, 3, 179, ...]

====================================================================================

UMI info for barcode TCTGGAATCCTGCCAT-1 contig 1 = GCTCTGCTTC...
umi AAAAGACCGA = 214 reads: +391 validated
umi AAAGCACTCT = 160 reads: +391 validated
umi ACCGCGCTCA = 246 reads: +391 validated
umi AGTTTCGCAG = 537 reads: -127X +2 -1XX +1 -4XX +3 -6XX +2 -1XX +35 -1 +1 -1XX +206 invalidated
umi ATACTTATCG = 317 reads: +391 validated
umi ATATAATTGG = 217 reads: +391 validated
umi ATCTGGGCAA = 215 reads: +391 validated
umi CAGTGACGGT = 251 reads: +391 validated
umi CCCGTTAGAC = 289 reads: +391 validated
umi CCCTGGCGTA = 304 reads: +391 validated
umi CCTTCGTACC = 218 reads: +391 validated
umi CGACTACCGA = 287 reads: +391 validated
umi CGGTGTGCAG = 311 reads: +391 validated
umi CGTTAATCGA = 238 reads: +391 validated
umi CTAATCCTAG = 259 reads: +391 validated
umi GAAGGGAACC = 241 reads: +391 validated
umi GAGGAATTGA = 248 reads: +391 validated
umi GCCGCTTCAC = 304 reads: -291X +100 invalidated
umi GCCGTCCGAA = 218 reads: +391 validated
umi GCGATGTGTG = 167 reads: +391 validated
umi TAATACTGCG = 545 reads: +391 validated
umi TCACTACGCT = 275 reads: +391 validated
umi TCCATCCTAG = 280 reads: +391 validated
umi TGGCTACAGC = 174 reads: +391 validated

UMI info for barcode TCTGGAATCCTGCCAT-1 contig 2 = GGGAGAGGAG...
umi AGTATCGTGG = 222 reads: +418 validated
umi ATCAGCGCTT = 141 reads: +418 validated
umi CCCTCTGTGC = 173 reads: +418 validated
umi CGATCTTTAA = 152 reads: +418 validated
umi CTAACCACCT = 231 reads: +418 validated
umi CTTACGAGGA = 348 reads: -392X +3 -1XX +1 -5XX +1 -1XX +1 -1XX +1 -1XX +1 -3XX +6 invalidated
umi TAAGTTTTAC = 234 reads: +418 validated
umi TCAGTACAGC = 44 reads: +365 -1 +52 non-validated
umi TTCAAATTCG = 43 reads: +393 -1 +11 -1 +12 non-validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=18)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 24 umis using 1060 reads
cdr3 = CQSFDSSLGGPVF at 375, score = 7 + 7
umis assigned: [3, 10, 87, 174, 177, 179, 196, 261, 323, 328] and 14 others
of which 24 are surviving nonsolos
reads assigned: 6409
start codons at 51, 208, 259, 358
confident = true

TIG 2[bases=673]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=1)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=23)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
491-673 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 7 umis using 139 reads
cdr3 = CARGCGGHCYRALDYW at 412, score = 8 + 7
umis assigned: [165, 185, 326, 370, 425, 479, 707, 776, 935]
of which 8 are surviving nonsolos
reads assigned: 1438
start codons at 73, 218, 229, 373
confident = true

REJECT CONTIGS

TIG 1[bases=458]
0-103 ==> 11-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
103-248 ==> 0-145 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=9)
247-458 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [224, 253, 330, 336, 444, 450, 477, 637, 652, 655] and 2 others
of which 12 are surviving nonsolos
reads assigned: 8319
start codons at 2, 25, 103, 217
confident = false
did not find CDR3
now this is a cell
paired!

GACGACACGGCCCTATATTACTGTGCGAGAGGGTGTGGTGGTCACTGCTACAGGGCCTTGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGACGATGAGGGTGATTATTACTGCCAGTCCTTTGACAGCAGCCTGGGTGGTCCGGTGTTCGGCGGAGGGACCAAGCTGGCCGTCCTGG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.511 = TCTGGAATCGAGAACG-1

using 334 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

UMI info for barcode TCTGGAATCGAGAACG-1 contig 1 = GGAGGAACTG...
umi TGGAATTGGA = 334 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.515 = TCTGGAATCGTATCAG-1

using 326 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 3^2, 4, 5, 301]
surviving nonsolo ucounts = 1[301]
ids = [6]

====================================================================================

UMI info for barcode TCTGGAATCGTATCAG-1 contig 1 = TGGGGGCTGG...
umi CGTATATGTG = 298 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=578]
46-399 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
437-578 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CSSYTSSSTLRVF at 370, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 46, 203, 247, 254, 257
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.518 = TCTGGAATCTCACATT-1

using 748 reads

====================================================================================

graph has 258 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[341, 406]
surviving nonsolo ucounts = 2[341, 406]
ids = [2, 1]

====================================================================================

UMI info for barcode TCTGGAATCTCACATT-1 contig 1 = GAAGAGCTGC...
umi TTGATCGTAT = 373 reads: +388 validated
umi TTGATGGTAT = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
421-505 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 139 reads
cdr3 = CQQYGSSPLITF at 357, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 672
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.519 = TCTGGAATCTCGATGA-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.523 = TCTGGAATCTGTACGA-1

using 374 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[8, 362]
surviving nonsolo ucounts = 1[362]
ids = [5]

====================================================================================

UMI info for barcode TCTGGAATCTGTACGA-1 contig 1 = GGAGAAGAGC...
umi TAAATCCCTT = 363 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSPRVTF at 360, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.535 = TCTTCGGAGAATCTCC-1

using 58 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 54]
surviving nonsolo ucounts = 1[54]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGAGAATCTCC-1 contig 1 = AGGAACTGCT...
umi AATCAATCGC = 41 reads: +370 validated

GOOD CONTIGS

TIG 1[bases=416]
0-32 ==> 65-97 on |287|IGKV3D-11|5'UTR| [len=97] (mis=0)
32-372 ==> 0-340 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=1)
364-402 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 11 reads
cdr3 = CQQRSNF at 353, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 41
start codons at 32, 237, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.537 = TCTTCGGAGACAAGCC-1

using 293 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=565]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 350, score = 4 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 30, 63, 99, 187, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 565
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.538 = TCTTCGGAGAGCCCAA-1

using 327 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 320]
surviving nonsolo ucounts = 1[320]
ids = [3]

====================================================================================

UMI info for barcode TCTTCGGAGAGCCCAA-1 contig 1 = GGAGAAGAGC...
umi TTAGTTATGG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-509 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPMYTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 36, 85, 244, 343, 384, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.541 = TCTTCGGAGATAGGAG-1

using 229 reads

====================================================================================

graph has 154 edges initially, 6 edges after simplification

total ucounts = 39
nonsolo ucounts = 18[2^11, 3^4, 4, 6, 164]
surviving nonsolo ucounts = 1[164]
ids = [37]

====================================================================================

UMI info for barcode TCTTCGGAGATAGGAG-1 contig 1 = ATCACATAAC...
umi TTTTTGCACT = 161 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=524]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=42)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
491-524 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CGREFEGFCTDGSCYGFDYW at 400, score = 10 + 7
umis assigned: [37]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 58, 355, 431, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.543 = TCTTCGGAGATCCGAG-1

using 321 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 311]
surviving nonsolo ucounts = 1[311]
ids = [4]

====================================================================================

UMI info for barcode TCTTCGGAGATCCGAG-1 contig 1 = AGTGCTTTCT...
umi CTACGCACCA = 308 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARGPRWLQFNLFDYW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 17, 38, 82, 168, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.553 = TCTTCGGAGGCGATAC-1

using 248 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 240]
surviving nonsolo ucounts = 1[240]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGAGGCGATAC-1 contig 1 = ACTGCTCAGT...
umi AGGCCCCCTG = 213 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=500]
0-28 ==> 19-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
28-373 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-500 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQRSNWPLTF at 349, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 28, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.554 = TCTTCGGAGGGAAACA-1

using 32 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.559 = TCTTCGGAGTCGTACT-1

using 540 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 6, 13, 517]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.560 = TCTTCGGAGTGGGATC-1

using 307 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[307]
surviving nonsolo ucounts = 1[307]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=502]
1-42 ==> 3081-3122 on rc of segment before IGHVIII-11-1 exon 1 [len=3122] (mis=1)
1-42 ==> 5959-6000 on rc of segment after IGHV3-20 exon 1 [len=6000] (mis=1)
1-42 ==> 7105-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=1)
1-42 ==> 7099-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=1)
1-42 ==> 6502-6543 on rc of segment before IGHVII-53-1 exon 1 [len=6543] (mis=1)
1-42 ==> 6924-6965 on rc of segment before IGHVII-62-1 exon 1 [len=6965] (mis=1)
12-50 ==> 6508-6546 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=0)
42-397 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
400-502 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 42, 187, 193, 198, 277, 345, 418, 479
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.561 = TCTTCGGAGTTAAGTG-1

using 277 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 18, 249]
surviving nonsolo ucounts = 1[249]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.562 = TCTTCGGAGTTCCACA-1

using 298 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode TCTTCGGAGTTCCACA-1 contig 1 = GGAGGAACTG...
umi TAAACCAGTA = 297 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYYNWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 34, 89, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.564 = TCTTCGGAGTTGAGAT-1

using 213 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGAGTTGAGAT-1 contig 1 = AGGAGTCAGA...
umi ATCGCATTGG = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.566 = TCTTCGGCAACACGCC-1

using 390 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 388]
surviving nonsolo ucounts = 1[388]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGCAACACGCC-1 contig 1 = AGTCAGTCCC...
umi TGCCACTTGC = 334 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=501]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=12)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYDNFPIFTF at 351, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 24, 30, 86, 99, 238, 361, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.572 = TCTTCGGCAATGAAAC-1

using 17116 reads

====================================================================================

graph has 5921 edges initially, 58 edges after simplification

total ucounts = 576
nonsolo ucounts = 296[2^101, 3^57, 4^34, 5^14, 6^14, 7^6, 8^4, 9^3, 10^2, 12, 13, 15, 16, 17, 18, 20, 23, 31, 55, 63, 74, 88, 101, 113, 128, 149, 160, 172, 190, 194, 196, 198, 200, 202, 203, 206, 211, 214, 218, 222, 223, 228, 239, 243, 247, 249, 250^2, 254, 272, 274^2, 276, 283, 288, 298, 309, 313, 322, 369, 413, 537, 591, 639, 642, 682, 687, 796, 925, 957]
surviving nonsolo ucounts = 51[55, 63, 74, 88, 101, 113, 128, 149, 160, 172, 190, 194, 196, 198, 200, 202, 203, 206, 211, 214, 218, 222, 223, 228, 239, 243, 247, 249, 250^2, 254, 272, 274^2, 276, 283, 288, 298, 309, 313, 369, 413, 537, 591, 639, 642, 682, 687, 796, 925, 957]
ids = [273, 421, 176, 449, 427, 430, 248, 287, 456, 1, ...]

====================================================================================

UMI info for barcode TCTTCGGCAATGAAAC-1 contig 1 = GGGAGCATCA...
umi AACGCCCGCA = 209 reads: +412 validated
umi AAGTTCGCGA = 286 reads: +412 validated
umi ATCGCACACG = 291 reads: +402 -10 non-validated
umi CACCCGGCCT = 75 reads: +356 -1 +8 -1 +46 non-validated
umi CCGAATCTTC = 316 reads: +412 validated
umi CTCACGATAA = 52 reads: +412 validated
umi CTTTGCGCTA = 196 reads: +412 validated
umi GTTAGGCCCT = 247 reads: +412 validated
umi TACGTACTCT = 61 reads: +274 -4 +69 -21 +44 non-validated
umi TATACGTGGC = 116 reads: +412 validated
umi TCATAATCCA = 89 reads: +399 -1 +6 -6 non-validated
umi TCTAGACCTT = 205 reads: +380 -1 +11 -20 non-validated
umi TGATGAGCCC = 227 reads: +1 -1XX +410 invalidated
umi TTCTTTCGGC = 221 reads: +412 validated
umi TTTACCTGCT = 186 reads: +411 -1 non-validated

UMI info for barcode TCTTCGGCAATGAAAC-1 contig 2 = GGGGTCTCAG...
umi AAAACTGGTA = 173 reads: +385 validated
umi ACATTTCTTT = 269 reads: +385 validated
umi ACCAAAATGT = 276 reads: +385 validated
umi ACTCTCATCA = 277 reads: +385 validated
umi ACTTCTGTCA = 200 reads: +385 validated
umi AGAGTCTCTC = 253 reads: +385 validated
umi CAAGCGGCCT = 227 reads: +385 validated
umi CATGTCCTAA = 243 reads: +385 validated
umi CCGAGTTCGG = 254 reads: +385 validated
umi CCTCGTAATG = 285 reads: +385 validated
umi CGCATCTTAC = 241 reads: +385 validated
umi CGCGTATACA = 128 reads: +385 validated
umi CTACGAACAC = 920 reads: -272X +113 invalidated
umi CTCTATACTT = 208 reads: +385 validated
umi CTCTTACATT = 148 reads: +385 validated
umi CTGGACTTGA = 956 reads: -347X +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CTTAACCATT = 213 reads: +385 validated
umi GCCCATTAGG = 251 reads: +385 validated
umi GGTGCGCCTT = 259 reads: +385 validated
umi GTACTCCTCG = 194 reads: +385 validated
umi GTCCTTCTCC = 276 reads: +385 validated
umi TACCAATCTA = 197 reads: +385 validated
umi TCCGGATGCG = 162 reads: +385 validated
umi TGCGTCGCAT = 193 reads: +385 validated
umi TTGCTCGTAG = 281 reads: +385 validated
umi TTTACTCAGC = 221 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=2)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=31)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 173 reads
cdr3 = CAPDRGWFASEYW at 406, score = 8 + 7
umis assigned: [17, 31, 137, 176, 213, 273, 308, 406, 421, 430] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2726
start codons at 64, 218, 258, 262, 268, 299, 328, 361, 383
confident = true

TIG 2[bases=634]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-382 ==> 0-344 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=14)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
423-634 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 25 umis using 1126 reads
cdr3 = CSSHAGRPYVF at 362, score = 8 + 8
umis assigned: [1, 50, 51, 77, 83, 88, 168, 196, 214, 223] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7135
start codons at 38, 239, 246, 345, 372, 387, 555
confident = true

REJECT CONTIGS

TIG 1[bases=374]
0-89 ==> 5657-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=4)
32-186 ==> 0-154 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=3)
238-374 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [362, 413, 427, 440, 466, 470, 540, 573]
of which 7 are surviving nonsolos
reads assigned: 3634
start codons at 32, 38, 94, 107, 280
confident = false
did not find CDR3
now this is a cell
paired!

CTGACATATGACGACACGGCCGTATATTATTGTGCGCCAGACAGGGGCTGGTTTGCCTCGGAATACTGGGGCCAGGGAACCGTGGTCACCGTCTCCTCAG <==> GTCTCTGGGCTCCAAGCTGAGGATGAGGCTGATTATTACTGCAGCTCACATGCAGGCAGACCTTATGTCTTCGGGACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.576 = TCTTCGGCACATGACT-1

using 237 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 227]
surviving nonsolo ucounts = 1[227]
ids = [6]

====================================================================================

UMI info for barcode TCTTCGGCACATGACT-1 contig 1 = AGGAGTCAGT...
umi TCACTTCGAG = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.578 = TCTTCGGCACCATGTA-1

using 133 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 5^3, 8, 10, 95]
surviving nonsolo ucounts = 1[95]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.583 = TCTTCGGCAGAAGCAC-1

using 175 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[175]
surviving nonsolo ucounts = 1[175]
ids = [0]

====================================================================================

UMI info for barcode TCTTCGGCAGAAGCAC-1 contig 1 = GAGAGCATCA...
umi CACAATATCC = 172 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=513]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-350 ==> 0-286 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=24)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
494-513 ==> 0-19 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSRDSSRDCSERSCHFDYW at 406, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 64, 262, 267, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.584 = TCTTCGGCAGATAATG-1

using 235 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[235]
surviving nonsolo ucounts = 1[235]
ids = [0]

====================================================================================

UMI info for barcode TCTTCGGCAGATAATG-1 contig 1 = GGAGGAACTG...
umi GCTTTCTTTC = 212 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=467]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-467 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.585 = TCTTCGGCAGATGAGC-1

using 37 reads

====================================================================================

graph has 29 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 30]
surviving nonsolo ucounts = 1[30]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.592 = TCTTCGGCATACGCTA-1

using 229 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 224]
surviving nonsolo ucounts = 1[224]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGCATACGCTA-1 contig 1 = TCAGGACACA...
umi GTCAACGTAC = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
12-363 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
362-400 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
400-536 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 339, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 12, 18, 87, 223, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.600 = TCTTCGGCATTGGCGC-1

using 2405 reads

====================================================================================

graph has 524 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[268, 394, 406, 588, 744]
surviving nonsolo ucounts = 5[268, 394, 406, 588, 744]
ids = [8, 4, 2, 1, 6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=380]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-245 ==> 0-212 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
244-380 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1, 2, 4, 6, 8]
of which 5 are surviving nonsolos
reads assigned: 2284
start codons at 33, 241, 286
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.602 = TCTTCGGGTAAGGGAA-1

using 661 reads

====================================================================================

graph has 141 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 203, 451]
surviving nonsolo ucounts = 2[203, 451]
ids = [6, 3]

====================================================================================

UMI info for barcode TCTTCGGGTAAGGGAA-1 contig 1 = GTCAGTCCCA...
umi GCTTAGGCTC = 449 reads: +388 validated
umi TGACTGCAGA = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=1)
23-374 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 96 reads
cdr3 = CQQLNSYPRTF at 350, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 646
start codons at 23, 85, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.604 = TCTTCGGGTACTTGAC-1

using 489 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 5, 473]
surviving nonsolo ucounts = 1[473]
ids = [8]

====================================================================================

UMI info for barcode TCTTCGGGTACTTGAC-1 contig 1 = GGGGTCTCAG...
umi TATGGTATGG = 459 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-372 ==> 0-334 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=8)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-536 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CSSFPGSIFGLF at 362, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 454
start codons at 38, 195, 246, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.608 = TCTTCGGGTATATCCG-1

using 301 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[9, 287]
surviving nonsolo ucounts = 1[287]
ids = [2]

====================================================================================

UMI info for barcode TCTTCGGGTATATCCG-1 contig 1 = AGAGCTCTGG...
umi CAATCCGAGA = 263 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
429-527 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGSSPWTF at 368, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.609 = TCTTCGGGTATCACCA-1

using 260 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 5, 250]
surviving nonsolo ucounts = 1[250]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGGTATCACCA-1 contig 1 = GCTCTGCTTC...
umi ATTGGGTTTC = 242 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-554 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.623 = TCTTCGGGTGAAGGCT-1

using 380 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^2, 3^2, 4, 8, 10, 340]
surviving nonsolo ucounts = 1[340]
ids = [3]

====================================================================================

UMI info for barcode TCTTCGGGTGAAGGCT-1 contig 1 = GAGCTGCTCA...
umi CCAGCAGTAC = 312 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-508 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 30, 79, 238, 337, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.627 = TCTTCGGGTTAGGGTG-1

using 186 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 7, 171]
surviving nonsolo ucounts = 1[171]
ids = [2]

====================================================================================

UMI info for barcode TCTTCGGGTTAGGGTG-1 contig 1 = GCTTCAGCTG...
umi ATGCATGTGC = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=466]
0-46 ==> 68-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
46-399 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-466 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.630 = TCTTCGGGTTGGGACA-1

using 236 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 7, 222]
surviving nonsolo ucounts = 1[222]
ids = [4]

====================================================================================

UMI info for barcode TCTTCGGGTTGGGACA-1 contig 1 = AGCTTCAGCT...
umi GGTCTTGCAA = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-530 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.632 = TCTTCGGGTTTGTTGG-1

using 533 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 15, 507]
surviving nonsolo ucounts = 1[507]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=388]
0-143 ==> 208-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=2)
139-177 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
177-388 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CLLYYGGALVF at 116, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 504
start codons at 129
confident = false
not full
VJ delta = 17
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.642 = TCTTCGGTCCAAGCCG-1

using 381 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[378]
surviving nonsolo ucounts = 1[378]
ids = [0]

====================================================================================

UMI info for barcode TCTTCGGTCCAAGCCG-1 contig 1 = GGAGTCAGTC...
umi ACAACACTCT = 312 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=20)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
414-486 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSSSSPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.655 = TCTTCGGTCCTTGGTC-1

using 1088 reads

====================================================================================

graph has 322 edges initially, 8 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 270, 812]
surviving nonsolo ucounts = 2[270, 812]
ids = [1, 0]

====================================================================================

UMI info for barcode TCTTCGGTCCTTGGTC-1 contig 1 = GGAGTCAGTC...
umi AAGACAGTCG = 818 reads: -6XX +1 -3XX +2 -3XX +1 -117X +1 -2XX +1 -6XX +4 -8XX +230 invalidated
umi AATTTCCTTT = 269 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-370 ==> 0-344 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 231 reads
cdr3 = CQQSYRAWTF at 353, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 1064
start codons at 26, 32, 88, 101, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.660 = TCTTCGGTCGCCAGCA-1

using 552 reads

====================================================================================

graph has 203 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 544]
surviving nonsolo ucounts = 1[544]
ids = [1]

====================================================================================

UMI info for barcode TCTTCGGTCGCCAGCA-1 contig 1 = AGTCCCAGTC...
umi GAAGCCGTCG = 541 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 94 reads
cdr3 = CQQLNSYPLTF at 347, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 535
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.671 = TCTTCGGTCTGTCTAT-1

using 1217 reads

====================================================================================

graph has 868 edges initially, 6 edges after simplification

total ucounts = 277
nonsolo ucounts = 68[2^32, 3^12, 4^11, 5^4, 6^3, 7, 9, 11, 20, 324, 455]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.685 = TCTTTCCAGAGACTAT-1

using 326 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 4, 5, 311]
surviving nonsolo ucounts = 1[311]
ids = [3]

====================================================================================

UMI info for barcode TCTTTCCAGAGACTAT-1 contig 1 = GATCAGGACT...
umi GTAGCACGGT = 317 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=10)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 48 reads
cdr3 = CMQALQALTF at 366, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.692 = TCTTTCCAGATGGCGT-1

using 296 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3^2, 4, 6, 277]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TCTTTCCAGATGGCGT-1 contig 1 = GATACTTTCT...
umi CAACCACGAC = 260 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=504]
38-386 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=21)
407-456 ==> 0-49 on |52|IGHJ3|J-REGION| [len=49] (mis=6)
456-504 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARARGILGSFEIW at 383, score = 9 + 8
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 258
start codons at 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.711 = TCTTTCCAGGCGATAC-1

using 922 reads

====================================================================================

graph has 906 edges initially, 4 edges after simplification

total ucounts = 227
nonsolo ucounts = 91[2^40, 3^12, 4^7, 5^6, 6^8, 7, 8^6, 9^4, 10^2, 11, 13, 44, 86, 299]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TCTTTCCAGGCGATAC-1 contig 1 = ACATGGGGGA...
umi ACCCTCAGTG = 83 reads: +400 validated
umi CTATCAGGGC = 295 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=474]
38-403 ==> 0-365 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=12)
399-438 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
438-474 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 63 reads
cdr3 = CMQRIEYPYTF at 377, score = 10 + 8
umis assigned: [31, 102]
of which 0 are surviving nonsolos
reads assigned: 371
start codons at 2, 38, 71, 107, 195, 360, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.717 = TCTTTCCAGGTCATCT-1

using 1566 reads

====================================================================================

graph has 1891 edges initially, 14 edges after simplification

total ucounts = 609
nonsolo ucounts = 273[2^128, 3^65, 4^35, 5^16, 6^10, 7^8, 8^3, 9^2, 11^2, 12, 13, 15, 338]
surviving nonsolo ucounts = 1[338]
ids = [314]

====================================================================================

UMI info for barcode TCTTTCCAGGTCATCT-1 contig 1 = TGGGATCAGT...
umi GACGCTTTAC = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [314]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.724 = TCTTTCCAGTCCATAC-1

using 255 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2^2, 243]
surviving nonsolo ucounts = 1[243]
ids = [6]

====================================================================================

UMI info for barcode TCTTTCCAGTCCATAC-1 contig 1 = AGCTCTGAGA...
umi CCTAGTACGC = 240 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=586]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=2)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
515-586 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CAKASYPLSLESGRGGYFDYW at 421, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 79, 230, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.729 = TCTTTCCAGTGTTGAA-1

using 7858 reads

====================================================================================

graph has 5352 edges initially, 56 edges after simplification

total ucounts = 1361
nonsolo ucounts = 682[2^255, 3^174, 4^80, 5^53, 6^42, 7^22, 8^12, 9^5, 10^6, 11^7, 12^2, 13^2, 16, 20, 114, 146, 151, 156, 178, 197, 202, 212, 226, 227, 232, 237, 256, 263, 299, 315, 319, 332, 340, 390]
surviving nonsolo ucounts = 19[114, 146, 151, 156, 178, 197, 202, 212, 226, 227, 232, 237, 256, 263, 299, 315, 319, 340, 390]
ids = [1189, 209, 487, 292, 373, 1158, 716, 442, 760, 623, ...]

====================================================================================

UMI info for barcode TCTTTCCAGTGTTGAA-1 contig 1 = CCTGGGTCAG...
umi CAGTATCTGC = 390 reads: +388 validated
umi GCTAATAATC = 257 reads: +388 validated
umi GGACATATTG = 200 reads: +388 validated
umi GGTATAGGAG = 226 reads: +388 validated
umi TCCATCTCGC = 270 reads: +388 validated
umi TGTTGCTCCT = 339 reads: +388 validated

UMI info for barcode TCTTTCCAGTGTTGAA-1 contig 2 = GGGAGAGGAG...
umi ACCAGTAAGT = 9 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384X invalidated
umi CATGCCGTCT = 6 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384XX invalidated
umi CCCTATGGCC = 157 reads: +439 validated
umi CGAGGTAGTA = 6 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384X invalidated
umi CGTTCAGAAT = 7 reads: +29 -1XX +6 -1XX +6 -1XX +3 -392XX invalidated
umi CTCAGTACAA = 159 reads: +59 -1XX +379 invalidated
umi CTTCTATGTA = 8 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384X invalidated
umi GAGCTCGTCG = 7 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384XX invalidated
umi GATATGCAGT = 8 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384XX invalidated
umi GTAAAATGGC = 11 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384XX invalidated
umi TCCCTTGGCT = 4 reads: +29 -1XX +6 -1XX +6 -1XX +3 -7XX +1 -384X invalidated
umi TGGTGCCTTT = 5 reads: +29 -1XX +1 -408 invalidated
umi TGTTGAACTC = 2 reads: +6 -1 +22 -1XX +6 -1X +6 -1X +3 -7X +1 -384X invalidated

GOOD CONTIGS

TIG 1[bases=576]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
402-440 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 258 reads
cdr3 = CQHYGSSPPVTF at 376, score = 9 + 8
umis assigned: [189, 697, 716, 760, 1012, 1191]
of which 6 are surviving nonsolos
reads assigned: 1655
start codons at 52, 260, 386, 482
confident = true

TIG 2[bases=587]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=3)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
460-512 ==> 11-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
512-587 ==> 0-75 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 27 reads
cdr3 = CARDVSDSSSWDKKFYYGMDVW at 415, score = 8 + 7
umis assigned: [36, 209, 292, 373, 442, 487, 564, 623, 632, 779] and 3 others
of which 13 are surviving nonsolos
reads assigned: 371
start codons at 73, 218, 224, 282, 287, 290, 308, 376, 425, 469
confident = true
now this is a cell
paired!

TACTGTGCGAGAGATGTCAGCGATAGCAGCAGTTGGGACAAGAAGTTTTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGGCTGAAGATTTTGCAGTGTATTACTGTCAGCACTATGGTAGCTCACCTCCAGTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.733 = TCTTTCCAGTTTCCTT-1

using 36 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^3, 4, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.766 = TCTTTCCCAGGACGTA-1

using 399 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 159, 226]
surviving nonsolo ucounts = 2[159, 226]
ids = [0, 11]

====================================================================================

UMI info for barcode TCTTTCCCAGGACGTA-1 contig 1 = GGGCCTCAGG...
umi TCCACATTCC = 223 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=555]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-375 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
414-555 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQAWDSSTGVVF at 350, score = 6 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 35, 40, 96, 183, 329, 333
confident = false

REJECT CONTIGS

TIG 1[bases=553]
510-548 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 7, 43, 109, 177, 220, 316, 326, 343, 512
confident = false
did not find CDR3
note long unannotated region
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.793 = TCTTTCCGTAGCAAAT-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.794 = TCTTTCCGTATGGTTC-1

using 218 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 214]
surviving nonsolo ucounts = 1[214]
ids = [2]

====================================================================================

UMI info for barcode TCTTTCCGTATGGTTC-1 contig 1 = AGGAGTCAGA...
umi GACCGTCACT = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=455]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-455 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQDYNYPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 27, 33, 89, 102, 184, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.795 = TCTTTCCGTATTCGTG-1

using 310 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3^2, 303]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.819 = TCTTTCCGTGTGAATA-1

using 370 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[370]
surviving nonsolo ucounts = 1[370]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.829 = TCTTTCCGTTCAGGCC-1

using 7283 reads

====================================================================================

graph has 3787 edges initially, 74 edges after simplification

total ucounts = 796
nonsolo ucounts = 332[2^115, 3^71, 4^38, 5^31, 6^12, 7^11, 8^8, 9^8, 10^2, 11^2, 12, 13^3, 15, 16, 17, 28, 56, 58, 90, 103, 107, 120, 127, 130, 131, 145, 153, 197, 207, 218, 252, 258, 269, 273, 280, 287, 307, 310, 334, 338, 382, 482]
surviving nonsolo ucounts = 28[11, 28, 56, 58, 90, 103, 107, 120, 127, 130, 131, 145, 153, 197, 207, 218, 252, 258, 269, 273, 280, 287, 307, 310, 334, 338, 382, 482]
ids = [695, 485, 731, 96, 657, 428, 678, 407, 130, 757, ...]

====================================================================================

UMI info for barcode TCTTTCCGTTCAGGCC-1 contig 1 = TGGGGAGACC...
umi ACTCTTCTCT = 307 reads: +388 validated
umi AGAACATTGG = 497 reads: +56 -1XX +1 -1XX +4 -4XX +5 -3XX +1 -20XX +3 -11XX +278 invalidated
umi AGCCTTGTGC = 128 reads: -3 +385 non-validated
umi ATAATTTTCC = 20 reads: -356X +3 -1X +3 -3XX +9 -1XX +10 -1XX +1 invalidated
umi CGGTCCTTTG = 385 reads: +388 validated
umi CTCTATAGCT = 256 reads: +388 validated
umi CTGCCTCCAA = 212 reads: +56 -1XX +1 -1XX +4 -4XX +5 -24X +3 -11XX +278 invalidated
umi GACTTGGCCA = 346 reads: +56 -1XX +1 -1XX +4 -4XX +5 -3XX +1 -20XX +3 -11XX +278 invalidated
umi GAGGTGCCCT = 294 reads: +388 validated
umi GATGCTTTGT = 103 reads: +388 validated
umi GGTCGCTCCG = 44 reads: -351 +1 -1X +1 -2XX +3 -1XX +3 -3XX +9 -1XX +10 -1XX +1 invalidated
umi GTACCCACCG = 338 reads: +388 validated
umi GTTGGGTCAG = 310 reads: +388 validated
umi TATGGCACGT = 2 reads: -388 non-validated
umi TGGAGCTCGG = 261 reads: +388 validated
umi TTAGTCTCCC = 56 reads: +388 validated
umi TTGAGAACCT = 282 reads: +388 validated
umi TTTTGACCCC = 275 reads: +388 validated

UMI info for barcode TCTTTCCGTTCAGGCC-1 contig 2 = GGAGTCTCCC...
umi ATCCATCGTC = 192 reads: +418 validated
umi CCCTTGCAGC = 12 reads: -370X +1 -1XX +2 -1XX +1 -2XX +6 -1XX +20 -2XX +1 -8XX +1 -1XX invalidated
umi GGATTATTGA = 28 reads: +263 -23 +92 -24 +16 non-validated
umi TCCTTGGCCT = 90 reads: +402 -16 non-validated
umi TGCTACGGAC = 10 reads: -15 +3 -1 +36 -1 +16 -1 +3 -1 +2 -1 +1 -1 +5 -1 +2 -1X +1 -1 +2 -2 +6 -4 +245 -66 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 0-25 on |243|IGKV1D-13|5'UTR| [len=25] (mis=4)
25-376 ==> 0-351 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=13)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 758 reads
cdr3 = CQQFNSYPLTF at 352, score = 8 + 9
umis assigned: [110, 122, 130, 158, 335, 367, 376, 413, 419, 428] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4031
start codons at 25, 31, 87, 239, 260, 455
confident = true

TIG 2[bases=583]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-583 ==> 0-106 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARQHGDLRDWLDPW at 401, score = 9 + 7
umis assigned: [173, 284, 485, 657, 695]
of which 5 are surviving nonsolos
reads assigned: 328
start codons at 59, 233, 257
confident = true
now this is a cell
paired!

GCCTCCGACACCGCCGTCTACTATTGTGCGAGACAACACGGTGACCTGCGGGACTGGTTGGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAAGTTATTACTGTCAACAGTTTAATAGTTACCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.830 = TCTTTCCGTTCCCTTG-1

using 229 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TCTTTCCGTTCCCTTG-1 contig 1 = ACCCAAAAAC...
umi TCTCCCTCGC = 226 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=553]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-553 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.836 = TCTTTCCTCAACACAC-1

using 923 reads

====================================================================================

graph has 394 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4, 265, 288, 362]
surviving nonsolo ucounts = 3[265, 288, 362]
ids = [3, 0, 1]

====================================================================================

UMI info for barcode TCTTTCCTCAACACAC-1 contig 1 = GAGAGGAGCC...
umi ATAACTTGGC = 258 reads: +445 validated

UMI info for barcode TCTTTCCTCAACACAC-1 contig 2 = GCTCTGCTTC...
umi CGCAAATTTG = 258 reads: +394 validated

UMI info for barcode TCTTTCCTCAACACAC-1 contig 3 = GCTCAGTTAG...
umi ATAATTGCGA = 334 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=538]
0-72 ==> 8-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
72-431 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=6)
443-470 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
469-517 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
517-538 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CTTSNPLRYYYGSGTVYYFDFW at 420, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 72, 228, 295, 352, 381, 451
confident = false

TIG 2[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 3[bases=502]
0-25 ==> 22-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
25-370 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-502 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPFLTF at 346, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 25, 230, 233, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.839 = TCTTTCCTCAATCACG-1

using 141 reads

====================================================================================

graph has 40 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[12, 122]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.843 = TCTTTCCTCACCCTCA-1

using 126 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 10, 102]
surviving nonsolo ucounts = 1[102]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.848 = TCTTTCCTCAGGCAAG-1

using 526 reads

====================================================================================

graph has 184 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 6, 232, 281]
surviving nonsolo ucounts = 2[232, 281]
ids = [0, 1]

====================================================================================

UMI info for barcode TCTTTCCTCAGGCAAG-1 contig 1 = ACCCAGACGG...
umi ACGCATAGCG = 234 reads: +385 validated

UMI info for barcode TCTTTCCTCAGGCAAG-1 contig 2 = ATCAGTCCCA...
umi CCATAGGTCC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
14-359 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
361-399 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNNWPPWTF at 335, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 14, 83, 219, 441
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.852 = TCTTTCCTCCAACCAA-1

using 21 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.867 = TCTTTCCTCCTCTAGC-1

using 553 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 3, 537]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=415]
0-272 ==> 2164-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
296-344 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
344-415 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 530
start codons at 27, 33, 74
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.876 = TCTTTCCTCCTTTCGG-1

using 242 reads

====================================================================================

graph has 49 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode TCTTTCCTCCTTTCGG-1 contig 1 = AGGAATCAGA...
umi ATCTCACCAC = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-506 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.889 = TCTTTCCTCTACCAGA-1

using 310 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 5, 7, 287]
surviving nonsolo ucounts = 1[287]
ids = [1]

====================================================================================

UMI info for barcode TCTTTCCTCTACCAGA-1 contig 1 = GAGGAGTCAG...
umi ATTTCCCTGG = 288 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=537]
28-111 ==> 0-83 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
111-366 ==> 98-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
364-401 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYTTLLTF at 340, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 28, 34, 81, 90, 103, 224, 443
confident = false
see deletion of 15 bases at pos 83 on |253|IGKV1D-39|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.911 = TGAAAGAAGAAACCAT-1

using 1099 reads

====================================================================================

graph has 316 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[1094]
surviving nonsolo ucounts = 1[1094]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=311]
3-135 ==> 213-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
137-175 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
175-311 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYHWPPITF at 111, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 1081
start codons at 217
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.913 = TGAAAGAAGAATGTTG-1

using 301 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 290]
surviving nonsolo ucounts = 1[290]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAAGAATGTTG-1 contig 1 = GAGGAACTGC...
umi CCGTCCGAGG = 292 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNNWPLYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.926 = TGAAAGAAGCCACCTG-1

using 279 reads

====================================================================================

graph has 138 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[9, 15, 84, 167]
surviving nonsolo ucounts = 2[84, 167]
ids = [7, 0]

====================================================================================

UMI info for barcode TGAAAGAAGCCACCTG-1 contig 1 = AGCTTCAGCT...
umi GTTGTGAAGG = 78 reads: +388 validated

UMI info for barcode TGAAAGAAGCCACCTG-1 contig 2 = TGGGAGAGGA...
umi ACAAATTCCA = 164 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=438]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 46, 200, 350, 375, 380
confident = false

TIG 2[bases=555]
0-74 ==> 6-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
74-425 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=3)
465-513 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
513-555 ==> 0-42 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARAEHVLRYFESVGPFSLDYW at 416, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 74, 225, 230, 288, 291, 309, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.928 = TGAAAGAAGCCGGTAA-1

using 251 reads

====================================================================================

graph has 85 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAAGCCGGTAA-1 contig 1 = GGAGTCAGAC...
umi TTACACGCGA = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYSETF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.930 = TGAAAGAAGCGCCTTG-1

using 254 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode TGAAAGAAGCGCCTTG-1 contig 1 = GGAGTCAGTC...
umi ATTTAGGCTG = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.931 = TGAAAGAAGCGTAATA-1

using 263 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 256]
surviving nonsolo ucounts = 1[256]
ids = [0]

====================================================================================

UMI info for barcode TGAAAGAAGCGTAATA-1 contig 1 = GGGGTCTCCC...
umi ATCTATGGAT = 256 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=544]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-544 ==> 0-67 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 59, 233, 531
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.932 = TGAAAGAAGCTGTTCA-1

using 105 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[102]
surviving nonsolo ucounts = 1[102]
ids = [1]

====================================================================================

UMI info for barcode TGAAAGAAGCTGTTCA-1 contig 1 = GGGAAATGCT...
umi CATTCAATTC = 78 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=480]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 8 reads
cdr3 = CARADAVAGMSHFDYW at 387, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 5, 21, 30, 42, 86, 400, 414
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.936 = TGAAAGAAGGCGCTCT-1

using 23 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.937 = TGAAAGAAGGGATACC-1

using 277 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAAGGGATACC-1 contig 1 = GTCAGTCTCA...
umi ACAATTCTGT = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-474 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPFTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.938 = TGAAAGAAGGGCTTGA-1

using 902 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[279, 619]
surviving nonsolo ucounts = 2[279, 619]
ids = [4, 0]

====================================================================================

UMI info for barcode TGAAAGAAGGGCTTGA-1 contig 1 = GGGGGAGGAA...
umi AACTCTGCAT = 653 reads: +228 -1XX +159 invalidated
umi GTACCCATCC = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 146 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 885
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.941 = TGAAAGAAGTACGCGA-1

using 305 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode TGAAAGAAGTACGCGA-1 contig 1 = GAGATCACAG...
umi GTTCAGTCTC = 282 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=520]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-520 ==> 0-65 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.943 = TGAAAGAAGTCAAGGC-1

using 318 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[315]
surviving nonsolo ucounts = 1[315]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAAGTCAAGGC-1 contig 1 = GCAGGAGTCA...
umi GCACGTCCTT = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.947 = TGAAAGAAGTTGAGAT-1

using 8612 reads

====================================================================================

graph has 3817 edges initially, 46 edges after simplification

total ucounts = 460
nonsolo ucounts = 231[2^64, 3^38, 4^34, 5^25, 6^14, 7^5, 8^6, 9^3, 10^2, 11, 12, 15, 21, 23, 65, 69, 79, 92, 97, 104, 127^2, 134^2, 144, 163, 170, 195, 202^2, 205, 210, 212, 213^2, 230, 231, 240, 255, 286, 296, 310, 320, 324, 355, 368, 375, 383, 454]
surviving nonsolo ucounts = 35[65, 69, 79, 92, 97, 104, 127^2, 134^2, 144, 163, 170, 195, 202^2, 205, 210, 212, 213^2, 230, 231, 240, 255, 286, 296, 310, 320, 324, 355, 368, 375, 383, 454]
ids = [200, 64, 407, 105, 98, 281, 56, 172, 293, 446, ...]

====================================================================================

UMI info for barcode TGAAAGAAGTTGAGAT-1 contig 1 = TGGGGATGCT...
umi ACTGAATCAG = 286 reads: +448 validated
umi AGCTAAGCCA = 207 reads: +448 validated
umi AGTTTAGATA = 68 reads: -29 +390 -1 +11 -17 non-validated
umi CAAAGTTGTC = 94 reads: +448 validated
umi CACTGTTGTT = 371 reads: +448 validated
umi CAGAGCCCTA = 457 reads: +448 validated
umi CCAAATGTGC = 295 reads: +448 validated
umi CGACAAATCC = 214 reads: +448 validated
umi CTATTTCTCA = 64 reads: +419 -29 non-validated
umi GACTCCTACA = 230 reads: +448 validated
umi GCTAGGACTC = 282 reads: +448 validated
umi GTAAAACCTG = 105 reads: +448 validated
umi GTATAAAAAG = 375 reads: +448 validated
umi GTATGGTGGT = 196 reads: +448 validated
umi GTTTCAAGGG = 211 reads: +448 validated
umi TACCTTATCG = 341 reads: +448 validated
umi TACTAATTCA = 314 reads: +448 validated
umi TCAGGTCCTT = 205 reads: +448 validated
umi TGTATTTCCT = 211 reads: +448 validated
umi TGTCTCGCAC = 78 reads: +25 -1 +1 -4 +417 non-validated
umi TTGTCTGTCC = 291 reads: +448 validated
umi TTTCTGTCCA = 169 reads: -2 +435 -11 non-validated

UMI info for barcode TGAAAGAAGTTGAGAT-1 contig 2 = GGGGAGCAGA...
umi ATTACTTACA = 235 reads: +400 validated
umi CGAACTATGC = 258 reads: +400 validated
umi CGGCGGCGCT = 210 reads: +400 validated
umi CTCGCGGCTA = 115 reads: +21 -1XX +2 -18XX +1 -2XX +1 -3XX +308 -17 +26 invalidated

GOOD CONTIGS

TIG 1[bases=540]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=4)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 18 umis using 405 reads
cdr3 = CARRATYNWNPQNWDYW at 387, score = 9 + 7
umis assigned: [46, 54, 64, 98, 115, 118, 132, 169, 200, 239] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5004
start codons at 5, 21, 30, 42, 86
confident = true

TIG 2[bases=560]
29-391 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=3)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-560 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 94 reads
cdr3 = CETWDSNTQGVF at 365, score = 7 + 8
umis assigned: [86, 167, 185, 206]
of which 4 are surviving nonsolos
reads assigned: 795
start codons at 29, 193, 233, 348
confident = true

REJECT CONTIGS

TIG 1[bases=524]
0-62 ==> 38-100 on rc of segment before IGHV3-65 exon 1 [len=100] (mis=0)
60-159 ==> 44-143 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=5)
141-160 ==> 5010-5029 on rc of segment before IGHV3-64D exon 2 [len=6000] (mis=0)
160-376 ==> 143-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=28)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CSNRYDAFDIW at 389, score = 3 + 8
umis assigned: [150, 439]
of which 2 are surviving nonsolos
reads assigned: 547
start codons at 6, 50, 173, 297, 326, 402, 405, 434
confident = false
VJ delta = -15
not full
not full
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGACGTGCCACGTATAACTGGAACCCCCAAAACTGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCCAACCTCCAGTTTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCAGGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.948 = TGAAAGACAAAGAATC-1

using 314 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 8, 292]
surviving nonsolo ucounts = 1[292]
ids = [4]

====================================================================================

UMI info for barcode TGAAAGACAAAGAATC-1 contig 1 = CTGGGCCTCA...
umi TAACCATCAA = 274 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=524]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-524 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQAWDSSTAVF at 352, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.949 = TGAAAGACAAGCCCAC-1

using 311 reads

====================================================================================

graph has 77 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 307]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.964 = TGAAAGACAGGAATGC-1

using 262 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode TGAAAGACAGGAATGC-1 contig 1 = GGGGAGCCCT...
umi AAGCAGGATG = 248 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=496]
64-419 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=40)
428-491 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=6)
junction support: 1 umis using 18 reads
cdr3 = CAKDIRESRYKYYGMDVW at 406, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 64, 209, 215, 220, 258, 299, 367, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.970 = TGAAAGACATCGGACC-1

using 289 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 282]
surviving nonsolo ucounts = 1[282]
ids = [0]

====================================================================================

UMI info for barcode TGAAAGACATCGGACC-1 contig 1 = TGAGCGCAGA...
umi ATCCAATGCG = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.976 = TGAAAGACATTTCAGG-1

using 431 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[3, 4, 32, 53, 66, 271]
surviving nonsolo ucounts = 2[66, 271]
ids = [3, 7]

====================================================================================

UMI info for barcode TGAAAGACATTTCAGG-1 contig 1 = GATCAGGACT...
umi GTTTTTTTAA = 254 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=500]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-500 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.978 = TGAAAGAGTAAAGGAG-1

using 37 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 1[37]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.981 = TGAAAGAGTACTCTCC-1

using 294 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 10, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAGTACTCTCC-1 contig 1 = GAGAGAGGAG...
umi TAACTCTTTC = 278 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=605]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-605 ==> 0-108 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.985 = TGAAAGAGTCAAAGCG-1

using 275 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================

UMI info for barcode TGAAAGAGTCAAAGCG-1 contig 1 = AGAGCCCTGG...
umi GAGATGGTTG = 246 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=506]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-506 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQRSNWPPLTF at 365, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 44, 249, 252, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.986 = TGAAAGAGTCATCGGC-1

using 308 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 303]
surviving nonsolo ucounts = 1[303]
ids = [3]

====================================================================================

UMI info for barcode TGAAAGAGTCATCGGC-1 contig 1 = GGGGAGGAAC...
umi TACGCTCTTT = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.987 = TGAAAGAGTCCGAAGA-1

using 299 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 6, 286]
surviving nonsolo ucounts = 1[286]
ids = [3]

====================================================================================

UMI info for barcode TGAAAGAGTCCGAAGA-1 contig 1 = GGCTGGGGTC...
umi GGAAGATACT = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
42-396 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
430-539 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.992 = TGAAAGAGTGAGGGTT-1

using 340 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3^2, 5, 326]
surviving nonsolo ucounts = 1[326]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=548]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-380 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=18)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 27, 33, 89, 184, 241, 337, 370, 454
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.996 = TGAAAGAGTTCCACAA-1

using 285 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 5, 19, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

UMI info for barcode TGAAAGAGTTCCACAA-1 contig 1 = ATCAGTCCCA...
umi GCTAATTCCC = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-490 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.997 = TGAAAGAGTTCCCTTG-1

using 415 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[415]
surviving nonsolo ucounts = 1[415]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=488]
14-315 ==> 62-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=17)
313-352 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
352-488 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYGSPRTF at 291, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 7, 21, 274, 304, 394
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.998 = TGAAAGAGTTCCGTCT-1

using 346 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 10, 326]
surviving nonsolo ucounts = 1[326]
ids = [5]

====================================================================================

UMI info for barcode TGAAAGAGTTCCGTCT-1 contig 1 = AGCCTGGGCC...
umi TGCGAGCTTC = 329 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=627]
0-40 ==> 75-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
40-371 ==> 0-331 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=18)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQVWDTNKAVF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 40, 91, 101, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1000 = TGAAAGAGTTGCCTCT-1

using 657 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[314, 340]
surviving nonsolo ucounts = 2[314, 340]
ids = [2, 3]

====================================================================================

UMI info for barcode TGAAAGAGTTGCCTCT-1 contig 1 = GGAACTGCTC...
umi TAGGAAACGG = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNNWPSMYTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 31, 100, 236, 379, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1010 = TGAAAGATCCCTGACT-1

using 1140 reads

====================================================================================

graph has 326 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[247, 892]
surviving nonsolo ucounts = 2[247, 892]
ids = [2, 0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=320]
3-92 ==> 267-356 on |180|IGHV4-30-2|L-REGION+V-REGION| [len=356] (mis=10)
110-160 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
160-320 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CAREGLLLYVDAFDLW at 81, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 880
start codons at 106, 112, 141, 214
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1013 = TGAAAGATCGTGGACC-1

using 574 reads

====================================================================================

graph has 192 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[274, 298]
surviving nonsolo ucounts = 2[274, 298]
ids = [3, 1]

====================================================================================

UMI info for barcode TGAAAGATCGTGGACC-1 contig 1 = ACTCCTGTGC...
umi GTGACATTAG = 288 reads: +433 validated

UMI info for barcode TGAAAGATCGTGGACC-1 contig 2 = GCAGGAGTCA...
umi TGGCATTGGG = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
16-374 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
399-449 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
449-557 ==> 0-108 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 52 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 361, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 16, 60, 239, 242, 245, 331, 401
confident = false

TIG 2[bases=503]
0-29 ==> 18-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-503 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQANSFPLTF at 356, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 29, 35, 91, 104, 243, 261, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1017 = TGAAAGATCTCCCTGA-1

using 640 reads

====================================================================================

graph has 270 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[636]
surviving nonsolo ucounts = 1[636]
ids = [1]

====================================================================================

UMI info for barcode TGAAAGATCTCCCTGA-1 contig 1 = AGTCTGGGCC...
umi CCACAACAGG = 636 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=630]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-382 ==> 0-342 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 110 reads
cdr3 = CQVWDSSSDYVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 624
start codons at 40, 101, 239, 242, 338, 383, 551
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1021 = TGAAAGATCTCTGCTG-1

using 35 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1024 = TGAAAGATCTTAGAGC-1

using 51 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 49]
surviving nonsolo ucounts = 1[49]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1028 = TGACAACAGACCACGA-1

using 119 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 110]
surviving nonsolo ucounts = 1[110]
ids = [2]

====================================================================================

UMI info for barcode TGACAACAGACCACGA-1 contig 1 = GGACTCCTGT...
umi GACTGCCGAC = 103 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=494]
18-369 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
436-494 ==> 0-58 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAVSSRADGYFDSW at 363, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 18, 62, 244, 324, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1035 = TGACAACAGCAAATCA-1

using 676 reads

====================================================================================

graph has 228 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[4, 9, 297, 361]
surviving nonsolo ucounts = 2[297, 361]
ids = [2, 6]

====================================================================================

UMI info for barcode TGACAACAGCAAATCA-1 contig 1 = GGAGTCAGTC...
umi CCCACCATGC = 284 reads: +385 validated
umi GTCCCAGTCG = 325 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=462]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-462 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 91 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 600
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1044 = TGACAACAGGGATCTG-1

using 31 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1056 = TGACAACCAAGACACG-1

using 223 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[8, 211]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=511]
1-77 ==> 4667-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
77-425 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
436-467 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=6)
459-511 ==> 0-52 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
umis assigned: [4]
of which 0 are surviving nonsolos
reads assigned: 204
start codons at 33, 77, 121, 479
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1062 = TGACAACCAATGACCT-1

using 229 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode TGACAACCAATGACCT-1 contig 1 = GGTAGCTCAG...
umi CTCCTTGTCT = 209 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=440]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=1)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSNRGVF at 363, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 36, 99, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1066 = TGACAACCACAGCGTC-1

using 84 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[81]
surviving nonsolo ucounts = 1[81]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1073 = TGACAACCAGACACTT-1

using 278 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 4, 264]
surviving nonsolo ucounts = 1[264]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1074 = TGACAACCAGATAATG-1

using 384 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[384]
surviving nonsolo ucounts = 1[384]
ids = [0]

====================================================================================

UMI info for barcode TGACAACCAGATAATG-1 contig 1 = GGGGAGGAAC...
umi CGACTCGTTC = 384 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1081 = TGACAACCAGGTCTCG-1

using 18502 reads

====================================================================================

graph has 5657 edges initially, 42 edges after simplification

total ucounts = 868
nonsolo ucounts = 379[2^125, 3^66, 4^40, 5^28, 6^13, 7^10, 8^10, 9^6, 10, 11^2, 12, 13, 14, 15, 16, 17, 18, 19, 21, 26, 46, 49, 68, 70, 73, 79, 87, 103, 144, 198, 203, 207, 208, 217^2, 219, 220, 223, 227, 232, 233^2, 236, 238, 240, 241, 242^2, 246, 247, 253, 254, 262, 265, 269, 270, 271, 272^2, 273, 276^2, 278, 279, 280, 290^2, 292, 295, 296, 299, 300, 306^2, 308, 313, 314, 315^2, 318, 321, 322, 323, 324, 335, 342, 355, 363]
surviving nonsolo ucounts = 63[73, 87, 103, 144, 198, 203, 207, 208, 217^2, 219, 220, 223, 227, 232, 233^2, 236, 238, 240, 241, 242^2, 246, 247, 253, 254, 262, 265, 269, 270, 271, 272^2, 273, 276^2, 278, 279, 280, 290^2, 292, 295, 296, 299, 300, 306^2, 308, 313, 314, 315^2, 318, 321, 322, 323, 324, 335, 342, 355, 363]
ids = [49, 316, 449, 90, 780, 714, 442, 775, 33, 169, ...]

====================================================================================

UMI info for barcode TGACAACCAGGTCTCG-1 contig 1 = TGGGGGATCA...
umi AAAGAGGGTC = 298 reads: +397 validated
umi AAATTGACGG = 250 reads: +397 validated
umi AACCGATTTC = 318 reads: +397 validated
umi AACTCAGCTC = 319 reads: +397 validated
umi AATACACCGG = 223 reads: +397 validated
umi AATCGCCGGA = 241 reads: +397 validated
umi AATCTATCCG = 73 reads: +397 validated
umi AATGTCTTCT = 311 reads: +397 validated
umi ACACGCTTTC = 312 reads: +397 validated
umi ACCAAATTCA = 321 reads: +397 validated
umi ACGATTTCAT = 147 reads: +397 validated
umi ACGTGGGGGA = 268 reads: +397 validated
umi ACTATGCCTC = 299 reads: +397 validated
umi ACTTCTGGGC = 305 reads: +397 validated
umi AGTAAAGCCT = 299 reads: +397 validated
umi ATACAACACC = 271 reads: +397 validated
umi ATATCCCAGC = 227 reads: +397 validated
umi ATCGTAATCC = 268 reads: +397 validated
umi ATGGAGCGGA = 230 reads: +397 validated
umi CAAAGAACCT = 239 reads: +397 validated
umi CAATAGTGAC = 313 reads: +397 validated
umi CCAACGACAG = 343 reads: +397 validated
umi CCTACTGTTG = 88 reads: +397 validated
umi CGAATCGCCG = 292 reads: +397 validated
umi CGTTCAGTCC = 248 reads: +397 validated
umi CTACACTCCT = 318 reads: +397 validated
umi CTCAGCAGTT = 245 reads: +397 validated
umi CTCGGGGGTC = 289 reads: +397 validated
umi CTGACATCCT = 274 reads: +397 validated
umi CTGGTGCGGT = 356 reads: +397 validated
umi CTGTTTGATA = 295 reads: +397 validated
umi CTTAGCACAC = 238 reads: +397 validated
umi GACATCAGAG = 207 reads: +397 validated
umi GACTCACCCT = 102 reads: +397 validated
umi GATTCACCTT = 277 reads: +397 validated
umi GATTGTGTGC = 302 reads: +397 validated
umi GCCATCGGGG = 249 reads: +397 validated
umi GCGGACCCCA = 257 reads: +397 validated
umi GCGGCATGTT = 237 reads: +397 validated
umi GCGGCGACTC = 274 reads: +397 validated
umi GCGGTTACGT = 334 reads: +65 -1XX +331 invalidated
umi GGTTGCCCAA = 324 reads: +397 validated
umi GTAGCAGCGC = 273 reads: +397 validated
umi GTCGGGTGGC = 235 reads: +3 -1XX +393 invalidated
umi TAAGGAGTGT = 226 reads: +397 validated
umi TACATCGCGA = 219 reads: +397 validated
umi TAGGCGGGAT = 277 reads: +397 validated
umi TAGGTCTTTC = 225 reads: +397 validated
umi TCAACTCTCT = 247 reads: +397 validated
umi TCCACGGGGA = 208 reads: +169 -8XX +220 invalidated
umi TCCGATATAT = 322 reads: +397 validated
umi TCCGATGTTG = 261 reads: +397 validated
umi TCGTTGTGGT = 217 reads: +397 validated
umi TCTGTCACTT = 365 reads: +397 validated
umi TGGTCAGTTT = 206 reads: +397 validated
umi TGTGTCAAGA = 200 reads: +397 validated
umi TGTGTCCTGA = 277 reads: +397 validated
umi TGTTCCTCCA = 278 reads: +397 validated
umi TGTTTCTGTG = 303 reads: +397 validated
umi TTAAAGCTAG = 332 reads: +397 validated
umi TTATAACCAG = 282 reads: +397 validated
umi TTTGGCTCCG = 274 reads: +397 validated
umi TTTTCATGTG = 235 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 63 umis using 2376 reads
cdr3 = CMQALQTLFTF at 371, score = 9 + 8
umis assigned: [4, 9, 13, 20, 33, 47, 49, 54, 67, 75] and 53 others
of which 63 are surviving nonsolos
reads assigned: 16286
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1087 = TGACAACCAGTGGAGT-1

using 311 reads

====================================================================================

graph has 107 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode TGACAACCAGTGGAGT-1 contig 1 = AGGAGTCAGA...
umi ATGGCCGCTT = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-511 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1093 = TGACAACCATCATCCC-1

using 192 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 186]
surviving nonsolo ucounts = 1[186]
ids = [2]

====================================================================================

UMI info for barcode TGACAACCATCATCCC-1 contig 1 = GCTCTGCTTC...
umi CGTCCAAATC = 179 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=503]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-503 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1095 = TGACAACCATTAGGCT-1

using 198 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1097 = TGACAACTCAAACCGT-1

using 269 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 256]
surviving nonsolo ucounts = 1[256]
ids = [1]

====================================================================================

UMI info for barcode TGACAACTCAAACCGT-1 contig 1 = GTCTGGGCCT...
umi AGGCCAACTA = 253 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-39 ==> 212-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
39-390 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=13)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
421-549 ==> 0-128 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQVWDSSSDHWVF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 39, 100, 241, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1099 = TGACAACTCAACCAAC-1

using 279 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=450]
0-65 ==> 49-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
65-418 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
415-450 ==> 0-35 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
cdr3 = CAAWDDSLNGWVF at 386, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 65, 369, 394, 399, 411
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1101 = TGACAACTCAAGCCTA-1

using 1798 reads

====================================================================================

graph has 2389 edges initially, 20 edges after simplification

total ucounts = 747
nonsolo ucounts = 340[2^128, 3^77, 4^46, 5^27, 6^20, 7^13, 8^12, 9^5, 10, 11, 12, 13, 15^3, 17^2, 19, 28, 60]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1102 = TGACAACTCAATCTCT-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1110 = TGACAACTCAGGATCT-1

using 367 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[360]
surviving nonsolo ucounts = 1[360]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=406]
0-169 ==> 184-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=13)
198-246 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
246-406 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGDRRAAAFYYHYMDVW at 158, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 14, 80, 113, 203, 300
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1114 = TGACAACTCATGTCCC-1

using 182 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4^2, 171]
surviving nonsolo ucounts = 1[171]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1115 = TGACAACTCCATTCTA-1

using 20 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1116 = TGACAACTCCCACTTG-1

using 230 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 220]
surviving nonsolo ucounts = 1[220]
ids = [2]

====================================================================================

UMI info for barcode TGACAACTCCCACTTG-1 contig 1 = GCTCTGCTTC...
umi CACGGTTAAT = 211 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=536]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=7)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
436-536 ==> 0-100 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDNSVRVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1126 = TGACAACTCCTTTACA-1

using 636 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[632]
surviving nonsolo ucounts = 1[632]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=395]
1-222 ==> 139-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
221-259 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
259-395 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
cdr3 = CMQALQIRETF at 198, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 621
start codons at 19, 181, 201, 301
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1127 = TGACAACTCGAACGGA-1

using 195 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[192]
surviving nonsolo ucounts = 1[192]
ids = [3]

====================================================================================

UMI info for barcode TGACAACTCGAACGGA-1 contig 1 = GCTCTGGGAG...
umi GTCATCGTGG = 185 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-78 ==> 2-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
78-429 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
440-471 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=3)
464-514 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
514-542 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CAKDGRAYYDFWSGYSAFDIW at 420, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 78, 229, 234, 292, 295, 313, 381, 495
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1140 = TGACAACTCTTCCTTC-1

using 295 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 18, 270]
surviving nonsolo ucounts = 1[270]
ids = [2]

====================================================================================

UMI info for barcode TGACAACTCTTCCTTC-1 contig 1 = GAGGAATCAG...
umi CACCACGGTT = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1145 = TGACGGCAGACCACGA-1

using 693 reads

====================================================================================

graph has 304 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 685]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1153 = TGACGGCAGCCACTAT-1

using 265 reads

====================================================================================

graph has 96 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 255]
surviving nonsolo ucounts = 2[3, 255]
ids = [5, 0]

====================================================================================

UMI info for barcode TGACGGCAGCCACTAT-1 contig 1 = GAGTCAGACT...
umi AATTACATAT = 258 reads: +388 validated
umi CCTTGGGGTT = 3 reads: -388 non-validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 258
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1157 = TGACGGCAGGAATGGA-1

using 3408 reads

====================================================================================

graph has 2482 edges initially, 30 edges after simplification

total ucounts = 510
nonsolo ucounts = 173[2^68, 3^36, 4^17, 5^15, 6^8, 7^5, 8^2, 9^4, 10, 11, 13, 14, 18, 40, 67, 85, 121, 171, 181, 194, 220, 223, 238, 251, 296, 396]
surviving nonsolo ucounts = 13[40, 67, 85, 121, 171, 181, 194, 220, 223, 238, 251, 296, 396]
ids = [457, 223, 199, 383, 384, 92, 378, 473, 212, 297, ...]

====================================================================================

UMI info for barcode TGACGGCAGGAATGGA-1 contig 1 = GGGAGAGGAG...
umi CATGGTAACT = 251 reads: +412 validated
umi CGCCAAACTC = 87 reads: +391 -21 non-validated
umi CGTTAAGATC = 43 reads: -11X +1 -6XX +1 -4XX +1 -1XX +1 -3XX +2 -3XX +2 -1XX +1 -1XX +2 -3XX +368 invalidated
umi CTGCCATCAT = 295 reads: +412 validated
umi TCAAAACCAC = 112 reads: -364X +1 -3X +1 -3X +1 -4X +1 -5X +29 invalidated
umi TGCACTGGCT = 211 reads: +412 validated
umi TGCGTTTCGT = 39 reads: +56 -1 +18 -1 +202 -5 +32 -1 +9 -1 +38 -1 +27 -9 +11 non-validated
umi TTAAAGAACC = 188 reads: +412 validated

UMI info for barcode TGACGGCAGGAATGGA-1 contig 2 = ATCTCCTCCA...
umi ATTCACATGA = 179 reads: +388 validated
umi CGGGCATGTA = 226 reads: +388 validated
umi GCATGAGGTT = 243 reads: +388 validated
umi TATGTTACTT = 187 reads: +388 validated
umi TCAAGCGCAC = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=588]
0-74 ==> 6-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
74-433 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=2)
448-486 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-588 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 89 reads
cdr3 = CTTGDYGIGYW at 422, score = 8 + 7
umis assigned: [134, 199, 223, 252, 383, 453, 457, 473]
of which 8 are surviving nonsolos
reads assigned: 1192
start codons at 74, 230, 297, 354, 383, 504, 565
confident = true

TIG 2[bases=733]
0-134 ==> 117-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
134-485 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3)
484-522 ==> 8-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
522-733 ==> 0-211 on |308|IGLC7|C-REGION| [len=317] (mis=1)
junction support: 5 umis using 132 reads
cdr3 = CQVWDSSSDHPSAVF at 449, score = 8 + 7
umis assigned: [92, 212, 297, 378, 384]
of which 5 are surviving nonsolos
reads assigned: 989
start codons at 41, 134, 195, 333, 336, 432, 654, 717
confident = true
now this is a cell
paired!

AACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACCGGTGACTACGGGATAGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCCTCTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1158 = TGACGGCAGGATCGCA-1

using 838 reads

====================================================================================

graph has 954 edges initially, 6 edges after simplification

total ucounts = 287
nonsolo ucounts = 116[2^56, 3^18, 4^14, 5^8, 6^6, 7^9, 8^2, 11^2, 268]
surviving nonsolo ucounts = 1[268]
ids = [282]

====================================================================================

UMI info for barcode TGACGGCAGGATCGCA-1 contig 1 = GGAGGAACTG...
umi TTTAGTGCTG = 251 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=501]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=8)
419-501 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPPYPF at 355, score = 9 + 6
umis assigned: [282]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1165 = TGACGGCAGTACGTAA-1

using 11931 reads

====================================================================================

graph has 5024 edges initially, 78 edges after simplification

total ucounts = 757
nonsolo ucounts = 343[2^136, 3^59, 4^33, 5^19, 6^13, 7^9, 8^6, 9^7, 10, 11^2, 12^2, 13, 14^3, 15, 19, 20^2, 24, 27, 38, 41, 47, 86, 89, 92, 98, 123, 124, 126, 131, 133, 138, 142, 148, 169, 175, 181, 185, 201, 204, 207, 214, 216, 218, 223, 225, 229, 230^2, 232^2, 234, 247^2, 254, 257, 259, 265, 295, 300, 305, 330, 444, 588, 1201]
surviving nonsolo ucounts = 43[27, 47, 86, 89, 98, 123, 124, 126, 131, 133, 138, 142, 148, 169, 175, 181, 185, 201, 204, 207, 214, 218, 223, 225, 229, 230^2, 232^2, 234, 247^2, 254, 257, 259, 265, 295, 300, 305, 330, 444, 588, 1201]
ids = [97, 664, 491, 728, 321, 242, 315, 58, 67, 370, ...]

====================================================================================

UMI info for barcode TGACGGCAGTACGTAA-1 contig 1 = ATCACATAAC...
umi ACATAACTTA = 127 reads: +436 validated
umi AGAGTCCGGG = 26 reads: -25 +300 -1 +8 -1 +5 -1 +5 -1 +5 -1 +2 -2 +3 -1 +1 -1 +1 -47 +25 non-validated
umi CATTATGGTA = 123 reads: +436 validated
umi CCTCGAACTT = 96 reads: +436 validated
umi CGGCTCATGT = 177 reads: +436 validated
umi CTGAGACTCT = 146 reads: +436 validated
umi GGACCCGGTT = 89 reads: +436 validated
umi TACACACATA = 219 reads: +436 validated
umi TGCAGGCGCG = 46 reads: +317 -2X +5 -2 +1 -1 +3 -1 +104 invalidated

UMI info for barcode TGACGGCAGTACGTAA-1 contig 2 = GCTGGGGTCT...
umi AAAAACTTCT = 226 reads: +388 validated
umi AAGTTAGACC = 128 reads: +17 -6XX +2 -6XX +2 -1XX +1 -1XX +1 -6XX +338 -7 invalidated
umi AATACACTCC = 235 reads: +388 validated
umi ACAACCCTGG = 217 reads: +388 validated
umi ACATTACTCA = 205 reads: +388 validated
umi ACCTAGCACA = 205 reads: +388 validated
umi AGGTTTACGC = 260 reads: +388 validated
umi ATAACTCCGT = 297 reads: +388 validated
umi CATAAACAGT = 137 reads: +388 validated
umi CATACCCTTA = 247 reads: +388 validated
umi CATGAACTAC = 590 reads: -199 +1 -3X +185 invalidated
umi CATGCCCGAG = 236 reads: +388 validated
umi CCCCTGGCAC = 169 reads: +388 validated
umi CCCGTCATGG = 332 reads: +388 validated
umi CCTCAACAAC = 125 reads: +388 validated
umi CGTCGTCTGT = 90 reads: -15X +2 -6XX +2 -6XX +2 -1XX +1 -1XX +1 -6XX +345 invalidated
umi CTTCTCAACA = 260 reads: +388 validated
umi GCATACCTAG = 140 reads: +388 validated
umi GCCACTACCG = 230 reads: +388 validated
umi GCGGATACAT = 185 reads: +388 validated
umi GCTTGATCGT = 224 reads: +388 validated
umi GGGTATCCTG = 265 reads: +388 validated
umi GTCCAATGTC = 231 reads: +388 validated
umi GTCGGCAGCA = 236 reads: +388 validated
umi TAAACACCCA = 254 reads: +388 validated
umi TCAGCTCCTC = 235 reads: +388 validated
umi TCTTGTTCTA = 12 reads: -259X +1 -5XX +1 -1XX +1 -10XX +2 -3XX +1 -2XX +1 -4XX +1 -1XX +48 -47 invalidated
umi TGCCGTTCCT = 305 reads: +388 validated
umi TTACGCGGTA = 202 reads: +388 validated
umi TTGCATGATA = 90 reads: +388 validated
umi TTTTAACCCT = 295 reads: +388 validated

UMI info for barcode TGACGGCAGTACGTAA-1 contig 3 = GGAGCCTGGG...
umi ACCCGGCAGA = 131 reads: +382 validated
umi ACTCGAGCCG = 1198 reads: -322X +3 -2XX +2 -3XX +1 -14XX +3 -1XX +31 invalidated
umi GCAGGCTTCA = 447 reads: +382 validated
umi GGCGTCTGTA = 245 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=676]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
416-436 ==> 0-20 on |30|IGHD5-24|D-REGION| [len=20] (mis=3)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-676 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 108 reads
cdr3 = CANQERRDGYIDYYYYGMDVW at 400, score = 9 + 7
umis assigned: [58, 97, 242, 321, 358, 409, 491, 549, 664]
of which 9 are surviving nonsolos
reads assigned: 1031
start codons at 58, 209, 256, 355, 422, 451
confident = true

TIG 2[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 29 umis using 1028 reads
cdr3 = CSSYTSSSTVVF at 365, score = 8 + 8
umis assigned: [1, 29, 31, 48, 59, 70, 118, 127, 221, 226] and 21 others
of which 30 are surviving nonsolos
reads assigned: 6758
start codons at 41, 198, 242, 249
confident = true

TIG 3[bases=635]
42-382 ==> 0-340 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=1)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 136 reads
cdr3 = CQVWDSSSALEVF at 357, score = 7 + 8
umis assigned: [67, 83, 465, 499]
of which 4 are surviving nonsolos
reads assigned: 1971
start codons at 42, 103, 147, 340
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1167 = TGACGGCAGTAGCCGA-1

using 880 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 874]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1171 = TGACGGCAGTGGACGT-1

using 293 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode TGACGGCAGTGGACGT-1 contig 1 = GATCAGGACT...
umi ACCAGATTCC = 273 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-520 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1172 = TGACGGCAGTGGGATC-1

using 307 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[307]
surviving nonsolo ucounts = 1[307]
ids = [0]

====================================================================================

UMI info for barcode TGACGGCAGTGGGATC-1 contig 1 = TGGGAGGAGT...
umi TGCCATCAAT = 248 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
37-285 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-512 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLHYDNRRRTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 37, 93, 106, 245, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1174 = TGACGGCCAAACTGCT-1

using 265 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 255]
surviving nonsolo ucounts = 1[255]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=583]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=6)
442-583 ==> 0-141 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVSELGP at 373, score = 7 + 4
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 49, 203, 206, 257, 356, 383, 407, 574
confident = false
not full
frameshifted full length transcript of length 583
VJ delta = 35
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1196 = TGACGGCCAGACACTT-1

using 319 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 311]
surviving nonsolo ucounts = 1[311]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1203 = TGACGGCCAGTACACT-1

using 453 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 180, 268]
surviving nonsolo ucounts = 2[180, 268]
ids = [2, 3]

====================================================================================

UMI info for barcode TGACGGCCAGTACACT-1 contig 1 = AGGAGTCAGA...
umi CTCCTCCCAT = 170 reads: +382 validated

UMI info for barcode TGACGGCCAGTACACT-1 contig 2 = AGTCTGGGCC...
umi TAACCTCAAC = 263 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-479 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQAKSFSF at 354, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 27, 33, 89, 102, 238, 451
confident = false

TIG 2[bases=630]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-382 ==> 0-342 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQVWDSSSDVVF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 40, 101, 239, 242, 338, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1205 = TGACGGCCAGTCCTTC-1

using 858 reads

====================================================================================

graph has 1220 edges initially, 24 edges after simplification

total ucounts = 431
nonsolo ucounts = 172[2^80, 3^39, 4^15, 5^13, 6^11, 7^4, 8^4, 9, 10, 11, 12, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1212 = TGACGGCCATGCCTTC-1

using 236 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [0]

====================================================================================

UMI info for barcode TGACGGCCATGCCTTC-1 contig 1 = GACTCCTGTG...
umi CATCGTACTA = 202 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=551]
17-375 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=20)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
453-551 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAHIVGFYFPNSGYYYFDSW at 362, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 17, 61, 240, 243, 332, 507
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1216 = TGACGGCCATTGTGCA-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1228 = TGACGGCGTAGCTCCG-1

using 178 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [1]

====================================================================================

UMI info for barcode TGACGGCGTAGCTCCG-1 contig 1 = ATCATCCAAC...
umi TTATCACATT = 160 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=589]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-589 ==> 0-101 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 58, 214, 256, 322, 355, 445, 542
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1230 = TGACGGCGTAGGACAC-1

using 285 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [7]

====================================================================================

UMI info for barcode TGACGGCGTAGGACAC-1 contig 1 = ATCAGTCCCA...
umi TTCTGACAGG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-508 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1233 = TGACGGCGTCAAAGAT-1

using 930 reads

====================================================================================

graph has 326 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[271, 287, 372]
surviving nonsolo ucounts = 2[287, 372]
ids = [2, 0]

====================================================================================

UMI info for barcode TGACGGCGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi ATCTATCCCG = 373 reads: +403 validated
umi CGTTACCGGA = 46 reads: -368 +10 -3XX +8 -1XX +5 -1XX +7 invalidated
umi GAATTACTAC = 285 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 74 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0, 1, 2]
of which 2 are surviving nonsolos
reads assigned: 699
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1235 = TGACGGCGTCATCGGC-1

using 53 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 49]
surviving nonsolo ucounts = 1[49]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1236 = TGACGGCGTCATGCCG-1

using 208 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [0]

====================================================================================

UMI info for barcode TGACGGCGTCATGCCG-1 contig 1 = AATCAGTCCC...
umi CTATGGCCGG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
374-412 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQHNSYPLTF at 351, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 24, 30, 99, 181, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1243 = TGACGGCGTGGCAAAC-1

using 368 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [1]

====================================================================================

UMI info for barcode TGACGGCGTGGCAAAC-1 contig 1 = GGGGAGGAAC...
umi TACGAAACGC = 319 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-342 ==> 0-306 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=25)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYNKWPLTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 36, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1250 = TGACGGCTCAATAAGG-1

using 234 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [3]

====================================================================================

UMI info for barcode TGACGGCTCAATAAGG-1 contig 1 = GGGGGTCTCA...
umi GTGCCACTCT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
39-391 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=22)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
427-539 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CTSYTSSGTRVF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 39, 175, 196, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1251 = TGACGGCTCACATGCA-1

using 2468 reads

====================================================================================

graph has 1516 edges initially, 30 edges after simplification

total ucounts = 491
nonsolo ucounts = 184[2^78, 3^37, 4^22, 5^18, 6^10, 7^6, 8, 9^2, 10, 11, 12, 13, 137, 194, 247, 295, 303, 366]
surviving nonsolo ucounts = 6[137, 194, 247, 295, 303, 366]
ids = [464, 68, 222, 301, 78, 141]

====================================================================================

UMI info for barcode TGACGGCTCACATGCA-1 contig 1 = AGAGCTGCTC...
umi AGCACATCGC = 195 reads: +385 validated
umi AGGATTCGCC = 305 reads: +385 validated
umi CACTAACCGC = 366 reads: +385 validated
umi CGGCGTCGCT = 245 reads: +385 validated
umi GCCCTCGTCG = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 214 reads
cdr3 = CQQYGSSPRTF at 355, score = 9 + 8
umis assigned: [68, 78, 141, 222, 301]
of which 5 are surviving nonsolos
reads assigned: 1388
start codons at 31, 239, 365, 458
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1253 = TGACGGCTCACCTCGT-1

using 207 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode TGACGGCTCACCTCGT-1 contig 1 = GCCTTAGCCC...
umi ATTGGAACAA = 198 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=522]
0-64 ==> 15-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
64-417 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
441-488 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
488-522 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 406, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 64, 215, 220, 367, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1258 = TGACGGCTCCAATGGT-1

using 300 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 292]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TGACGGCTCCAATGGT-1 contig 1 = GACTTTCTGA...
umi CCTACATACA = 273 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=512]
36-384 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
413-463 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
463-512 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARDLLWFGETRAFDIW at 381, score = 9 + 8
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 269
start codons at 36, 80, 398, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1259 = TGACGGCTCCAGAAGG-1

using 507 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[196, 309]
surviving nonsolo ucounts = 2[196, 309]
ids = [0, 1]

====================================================================================

UMI info for barcode TGACGGCTCCAGAAGG-1 contig 1 = GAGAAGAGCT...
umi CCTCATGTCA = 310 reads: +385 validated

UMI info for barcode TGACGGCTCCAGAAGG-1 contig 2 = TCACTGCCCA...
umi CCGATTTAGA = 178 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQHATSPFTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 35, 243, 369, 462
confident = false

TIG 2[bases=543]
0-49 ==> 10-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
49-402 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
421-467 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
467-543 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARPYNSYWLGFDYW at 391, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 49, 223, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1262 = TGACGGCTCCTAAGTG-1

using 180 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [2]

====================================================================================

UMI info for barcode TGACGGCTCCTAAGTG-1 contig 1 = CTCTGCTTCA...
umi TCAATAGGGC = 163 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=539]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
403-441 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
441-539 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDTSLSGSVF at 374, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 50, 204, 207, 258, 357, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1264 = TGACGGCTCCTCAATT-1

using 12887 reads

====================================================================================

graph has 5175 edges initially, 106 edges after simplification

total ucounts = 826
nonsolo ucounts = 325[2^142, 3^66, 4^23, 5^20, 6^12, 7^16, 8^2, 9^5, 10^2, 11^2, 12, 13, 17, 18, 66, 79, 150, 179, 207, 208, 210, 235, 240, 242, 246, 248, 266, 269, 282^2, 283, 284, 288, 307, 310, 313, 324, 330, 360, 362, 545, 690, 829, 1102, 1629]
surviving nonsolo ucounts = 31[66, 79, 150, 179, 207, 208, 210, 235, 240, 242, 246, 248, 266, 269, 282^2, 283, 284, 288, 307, 310, 313, 324, 330, 360, 362, 545, 690, 829, 1102, 1629]
ids = [6, 507, 488, 14, 455, 370, 81, 347, 417, 419, ...]

====================================================================================

UMI info for barcode TGACGGCTCCTCAATT-1 contig 1 = TCTGGCACCA...
umi AAACTTGCAA = 65 reads: -349X +1 -4XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi AACACACGCT = 172 reads: +388 validated
umi ACGGGCTATA = 213 reads: +388 validated
umi ATCGTAATGG = 254 reads: +388 validated
umi ATTTTACCCC = 557 reads: -354 +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CAGTCCTAGC = 308 reads: +388 validated
umi CATTACATAC = 1706 reads: -349X +1 -4XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CCGTCACTCG = 312 reads: -11X +1 -6X +370 invalidated
umi CGTAGTTCGG = 251 reads: +388 validated
umi CTTCACCCGG = 241 reads: +388 validated
umi CTTCCACGCA = 246 reads: +388 validated
umi GAACCTACGA = 859 reads: -349X +2 -3X +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi GATCTCTTCG = 205 reads: +388 validated
umi GATTAGACTC = 264 reads: +388 validated
umi GTAAAGCGAA = 365 reads: +388 validated
umi GTCATTTCCA = 359 reads: +388 validated
umi GTTAGACACA = 285 reads: +388 validated
umi TCAATCCTTG = 1101 reads: -231X +157 invalidated
umi TCGTGGACAA = 249 reads: +388 validated
umi TCTACAATGT = 286 reads: +388 validated
umi TTACACTTCG = 272 reads: +388 validated
umi TTATATCCCG = 283 reads: +388 validated
umi TTTTTTTAAC = 283 reads: +388 validated

UMI info for barcode TGACGGCTCCTCAATT-1 contig 2 = GGTGATCAGG...
umi AAGCCGACTA = 275 reads: +445 validated
umi AATTTGTGTT = 331 reads: +445 validated
umi CTAGCTTGTC = 206 reads: +445 validated
umi GCGTCGGTTG = 151 reads: +445 validated
umi GGCAGGAGTG = 77 reads: +445 validated
umi GTAACATTGT = 260 reads: +445 validated
umi TGTAATATTC = 32 reads: -400X +1 -4X +1 -1X +1 -2X +9 -1XX +2 -1XX +3 -2XX +17 invalidated

GOOD CONTIGS

TIG 1[bases=633]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 19 umis using 1032 reads
cdr3 = CLLSYSGARNVF at 358, score = 8 + 8
umis assigned: [6, 14, 81, 151, 183, 223, 245, 296, 347, 417] and 13 others
of which 23 are surviving nonsolos
reads assigned: 8814
start codons at 34, 242, 341, 386, 554
confident = true

TIG 2[bases=578]
0-31 ==> 48-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
31-384 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
393-415 ==> 0-22 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
413-476 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
476-578 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 99 reads
cdr3 = CAKIGKTYYDFWSGPYYYYGMDVW at 373, score = 9 + 7
umis assigned: [26, 48, 370, 488, 507, 535, 741]
of which 7 are surviving nonsolos
reads assigned: 1303
start codons at 31, 182, 187, 334, 433, 494, 555
confident = true

REJECT CONTIGS

TIG 1[bases=316]
16-73 ==> 296-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
122-156 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
156-316 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 62, score = 7 + 7
umis assigned: [281]
of which 1 are surviving nonsolos
reads assigned: 685
start codons at 17, 210
confident = false
VJ delta = 6
not full
not full
now this is a cell
paired!

GCGAAGATTGGTAAAACGTATTACGATTTTTGGAGTGGTCCGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGGAATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1278 = TGACGGCTCTCGTTTA-1

using 232 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 226]
surviving nonsolo ucounts = 1[226]
ids = [4]

====================================================================================

UMI info for barcode TGACGGCTCTCGTTTA-1 contig 1 = TCTCAGGAGG...
umi TCCATTCCTG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
34-385 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
422-518 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSYTSSSTRVF at 358, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 34, 191, 235, 242, 245
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1280 = TGACGGCTCTGAGTGT-1

using 401 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 393]
surviving nonsolo ucounts = 1[393]
ids = [6]

====================================================================================

UMI info for barcode TGACGGCTCTGAGTGT-1 contig 1 = GAGGAACTGC...
umi GCGTCATATA = 394 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQQYNNWPRYTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 388
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1287 = TGACTAGAGACTACAA-1

using 298 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 291]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1291 = TGACTAGAGAGGACGG-1

using 281 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 270]
surviving nonsolo ucounts = 1[270]
ids = [8]

====================================================================================

UMI info for barcode TGACTAGAGAGGACGG-1 contig 1 = AGTCAGACCC...
umi TTTTAGGCGC = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-24 ==> 157-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
24-377 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=5)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-487 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYYSFPWTF at 351, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 24, 30, 86, 99, 162, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1296 = TGACTAGAGCTAACAA-1

using 867 reads

====================================================================================

graph has 1134 edges initially, 14 edges after simplification

total ucounts = 309
nonsolo ucounts = 149[2^52, 3^34, 4^21, 5^16, 6^7, 7^9, 8^2, 9^2, 10, 11^2, 12^2, 142]
surviving nonsolo ucounts = 1[142]
ids = [270]

====================================================================================

UMI info for barcode TGACTAGAGCTAACAA-1 contig 1 = CTCAGGAAGC...
umi TCTACATCAG = 131 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=495]
0-31 ==> 55-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
31-384 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-495 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSNQAVF at 358, score = 6 + 8
umis assigned: [270]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 31, 94, 185, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1300 = TGACTAGAGGCTAGCA-1

using 203 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 192]
surviving nonsolo ucounts = 1[192]
ids = [3]

====================================================================================

UMI info for barcode TGACTAGAGGCTAGCA-1 contig 1 = GGGGCTTTCT...
umi GATCCAAACC = 188 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=524]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=20)
412-462 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
462-524 ==> 0-62 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARYNLLTGHDAFDIW at 383, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 17, 26, 38, 82, 251, 260, 414, 443, 516
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1315 = TGACTAGCAAAGCAAT-1

using 7201 reads

====================================================================================

graph has 7037 edges initially, 128 edges after simplification

total ucounts = 1210
nonsolo ucounts = 930[2^105, 3^103, 4^99, 5^80, 6^84, 7^69, 8^74, 9^53, 10^53, 11^37, 12^30, 13^40, 14^20, 15^18, 16^19, 17^12, 18^13, 19^11, 20^4, 21^2, 24^2, 30, 32]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1320 = TGACTAGCAAGCCTAT-1

using 184 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[3^2, 4^2, 5, 161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=492]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
0-79 ==> 7407-7486 on rc of segment before IGHV1-24 exon 2 [len=7486] (mis=0)
43-90 ==> 3154-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=6)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=9)
449-492 ==> 0-43 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
cdr3 = CAKDRLPTRTAFDYW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 79, 230, 235, 382
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1330 = TGACTAGCACCCTATC-1

using 265 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

UMI info for barcode TGACTAGCACCCTATC-1 contig 1 = CCCTAGATCA...
umi GACTACCTCC = 243 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=494]
0-22 ==> 37-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
22-375 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=10)
382-400 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=3)
398-449 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
449-494 ==> 0-45 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARSGPQYSTSSGWFDPW at 364, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 22, 173, 220, 225, 242, 257, 286, 319
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1331 = TGACTAGCACCGCTAG-1

using 357 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 351]
surviving nonsolo ucounts = 1[351]
ids = [5]

====================================================================================

UMI info for barcode TGACTAGCACCGCTAG-1 contig 1 = AGGCCCCTCC...
umi GCGTGTAATG = 343 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=529]
0-93 ==> 82-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
93-456 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
454-493 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
493-529 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYYSTPYTF at 432, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 93, 162, 415
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1337 = TGACTAGCAGCTTAAC-1

using 179 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================

UMI info for barcode TGACTAGCAGCTTAAC-1 contig 1 = GGGTCTCAGG...
umi ACATTGGGCA = 165 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=491]
37-398 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
431-491 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CSSYTSSSTLGVVF at 361, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 37, 194, 238, 245, 248
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1339 = TGACTAGCAGGATCGA-1

using 316 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 5, 305]
surviving nonsolo ucounts = 1[305]
ids = [5]

====================================================================================

UMI info for barcode TGACTAGCAGGATCGA-1 contig 1 = AGAGCTCTGG...
umi TCTCTAACGT = 303 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPRTF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1351 = TGACTAGCATAGGATA-1

using 1058 reads

====================================================================================

graph has 1435 edges initially, 16 edges after simplification

total ucounts = 424
nonsolo ucounts = 227[2^82, 3^59, 4^35, 5^15, 6^11, 7^9, 8^9, 9^2, 10, 13^2, 21, 29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1358 = TGACTAGCATGCCTAA-1

using 574 reads

====================================================================================

graph has 256 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3^2, 8, 239, 316]
surviving nonsolo ucounts = 2[239, 316]
ids = [5, 7]

====================================================================================

UMI info for barcode TGACTAGCATGCCTAA-1 contig 1 = GAGTCAGACT...
umi TGACTAGCCT = 322 reads: +388 validated

UMI info for barcode TGACTAGCATGCCTAA-1 contig 2 = GAGCTACAAC...
umi TATGACCCTG = 239 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1361 = TGACTAGGTAAACACA-1

using 48 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 39]
surviving nonsolo ucounts = 1[39]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1372 = TGACTAGGTATCGCAT-1

using 10894 reads

====================================================================================

graph has 7462 edges initially, 52 edges after simplification

total ucounts = 1533
nonsolo ucounts = 728[2^265, 3^163, 4^101, 5^66, 6^39, 7^23, 8^14, 9^14, 10^5, 11^4, 12^3, 13^2, 14, 20, 23, 24, 104, 120, 127, 173, 196, 201^2, 231, 241, 245, 275, 290, 301, 308, 310, 316, 333, 337, 348, 361, 364, 392, 525, 556, 611]
surviving nonsolo ucounts = 27[4, 23, 104, 120, 127, 173, 196, 201^2, 231, 241, 245, 275, 290, 301, 308, 310, 316, 333, 337, 348, 361, 364, 392, 525, 556, 611]
ids = [1305, 627, 192, 529, 80, 894, 1222, 48, 274, 1160, ...]

====================================================================================

UMI info for barcode TGACTAGGTATCGCAT-1 contig 1 = AGGAGTCAGA...
umi AACTGTACGT = 199 reads: +382 validated
umi ACCAATTCTA = 557 reads: +382 validated
umi ACTTTGATGA = 105 reads: +382 validated
umi AGCTGTCTTT = 353 reads: +382 validated
umi ATCACGTCCT = 202 reads: +382 validated
umi ATCGCACCTC = 277 reads: +382 validated
umi ATGTGTCCTA = 363 reads: +382 validated
umi CCCATGACTC = 361 reads: +382 validated
umi CCCGTCTCAA = 310 reads: +382 validated
umi CCTCGGCTCT = 120 reads: +382 validated
umi CTTTAAGTAA = 303 reads: +382 validated
umi GGATGTTGTC = 176 reads: +382 validated
umi GGCTCAGTAT = 286 reads: +382 validated
umi GTGCGGTCGG = 246 reads: +382 validated
umi TAGTTAGTCG = 528 reads: +382 validated
umi TCACACATGG = 232 reads: +382 validated
umi TCGATCGGCA = 196 reads: +382 validated
umi TGGTATATGG = 391 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=545]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 759 reads
cdr3 = CQQAKSFSF at 354, score = 9 + 7
umis assigned: [48, 117, 192, 220, 274, 289, 320, 477, 489, 529] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5122
start codons at 27, 33, 89, 102, 238, 451
confident = true

REJECT CONTIGS

TIG 1[bases=560]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-192 ==> 0-162 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4)
192-383 ==> 169-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=5) [SHIFT!]
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [80, 247, 248, 643, 1042]
of which 5 are surviving nonsolos
reads assigned: 1709
start codons at 30, 63, 91, 99, 187, 342, 362, 466
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1375 = TGACTAGGTCAAAGAT-1

using 201 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [0]

====================================================================================

UMI info for barcode TGACTAGGTCAAAGAT-1 contig 1 = ACCATCACAC...
umi ACGGCAACGT = 201 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=559]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
469-559 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1378 = TGACTAGGTCCCGACA-1

using 199 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[196]
surviving nonsolo ucounts = 1[196]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1380 = TGACTAGGTCGACTAT-1

using 164 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================

UMI info for barcode TGACTAGGTCGACTAT-1 contig 1 = GAGTCAGTCT...
umi TTCTGAGGCA = 157 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=552]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYSTPRYTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 25, 31, 87, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1389 = TGACTAGGTTACGCGC-1

using 1346 reads

====================================================================================

graph has 942 edges initially, 8 edges after simplification

total ucounts = 238
nonsolo ucounts = 90[2^41, 3^15, 4^14, 5^6, 6^3, 7^2, 8^3, 9^2, 10, 18, 215, 668]
surviving nonsolo ucounts = 3[18, 215, 668]
ids = [92, 66, 215]

====================================================================================

UMI info for barcode TGACTAGGTTACGCGC-1 contig 1 = GAGTCAGTCT...
umi ATAGCTCAGT = 217 reads: +388 validated
umi CAGATTTGGG = 16 reads: -388 non-validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=25)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYGTPWTF at 352, score = 9 + 8
umis assigned: [66, 92]
of which 2 are surviving nonsolos
reads assigned: 228
start codons at 25, 31, 87, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1394 = TGACTAGGTTCGCTAA-1

using 267 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [1]

====================================================================================

UMI info for barcode TGACTAGGTTCGCTAA-1 contig 1 = GGAGAAGAGC...
umi TAGTACGTTT = 266 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPRTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1398 = TGACTAGGTTTGTTTC-1

using 1018 reads

====================================================================================

graph has 325 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2, 3, 4, 6, 220, 252, 520]
surviving nonsolo ucounts = 3[220, 252, 520]
ids = [9, 5, 1]

====================================================================================

UMI info for barcode TGACTAGGTTTGTTTC-1 contig 1 = GCAGGAGTCA...
umi ATTAAGCTAG = 487 reads: +388 validated
umi GCCTAGCCCT = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-512 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 116 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 712
start codons at 29, 35, 91, 104, 186, 189, 459
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1406 = TGACTAGTCAGTGTTG-1

using 190 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 178]
surviving nonsolo ucounts = 1[178]
ids = [6]

====================================================================================

UMI info for barcode TGACTAGTCAGTGTTG-1 contig 1 = AGTCTGGGCC...
umi TCAGTGTGGC = 166 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=492]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-492 ==> 0-70 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1413 = TGACTAGTCCACTCCA-1

using 252 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode TGACTAGTCCACTCCA-1 contig 1 = AGTGCTTTCT...
umi CCTCCTCAGT = 233 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=568]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-568 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_99.1413_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1417 = TGACTAGTCCCAGGTG-1

using 89 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[86]
surviving nonsolo ucounts = 1[86]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1419 = TGACTAGTCCGAACGC-1

using 248 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [5]

====================================================================================

UMI info for barcode TGACTAGTCCGAACGC-1 contig 1 = CTTTCTGAGA...
umi TCATCCTCTG = 233 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=503]
13-384 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
401-449 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
449-503 ==> 0-54 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARAHGDYYTLLDYW at 373, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 13, 34, 78, 164, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1422 = TGACTAGTCGAATGGG-1

using 238 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [0]

====================================================================================

UMI info for barcode TGACTAGTCGAATGGG-1 contig 1 = GAAGAGCTGC...
umi ACTTGATAGT = 240 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1426 = TGACTAGTCGTGACAT-1

using 205 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 197]
surviving nonsolo ucounts = 1[197]
ids = [4]

====================================================================================

UMI info for barcode TGACTAGTCGTGACAT-1 contig 1 = GATCAGGACT...
umi GTTCCTGTCC = 197 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CMQALQTPFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1427 = TGACTAGTCTAACTTC-1

using 318 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 308]
surviving nonsolo ucounts = 1[308]
ids = [4]

====================================================================================

UMI info for barcode TGACTAGTCTAACTTC-1 contig 1 = GGAGGAACTG...
umi GACACTATCA = 288 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=509]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-509 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNWPPYTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1439 = TGACTAGTCTTGCATT-1

using 34 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 1[25]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1443 = TGACTTTAGACAATAC-1

using 292 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 9[2^2, 3, 4, 5^2, 6, 8, 244]
surviving nonsolo ucounts = 1[244]
ids = [5]

====================================================================================

UMI info for barcode TGACTTTAGACAATAC-1 contig 1 = GAATCAGTCC...
umi CATTTACCAT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1446 = TGACTTTAGAGGACGG-1

using 187 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 4, 172]
surviving nonsolo ucounts = 1[172]
ids = [5]

====================================================================================

UMI info for barcode TGACTTTAGAGGACGG-1 contig 1 = TGAGCGCAGA...
umi CGGTCTCTGA = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
424-521 ==> 0-97 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1447 = TGACTTTAGAGTCGGT-1

using 203 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3^2, 4, 184]
surviving nonsolo ucounts = 1[184]
ids = [2]

====================================================================================

UMI info for barcode TGACTTTAGAGTCGGT-1 contig 1 = GGCTGGGGTC...
umi CAGCTTCATC = 178 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=503]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=9)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
433-503 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CCSYAGSYKYMLF at 366, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 42, 181, 250, 253, 349, 376, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1451 = TGACTTTAGATCCGAG-1

using 250 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 238]
surviving nonsolo ucounts = 1[238]
ids = [2]

====================================================================================

UMI info for barcode TGACTTTAGATCCGAG-1 contig 1 = AGGAGTCAGA...
umi CACTGGCACT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-488 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1454 = TGACTTTAGCATGGCA-1

using 669 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^4, 284, 368]
surviving nonsolo ucounts = 2[284, 368]
ids = [0, 7]

====================================================================================

UMI info for barcode TGACTTTAGCATGGCA-1 contig 1 = GCTCTGCTTC...
umi AAGATTCGGA = 276 reads: +394 validated

UMI info for barcode TGACTTTAGCATGGCA-1 contig 2 = GTCAGACCCT...
umi GATAACTCTG = 370 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1459 = TGACTTTAGCTGATAA-1

using 72 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 4[2^3, 54]
surviving nonsolo ucounts = 1[54]
ids = [13]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1462 = TGACTTTAGCTTCGCG-1

using 217 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3, 5, 9, 193]
surviving nonsolo ucounts = 1[193]
ids = [2]

====================================================================================

UMI info for barcode TGACTTTAGCTTCGCG-1 contig 1 = GAAGAGCTGC...
umi CGAAAGGTAG = 182 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1481 = TGACTTTAGTTATCGC-1

using 33 reads

====================================================================================

graph has 44 edges initially, 6 edges after simplification

total ucounts = 19
nonsolo ucounts = 7[2^3, 3, 4^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1489 = TGACTTTCAAGCTGTT-1

using 2351 reads

====================================================================================

graph has 3090 edges initially, 94 edges after simplification

total ucounts = 1121
nonsolo ucounts = 492[2^233, 3^98, 4^53, 5^38, 6^25, 7^16, 8^10, 9^5, 10^4, 11^4, 14^2, 15^3, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1491 = TGACTTTCAATAAGCA-1

using 321 reads

====================================================================================

graph has 128 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^5, 5, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode TGACTTTCAATAAGCA-1 contig 1 = GGAGAAGAGC...
umi CCCAGGCCAG = 279 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=515]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-515 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPITF at 360, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1495 = TGACTTTCACAACGCC-1

using 7714 reads

====================================================================================

graph has 3126 edges initially, 80 edges after simplification

total ucounts = 307
nonsolo ucounts = 153[2^56, 3^26, 4^23, 5^8, 6^4, 7^3, 8^3, 9, 10, 14^2, 25, 93, 111, 115, 117, 155, 165, 179, 190, 195, 216, 220, 228, 242, 252, 257, 282, 310, 323, 330, 354, 388, 416, 494, 625, 840]
surviving nonsolo ucounts = 23[111, 115, 117, 165, 179, 190, 195, 216, 220, 228, 242, 252, 257, 282, 310, 323, 330, 354, 388, 416, 494, 625, 840]
ids = [76, 223, 300, 172, 95, 253, 150, 151, 142, 203, ...]

====================================================================================

UMI info for barcode TGACTTTCACAACGCC-1 contig 1 = AGATCTCAGA...
umi ACCGGACTTC = 309 reads: +406 validated
umi ACTCCACTTT = 337 reads: +406 validated
umi AGATCGTCCA = 241 reads: +406 validated
umi ATACCTACAG = 326 reads: +406 validated
umi ATGCAAGGTC = 110 reads: +406 validated
umi CACGTACGTT = 180 reads: +406 validated
umi CTCTGTCCCT = 217 reads: +406 validated
umi GCAACGTCCA = 162 reads: +406 validated
umi GGTTTACAAT = 229 reads: +406 validated
umi TAAAACCGTT = 118 reads: +406 validated
umi TATCTTGGCC = 243 reads: +406 validated
umi TTTGCTGCCA = 107 reads: +406 validated

UMI info for barcode TGACTTTCACAACGCC-1 contig 2 = GCTGGGGTCT...
umi AATTTAACCC = 329 reads: +388 validated
umi ACAACGCCCT = 285 reads: +388 validated
umi CTTTATATGT = 199 reads: +388 validated
umi CTTTCCTACA = 211 reads: +388 validated
umi GACTTCTCTA = 637 reads: -354X +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi GTAAATAGTA = 258 reads: +388 validated
umi TAAAGGCTTC = 44 reads: +17 -1XX +7 -1XX +14 -1XX +37 -1XX +6 -1XX +3 -1XX +17 -2XX +21 -1XX +1 -1XX +8 -1XX +4 -3XX +2 -1XX +1 -1XX +1 -3XX +3 -227 invalidated
umi TCCCTTACAG = 186 reads: +388 validated
umi TTAGACCTGT = 831 reads: -354X +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated

GOOD CONTIGS

TIG 1[bases=556]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=3)
449-485 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 199 reads
cdr3 = CARDRSTSRHW at 421, score = 9 + 7
umis assigned: [40, 50, 56, 67, 76, 95, 142, 172, 203, 223] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2521
start codons at 79, 235, 296, 314, 382
confident = true

TIG 2[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
429-640 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 6 umis using 234 reads
cdr3 = CSSYAGSNNYVF at 365, score = 8 + 8
umis assigned: [27, 28, 150, 151, 162, 205, 224, 253, 282]
of which 8 are surviving nonsolos
reads assigned: 2901
start codons at 41, 198, 242, 249, 348, 375, 393
confident = true

REJECT CONTIGS

TIG 1[bases=555]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
44-382 ==> 0-338 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [70, 124]
of which 2 are surviving nonsolos
reads assigned: 792
start codons at 44, 252, 378, 461
confident = false
did not find CDR3

TIG 2[bases=343]
5-194 ==> 296-485 on rc of segment before IGHD6-25 exon 1 [len=485] (mis=0)
209-272 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
272-343 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 491
start codons at 8, 229
confident = false
did not find CDR3
now this is a cell
paired!

AACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGGGATAGGAGTACCAGCCGACACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1499 = TGACTTTCACCAGCAC-1

using 144 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[141]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1501 = TGACTTTCACCAGTTA-1

using 17 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1508 = TGACTTTCACGGCCAT-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1509 = TGACTTTCACGGCTAC-1

using 7225 reads

====================================================================================

graph has 3768 edges initially, 40 edges after simplification

total ucounts = 811
nonsolo ucounts = 347[2^137, 3^68, 4^45, 5^20, 6^23, 7^10, 8, 9^3, 10, 11, 12^3, 13^2, 14, 15, 16, 24, 66, 117, 132, 143, 154, 157, 165, 167, 172, 174^2, 183, 186, 189, 194^2, 207, 209, 210, 214^2, 227, 239, 243^2, 247, 257, 265, 266]
surviving nonsolo ucounts = 31[13, 14, 16, 24, 66, 117, 154, 157, 165, 167, 172, 174^2, 183, 186, 189, 194^2, 207, 209, 210, 214^2, 227, 239, 243^2, 247, 257, 265, 266]
ids = [364, 156, 256, 62, 401, 100, 303, 46, 535, 712, ...]

====================================================================================

UMI info for barcode TGACTTTCACGGCTAC-1 contig 1 = TGAGCGCAGA...
umi AAAGAAATGC = 235 reads: +391 validated
umi AAATAGTCCA = 207 reads: +391 validated
umi AACGGGATGG = 246 reads: +391 validated
umi AAGCTAATAA = 201 reads: -7 +1 -2X +1 -5XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +348 invalidated
umi AAGTGACGGA = 173 reads: +391 validated
umi AATTATGGGC = 158 reads: +391 validated
umi ACTGATCTCT = 132 reads: +35 -1XX +1 -6XX +314 -34 invalidated
umi ACTGCATCCG = 87 reads: +21 -1X +1 -2X +10 -1X +1 -6XX +348 invalidated
umi ACTGTCGCCC = 199 reads: +276 -1 +1 -3XX +1 -3XX +106 invalidated
umi AGCAATCAAA = 269 reads: +391 validated
umi ATTGTGTCGT = 212 reads: +391 validated
umi CATCCCCATC = 265 reads: +391 validated
umi CCGCTTCATA = 152 reads: +391 validated
umi CTAGGTTAAG = 185 reads: +391 validated
umi CTTGGAACTG = 66 reads: +391 validated
umi GAAATCGCAT = 135 reads: +26 -1 +2 -1 +3 -1X +1 -1X +1 -6XX +348 invalidated
umi GACCAAAACC = 168 reads: +391 validated
umi GTAACGGGCA = 165 reads: +391 validated
umi GTCCAACCGG = 215 reads: +391 validated
umi TACATTCATA = 258 reads: +391 validated
umi TATCCACTCT = 191 reads: +391 validated
umi TATCGCCTGC = 248 reads: +391 validated
umi TTGCATTTCT = 241 reads: +391 validated

UMI info for barcode TGACTTTCACGGCTAC-1 contig 2 = CCACATCCCT...
umi ACATTTTGCA = 20 reads: -7 +174 -1X +108 -19 +56 -62 invalidated
umi AGACAGCCTT = 181 reads: +427 validated
umi ATAAAAGGAC = 13 reads: +24 -38 +225 -22 +56 -18 +44 non-validated
umi CACTCTGTAA = 14 reads: -6 +239 -23 +56 -103 non-validated
umi CTACACGACA = 11 reads: -77 +100 -5 +64 -1 +110 -17 +17 -1 +35 non-validated
umi TGCGCCATCA = 149 reads: +427 validated
umi TTTCAGCCCT = 159 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=638]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 549 reads
cdr3 = CGTWDSSLSAYWVF at 357, score = 7 + 8
umis assigned: [5, 7, 24, 30, 32, 46, 99, 100, 101, 116] and 13 others
of which 23 are surviving nonsolos
reads assigned: 4338
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=526]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=2)
392-414 ==> 0-22 on |21|IGHD3-3|D-REGION| [len=31] (mis=2)
418-469 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
469-526 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 55 reads
cdr3 = CASNYDFWSGTNYGMDVW at 384, score = 9 + 7
umis assigned: [62, 110, 156, 256, 364, 712, 796]
of which 7 are surviving nonsolos
reads assigned: 538
start codons at 42, 193, 198, 240, 245, 262, 339, 426, 487
confident = true
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGCAATTACGATTTTTGGAGTGGTACCAACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCCTATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1512 = TGACTTTCACTTGGAT-1

using 358 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 351]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1513 = TGACTTTCAGACACTT-1

using 218 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

UMI info for barcode TGACTTTCAGACACTT-1 contig 1 = GGGGTCACAA...
umi AAGTCCTCTT = 206 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=564]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-564 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1521 = TGACTTTCAGGTTTCA-1

using 3065 reads

====================================================================================

graph has 3054 edges initially, 22 edges after simplification

total ucounts = 910
nonsolo ucounts = 455[2^204, 3^103, 4^55, 5^36, 6^24, 7^13, 8^7, 9^2, 10^2, 11^2, 12^2, 16, 18, 28, 246, 809]
surviving nonsolo ucounts = 2[246, 809]
ids = [298, 763]

====================================================================================

UMI info for barcode TGACTTTCAGGTTTCA-1 contig 1 = ATACTTTCTG...
umi CCATCGGAGG = 205 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=484]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=5)
422-461 ==> 7-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
461-484 ==> 0-23 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARARRPNSSSWPTPYYW at 376, score = 9 + 7
umis assigned: [298]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 37, 81
confident = false

REJECT CONTIGS

TIG 1[bases=329]
0-108 ==> 5669-5777 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=5)
20-74 ==> 0-54 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=0)
23-114 ==> 0-91 on segment before IGKV1D-37 exon 2 [len=176] (mis=1)
109-194 ==> 54-139 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=5) [SHIFT!]
193-329 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [763]
of which 1 are surviving nonsolos
reads assigned: 798
start codons at 20, 26, 117, 235
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1523 = TGACTTTCAGTCTTCC-1

using 315 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 4, 298]
surviving nonsolo ucounts = 1[298]
ids = [9]

====================================================================================

UMI info for barcode TGACTTTCAGTCTTCC-1 contig 1 = GTCAGTCTCA...
umi TTTCCTTTTT = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
411-469 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSNTSPRTF at 350, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1525 = TGACTTTCATACTCTT-1

using 689 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 27
nonsolo ucounts = 8[2^3, 3^2, 4, 5, 649]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1537 = TGACTTTGTAAGTAGT-1

using 330 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 2[2, 318]
surviving nonsolo ucounts = 1[318]
ids = [1]

====================================================================================

UMI info for barcode TGACTTTGTAAGTAGT-1 contig 1 = GAATCAGTCC...
umi ATTTTTCACG = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1545 = TGACTTTGTCAAGCGA-1

using 234 reads

====================================================================================

graph has 159 edges initially, 2 edges after simplification

total ucounts = 33
nonsolo ucounts = 14[2^7, 3^3, 4^2, 5, 179]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1552 = TGACTTTGTCCCTACT-1

using 25 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^6, 3^2, 4]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1554 = TGACTTTGTCGTTGTA-1

using 458 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 446]
surviving nonsolo ucounts = 1[446]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=638]
0-81 ==> 11262-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 35, 96, 165, 183, 234, 296, 333, 391, 559
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1555 = TGACTTTGTCTAAACC-1

using 31 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 8[2^4, 3^4]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1559 = TGACTTTGTCTCCATC-1

using 297 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 12, 281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=628]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-354 ==> 0-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=15)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 46, 257, 350
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1565 = TGACTTTGTGGACGAT-1

using 3617 reads

====================================================================================

graph has 4556 edges initially, 74 edges after simplification

total ucounts = 1536
nonsolo ucounts = 717[2^274, 3^158, 4^76, 5^74, 6^43, 7^29, 8^21, 9^14, 10^7, 11^6, 12^5, 13^3, 14^2, 15^2, 16, 18, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1572 = TGACTTTGTTACGGAG-1

using 276 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[6, 39, 230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode TGACTTTGTTACGGAG-1 contig 1 = GGAAACAGAG...
umi GCGTATTGCG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-527 ==> 0-100 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CSSWDSSLSAWVF at 360, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 39, 178, 250, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1585 = TGACTTTTCAAGATCC-1

using 699 reads

====================================================================================

graph has 294 edges initially, 30 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^2, 10, 285, 390]
surviving nonsolo ucounts = 2[285, 390]
ids = [9, 10]

====================================================================================

UMI info for barcode TGACTTTTCAAGATCC-1 contig 1 = GAATCAGTCC...
umi TACGCGGCTC = 286 reads: +388 validated

UMI info for barcode TGACTTTTCAAGATCC-1 contig 2 = AGTCCCAACC...
umi TGCCAACGTT = 390 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=20)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQFDNLPVTF at 347, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 20, 26, 82, 95, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1591 = TGACTTTTCACGCGGT-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1597 = TGACTTTTCATGTAGC-1

using 321 reads

====================================================================================

graph has 124 edges initially, 6 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^3, 3, 4, 6, 8, 75, 212]
surviving nonsolo ucounts = 2[75, 212]
ids = [13, 0]

====================================================================================

UMI info for barcode TGACTTTTCATGTAGC-1 contig 1 = AGCTCTGAGA...
umi GCGCCCTTTT = 75 reads: +424 validated

UMI info for barcode TGACTTTTCATGTAGC-1 contig 2 = AGCTTCAGCT...
umi AAAAACGCAA = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 7 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 75
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=495]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-495 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1599 = TGACTTTTCCAATGGT-1

using 1317 reads

====================================================================================

graph has 671 edges initially, 18 edges after simplification

total ucounts = 101
nonsolo ucounts = 50[2^22, 3^11, 4^5, 5^3, 6, 8, 21, 98, 122, 132, 247, 251, 269]
surviving nonsolo ucounts = 6[21, 98, 132, 247, 251, 269]
ids = [84, 15, 61, 67, 89, 63]

====================================================================================

UMI info for barcode TGACTTTTCCAATGGT-1 contig 1 = ACAACCACAT...
umi AGTAAGACAC = 96 reads: +442 validated
umi GTTAGTAGGG = 268 reads: +442 validated
umi TCTAAATCGT = 89 reads: +17 -2XX +4 -1XX +2 -2XX +13 -1XX +7 -1XX +3 -1XX +8 -1XX +17 -1XX +21 -1XX +4 -1XX +26 -3XX +6 -1XX +1 -1XX +8 -1XX +49 -1XX +6 -1XX +1 -1XX +2 -2XX +1 -2XX +5 -3XX +7 -1XX +2 -9 +15 -1XX +2 -1XX +3 -1XX +1 -1XX +3 -2XX +30 -1XX +14 -1XX +32 -4XX +2 -9XX +1 -7XX +1 -7X +2 -23X +4 -1X +2 -1X +3 -2X +2 -1 +14 invalidated
umi TGGAATTCTG = 19 reads: +38 -27 +256 -4 +60 -57 non-validated
umi TTCACTTGTC = 232 reads: +427 -15 non-validated

UMI info for barcode TGACTTTTCCAATGGT-1 contig 2 = TGAGCGCAGA...
umi GTGAGATGTA = 11 reads: -326X +1 -3XX +1 -3XX +1 -1XX +1 -3XX +1 -1XX +2 -5XX +3 -1XX +3 -1XX +31 invalidated
umi TACAGTTTTC = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-50 ==> 8-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
50-403 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
409-440 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=8)
429-492 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 23 reads
cdr3 = CAREVIAHYDSSGYSGYYGMDVW at 392, score = 9 + 7
umis assigned: [15, 63, 78, 84, 89]
of which 4 are surviving nonsolos
reads assigned: 697
start codons at 50, 201, 248, 347, 417, 449
confident = true

TIG 2[bases=556]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-556 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CGTWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [61, 67]
of which 2 are surviving nonsolos
reads assigned: 253
start codons at 36, 190, 241, 365
confident = true
now this is a cell
paired!

TGTGCGAGAGAGGTCATCGCGCACTATGATAGTAGTGGTTATTCCGGCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1603 = TGACTTTTCCGATATG-1

using 345 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 4, 6, 325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode TGACTTTTCCGATATG-1 contig 1 = GGAGGAACTG...
umi AACACCTCGG = 331 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPLLTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1615 = TGACTTTTCGGAGCAA-1

using 559 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[2^6, 3^2, 4, 5, 6, 521]
surviving nonsolo ucounts = 1[521]
ids = [15]

====================================================================================

REJECT CONTIGS

TIG 1[bases=590]
0-343 ==> 9-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
341-379 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
379-590 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSSWDSSLSAWVF at 312, score = 7 + 8
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 507
start codons at 130, 202, 320
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1619 = TGACTTTTCTCAAACG-1

using 43 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2^2, 4, 5, 6^2, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1628 = TGACTTTTCTTGGGTA-1

using 37 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^2, 3, 4, 7, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1631 = TGAGAGGAGAAACCTA-1

using 827 reads

====================================================================================

graph has 337 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[3, 4, 6, 234, 259, 315]
surviving nonsolo ucounts = 3[234, 259, 315]
ids = [7, 4, 9]

====================================================================================

UMI info for barcode TGAGAGGAGAAACCTA-1 contig 1 = ACCCAAAAAC...
umi CTCGTCGCGA = 257 reads: +436 validated

UMI info for barcode TGAGAGGAGAAACCTA-1 contig 2 = GCTGTGCTGT...
umi GTACGCCTTT = 227 reads: +382 validated

UMI info for barcode TGAGAGGAGAAACCTA-1 contig 3 = GTCAGACCCT...
umi TCCTGGACTC = 318 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=533]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-533 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=513]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-513 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 43, 104, 173, 191, 386
confident = false

TIG 3[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1641 = TGAGAGGAGAGGTAGA-1

using 268 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 262]
surviving nonsolo ucounts = 1[262]
ids = [3]

====================================================================================

UMI info for barcode TGAGAGGAGAGGTAGA-1 contig 1 = GTCAGACTCA...
umi TTTTGTTTCA = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1642 = TGAGAGGAGATCCCGC-1

using 908 reads

====================================================================================

graph has 337 edges initially, 42 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[265, 639]
surviving nonsolo ucounts = 2[265, 639]
ids = [2, 3]

====================================================================================

UMI info for barcode TGAGAGGAGATCCCGC-1 contig 1 = AGTCCCAACC...
umi ACACTAGGGA = 266 reads: +391 validated

UMI info for barcode TGAGAGGAGATCCCGC-1 contig 2 = TGGGAGTCTC...
umi ATAGTACCTC = 637 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDNLPPSTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 20, 26, 82, 95, 234, 357, 453
confident = false

TIG 2[bases=548]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 102 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 628
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1651 = TGAGAGGAGCGTGAAC-1

using 343 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 338]
surviving nonsolo ucounts = 1[338]
ids = [4]

====================================================================================

UMI info for barcode TGAGAGGAGCGTGAAC-1 contig 1 = AGGAGTCAGT...
umi TCTCACGGCA = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSTVFTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1653 = TGAGAGGAGGAATGGA-1

using 391 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 381]
surviving nonsolo ucounts = 1[381]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1658 = TGAGAGGAGGTCATCT-1

using 6462 reads

====================================================================================

graph has 3786 edges initially, 64 edges after simplification

total ucounts = 702
nonsolo ucounts = 343[2^126, 3^72, 4^37, 5^32, 6^15, 7^15, 8^9, 9^6, 10, 11^3, 12^2, 15, 16, 19^2, 43, 48, 57, 79, 85, 103, 133, 140, 185, 225, 243, 274, 304, 317^2, 318, 327, 355^2, 380, 582]
surviving nonsolo ucounts = 19[43, 79, 85, 103, 133, 140, 185, 225, 243, 274, 304, 317^2, 318, 327, 355^2, 380, 582]
ids = [274, 415, 62, 6, 450, 48, 448, 687, 652, 256, ...]

====================================================================================

UMI info for barcode TGAGAGGAGGTCATCT-1 contig 1 = GAGAGCATCA...
umi ACCTCTGGGA = 74 reads: +366 -1 +12 -1 +1 -1 +33 non-validated
umi CCTCAAATCT = 272 reads: +415 validated
umi CCTCTGCCAT = 45 reads: +232 -6X +4 -1 +172 invalidated
umi GCTGTTCGAT = 78 reads: +415 validated
umi GGTTGACTCT = 160 reads: +415 validated
umi GGTTTGCTTA = 134 reads: +376 -3 +4 -1 +31 non-validated

UMI info for barcode TGAGAGGAGGTCATCT-1 contig 2 = AGAGCTCTGG...
umi AAATTGGTTC = 100 reads: +388 validated
umi AACATGGGTT = 319 reads: +388 validated
umi ACAATAGCCC = 142 reads: +181 -1XX +206 invalidated
umi ACGTTACACA = 305 reads: +388 validated
umi ATAGCCTTTC = 330 reads: +388 validated
umi CACTATATTC = 377 reads: +388 validated
umi GCTAGTAGTC = 320 reads: +388 validated
umi GTCTACGCGT = 353 reads: +388 validated
umi TCCGTGGGAT = 598 reads: +388 validated
umi TCTATCTAGG = 317 reads: +388 validated
umi TTCTATTGAG = 355 reads: +388 validated
umi TTTAGGGGTC = 149 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +342 invalidated

GOOD CONTIGS

TIG 1[bases=581]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
433-479 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
479-581 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 64 reads
cdr3 = CARVGLYGSGNDYW at 406, score = 8 + 7
umis assigned: [62, 256, 274, 415, 448, 450]
of which 6 are surviving nonsolos
reads assigned: 749
start codons at 64, 220, 262, 267, 299, 328, 361, 425, 437, 497, 558
confident = true

TIG 2[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 573 reads
cdr3 = CQQYGSSPPCSF at 368, score = 9 + 7
umis assigned: [6, 12, 48, 69, 122, 182, 410, 464, 564, 576] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3600
start codons at 44, 252, 378, 474
confident = true

REJECT CONTIGS

TIG 1[bases=626]
538-576 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
576-626 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [125, 652]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 38, 74, 140, 208, 251, 347, 357, 374, 540
confident = false
did not find CDR3
note long unannotated region
now this is a cell
paired!

AGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGTGGGGCTCTATGGTTCGGGTAATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1662 = TGAGAGGAGTCGTACT-1

using 435 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 425]
surviving nonsolo ucounts = 1[425]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=374]
3-198 ==> 156-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
199-238 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
238-374 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYSGYTF at 174, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 154, 280
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1664 = TGAGAGGAGTGACATA-1

using 525 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[524]
surviving nonsolo ucounts = 1[524]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGAGTGACATA-1 contig 1 = AGCTTCAGCT...
umi CTCGTAGGAT = 510 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-589 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 507
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1665 = TGAGAGGAGTGTACTC-1

using 224 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[223]
surviving nonsolo ucounts = 1[223]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGAGTGTACTC-1 contig 1 = GTGGGCTCAG...
umi TCCGATGATA = 206 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=490]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-490 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1666 = TGAGAGGAGTGTGAAT-1

using 248 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 3^2, 4, 229]
surviving nonsolo ucounts = 1[229]
ids = [4]

====================================================================================

UMI info for barcode TGAGAGGAGTGTGAAT-1 contig 1 = AGCATCATCC...
umi CCTCGCGCCA = 191 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=486]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
414-430 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=3)
434-485 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 12 reads
cdr3 = CARAPYGDYVGGWFDPW at 403, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 61, 217, 259, 325, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1667 = TGAGAGGAGTTGTCGT-1

using 1402 reads

====================================================================================

graph has 1083 edges initially, 22 edges after simplification

total ucounts = 314
nonsolo ucounts = 200[2^33, 3^33, 4^19, 5^19, 6^15, 7^16, 8^13, 9^12, 10^8, 11^11, 12^5, 13, 14^2, 15^3, 17^3, 18^2, 19, 20, 21^2, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1671 = TGAGAGGCAAAGGTGC-1

using 249 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 240]
surviving nonsolo ucounts = 1[240]
ids = [3]

====================================================================================

UMI info for barcode TGAGAGGCAAAGGTGC-1 contig 1 = AGGAGTCAGA...
umi TTAACGTCTA = 231 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-501 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CQQYISDSPWTF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 27, 33, 89, 102, 238, 241, 334, 411, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1676 = TGAGAGGCAAGCGATG-1

using 451 reads

====================================================================================

graph has 148 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 4, 212, 230]
surviving nonsolo ucounts = 2[212, 230]
ids = [0, 5]

====================================================================================

UMI info for barcode TGAGAGGCAAGCGATG-1 contig 1 = GGGAGGAATC...
umi TTGCCGCATG = 231 reads: +388 validated

UMI info for barcode TGAGAGGCAAGCGATG-1 contig 2 = GGGGAGGAAC...
umi ACGATCGTGT = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-366 ==> 0-336 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYVTYPWTF at 357, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 30, 36, 105, 367, 460
confident = false

TIG 2[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQRSNWPRGLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1677 = TGAGAGGCAAGGTTCT-1

using 640 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 632]
surviving nonsolo ucounts = 1[632]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGCAAGGTTCT-1 contig 1 = AGGAGTCAGA...
umi CGTCACGCAC = 632 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 88 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 624
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1683 = TGAGAGGCACCGGAAA-1

using 914 reads

====================================================================================

graph has 330 edges initially, 14 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 4, 262, 306, 335]
surviving nonsolo ucounts = 3[262, 306, 335]
ids = [3, 6, 4]

====================================================================================

UMI info for barcode TGAGAGGCACCGGAAA-1 contig 1 = AGCTTCAGCT...
umi ACTATTGTAT = 263 reads: +388 validated

UMI info for barcode TGAGAGGCACCGGAAA-1 contig 2 = GAAGAGCTGC...
umi CCCCGGCATG = 316 reads: +397 validated

UMI info for barcode TGAGAGGCACCGGAAA-1 contig 3 = TGGGGACACA...
umi CGGGCCCGCT = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=485]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-189 ==> 0-156 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
201-393 ==> 156-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-485 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGNLPPTF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 33, 253, 379, 472
confident = false
see insertion of TACTTAGCCTGG at pos 156 on |283|IGKV3-20|L-REGION+V-REGION|

TIG 3[bases=638]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=1)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CCSYAGSSCVVF at 363, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 39, 178, 240, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1684 = TGAGAGGCACGAAATA-1

using 116 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGCACGAAATA-1 contig 1 = GCTCTGCTTC...
umi AGATTTTAGG = 108 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=496]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-496 ==> 0-51 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1690 = TGAGAGGCAGACGTAG-1

using 107 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 20[2^7, 3^4, 4, 5, 6, 7, 10, 11^3, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1691 = TGAGAGGCAGACTCGC-1

using 84 reads

====================================================================================

graph has 56 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 16[2^4, 3^4, 4^2, 5, 7^3, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1692 = TGAGAGGCAGATAATG-1

using 164 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[164]
surviving nonsolo ucounts = 1[164]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGCAGATAATG-1 contig 1 = GGGGAGGAAC...
umi AGCCCCCGCT = 151 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1693 = TGAGAGGCAGCAGTTT-1

using 281 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TGAGAGGCAGCAGTTT-1 contig 1 = GAACCACATC...
umi GAAATGTTGA = 243 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=461]
49-402 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=10)
412-455 ==> 9-52 on |49|IGHJ1|J-REGION| [len=52] (mis=2)
junction support: 1 umis using 20 reads
cdr3 = CARVQQEFQHW at 391, score = 10 + 7
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 242
start codons at 49, 200, 247, 252, 256, 284, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1701 = TGAGAGGCATCACGTA-1

using 380 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4, 6, 159, 211]
surviving nonsolo ucounts = 2[159, 211]
ids = [1, 3]

====================================================================================

UMI info for barcode TGAGAGGCATCACGTA-1 contig 1 = GAGTCATGGA...
umi TGACGTACTC = 204 reads: +439 validated

UMI info for barcode TGAGAGGCATCACGTA-1 contig 2 = TGGGGTCACA...
umi GATATTATTG = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
5-376 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=16)
398-444 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
444-526 ==> 0-82 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGAARSTTVIIDYW at 365, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 5, 26, 70, 156
confident = false

TIG 2[bases=562]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-562 ==> 0-135 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CCSYAGSSTLVF at 363, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 39, 178, 240, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1702 = TGAGAGGCATCCGTGG-1

using 175 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[174]
surviving nonsolo ucounts = 1[174]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGCATCCGTGG-1 contig 1 = GAGCCCCAGC...
umi GCTTTATGGT = 169 reads: +105 -1XX +318 invalidated

GOOD CONTIGS

TIG 1[bases=534]
0-67 ==> 169-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=1)
67-366 ==> 0-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=16)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
491-534 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CVRGGRSLWFGDLLDYW at 409, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 67, 103, 223, 281, 284, 432
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1713 = TGAGAGGGTAAGGGAA-1

using 241 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 229]
surviving nonsolo ucounts = 1[229]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGGTAAGGGAA-1 contig 1 = GGGGGTCTCA...
umi ACGCGACCGC = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
39-400 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-509 ==> 0-82 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSYTSSSTLVF at 363, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1714 = TGAGAGGGTACCATCA-1

using 130 reads

====================================================================================

graph has 66 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 32, 90]
surviving nonsolo ucounts = 2[32, 90]
ids = [3, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=348]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
10-42 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
37-348 ==> 0-311 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 37, 42, 98, 185, 331, 335
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1716 = TGAGAGGGTAGGGTAC-1

using 90 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 88]
surviving nonsolo ucounts = 1[88]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGGTAGGGTAC-1 contig 1 = TCCCACTCAG...
umi TCTTCCGTGT = 84 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=451]
18-369 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
368-406 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
406-451 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CLQYSSSPWTF at 345, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 18, 24, 93, 229
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1723 = TGAGAGGGTCCGAATT-1

using 21 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 1[18]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1724 = TGAGAGGGTCGATTGT-1

using 184 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 179]
surviving nonsolo ucounts = 1[179]
ids = [4]

====================================================================================

UMI info for barcode TGAGAGGGTCGATTGT-1 contig 1 = GGGGAGTGAC...
umi TACGTTGCAC = 177 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=495]
24-374 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
405-457 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
457-495 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 369, score = 8 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 24, 68, 247, 330
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1725 = TGAGAGGGTCTAGTGT-1

using 544 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[234, 308]
surviving nonsolo ucounts = 2[234, 308]
ids = [0, 3]

====================================================================================

UMI info for barcode TGAGAGGGTCTAGTGT-1 contig 1 = AGGCAGCGCT...
umi AGTAATCTCA = 224 reads: +388 validated

UMI info for barcode TGAGAGGGTCTAGTGT-1 contig 2 = AGGCTGGACA...
umi CTTTCTGCCG = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
0-27 ==> 136-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
27-342 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
415-552 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CTSYAGGSNVVF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 27, 235, 334, 361, 376
confident = false

TIG 2[bases=571]
47-398 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 374, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 16, 47, 53, 122, 258, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1727 = TGAGAGGGTGAGTGAC-1

using 26 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 20]
surviving nonsolo ucounts = 1[20]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1730 = TGAGAGGGTGCCTTGG-1

using 314 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode TGAGAGGGTGCCTTGG-1 contig 1 = GGGGTCACAA...
umi GCCCCGGCCC = 307 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-547 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CCSYAGSSTFNVVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 38, 177, 239, 246, 372, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1733 = TGAGAGGGTTAAAGAC-1

using 371 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 364]
surviving nonsolo ucounts = 1[364]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGGTTAAAGAC-1 contig 1 = GAGTCAGTCC...
umi CAAGAATGTA = 363 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=552]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDNLPPITF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 25, 31, 87, 100, 239, 362, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1736 = TGAGAGGGTTCCATGA-1

using 391 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 7, 376]
surviving nonsolo ucounts = 1[376]
ids = [5]

====================================================================================

UMI info for barcode TGAGAGGGTTCCATGA-1 contig 1 = GAGTCAGTCT...
umi CTTCAGCCCT = 377 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYSTYTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1738 = TGAGAGGGTTGTCGCG-1

using 140 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1741 = TGAGAGGGTTTGTTTC-1

using 169 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 1[166]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGGTTTGTTTC-1 contig 1 = CTCAGGAGGC...
umi ATATTATCAG = 163 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
33-394 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
383-421 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
421-491 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CSSYTSSSTLVF at 357, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 33, 190, 234, 241, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1747 = TGAGAGGTCAGCGACC-1

using 101 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[101]
surviving nonsolo ucounts = 1[101]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGTCAGCGACC-1 contig 1 = TGGGGTCACA...
umi ACGCCGTATC = 86 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=441]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
396-424 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 14 reads
cdr3 = CFSYGTSGRTF at 363, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 39, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1753 = TGAGAGGTCCCTAACC-1

using 529 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 6, 171, 345]
surviving nonsolo ucounts = 2[171, 345]
ids = [1, 0]

====================================================================================

UMI info for barcode TGAGAGGTCCCTAACC-1 contig 1 = AGCTTCAGCT...
umi AAGGCGTATG = 347 reads: +388 validated
umi ACTCCCGGTT = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 72 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 507
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1755 = TGAGAGGTCCGCGTTT-1

using 184 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 181]
surviving nonsolo ucounts = 1[181]
ids = [1]

====================================================================================

UMI info for barcode TGAGAGGTCCGCGTTT-1 contig 1 = GAGCTCTGGG...
umi TGCGTTTGTG = 180 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=13)
471-507 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
507-572 ==> 0-65 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CATVYRSGVRGIVLPWDW at 422, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 80, 231, 236, 294, 297, 315, 383, 561
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1758 = TGAGAGGTCCGTTGCT-1

using 303 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 290]
surviving nonsolo ucounts = 1[290]
ids = [0]

====================================================================================

UMI info for barcode TGAGAGGTCCGTTGCT-1 contig 1 = GGAGTCAGAC...
umi AAATGACCGC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-467 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNTYSWTF at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 26, 32, 88, 101, 237, 240, 258, 333, 376, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1759 = TGAGAGGTCCTACAGA-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1779 = TGAGCATAGAGGTTAT-1

using 361 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[361]
surviving nonsolo ucounts = 1[361]
ids = [0]

====================================================================================

UMI info for barcode TGAGCATAGAGGTTAT-1 contig 1 = GTCAGTCCCA...
umi AGGGCACTAT = 361 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYDNLLLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1789 = TGAGCATAGCGTAATA-1

using 299 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 289]
surviving nonsolo ucounts = 1[289]
ids = [5]

====================================================================================

UMI info for barcode TGAGCATAGCGTAATA-1 contig 1 = GCTCTGCTTC...
umi TTATTTAAGG = 280 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-583 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1793 = TGAGCATAGGGTATCG-1

using 1878 reads

====================================================================================

graph has 1410 edges initially, 12 edges after simplification

total ucounts = 331
nonsolo ucounts = 139[2^59, 3^29, 4^20, 5^5, 6^4, 7^4, 8^2, 9^4, 10^2, 11, 12, 13, 14^2, 16, 18, 19, 294, 841]
surviving nonsolo ucounts = 2[294, 841]
ids = [93, 155]

====================================================================================

REJECT CONTIGS

TIG 1[bases=331]
4-85 ==> 272-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
82-120 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
120-331 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLVF at 56, score = 8 + 9
umis assigned: [93, 155]
of which 2 are surviving nonsolos
reads assigned: 906
start codons at 
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1794 = TGAGCATAGGGTGTTG-1

using 216 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[216]
surviving nonsolo ucounts = 1[216]
ids = [0]

====================================================================================

UMI info for barcode TGAGCATAGGGTGTTG-1 contig 1 = ACCCAAAAAC...
umi TTAATTCGCC = 209 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=506]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1801 = TGAGCATAGTCTCGGC-1

using 123 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[119]
surviving nonsolo ucounts = 1[119]
ids = [3]

====================================================================================

UMI info for barcode TGAGCATAGTCTCGGC-1 contig 1 = TTCTGAGAGT...
umi TCTACTGATC = 114 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
11-382 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
399-447 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
447-537 ==> 0-90 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARAHGDYYTLLDFW at 371, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 11, 32, 76, 162, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1806 = TGAGCATAGTTCGATC-1

using 856 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 187, 666]
surviving nonsolo ucounts = 2[187, 666]
ids = [2, 3]

====================================================================================

UMI info for barcode TGAGCATAGTTCGATC-1 contig 1 = GGGAATCAGT...
umi CGTTAAGTCT = 186 reads: +388 validated
umi TGGGTATGGC = 670 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 155 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 845
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1807 = TGAGCATCAAACCCAT-1

using 308 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [3]

====================================================================================

UMI info for barcode TGAGCATCAAACCCAT-1 contig 1 = GGGAATCAGT...
umi TCTCCATCAC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQHNSYPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 27, 33, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1815 = TGAGCATCAATAGAGT-1

using 397 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 138, 245]
surviving nonsolo ucounts = 3[4, 138, 245]
ids = [2, 3, 4]

====================================================================================

UMI info for barcode TGAGCATCAATAGAGT-1 contig 1 = TCTGGCACCA...
umi ATTAGTGCTG = 129 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=442]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 24 reads
cdr3 = CLLSYSGARREVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1817 = TGAGCATCAATCGGTT-1

using 136 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 130]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1822 = TGAGCATCACCAGGTC-1

using 408 reads

====================================================================================

graph has 160 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 120, 277]
surviving nonsolo ucounts = 2[120, 277]
ids = [4, 2]

====================================================================================

UMI info for barcode TGAGCATCACCAGGTC-1 contig 1 = GCTCTGCTTC...
umi GATGCGTGAT = 105 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=445]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CQSYDISLSAHVVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 51, 205, 208, 259, 358, 385, 406
confident = false

REJECT CONTIGS

TIG 1[bases=564]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |277|IGKV2D-30|L-REGION+V-REGION| [len=360] (mis=1)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 30, 63, 91, 99, 187, 349, 369, 470
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1828 = TGAGCATCAGACAAAT-1

using 276 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 10, 256]
surviving nonsolo ucounts = 1[256]
ids = [5]

====================================================================================

UMI info for barcode TGAGCATCAGACAAAT-1 contig 1 = GCTGGGGTCT...
umi TTATGATCGC = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-378 ==> 0-337 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=13)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-556 ==> 0-127 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSLYISSTPLVF at 365, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 41, 198
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1829 = TGAGCATCAGACGTAG-1

using 5346 reads

====================================================================================

graph has 4266 edges initially, 22 edges after simplification

total ucounts = 1017
nonsolo ucounts = 432[2^176, 3^94, 4^53, 5^32, 6^22, 7^12, 8^11, 9^5, 10^4, 11^2, 12^5, 21, 27, 73, 133, 144, 182, 192, 204, 225, 238, 242, 244, 245, 262, 282, 570]
surviving nonsolo ucounts = 17[3, 21, 27, 73, 133, 144, 182, 192, 204, 225, 238, 242, 244, 245, 262, 282, 570]
ids = [617, 864, 4, 101, 392, 663, 947, 976, 835, 100, ...]

====================================================================================

UMI info for barcode TGAGCATCAGACGTAG-1 contig 1 = CCAGCAACCA...
umi CCACTTATAC = 124 reads: +433 validated
umi GACATACGGG = 3 reads: -113 +12 -1 +43 -1 +18 -1 +14 -1 +11 -125 +18 -1 +2 -1 +29 -1 +4 -37 non-validated
umi TATTATGTTT = 18 reads: +1 -1 +2 -2 +1 -1 +29 -1 +12 -1 +148 -1 +2 -1 +87 -1 +69 -6 +56 -11 non-validated

UMI info for barcode TGAGCATCAGACGTAG-1 contig 2 = AGTCTGGGCC...
umi AAACTGCTCA = 27 reads: +113 -1 +180 -1 +77 -10 non-validated
umi ACCACACCTA = 226 reads: +382 validated
umi ACCAGATCCA = 73 reads: +382 validated
umi ACTTGACACT = 240 reads: +382 validated
umi AGAACTGCCC = 287 reads: +382 validated
umi AGATTACAAA = 242 reads: +382 validated
umi GATTGCGGAC = 265 reads: +382 validated
umi GCATTTTCCT = 149 reads: +382 validated
umi TACTTCAGGA = 206 reads: +382 validated
umi TTACCGTAAC = 184 reads: +382 validated
umi TTCGCAGGCT = 193 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=486]
0-53 ==> 11-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
53-406 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=17)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARGRPQSQDYFDTSGYDSW at 395, score = 8 + 7
umis assigned: [392, 617, 864]
of which 3 are surviving nonsolos
reads assigned: 145
start codons at 53, 209, 251, 288, 317, 350, 444
confident = true

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-377 ==> 0-337 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=10)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 366 reads
cdr3 = CQVWDSSTDVVLF at 355, score = 8 + 8
umis assigned: [4, 100, 101, 147, 156, 166, 653, 663, 835, 947] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2045
start codons at 40, 101, 239, 338, 380
confident = true
now this is a cell
paired!

GTCTATTACTGTGCGAGAGGTCGCCCCCAGTCCCAAGATTACTTTGATACTAGTGGTTATGACTCTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGAGGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTACTGATGTTGTGCTATTCGGCGGAGGGACCAAACTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1831 = TGAGCATCAGCCAGAA-1

using 10869 reads

====================================================================================

graph has 4218 edges initially, 64 edges after simplification

total ucounts = 419
nonsolo ucounts = 175[2^60, 3^30, 4^14, 5^7, 6^8, 7^5, 8^3, 9^3, 10, 11, 13, 14, 16^2, 17, 21, 46, 54, 64, 81, 97, 107, 143, 153, 155, 158, 168, 177, 180, 199, 201, 202, 204, 207, 209, 210, 215, 223, 233, 237, 253, 262, 265, 276, 302, 342, 477, 549, 568, 623, 655, 710, 867]
surviving nonsolo ucounts = 35[54, 64, 81, 107, 143, 153, 155, 158, 168, 177, 180, 199, 201, 202, 204, 207, 209, 210, 215, 223, 233, 237, 253, 262, 265, 276, 302, 342, 477, 549, 568, 623, 655, 710, 867]
ids = [340, 317, 277, 192, 144, 188, 328, 238, 95, 218, ...]

====================================================================================

UMI info for barcode TGAGCATCAGCCAGAA-1 contig 1 = AGCTCTGGGA...
umi ATCCCCGCCC = 199 reads: +463 validated
umi CGGAAATCAT = 141 reads: +459 -1 +3 non-validated
umi CTGTAGATGT = 205 reads: +463 validated
umi TAATCCGTAG = 84 reads: +396 -1X +1 -65 invalidated
umi TCCCCCGGGC = 154 reads: +460 -1 +2 non-validated
umi TTTAGCCGGA = 201 reads: +463 validated

UMI info for barcode TGAGCATCAGCCAGAA-1 contig 2 = GGGGTCTCAG...
umi ACCTCCTTTC = 204 reads: +388 validated
umi ACTACCGTAC = 260 reads: +388 validated
umi ATGTATAGCC = 209 reads: +388 validated
umi CATGCAGCCA = 269 reads: +388 validated
umi CCCGGTCATA = 226 reads: +388 validated
umi CTACACGCTG = 186 reads: +388 validated
umi CTGAACCGCT = 234 reads: +388 validated
umi GAAAGTCGTT = 148 reads: +388 validated
umi GACCATCTTG = 107 reads: +388 validated
umi GATCGTCTCT = 38 reads: -383X +1 -2X +2 invalidated
umi GCCATCCATT = 29 reads: -381X +1 -4XX +2 invalidated
umi GCCCCGGTCA = 208 reads: +388 validated
umi GGCACCACAG = 160 reads: +388 validated
umi TATATTTCTC = 212 reads: +388 validated
umi TATTACTCCT = 863 reads: -332X +56 invalidated
umi TCACCTACTG = 64 reads: +42 -1 +345 non-validated
umi TCTATCGGAT = 234 reads: +388 validated
umi TGGGACCTTC = 278 reads: +388 validated
umi TGTCAACATC = 28 reads: -386 +2 non-validated
umi TTAAAATCCT = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=614]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
448-479 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=6)
480-543 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
543-614 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 48 reads
cdr3 = CTTDSLFYYDFWSGYFRSYYYYYGMDVW at 428, score = 8 + 7
umis assigned: [47, 144, 178, 277, 328, 408]
of which 6 are surviving nonsolos
reads assigned: 958
start codons at 80, 236, 303, 360, 389, 500
confident = true

TIG 2[bases=637]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=1)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 518 reads
cdr3 = CSSYAGSNNLVF at 362, score = 8 + 9
umis assigned: [22, 27, 53, 82, 106, 159, 172, 188, 192, 205] and 10 others
of which 19 are surviving nonsolos
reads assigned: 4081
start codons at 38, 195, 239, 246, 345, 372
confident = true

REJECT CONTIGS

TIG 1[bases=308]
3-82 ==> 5658-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
34-173 ==> 0-139 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=0)
172-308 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [86, 93, 95, 127, 219, 271, 284, 340, 364, 387]
of which 10 are surviving nonsolos
reads assigned: 4350
start codons at 34, 40, 96, 214
confident = false
did not find CDR3
now this is a cell
paired!

CTTTTCTATTACGATTTTTGGAGTGGTTATTTCCGGAGCTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1833 = TGAGCATCAGCTTAAC-1

using 502 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 233, 261]
surviving nonsolo ucounts = 2[233, 261]
ids = [7, 2]

====================================================================================

UMI info for barcode TGAGCATCAGCTTAAC-1 contig 1 = GAGTCAGTCT...
umi CACGAAGTCC = 226 reads: +388 validated

UMI info for barcode TGAGCATCAGCTTAAC-1 contig 2 = GCTCTGCTTC...
umi GTTATCCCAA = 224 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false

TIG 2[bases=557]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-557 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CQCYDNSLTGWGF at 375, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1835 = TGAGCATCAGGGTTAG-1

using 24 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 1[23]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1841 = TGAGCATCATGTCGAT-1

using 881 reads

====================================================================================

graph has 245 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[3, 22, 45, 128, 204, 226, 244]
surviving nonsolo ucounts = 6[22, 45, 128, 204, 226, 244]
ids = [0, 3, 9, 8, 1, 15]

====================================================================================

UMI info for barcode TGAGCATCATGTCGAT-1 contig 1 = GGGGGACTCC...
umi CCGTGTCCGG = 45 reads: -23 +392 non-validated
umi GGCACCTCGC = 204 reads: +415 validated
umi TATGCCAGCG = 127 reads: +15 -1 +399 non-validated
umi TTCCAACCAG = 247 reads: +415 validated

UMI info for barcode TGAGCATCATGTCGAT-1 contig 2 = AGGAGTCAGA...
umi AACGTGCTGT = 22 reads: +330 -1 +3 -1 +18 -1 +10 -1 +3 -1 +3 -1 +1 -1 +3 -10 non-validated
umi ACACCAGCGC = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=618]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=11)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
436-618 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 4 umis using 84 reads
cdr3 = CAHCTSIDYLVYW at 366, score = 7 + 7
umis assigned: [3, 8, 9, 15]
of which 4 are surviving nonsolos
reads assigned: 616
start codons at 21, 65, 177, 244, 247, 327, 336
confident = true

TIG 2[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 246
start codons at 27, 33, 89, 102, 241, 259, 457
confident = true
now this is a cell
paired!

ATGGACCCTGTGGACACAGCCACATATTACTGTGCACACTGTACTTCAATTGACTACCTTGTCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTACTGTCAACAGGCTAACAGTTTCCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1843 = TGAGCATCATTAGGCT-1

using 1340 reads

====================================================================================

graph has 468 edges initially, 16 edges after simplification

total ucounts = 20
nonsolo ucounts = 10[2^3, 3^2, 27, 104, 191, 350, 646]
surviving nonsolo ucounts = 5[27, 104, 191, 350, 646]
ids = [17, 7, 1, 2, 10]

====================================================================================

UMI info for barcode TGAGCATCATTAGGCT-1 contig 1 = AGCTTCAGCT...
umi CGCTTAACTA = 188 reads: +388 validated

UMI info for barcode TGAGCATCATTAGGCT-1 contig 2 = AGTCTCAGTC...
umi CTGGCGCTTA = 354 reads: +388 validated

UMI info for barcode TGAGCATCATTAGGCT-1 contig 3 = GGAGAAGAGC...
umi GTTTTTATGG = 650 reads: +388 validated
umi TTATACCCAA = 29 reads: -2 +322 -22 +5 -3 +2 -1 +31 non-validated

GOOD CONTIGS

TIG 1[bases=599]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-599 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=544]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQSYRRPITF at 347, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 20, 26, 82, 95, 231, 330, 450
confident = false

TIG 3[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQQYGSSRGFTF at 360, score = 9 + 8
umis assigned: [10, 17]
of which 2 are surviving nonsolos
reads assigned: 670
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1846 = TGAGCATGTACCGAGA-1

using 636 reads

====================================================================================

graph has 276 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 270, 355]
surviving nonsolo ucounts = 2[270, 355]
ids = [7, 4]

====================================================================================

UMI info for barcode TGAGCATGTACCGAGA-1 contig 1 = GACTGATCAG...
umi TTTTAGATGG = 258 reads: +397 validated

UMI info for barcode TGAGCATGTACCGAGA-1 contig 2 = GAGTCAGACT...
umi CCTCGCCACG = 328 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=526]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
431-526 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTPVTF at 370, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false

TIG 2[bases=496]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-364 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
401-496 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYETF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1847 = TGAGCATGTAGCGCAA-1

using 181 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [4]

====================================================================================

UMI info for barcode TGAGCATGTAGCGCAA-1 contig 1 = GGTGACTCCT...
umi CGTAACTCTT = 2 reads: -416 +3 -1 +1 -1 +3 -1 +2 -1 +1 -1 +2 non-validated
umi CGTTTCTCTT = 178 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=596]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=1)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-596 ==> 0-143 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1848 = TGAGCATGTAGGCATG-1

using 219 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

UMI info for barcode TGAGCATGTAGGCATG-1 contig 1 = ATGCTTTCTG...
umi CCGGACGGAG = 213 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=568]
16-393 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=4)
425-476 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
476-568 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CARHHSGFTMFGVDLKWFDPW at 382, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 0, 16, 25, 37, 81, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1851 = TGAGCATGTCAGGACA-1

using 620 reads

====================================================================================

graph has 279 edges initially, 48 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[274, 343]
surviving nonsolo ucounts = 2[274, 343]
ids = [2, 0]

====================================================================================

UMI info for barcode TGAGCATGTCAGGACA-1 contig 1 = AGGAATCAGA...
umi GACTTAGCCA = 277 reads: +388 validated

UMI info for barcode TGAGCATGTCAGGACA-1 contig 2 = TGGGGAGTCA...
umi AACACACTCG = 342 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=557]
33-384 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=7)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQLKSYPLIF at 360, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 33, 39, 95, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1855 = TGAGCATGTCCCTTGT-1

using 306 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [2]

====================================================================================

UMI info for barcode TGAGCATGTCCCTTGT-1 contig 1 = GAGCTACAAC...
umi TTCTCTGTGG = 287 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=518]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=7)
430-518 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYRGPHTF at 369, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1868 = TGAGCATGTTAAGGGC-1

using 218 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[4, 5, 8, 200]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1876 = TGAGCATTCAAGGTAA-1

using 111 reads

====================================================================================

graph has 90 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 15[2^4, 3, 4^2, 5^2, 7, 12, 13, 14^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1880 = TGAGCATTCACTTATC-1

using 93 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 15[2^3, 3^4, 5, 6^2, 8, 9^2, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1884 = TGAGCATTCATCGCTC-1

using 46 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 4, 35]
surviving nonsolo ucounts = 2[4, 35]
ids = [2, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=326]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
0-37 ==> 4706-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-37 ==> 4690-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-37 ==> 3479-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-37 ==> 3548-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
37-306 ==> 0-269 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=22)
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 28
start codons at 37, 81, 254, 304
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1885 = TGAGCATTCCACGTGG-1

using 743 reads

====================================================================================

graph has 276 edges initially, 20 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 8, 340, 387]
surviving nonsolo ucounts = 2[340, 387]
ids = [0, 2]

====================================================================================

UMI info for barcode TGAGCATTCCACGTGG-1 contig 1 = GGAGGAACTG...
umi AACGTGAACG = 336 reads: +382 validated
umi ACATCTTCGT = 163 reads: +14 -1XX +36 -1XX +4 -1XX +6 -1XX +1 -1XX +3 -1XX +4 -1XX +10 -118XX +5 -1XX +6 -1XX +1 -2XX +7 -1XX +3 -3XX +4 -1XX +31 -1XX +5 -1XX +17 -2XX +2 -1XX +6 -11 +1 -1XX +6 -2XX +5 -2XX +2 -4XX +8 -1XX +29 -1XX +5 invalidated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSSWPLTF at 355, score = 9 + 9
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 484
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1886 = TGAGCATTCCAGAAGG-1

using 137 reads

====================================================================================

graph has 90 edges initially, 8 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[4^2, 5^2, 7^2, 99]
surviving nonsolo ucounts = 1[99]
ids = [8]

====================================================================================

UMI info for barcode TGAGCATTCCAGAAGG-1 contig 1 = CACCTTCTCA...
umi ACCCCCAGTG = 4 reads: -39 +4 -1 +1 -1XX +28 -1XX +3 -1XX +11 -3XX +2 -1XX +7 -1X +4 -1X +38 -3X +2 -1X +1 -1X +1 -1X +5 -1X +3 -1X +3 -227X invalidated
umi CTGTTGCCAG = 95 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=421]
12-372 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=6)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 16 reads
cdr3 = CMQTTQFPRTF at 348, score = 9 + 8
umis assigned: [2, 8]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 12, 45, 81, 169, 331, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1895 = TGAGCATTCGGACAAG-1

using 15923 reads

====================================================================================

graph has 7576 edges initially, 182 edges after simplification

total ucounts = 1233
nonsolo ucounts = 782[2^168, 3^127, 4^114, 5^71, 6^64, 7^45, 8^42, 9^36, 10^13, 11^17, 12^7, 13^7, 14^9, 15^2, 16^5, 17^6, 19^3, 20, 70, 81, 130, 138, 144, 163^2, 181, 182, 183, 191, 193, 195, 197, 203, 207, 209, 211, 213^2, 230, 247, 254, 256, 258, 262^2, 268, 274, 275, 287^2, 292, 306, 307, 312, 313, 358, 361, 392, 395, 396, 400, 451, 768]
surviving nonsolo ucounts = 45[70, 81, 130, 138, 144, 163^2, 181, 182, 183, 191, 193, 195, 197, 203, 207, 209, 211, 213^2, 230, 247, 254, 256, 258, 262^2, 268, 274, 275, 287^2, 292, 306, 307, 312, 313, 358, 361, 392, 395, 396, 400, 451, 768]
ids = [265, 632, 1063, 395, 310, 244, 630, 538, 74, 821, ...]

====================================================================================

UMI info for barcode TGAGCATTCGGACAAG-1 contig 1 = TGAGCGCAGA...
umi ATAACGACAT = 166 reads: +388 validated
umi ATATCCCCGT = 193 reads: +388 validated
umi ATGGCTTTCA = 147 reads: +388 validated
umi CCGAACGAAT = 262 reads: +388 validated
umi CGCACTACAT = 177 reads: +388 validated
umi CGTTCACGAG = 210 reads: +388 validated
umi CTGATCCGTT = 164 reads: +388 validated
umi GCGATGCTCC = 214 reads: +388 validated
umi GGCTATTGGA = 255 reads: +388 validated
umi GGGTTTAAGT = 185 reads: +388 validated
umi TCGTCTGTAG = 266 reads: +388 validated

UMI info for barcode TGAGCATTCGGACAAG-1 contig 2 = TGGGGATGCT...
umi AACGCACCTC = 309 reads: +469 validated
umi AAGTAAAGGA = 208 reads: -2X +467 invalidated
umi AATTTAGGTT = 185 reads: +465 -1 +3 non-validated
umi ACTTCACTTA = 277 reads: +469 validated
umi AGCATGTTCA = 192 reads: +469 validated
umi ATATTGACTC = 69 reads: +415 -10 +44 non-validated
umi ATCTCTTTCT = 246 reads: +469 validated
umi CCTAATACCT = 186 reads: +469 validated
umi CGACGGGTAC = 191 reads: +469 validated
umi CGATGAATAG = 210 reads: +462 -7 non-validated
umi CTGCCTTTTG = 79 reads: +62 -1 +359 -38 +9 non-validated
umi GGCATCGCTT = 251 reads: +444 -1XX +3 -1XX +1 -3XX +1 -4X +11 invalidated
umi TCTCATTCTT = 126 reads: +469 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 346 reads
cdr3 = CVTWDTSLSAGIF at 357, score = 7 + 9
umis assigned: [244, 258, 310, 481, 538, 583, 630, 755, 813, 821] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2202
start codons at 36, 190, 340, 365, 556
confident = true

TIG 2[bases=601]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
440-490 ==> 11-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
490-601 ==> 0-111 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 9 umis using 199 reads
cdr3 = CARHKRGFCGTTSCLGYFYYMDVW at 387, score = 8 + 6
umis assigned: [20, 41, 74, 163, 192, 265, 292, 499, 528, 533] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2485
start codons at 5, 21, 30, 42, 86, 159, 166, 175, 378, 447, 544
confident = true

REJECT CONTIGS

TIG 1[bases=332]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=4)
33-205 ==> 0-172 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=23)
205-320 ==> 173-288 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=24) [SHIFT!]
umis assigned: [64, 386, 388, 404, 465, 517, 702, 733, 816, 872] and 1 others
of which 11 are surviving nonsolos
reads assigned: 340
start codons at 33, 89, 102, 129, 240
confident = false
did not find CDR3

TIG 2[bases=630]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=1)
28-82 ==> 5638-5692 on segment before IGLV3-29 exon 1 [len=6000] (mis=5)
40-103 ==> 0-63 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=2)
103-227 ==> 64-188 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=8) [SHIFT!]
227-359 ==> 189-321 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=11) [SHIFT!]
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [195, 395, 433, 611, 960, 1057, 1128, 1185]
of which 8 are surviving nonsolos
reads assigned: 2013
start codons at 40, 240, 336, 359
confident = false
did not find CDR3
now this is a cell
paired!

GCGAGACATAAGCGTGGATTTTGTGGTACTACCAGCTGCTTAGGATACTTCTACTACATGGACGTCTGGGGCAAAGGGGCCACGGTCACCGTCTCCTCAG <==> GGACTCCAGACTGGGGATGAGGCCGATTATTACTGCGTAACATGGGATACCAGCCTGAGTGCTGGGATCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1896 = TGAGCATTCGGCCGAT-1

using 663 reads

====================================================================================

graph has 240 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 4^2, 6^2, 302, 337]
surviving nonsolo ucounts = 2[302, 337]
ids = [8, 7]

====================================================================================

UMI info for barcode TGAGCATTCGGCCGAT-1 contig 1 = AGTCTCAGTC...
umi TTTTATACTC = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQTYSTPLTF at 347, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 20, 26, 82, 95, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1897 = TGAGCATTCGTGGTCG-1

using 84 reads

====================================================================================

graph has 94 edges initially, 4 edges after simplification

total ucounts = 29
nonsolo ucounts = 16[2^2, 3^5, 4^4, 5^2, 6, 8, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1903 = TGAGCATTCTGGTTCC-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1906 = TGAGCATTCTTGTATC-1

using 211 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[211]
surviving nonsolo ucounts = 1[211]
ids = [0]

====================================================================================

UMI info for barcode TGAGCATTCTTGTATC-1 contig 1 = GGAACTGCTC...
umi GATAACTTGT = 212 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYYNWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 31, 86, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1929 = TGAGCCGAGGACACCA-1

using 212 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode TGAGCCGAGGACACCA-1 contig 1 = CCCTCCCCTA...
umi CTGATATGGC = 207 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=509]
0-39 ==> 21-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
39-392 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
448-509 ==> 0-61 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVTDLATTVDYW at 381, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 39, 195, 237, 259, 274, 303, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1932 = TGAGCCGAGGATCGCA-1

using 17 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1937 = TGAGCCGAGGGATACC-1

using 308 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 294]
surviving nonsolo ucounts = 1[294]
ids = [8]

====================================================================================

UMI info for barcode TGAGCCGAGGGATACC-1 contig 1 = TGGGGGTGAC...
umi TGCATCCTCG = 277 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=566]
24-382 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
397-445 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
445-566 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 56 reads
cdr3 = CARRRSPWFGALDYW at 369, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 24, 68, 247, 250, 330, 339, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1938 = TGAGCCGAGGGATGGG-1

using 13148 reads

====================================================================================

graph has 4779 edges initially, 110 edges after simplification

total ucounts = 864
nonsolo ucounts = 333[2^131, 3^83, 4^31, 5^14, 6^10, 7^4, 8^11, 9^4, 10^3, 11, 12^2, 14, 16^3, 25, 73, 93, 109, 125, 132, 142, 144, 146, 156, 169, 174, 180, 184, 198, 203, 208, 209^2, 211, 213, 230, 262, 263, 298, 347, 391, 640, 647, 654, 668, 812, 949, 974, 1135]
surviving nonsolo ucounts = 33[16, 93, 125, 132, 142, 144, 146, 156, 169, 174, 180, 184, 198, 203, 208, 209^2, 211, 213, 230, 262, 263, 298, 347, 391, 640, 647, 654, 668, 812, 949, 974, 1135]
ids = [819, 161, 508, 630, 657, 340, 512, 401, 146, 216, ...]

====================================================================================

UMI info for barcode TGAGCCGAGGGATGGG-1 contig 1 = AGCTCTGAGA...
umi AACATTTGCT = 199 reads: +402 -1 +1 -2 +2 -1 +12 non-validated
umi AATGAGCCGA = 7 reads: -371X +1 -3XX +1 -1XX +1 -1XX +1 -2XX +1 -2XX +13 -1XX +2 -1XX +19 invalidated
umi ACAATTGTAG = 24 reads: -366 +4 -1XX +1 -3XX +1 -1XX +1 -1XX +1 -2XX +1 -2XX +13 -1XX +2 -1XX +19 invalidated
umi AGTCGCCTGA = 168 reads: +421 validated
umi ATACTGCTCC = 213 reads: +421 validated
umi ATCCATTAGT = 233 reads: +421 validated
umi ATCGGGTTAC = 214 reads: +421 validated
umi ATCTCGCGGC = 263 reads: +421 validated
umi ATTCATACAG = 175 reads: +408 -2 +3 -1 +2 -1X +1 -1X +1 -1X invalidated
umi CGGCATCTGA = 432 reads: -383 +1 -7X +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GCCGAGCAGC = 126 reads: +421 validated
umi GCCTCCGGAA = 146 reads: +421 validated
umi GGTAGTGGGC = 525 reads: -391X +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GTCACCCTGC = 969 reads: -383X +1 -7XX +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GTCTAGTATG = 448 reads: -391X +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi TAATTCATCA = 130 reads: +421 validated
umi TAGCCTCTAG = 144 reads: +421 validated
umi TATCGGGCGC = 264 reads: +421 validated
umi TCCGTAGCTT = 2 reads: -382X +1 -3X +3 -1 +8 -1X +2 -1XX +19 invalidated
umi TGGACCTCCA = 215 reads: +421 validated
umi TTCACCGACA = 819 reads: -391X +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi TTCCTCCTGT = 753 reads: -391X +2 -3XX +1 -5XX +1 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi TTGCACCTAC = 8 reads: -368 +2 -1X +1 -3X +1 -1XX +1 -1XX +1 -2XX +1 -2XX +13 -1XX +2 -1XX +19 invalidated

UMI info for barcode TGAGCCGAGGGATGGG-1 contig 2 = AGCTTCAGCT...
umi AACATATTAG = 178 reads: +388 validated
umi AATAAGTAAC = 214 reads: +388 validated
umi CTCAACGCTT = 159 reads: -388 non-validated
umi GACTCTCCGT = 204 reads: +388 validated
umi GGGATATTCA = 183 reads: +388 validated
umi TGCCACCCTC = 297 reads: +388 validated
umi TTCATTACCG = 17 reads: -10 +140 -1 +5 -1 +141 -3 +87 non-validated

GOOD CONTIGS

TIG 1[bases=661]
0-80 ==> 0-80 on |162|IGHV3-72|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |163|IGHV3-72|L-REGION+V-REGION| [len=359] (mis=28)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
501-661 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 11 umis using 250 reads
cdr3 = CVRDLFVGWSVDYW at 428, score = 8 + 7
umis assigned: [15, 37, 49, 146, 170, 181, 189, 192, 216, 368] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6392
start codons at 80, 236, 360, 389, 555
confident = true

TIG 2[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=19)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-645 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 179 reads
cdr3 = CAAWDNNLGGPLF at 367, score = 7 + 8
umis assigned: [14, 33, 401, 472, 566, 770, 819]
of which 7 are surviving nonsolos
reads assigned: 1224
start codons at 46, 200, 350, 375
confident = true
now this is a cell
paired!

AAAACCGAGGACACGGCCGTGTATTATTGTGTTAGAGATCTTTTTGTGGGTTGGTCCGTTGACTACTGGGGCCAGGGAACTCTGGTCACCGTCTCCTCAG <==> GGGCTCCGGTCCGAGGATGAGGCTGATTATTATTGTGCAGCATGGGATAATAACCTGGGTGGTCCGCTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1957 = TGAGCCGCAAAGGTGC-1

using 75 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[75]
surviving nonsolo ucounts = 1[75]
ids = [0]

====================================================================================

UMI info for barcode TGAGCCGCAAAGGTGC-1 contig 1 = GCTGGGGTCT...
umi TCCTTGGCGC = 66 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=14)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-469 ==> 0-40 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1959 = TGAGCCGCAACAACCT-1

using 247 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 239]
surviving nonsolo ucounts = 1[239]
ids = [3]

====================================================================================

UMI info for barcode TGAGCCGCAACAACCT-1 contig 1 = GGGGGCAGGA...
umi GGGTTCTATA = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
421-494 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSYSTPPAF at 360, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 33, 39, 95, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1964 = TGAGCCGCAAGCCGCT-1

using 1464 reads

====================================================================================

graph has 586 edges initially, 26 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[221, 349, 393, 497]
surviving nonsolo ucounts = 4[221, 349, 393, 497]
ids = [4, 7, 1, 3]

====================================================================================

UMI info for barcode TGAGCCGCAAGCCGCT-1 contig 1 = GAATCAGTCC...
umi ATATAGACGT = 63 reads: -348X +1 -1X +2 -2X +2 -1XX +8 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CGGCTCCTGG = 496 reads: -8X +1 -2XX +1 -4XX +372 invalidated
umi GGTGGACGGA = 226 reads: +388 validated
umi TTGTAACGTG = 58 reads: -349X +1 -4X +2 -1XX +2 -1XX +3 -2XX +15 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 136 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1, 3, 4, 7]
of which 4 are surviving nonsolos
reads assigned: 822
start codons at 25, 31, 100, 236, 455
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1975 = TGAGCCGCACGGACAA-1

using 34 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[33]
surviving nonsolo ucounts = 1[33]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1977 = TGAGCCGCACGGTAAG-1

using 373 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 367]
surviving nonsolo ucounts = 1[367]
ids = [3]

====================================================================================

UMI info for barcode TGAGCCGCACGGTAAG-1 contig 1 = AGGAGTCAGA...
umi TATAGTGTTC = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1980 = TGAGCCGCACGTGAGA-1

using 544 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3, 6, 24, 213, 293]
surviving nonsolo ucounts = 2[213, 293]
ids = [8, 9]

====================================================================================

UMI info for barcode TGAGCCGCACGTGAGA-1 contig 1 = ATCAGTCCCA...
umi TTCAATCGGT = 214 reads: +388 validated
umi TTTTTAGGTT = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 74 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [8, 9]
of which 2 are surviving nonsolos
reads assigned: 496
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1982 = TGAGCCGCAGACACTT-1

using 240 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[83, 157]
surviving nonsolo ucounts = 2[83, 157]
ids = [1, 0]

====================================================================================

UMI info for barcode TGAGCCGCAGACACTT-1 contig 1 = AGCTCTGGGA...
umi ACGCTTCAAG = 155 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=537]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-387 ==> 0-307 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=22)
468-531 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
junction support: 1 umis using 7 reads
cdr3 = CTRDIPHRIWFGDVLVYYYYMDVW at 428, score = 10 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 80, 133, 236, 321, 360, 389, 454, 488
confident = false

REJECT CONTIGS

TIG 1[bases=421]
0-319 ==> 21-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
336-364 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
364-421 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CFSYGTSGRTF at 303, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 187, 313
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1985 = TGAGCCGCAGCGTCCA-1

using 305 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 296]
surviving nonsolo ucounts = 1[296]
ids = [5]

====================================================================================

UMI info for barcode TGAGCCGCAGCGTCCA-1 contig 1 = TTAGGACCCA...
umi GGCGCAGCTT = 262 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-19 ==> 28-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
19-364 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=10)
364-401 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
401-494 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQRSNWPQTF at 340, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 19, 224, 227, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1989 = TGAGCCGCAGGATTGG-1

using 277 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=552]
34-50 ==> 90-106 on rc of segment before IGLVVII-41-1 exon 1 [len=1324] (mis=0)
45-303 ==> 95-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=12)
303-341 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
341-552 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CATWETSLSAPYVF at 271, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 104, 279, 305, 473
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1996 = TGAGCCGCATCGTCGG-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1997 = TGAGCCGCATCTATGG-1

using 115 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 72
nonsolo ucounts = 15[2^6, 3^4, 5^3, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.1999 = TGAGCCGCATGATCCA-1

using 65 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 14[2^3, 3^3, 4^4, 6^3, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2002 = TGAGCCGCATGTCCTC-1

using 736 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 167, 258, 306]
surviving nonsolo ucounts = 3[167, 258, 306]
ids = [0, 3, 2]

====================================================================================

UMI info for barcode TGAGCCGCATGTCCTC-1 contig 1 = GGGGTCTCAG...
umi ACAGTTGGAT = 169 reads: +385 validated
umi CCGGTCATGT = 305 reads: +385 validated
umi CTACGATCGT = 260 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-365 ==> 0-327 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=11)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
423-634 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 124 reads
cdr3 = CGAYAGSSDVF at 362, score = 7 + 8
umis assigned: [0, 2, 3]
of which 3 are surviving nonsolos
reads assigned: 723
start codons at 38, 174, 246, 345, 372, 387, 555
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2004 = TGAGCCGCATTCGACA-1

using 4122 reads

====================================================================================

graph has 2180 edges initially, 62 edges after simplification

total ucounts = 503
nonsolo ucounts = 197[2^81, 3^39, 4^25, 5^18, 6^5, 7^6, 8, 9^2, 11, 13, 14, 19, 32, 52, 125, 147, 148, 150, 179, 187, 203, 224, 230, 238, 251, 281, 364, 381]
surviving nonsolo ucounts = 15[32, 52, 125, 148, 150, 179, 187, 203, 224, 230, 238, 251, 281, 364, 381]
ids = [347, 33, 162, 436, 211, 386, 146, 183, 141, 407, ...]

====================================================================================

UMI info for barcode TGAGCCGCATTCGACA-1 contig 1 = AAGCATCATC...
umi AACTTACCAA = 279 reads: +415 validated
umi AAGTAGCTGC = 53 reads: +390 -25 non-validated
umi CAGGGTATGA = 187 reads: +353 -6 +56 non-validated
umi CCGCATCCGT = 180 reads: +414 -1 non-validated
umi CGGAACGCCT = 148 reads: +415 validated
umi GGAGGCCCTA = 19 reads: -287X +1 -1X +2 -1XX +1 -1XX +2 -2XX +2 -1XX +1 -2XX +3 -1XX +10 -1XX +1 -1XX +29 -1X +1 -3X +1 -4X +1 -9X +1 -1X +43 invalidated
umi GGCTTCACCA = 363 reads: +415 validated
umi GTGGGTTCAA = 30 reads: +311 -73 +2 -1 +3 -1 +5 -1 +1 -1 +3 -1 +1 -4 +1 -1 +4 -1 non-validated
umi TCACCAGATC = 150 reads: +2 -1 +17 -1 +1 -1 +392 non-validated
umi TGCTATCCGT = 149 reads: +415 validated
umi TGTTAATAGC = 237 reads: +415 validated

UMI info for barcode TGAGCCGCATTCGACA-1 contig 2 = AGGCCCAGTG...
umi CACTTATAGC = 50 reads: -357 +1 -4X +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi CATTGTACTC = 8 reads: -378X +1 -4X +2 invalidated
umi TATCCACCAC = 250 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-62 ==> 242-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
62-415 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
429-477 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 127 reads
cdr3 = CARDSGSGSEFDYW at 404, score = 9 + 7
umis assigned: [22, 33, 146, 183, 211, 312, 315, 347, 386, 436] and 1 others
of which 10 are surviving nonsolos
reads assigned: 1770
start codons at 62, 218, 260, 326, 359
confident = true

TIG 2[bases=646]
50-397 ==> 0-347 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=1)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYTSSSWVF at 374, score = 8 + 8
umis assigned: [141, 162, 374]
of which 3 are surviving nonsolos
reads assigned: 299
start codons at 50, 251, 258
confident = true

REJECT CONTIGS

TIG 1[bases=564]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
391-428 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [407]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 36, 69, 105, 193, 355, 375, 470
confident = false
did not find CDR3
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATAGCGGTTCAGGGAGTGAGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2006 = TGAGCCGGTAAATGTG-1

using 410 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 3, 398]
surviving nonsolo ucounts = 1[398]
ids = [1]

====================================================================================

UMI info for barcode TGAGCCGGTAAATGTG-1 contig 1 = AGAGCTGCTC...
umi ACTGATGACT = 399 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYGSSLITF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2007 = TGAGCCGGTAAGCACG-1

using 202 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [0]

====================================================================================

UMI info for barcode TGAGCCGGTAAGCACG-1 contig 1 = GCTCTGCTTC...
umi AGTAAAGGTT = 200 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2008 = TGAGCCGGTAAGTGTA-1

using 75 reads

====================================================================================

graph has 62 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 21, 48]
surviving nonsolo ucounts = 1[48]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2018 = TGAGCCGGTACTTAGC-1

using 33 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2019 = TGAGCCGGTAGAGGAA-1

using 207 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode TGAGCCGGTAGAGGAA-1 contig 1 = GGGGGGGGTC...
umi GGTTATCGTC = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-370 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-473 ==> 0-43 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSVAGSYSLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 42, 181, 199, 250, 253, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2020 = TGAGCCGGTAGCTAAA-1

using 148 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 141]
surviving nonsolo ucounts = 1[141]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2030 = TGAGCCGGTCTAACGT-1

using 386 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 379]
surviving nonsolo ucounts = 1[379]
ids = [2]

====================================================================================

UMI info for barcode TGAGCCGGTCTAACGT-1 contig 1 = GAGGAATCAG...
umi CCGCGTCAAC = 380 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 372
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2034 = TGAGCCGGTGATGATA-1

using 212 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 206]
surviving nonsolo ucounts = 1[206]
ids = [3]

====================================================================================

UMI info for barcode TGAGCCGGTGATGATA-1 contig 1 = AGCTCTCAGA...
umi CTGGACGGCA = 211 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=519]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
485-519 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2041 = TGAGCCGGTTACCAGT-1

using 57 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3^2, 5, 39]
surviving nonsolo ucounts = 1[39]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2044 = TGAGCCGGTTACGTCA-1

using 573 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[192, 378]
surviving nonsolo ucounts = 2[192, 378]
ids = [3, 0]

====================================================================================

UMI info for barcode TGAGCCGGTTACGTCA-1 contig 1 = AGACCCAGTC...
umi CATTTTATCC = 379 reads: +388 validated

UMI info for barcode TGAGCCGGTTACGTCA-1 contig 2 = GCTCTGCTTC...
umi TACATCAACT = 192 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYNTYIWTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 373
start codons at 20, 26, 95, 233, 450
confident = false

TIG 2[bases=515]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-515 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSRSASYVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 51, 205, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2047 = TGAGCCGGTTCCACGG-1

using 40 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[4, 5, 23]
surviving nonsolo ucounts = 2[5, 23]
ids = [3, 5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2051 = TGAGCCGGTTCGGGCT-1

using 1365 reads

====================================================================================

graph has 658 edges initially, 12 edges after simplification

total ucounts = 406
nonsolo ucounts = 264[2^60, 3^57, 4^43, 5^30, 6^24, 7^20, 8^7, 9^6, 10^4, 11^3, 12^4, 13^2, 15, 17, 18, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2071 = TGAGCCGTCCCATTAT-1

using 4112 reads

====================================================================================

graph has 3325 edges initially, 48 edges after simplification

total ucounts = 961
nonsolo ucounts = 652[2^145, 3^92, 4^76, 5^64, 6^46, 7^40, 8^40, 9^45, 10^18, 11^30, 12^15, 13^11, 14^7, 15^4, 16^5, 17^6, 18^3, 20^3, 21, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2075 = TGAGCCGTCCGTACAA-1

using 246 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[4, 5, 9, 223]
surviving nonsolo ucounts = 1[223]
ids = [4]

====================================================================================

UMI info for barcode TGAGCCGTCCGTACAA-1 contig 1 = GCTTCAGCTG...
umi CTTTCTTCTT = 216 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=539]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
440-539 ==> 0-99 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 46, 200, 203, 254, 353, 380, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2077 = TGAGCCGTCCTCAATT-1

using 362 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 356]
surviving nonsolo ucounts = 1[356]
ids = [2]

====================================================================================

UMI info for barcode TGAGCCGTCCTCAATT-1 contig 1 = GATCAGGACT...
umi CCCTGCCCCG = 353 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2078 = TGAGCCGTCCTTCAAT-1

using 108 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 3, 95]
surviving nonsolo ucounts = 1[95]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2079 = TGAGCCGTCGTTGCCT-1

using 119 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[117]
surviving nonsolo ucounts = 1[117]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2081 = TGAGCCGTCTAAGCCA-1

using 373 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 358]
surviving nonsolo ucounts = 1[358]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=459]
1-335 ==> 11-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
334-372 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
372-459 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQFNKWPPTF at 311, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 59, 414
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2093 = TGAGGGAAGACCGGAT-1

using 312 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[8, 296]
surviving nonsolo ucounts = 1[296]
ids = [8]

====================================================================================

UMI info for barcode TGAGGGAAGACCGGAT-1 contig 1 = GAAGAGCTGC...
umi GACTTCACCC = 267 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
386-418 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
418-508 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGSSPQTF at 357, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2101 = TGAGGGAAGATATACG-1

using 815 reads

====================================================================================

graph has 258 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[19, 119, 198, 229, 247]
surviving nonsolo ucounts = 5[19, 119, 198, 229, 247]
ids = [7, 3, 6, 4, 1]

====================================================================================

UMI info for barcode TGAGGGAAGATATACG-1 contig 1 = AGCTCTGAGA...
umi CATCCCGTAT = 243 reads: +424 validated
umi GCATGTAGGT = 224 reads: +424 validated

UMI info for barcode TGAGGGAAGATATACG-1 contig 2 = AGCTTCAGCT...
umi CTCGACTTCT = 121 reads: +388 validated
umi GCTAATGGCT = 195 reads: +388 validated
umi TACTTGCCCT = 19 reads: -169 +219 non-validated

GOOD CONTIGS

TIG 1[bases=609]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-609 ==> 0-106 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 50 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 459
start codons at 79, 230, 235, 382, 460
confident = true

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 71 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 329
start codons at 47, 201, 351, 376, 381
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2102 = TGAGGGAAGATCCCAT-1

using 210 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=546]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-236 ==> 0-200 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
236-373 ==> 208-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0) [SHIFT!]
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWPPTF at 349, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 36, 236, 452
confident = false
not full
frameshifted full length stopped transcript of length 546
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2105 = TGAGGGAAGCCAGAAC-1

using 234 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode TGAGGGAAGCCAGAAC-1 contig 1 = GGCATGAGCA...
umi AGTGTTCTCT = 227 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 30-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
34-376 ==> 0-342 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=16)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CHQSNSLPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 3, 34, 232, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2114 = TGAGGGAAGGACTGGT-1

using 240 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [0]

====================================================================================

UMI info for barcode TGAGGGAAGGACTGGT-1 contig 1 = GCTGGGGTCA...
umi TGGTTACATG = 231 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-566 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 28 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2116 = TGAGGGAAGGATATAC-1

using 333 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 4, 321]
surviving nonsolo ucounts = 1[321]
ids = [4]

====================================================================================

UMI info for barcode TGAGGGAAGGATATAC-1 contig 1 = GGGAGATCAC...
umi CGGCTATATG = 294 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=504]
21-374 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
423-457 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-504 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 363, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 21, 219, 224, 241, 285, 318
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2120 = TGAGGGAAGGCTCTTA-1

using 598 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3, 4, 231, 351]
surviving nonsolo ucounts = 2[231, 351]
ids = [5, 6]

====================================================================================

UMI info for barcode TGAGGGAAGGCTCTTA-1 contig 1 = GAGTCAGTCT...
umi TCTATTGGGT = 352 reads: +388 validated

UMI info for barcode TGAGGGAAGGCTCTTA-1 contig 2 = TCTGAGAGAG...
umi GTGACACCGC = 223 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 25, 31, 87, 100, 236, 455
confident = false

TIG 2[bases=581]
0-76 ==> 3-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
76-429 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
453-500 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
500-581 ==> 0-81 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDRAATARLGGMDVW at 418, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 76, 227, 232, 379, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2121 = TGAGGGAAGGGTATCG-1

using 257 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [1]

====================================================================================

UMI info for barcode TGAGGGAAGGGTATCG-1 contig 1 = ATCACATAAC...
umi AGTTCAATTC = 247 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=544]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-544 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2123 = TGAGGGAAGGTGCTTT-1

using 10313 reads

====================================================================================

graph has 7829 edges initially, 120 edges after simplification

total ucounts = 1531
nonsolo ucounts = 1169[2^229, 3^142, 4^130, 5^100, 6^91, 7^84, 8^78, 9^68, 10^50, 11^51, 12^37, 13^26, 14^24, 15^11, 16^14, 17^7, 18^5, 19, 20^4, 21, 22, 24, 25, 26, 44, 66, 72, 94, 212, 232, 297, 311^2, 320, 335, 389]
surviving nonsolo ucounts = 10[44, 94, 212, 232, 297, 311^2, 320, 335, 389]
ids = [1199, 52, 214, 1408, 780, 309, 1505, 839, 67, 1475]

====================================================================================

UMI info for barcode TGAGGGAAGGTGCTTT-1 contig 1 = ATGTTCGCAG...
umi AACTTTTCAA = 20 reads: +75 -1 +65 -253 non-validated
umi AAGGTTGAAA = 334 reads: +394 validated
umi AGCGCAGCGC = 216 reads: +394 validated
umi ATGTAAAAAT = 313 reads: +394 validated
umi GAACCTTTAC = 297 reads: +394 validated
umi GATATGTCTG = 324 reads: +394 validated
umi TCAGAGTTTG = 44 reads: +394 validated
umi TTAGATGTTA = 238 reads: +394 validated
umi TTGTACTTCG = 385 reads: +394 validated
umi TTTCTTCGCT = 317 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=619]
0-89 ==> 0-89 on |249|IGKV1D-33|5'UTR| [len=89] (mis=0)
89-440 ==> 0-351 on |250|IGKV1D-33|L-REGION+V-REGION| [len=351] (mis=0)
445-483 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
483-619 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 374 reads
cdr3 = CQQYDNLPPLFTF at 416, score = 9 + 8
umis assigned: [52, 67, 214, 309, 780, 839, 1199, 1408, 1475, 1505]
of which 10 are surviving nonsolos
reads assigned: 2435
start codons at 0, 89, 95, 151, 164, 303, 426, 525
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2126 = TGAGGGAAGTATTGGA-1

using 102 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 11, 85]
surviving nonsolo ucounts = 1[85]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2127 = TGAGGGAAGTCAATAG-1

using 273 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 267]
surviving nonsolo ucounts = 1[267]
ids = [4]

====================================================================================

UMI info for barcode TGAGGGAAGTCAATAG-1 contig 1 = GGGGAGTCAG...
umi TGGTTTTCCG = 240 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=451]
34-282 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=33)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-451 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLHYDNRRRTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 34, 90, 103, 242, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2129 = TGAGGGAAGTCGATAA-1

using 75 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 68]
surviving nonsolo ucounts = 1[68]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2135 = TGAGGGAAGTGTTGAA-1

using 91 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 17[2^4, 3^6, 4, 5^3, 6, 9, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2137 = TGAGGGAAGTTCCACA-1

using 748 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[748]
surviving nonsolo ucounts = 1[748]
ids = [0]

====================================================================================

UMI info for barcode TGAGGGAAGTTCCACA-1 contig 1 = GGGGAGGAAC...
umi ATTTAGGTCG = 751 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 142 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 741
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2138 = TGAGGGAAGTTCGCAT-1

using 617 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 4^2, 11, 281, 313]
surviving nonsolo ucounts = 2[281, 313]
ids = [3, 5]

====================================================================================

UMI info for barcode TGAGGGAAGTTCGCAT-1 contig 1 = GGGGTCTCAG...
umi CAATAATGAT = 267 reads: +388 validated

UMI info for barcode TGAGGGAAGTTCGCAT-1 contig 2 = GGGGATCAGT...
umi TTCCTCTCTC = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-551 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 38, 195, 246, 345, 372
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2148 = TGAGGGACAATCTGCA-1

using 895 reads

====================================================================================

graph has 274 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 884]
surviving nonsolo ucounts = 1[884]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=500]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-92 ==> 0-46 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=0)
88-226 ==> 170-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
251-289 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
289-500 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 871
start codons at 46, 129, 222
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2167 = TGAGGGACAGCGAACA-1

using 254 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[10, 241]
surviving nonsolo ucounts = 1[241]
ids = [4]

====================================================================================

UMI info for barcode TGAGGGACAGCGAACA-1 contig 1 = ATACTTTCTG...
umi TTACGTCCAT = 1 reads: -41 +3 -2 +1 -1 +2 -1 +1 -3X +1 -1X +2 -1 +5 -1 +5 -1 +2 -1 +2 -3X +1 -2 +1 -1 +2 -1 +1 -3 +3 -314 invalidated
umi TTTACGTCCA = 192 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=504]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
404-446 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
446-504 ==> 0-58 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARERSSGGLDVW at 376, score = 9 + 7
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 37, 81, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2172 = TGAGGGACAGTTTACG-1

using 524 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 228, 284]
surviving nonsolo ucounts = 2[228, 284]
ids = [3, 6]

====================================================================================

UMI info for barcode TGAGGGACAGTTTACG-1 contig 1 = AGCTTCAGCT...
umi CATCACATTA = 218 reads: +388 validated

UMI info for barcode TGAGGGACAGTTTACG-1 contig 2 = GAGGAACTGC...
umi GCCCACGCTT = 286 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-548 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQRSNRLTF at 354, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 33, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2173 = TGAGGGACATACAGCT-1

using 206 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 199]
surviving nonsolo ucounts = 1[199]
ids = [5]

====================================================================================

UMI info for barcode TGAGGGACATACAGCT-1 contig 1 = CAGCTTCAGC...
umi TGATTGCAGG = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
436-468 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CASWDDSLRGRVF at 369, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 48, 202, 352, 377, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2178 = TGAGGGACATGAACCT-1

using 295 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 285]
surviving nonsolo ucounts = 1[285]
ids = [9]

====================================================================================

UMI info for barcode TGAGGGACATGAACCT-1 contig 1 = GATCAGGACT...
umi TTTTTCTTGC = 288 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2183 = TGAGGGAGTACCATCA-1

using 351 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[349]
surviving nonsolo ucounts = 1[349]
ids = [1]

====================================================================================

UMI info for barcode TGAGGGAGTACCATCA-1 contig 1 = GATCAGGACT...
umi CTGCGTTTGC = 352 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2184 = TGAGGGAGTACCGCTG-1

using 156 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

UMI info for barcode TGAGGGAGTACCGCTG-1 contig 1 = ATCATCCAAC...
umi CACCTTGTAC = 136 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=539]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=1)
426-457 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=0)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
500-539 ==> 0-39 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARGSPGDLGYCSGGSCYSDDYW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 58, 214, 256, 322, 355, 458, 518
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2187 = TGAGGGAGTAGCGCTC-1

using 296 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[292]
surviving nonsolo ucounts = 1[292]
ids = [3]

====================================================================================

UMI info for barcode TGAGGGAGTAGCGCTC-1 contig 1 = TGGGGAGGAA...
umi TGCCTTAGCC = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-512 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2193 = TGAGGGAGTCATATGC-1

using 464 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 112, 143, 200]
surviving nonsolo ucounts = 2[112, 200]
ids = [8, 10]

====================================================================================

UMI info for barcode TGAGGGAGTCATATGC-1 contig 1 = GGGCCTCAGG...
umi GATCCTAACG = 107 reads: +373 validated
umi TTCTCCCGTA = 181 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=514]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-371 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=1)
370-408 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
408-514 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CQAWDSSVVF at 350, score = 6 + 8
umis assigned: [8, 10]
of which 2 are surviving nonsolos
reads assigned: 286
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2198 = TGAGGGAGTCGACTAT-1

using 152 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[148]
surviving nonsolo ucounts = 1[148]
ids = [2]

====================================================================================

UMI info for barcode TGAGGGAGTCGACTAT-1 contig 1 = GTCAGACCCA...
umi ATCTTTGTTC = 141 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-473 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQANSFPQTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2202 = TGAGGGAGTGACTACT-1

using 310 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 300]
surviving nonsolo ucounts = 1[300]
ids = [4]

====================================================================================

UMI info for barcode TGAGGGAGTGACTACT-1 contig 1 = GGGGTCACAA...
umi GCCGCATTCT = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=15)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 40 reads
cdr3 = CCSYAGSSTWVF at 362, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 38, 174, 177, 246, 372, 551
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2205 = TGAGGGAGTGCACGAA-1

using 234 reads

====================================================================================

graph has 129 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode TGAGGGAGTGCACGAA-1 contig 1 = CCCCTAGATC...
umi TGTCTCAATA = 217 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=527]
0-23 ==> 36-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
23-376 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
425-459 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
459-527 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 365, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 23, 221, 226, 243, 287, 320, 513
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2206 = TGAGGGAGTGCAGGTA-1

using 324 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 319]
surviving nonsolo ucounts = 1[319]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=354]
0-178 ==> 182-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
180-218 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
218-354 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPLFTF at 154, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 137, 157, 260
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2220 = TGAGGGATCACCATAG-1

using 88 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 73]
surviving nonsolo ucounts = 1[73]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
0-301 ==> 62-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=17)
299-338 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
338-474 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYGSPRTF at 277, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 7, 260, 290, 380
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2226 = TGAGGGATCCCACTTG-1

using 249 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 238]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2228 = TGAGGGATCCGTAGGC-1

using 400 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 10, 376]
surviving nonsolo ucounts = 1[376]
ids = [7]

====================================================================================

UMI info for barcode TGAGGGATCCGTAGGC-1 contig 1 = GGGGAGGAAC...
umi CGTATACGTA = 381 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYNNWPPITF at 357, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2231 = TGAGGGATCGAATGGG-1

using 435 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[7, 69, 357]
surviving nonsolo ucounts = 2[69, 357]
ids = [1, 0]

====================================================================================

UMI info for barcode TGAGGGATCGAATGGG-1 contig 1 = GTCAGTCCCA...
umi GTTACTACTA = 353 reads: +388 validated
umi TAAAATCGTA = 69 reads: -20 +368 non-validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-355 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 71 reads
cdr3 = CQHLVTHPISF at 350, score = 9 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 419
start codons at 23, 29, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2233 = TGAGGGATCGCGGATC-1

using 256 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 5, 241]
surviving nonsolo ucounts = 1[241]
ids = [7]

====================================================================================

UMI info for barcode TGAGGGATCGCGGATC-1 contig 1 = AGGAGTCAGA...
umi GCTTGTCTGA = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=9)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQANNFPITF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2242 = TGAGGGATCTTTACAC-1

using 354 reads

====================================================================================

graph has 199 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2^2, 3, 4, 5, 125, 202]
surviving nonsolo ucounts = 2[125, 202]
ids = [15, 0]

====================================================================================

UMI info for barcode TGAGGGATCTTTACAC-1 contig 1 = GGGCACAAGA...
umi TCGACATTCT = 119 reads: +424 validated

UMI info for barcode TGAGGGATCTTTACAC-1 contig 2 = AGCTTCAGCT...
umi AGGTCTATTC = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=531]
12-365 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
436-531 ==> 0-95 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CARGAGITTRAYYFDYW at 354, score = 9 + 7
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 116
start codons at 12, 56
confident = false

TIG 2[bases=528]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=28)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-528 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CASWDDSVNGIIF at 368, score = 5 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2244 = TGATTTCAGACCACGA-1

using 65 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 61]
surviving nonsolo ucounts = 1[61]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=436]
0-353 ==> 18-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
385-433 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
cdr3 = CARGSGILVIAIEDYYFDHW at 342, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 3, 47, 133, 220
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2246 = TGATTTCAGAGCAATT-1

using 127 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 8, 104]
surviving nonsolo ucounts = 1[104]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2250 = TGATTTCAGATGCCAG-1

using 382 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3^2, 15, 354]
surviving nonsolo ucounts = 1[354]
ids = [4]

====================================================================================

UMI info for barcode TGATTTCAGATGCCAG-1 contig 1 = GAGTCAGTCC...
umi CAAAACACTA = 349 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=552]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYDNLPSITF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 25, 31, 87, 100, 239, 362, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2256 = TGATTTCAGCTAGTTC-1

using 18380 reads

====================================================================================

graph has 6193 edges initially, 74 edges after simplification

total ucounts = 942
nonsolo ucounts = 436[2^141, 3^95, 4^46, 5^29, 6^21, 7^15, 8^6, 9^3, 10^5, 11^2, 12, 13^2, 14, 20, 23, 32, 35, 37, 53, 65^2, 102, 122, 142, 145, 160, 164, 176, 178, 192, 195, 197, 199, 211^2, 217, 222, 225, 227, 231, 233, 242, 243, 250, 251^2, 257, 258, 260, 263, 267, 268, 270, 271, 278, 280, 283^2, 284^2, 289, 295, 300, 301, 305, 312^3, 316, 317, 330, 331, 333, 337, 340, 343, 356, 368, 369, 375, 423, 462]
surviving nonsolo ucounts = 65[10, 23, 32, 53, 102, 122, 142, 145, 160, 164, 176, 178, 192, 195, 197, 199, 211^2, 217, 222, 225, 227, 231, 233, 242, 243, 250, 251^2, 257, 258, 260, 263, 267, 268, 270, 271, 278, 280, 283^2, 284^2, 289, 295, 300, 301, 305, 312^3, 316, 317, 330, 331, 333, 337, 340, 343, 356, 368, 369, 375, 423, 462]
ids = [109, 661, 744, 679, 140, 360, 534, 882, 441, 507, ...]

====================================================================================

UMI info for barcode TGATTTCAGCTAGTTC-1 contig 1 = TGGGGAGGAG...
umi AACCATGCAA = 252 reads: +388 validated
umi AATAATCTTA = 312 reads: +388 validated
umi AATGTTACCT = 299 reads: +388 validated
umi ACCCTCTCAG = 192 reads: +388 validated
umi ACTTAAGGAC = 103 reads: +388 validated
umi ACTTACCCGC = 355 reads: +388 validated
umi AGCTTGTCAA = 262 reads: +388 validated
umi AGGTCCCTGT = 380 reads: +388 validated
umi CAACAGGTCG = 251 reads: +388 validated
umi CACCCAATTT = 331 reads: +388 validated
umi CACTTACGTA = 307 reads: +388 validated
umi CAGTGATCGT = 213 reads: +388 validated
umi CATCCCCCGT = 218 reads: +388 validated
umi CATGGGCGGA = 421 reads: +388 validated
umi CCCTAGGGTC = 316 reads: +388 validated
umi CCTCGCTCCG = 278 reads: +388 validated
umi CGAAGTCACA = 228 reads: +388 validated
umi CGCCCAGTAA = 287 reads: +388 validated
umi CGTTATACCA = 264 reads: +388 validated
umi CTCTCGCACA = 161 reads: +388 validated
umi CTGTTGTCAT = 272 reads: +388 validated
umi CTTCTTTGCA = 198 reads: +388 validated
umi GAATTACATC = 254 reads: +388 validated
umi GACAGTGGGA = 275 reads: +388 validated
umi GAGCGGAATA = 164 reads: +388 validated
umi GAGTTACTGG = 258 reads: +388 validated
umi GATTGGCATC = 334 reads: +388 validated
umi GCACCCTCAC = 141 reads: +388 validated
umi GCAGTTTCGG = 274 reads: +388 validated
umi GCGCTATTCT = 368 reads: +388 validated
umi GCTATCACCC = 279 reads: +388 validated
umi GCTCGCCTTT = 339 reads: +388 validated
umi GGATCACCGT = 223 reads: +388 validated
umi GGATGTTGTC = 301 reads: +388 validated
umi GGTCTTCTCC = 335 reads: +388 validated
umi GTAATGGTCA = 283 reads: +388 validated
umi GTCCAATACT = 240 reads: +388 validated
umi TAAGAGATCG = 319 reads: +388 validated
umi TAGACAACTC = 233 reads: +388 validated
umi TAGCTGAGTC = 371 reads: +388 validated
umi TCACTGGGGC = 227 reads: +388 validated
umi TCATGCATCA = 337 reads: +388 validated
umi TCTCTCCGGT = 197 reads: +388 validated
umi TCTTAATGTA = 314 reads: +388 validated
umi TGAACGGTCG = 285 reads: +388 validated
umi TGTTCAATTC = 177 reads: +388 validated
umi TTAACCCGCG = 245 reads: +388 validated
umi TTATAACCTT = 175 reads: +325 -1 +4 -1 +20 -1 +25 -1 +10 non-validated
umi TTCAGAAGTA = 267 reads: +388 validated
umi TTCCTCACAT = 98 reads: +377 -11 non-validated
umi TTGAGACCAT = 296 reads: +388 validated
umi TTGATAATCT = 186 reads: -343 +45 non-validated
umi TTGATAGCCT = 312 reads: +388 validated
umi TTTGGATCCG = 274 reads: +388 validated
umi TTTTCACGTA = 182 reads: +388 validated

UMI info for barcode TGATTTCAGCTAGTTC-1 contig 2 = TCTGAGAGTC...
umi CTTACTCAGG = 208 reads: +445 validated
umi TACGGATCCA = 54 reads: +430 -15 non-validated
umi TTCTATGAGG = 244 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 53 umis using 2182 reads
cdr3 = CQQSYSTPWQF at 359, score = 8 + 7
umis assigned: [25, 56, 74, 101, 140, 141, 163, 176, 256, 272] and 45 others
of which 55 are surviving nonsolos
reads assigned: 14243
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=566]
0-31 ==> 70-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
31-387 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=15)
393-424 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=9)
425-476 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
476-566 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 55 reads
cdr3 = CARGQPFVDFSSGYYVPNWFDPW at 376, score = 9 + 7
umis assigned: [458, 679, 888]
of which 3 are surviving nonsolos
reads assigned: 502
start codons at 31, 75
confident = true

REJECT CONTIGS

TIG 1[bases=560]
1-399 ==> 2247-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
426-489 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [109, 218, 360, 385, 661, 744]
of which 6 are surviving nonsolos
reads assigned: 826
start codons at 446
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGGACAGCCCTTCGTCGATTTTTCGAGTGGTTATTACGTCCCGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCACGAGTCTGCAACCTGAAGATTTTGCAATTTACTACTGTCAACAGAGTTACAGTACCCCGTGGCAGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2257 = TGATTTCAGCTGAACG-1

using 337 reads

====================================================================================

graph has 169 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 324]
surviving nonsolo ucounts = 1[324]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCAGCTGAACG-1 contig 1 = AGGAGTCAGA...
umi AGAACCACAT = 332 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2271 = TGATTTCAGTCCTCCT-1

using 568 reads

====================================================================================

graph has 876 edges initially, 2 edges after simplification

total ucounts = 284
nonsolo ucounts = 108[2^44, 3^25, 4^13, 5^7, 6^9, 7^3, 8^2, 9^2, 10^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2273 = TGATTTCAGTGAAGTT-1

using 225 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 222]
surviving nonsolo ucounts = 1[222]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCAGTGAAGTT-1 contig 1 = GATCAGGACT...
umi AAACCATGGC = 227 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2276 = TGATTTCAGTGTCCAT-1

using 547 reads

====================================================================================

graph has 836 edges initially, 6 edges after simplification

total ucounts = 301
nonsolo ucounts = 118[2^56, 3^21, 4^24, 5^13, 6, 7^2, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2280 = TGATTTCCAACACCTA-1

using 129 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 119]
surviving nonsolo ucounts = 1[119]
ids = [2]

====================================================================================

UMI info for barcode TGATTTCCAACACCTA-1 contig 1 = GCTCTGCTTC...
umi ATCTCCATTT = 113 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=543]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
445-543 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQSYDISLSAHVVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 51, 205, 208, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2284 = TGATTTCCAAGCCCAC-1

using 330 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [2]

====================================================================================

UMI info for barcode TGATTTCCAAGCCCAC-1 contig 1 = AGGAGTCAGA...
umi TACTCTTTGT = 331 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2286 = TGATTTCCAAGGACTG-1

using 316 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 4[2, 3, 10, 286]
surviving nonsolo ucounts = 1[286]
ids = [10]

====================================================================================

UMI info for barcode TGATTTCCAAGGACTG-1 contig 1 = GAGCTGCTCA...
umi GAATCTAGGA = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-517 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPRYTF at 354, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 30, 238, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2289 = TGATTTCCAATAGCGG-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2293 = TGATTTCCACAGACTT-1

using 406 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 395]
surviving nonsolo ucounts = 1[395]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCCACAGACTT-1 contig 1 = GAGTCAGTCT...
umi CCTATGCTAT = 396 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2303 = TGATTTCCACTGTGTA-1

using 299 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 291]
surviving nonsolo ucounts = 1[291]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCCACTGTGTA-1 contig 1 = GGGGAAAACA...
umi ATTGTTGTCC = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-545 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CSSWDSSLSAWVF at 363, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 42, 181, 253, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2304 = TGATTTCCACTTCGAA-1

using 252 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[249]
surviving nonsolo ucounts = 1[249]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCCACTTCGAA-1 contig 1 = GAGCTACAAC...
umi CAGATCTGGG = 244 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=487]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-487 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYYSTPVTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2315 = TGATTTCCAGCTGTTA-1

using 237 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3^2, 6, 10, 207]
surviving nonsolo ucounts = 1[207]
ids = [12]

====================================================================================

UMI info for barcode TGATTTCCAGCTGTTA-1 contig 1 = GAGGTGCCTT...
umi TGTCTTACCT = 194 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=544]
0-69 ==> 10-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
69-422 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
433-460 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=4)
456-517 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=4)
517-544 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARVGRARITMVRGVPNYYYYMDVW at 411, score = 9 + 7
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 69, 225, 346, 372, 441, 474, 535
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2316 = TGATTTCCAGCTTCGG-1

using 1717 reads

====================================================================================

graph has 2315 edges initially, 14 edges after simplification

total ucounts = 689
nonsolo ucounts = 316[2^136, 3^61, 4^38, 5^30, 6^18, 7^8, 8^9, 9^2, 10^2, 11^7, 12, 13, 14, 18, 179]
surviving nonsolo ucounts = 1[179]
ids = [68]

====================================================================================

UMI info for barcode TGATTTCCAGCTTCGG-1 contig 1 = GTAGAGAAGA...
umi ACTAGTCTTA = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-33 ==> 81-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
33-386 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
421-516 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLRGRVF at 354, score = 8 + 8
umis assigned: [68]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 33, 187, 337, 362, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2327 = TGATTTCGTAAGGGCT-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2329 = TGATTTCGTACCGGCT-1

using 415 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[409]
surviving nonsolo ucounts = 1[409]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=546]
3-68 ==> 5672-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 406
start codons at 20, 26, 82, 95, 231, 452
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2331 = TGATTTCGTACTTGAC-1

using 266 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 261]
surviving nonsolo ucounts = 1[261]
ids = [2]

====================================================================================

UMI info for barcode TGATTTCGTACTTGAC-1 contig 1 = GAGTCAGTCT...
umi GCAAGCTGTA = 261 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2332 = TGATTTCGTAGATTAG-1

using 486 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^2, 3^2, 4, 5, 209, 249]
surviving nonsolo ucounts = 2[209, 249]
ids = [16, 4]

====================================================================================

UMI info for barcode TGATTTCGTAGATTAG-1 contig 1 = GAGCTCTACC...
umi CCCTCAAGCC = 239 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=494]
52-412 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=24)
411-449 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
449-494 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CKQGKYWRITF at 388, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 52, 85, 121, 209, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2336 = TGATTTCGTCAAAGAT-1

using 379 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 372]
surviving nonsolo ucounts = 1[372]
ids = [0]

====================================================================================

UMI info for barcode TGATTTCGTCAAAGAT-1 contig 1 = GGAGTCAGTC...
umi AATAGTCGCT = 370 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-358 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQHLVTHPISF at 353, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 26, 32, 237, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2346 = TGATTTCGTGTCTGAT-1

using 64 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 53]
surviving nonsolo ucounts = 1[53]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2348 = TGATTTCGTGTGCGTC-1

using 481 reads

====================================================================================

graph has 178 edges initially, 42 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[226, 253]
surviving nonsolo ucounts = 2[226, 253]
ids = [1, 3]

====================================================================================

UMI info for barcode TGATTTCGTGTGCGTC-1 contig 1 = GGAGTCAGAC...
umi TGGTCGCATA = 254 reads: +388 validated

UMI info for barcode TGATTTCGTGTGCGTC-1 contig 2 = TGGGGGAGTC...
umi CGGATACATG = 226 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false

TIG 2[bases=551]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYSTPSF at 357, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 30, 36, 92, 105, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2375 = TGATTTCTCCTGTAGA-1

using 198 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 186]
surviving nonsolo ucounts = 1[186]
ids = [4]

====================================================================================

UMI info for barcode TGATTTCTCCTGTAGA-1 contig 1 = GGCTGGGGTC...
umi CCTTATATTG = 180 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=527]
42-364 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-527 ==> 0-94 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CCSFTVNTRSYVF at 366, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 42, 199, 243, 253, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2380 = TGATTTCTCGGATGTT-1

using 173 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 167]
surviving nonsolo ucounts = 1[167]
ids = [4]

====================================================================================

UMI info for barcode TGATTTCTCGGATGTT-1 contig 1 = AGCTCTGAGA...
umi CTTTGTGTTC = 168 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=567]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=30)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
515-567 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARVLDDYCLGGICSYYFDSW at 421, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 79, 382, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2388 = TGATTTCTCTATCCCG-1

using 473 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 7, 8, 190, 263]
surviving nonsolo ucounts = 2[190, 263]
ids = [2, 0]

====================================================================================

UMI info for barcode TGATTTCTCTATCCCG-1 contig 1 = TGAGCGCAGA...
umi CACAGCTTCA = 187 reads: +388 validated

UMI info for barcode TGATTTCTCTATCCCG-1 contig 2 = TGGGGAGGAA...
umi AAGATCTATT = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-546 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 36, 241, 365
confident = false

TIG 2[bases=493]
32-368 ==> 0-336 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-493 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYVTYPWTF at 359, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 32, 38, 107, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2393 = TGATTTCTCTGCAAGT-1

using 20 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 4, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2395 = TGATTTCTCTGGTGTA-1

using 38 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3^2, 22]
surviving nonsolo ucounts = 1[22]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2400 = TGCACCTAGAAACGCC-1

using 228 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 7, 213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode TGCACCTAGAAACGCC-1 contig 1 = CAGGACTCCT...
umi CCTTCCATCG = 206 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 3-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
27-387 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-487 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTPPWTF at 363, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 27, 60, 96, 184, 346, 366, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2404 = TGCACCTAGACGACGT-1

using 11940 reads

====================================================================================

graph has 4608 edges initially, 76 edges after simplification

total ucounts = 781
nonsolo ucounts = 348[2^143, 3^75, 4^41, 5^19, 6^13, 7^8, 8^9, 9^3, 10^3, 12^2, 16, 17, 69, 84, 202, 223, 229, 237, 248, 255^2, 267, 275, 286, 287, 295, 302, 313^2, 333, 346, 363, 367^2, 385, 414, 500, 542, 547, 566, 629, 917]
surviving nonsolo ucounts = 29[84, 202, 223, 229, 237, 248, 255^2, 267, 275, 286, 287, 295, 302, 313^2, 333, 346, 363, 367^2, 385, 414, 500, 542, 547, 566, 629, 917]
ids = [188, 367, 391, 679, 563, 197, 319, 572, 50, 243, ...]

====================================================================================

UMI info for barcode TGCACCTAGACGACGT-1 contig 1 = TGGGGAGGAA...
umi ACAAATGGCG = 271 reads: +388 validated
umi ACCATCTTTT = 364 reads: -350X +1 -4X +1 -1XX +6 -2XX +15 -2XX +6 invalidated
umi AGGGTTCCAT = 331 reads: +388 validated
umi CAAGACCTTC = 247 reads: +388 validated
umi CAAGGACCCT = 558 reads: -315 +1 -4X +1 -1XX +1 -2XX +1 -11XX +1 -12XX +30 -2XX +6 invalidated
umi CATAGCTCGG = 274 reads: +388 validated
umi CATTGTCCTG = 342 reads: -320X +1 -1XX +1 -2XX +1 -11XX +1 -12XX +30 -2XX +6 invalidated
umi CCTTATTCCT = 254 reads: +388 validated
umi CTCCACACCT = 199 reads: +388 validated
umi CTCTGAGGTA = 372 reads: +388 validated
umi CTTTACTGCT = 223 reads: +388 validated
umi GAAGATATCT = 307 reads: +388 validated
umi GAGACAGCAA = 1 reads: -354X +2 -1X +11 -1 +2 -5X +4 -2X +1 -1X +4 invalidated
umi GATTCTAGGG = 415 reads: -320X +1 -1X +1 -2XX +1 -11XX +1 -12XX +30 -2XX +6 invalidated
umi GCAAGCGGGT = 295 reads: +227 -3XX +158 invalidated
umi GGACGGTCAG = 295 reads: +388 validated
umi GGCATTGCTC = 112 reads: -354X +2 -2XX +6 -2XX +8 -1XX +5 -2XX +6 invalidated
umi GGTGTTTGGT = 364 reads: +388 validated
umi GTTTTGCATC = 289 reads: +388 validated
umi TAAACCTGGC = 829 reads: -314 +1 -5XX +1 -1XX +1 -2XX +1 -11XX +1 -12XX +30 -2XX +6 invalidated
umi TACCATAGCC = 238 reads: +388 validated
umi TACCTCTTTT = 257 reads: +388 validated
umi TAGCGCCCGG = 545 reads: +388 validated
umi TATGTCAATC = 350 reads: +388 validated
umi TCAACAGAGT = 226 reads: -350X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -2XX +6 invalidated
umi TCCCATTGCG = 552 reads: +388 validated
umi TCTGGATCAC = 226 reads: +388 validated
umi TGTGCCATAG = 622 reads: -320X +1 -1XX +1 -2XX +1 -11XX +1 -12XX +30 -2XX +6 invalidated

UMI info for barcode TGCACCTAGACGACGT-1 contig 2 = GCATTCAGTG...
umi ATTGCAGTTC = 83 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=12)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 863 reads
cdr3 = CLHHNNYPWTF at 359, score = 9 + 7
umis assigned: [50, 62, 126, 197, 200, 243, 269, 319, 367, 374] and 18 others
of which 28 are surviving nonsolos
reads assigned: 9127
start codons at 32, 38, 107, 189, 462
confident = true

TIG 2[bases=481]
37-316 ==> 0-279 on |138|IGHV3-43|L-REGION+V-REGION| [len=354] (mis=35)
418-467 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
junction support: 1 umis using 11 reads
cdr3 = CAKGNWGSVWGEDSGLDPW at 379, score = 9 + 7
umis assigned: [188]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 37, 97, 182, 188, 193, 249, 254, 272, 340
confident = true
now this is a cell
paired!

GGCTTCTATTACTGTGCTAAAGGAAACTGGGGATCGGTGTGGGGTGAGGATTCCGGTCTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTGCACCATAATAATTACCCGTGGACGTTCGGCCAAGGGACCAAGGTGGACCTCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2406 = TGCACCTAGAGAACAG-1

using 82 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[2^3, 3^2, 4, 5^3, 6, 7, 9^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2408 = TGCACCTAGATACACA-1

using 474 reads

====================================================================================

graph has 644 edges initially, 10 edges after simplification

total ucounts = 255
nonsolo ucounts = 98[2^53, 3^24, 4^5, 5^8, 6^2, 8, 10^2, 11, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2412 = TGCACCTAGATCGGGT-1

using 1773 reads

====================================================================================

graph has 1834 edges initially, 12 edges after simplification

total ucounts = 545
nonsolo ucounts = 271[2^100, 3^65, 4^38, 5^24, 6^17, 7^10, 8^8, 10^4, 12, 16, 30, 240, 258]
surviving nonsolo ucounts = 2[240, 258]
ids = [254, 165]

====================================================================================

UMI info for barcode TGCACCTAGATCGGGT-1 contig 1 = AGAGTTCTGG...
umi CAAGTCGGAG = 257 reads: +388 validated
umi CTATTAGACG = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=621]
0-22 ==> 18-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
22-359 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
410-621 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 71 reads
cdr3 = CNSRDSSGNHPYVVF at 337, score = 8 + 8
umis assigned: [165, 254]
of which 2 are surviving nonsolos
reads assigned: 487
start codons at 22, 141, 170, 221, 320, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2428 = TGCACCTAGGCATTGG-1

using 329 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 4, 46, 271]
surviving nonsolo ucounts = 2[46, 271]
ids = [5, 4]

====================================================================================

UMI info for barcode TGCACCTAGGCATTGG-1 contig 1 = AGCTTCAGCT...
umi TGCATTTTTG = 257 reads: +388 validated
umi TGCATTTTTT = 45 reads: +311 -1 +9 -51 +7 -1 +3 -1 +4 non-validated

GOOD CONTIGS

TIG 1[bases=559]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-559 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 296
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2431 = TGCACCTAGGGTGTTG-1

using 103 reads

====================================================================================

graph has 92 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^4, 3, 4, 6, 8, 9, 10, 17, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2442 = TGCACCTAGTCTTGCA-1

using 463 reads

====================================================================================

graph has 146 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 4, 200, 250]
surviving nonsolo ucounts = 1[250]
ids = [6]

====================================================================================

UMI info for barcode TGCACCTAGTCTTGCA-1 contig 1 = GCTGGGGTCT...
umi GTTCTTTCAG = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-379 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=10)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
429-585 ==> 0-156 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYTSSNTCVF at 365, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 41, 198, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2445 = TGCACCTAGTGTTTGC-1

using 608 reads

====================================================================================

graph has 200 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 282, 316]
surviving nonsolo ucounts = 2[282, 316]
ids = [5, 3]

====================================================================================

UMI info for barcode TGCACCTAGTGTTTGC-1 contig 1 = AGGAGTCAGA...
umi GCTAGGTTGG = 261 reads: +388 validated

UMI info for barcode TGCACCTAGTGTTTGC-1 contig 2 = GGAGGAACTG...
umi ATCGGCTCAG = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYSWTF at 354, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 2[bases=515]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
422-515 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQHSNWPLMYTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 34, 239, 242, 382, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2447 = TGCACCTAGTTCCACA-1

using 304 reads

====================================================================================

graph has 217 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 6, 8, 276]
surviving nonsolo ucounts = 1[276]
ids = [6]

====================================================================================

UMI info for barcode TGCACCTAGTTCCACA-1 contig 1 = GGAGCCCCAG...
umi CTCGCTTGAC = 268 reads: +409 validated
umi TAGCTTTTAC = 3 reads: +13 -60 +1 -5X +6 -5X +2 -1X +9 -2X +1 -1 +13 -1 +2 -2 +5 -252 +2 -1X +2 -1X +3 -2X +17 invalidated

GOOD CONTIGS

TIG 1[bases=505]
0-68 ==> 168-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
68-399 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
440-477 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
477-505 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CTNLYHFGSEVW at 410, score = 9 + 7
umis assigned: [6, 10]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 68, 224, 285
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2451 = TGCACCTCAAACTGCT-1

using 26 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2458 = TGCACCTCAAGCTGGA-1

using 889 reads

====================================================================================

graph has 356 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 3, 5, 277, 593]
surviving nonsolo ucounts = 2[277, 593]
ids = [3, 12]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-378 ==> 0-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=1)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3, 12]
of which 2 are surviving nonsolos
reads assigned: 857
start codons at 27, 33, 89, 102, 241, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2461 = TGCACCTCAATAGCAA-1

using 35 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 3, 4^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2462 = TGCACCTCAATCGAAA-1

using 620 reads

====================================================================================

graph has 224 edges initially, 12 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 277, 333]
surviving nonsolo ucounts = 2[277, 333]
ids = [1, 9]

====================================================================================

UMI info for barcode TGCACCTCAATCGAAA-1 contig 1 = GAAGAGCTGC...
umi GTCTCTTCAA = 317 reads: +385 validated

UMI info for barcode TGCACCTCAATCGAAA-1 contig 2 = GATCAGGACT...
umi ACCTATCACT = 275 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=499]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYGSSLVTF at 357, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 33, 241, 367, 460
confident = false

TIG 2[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-511 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2469 = TGCACCTCACAGAGGT-1

using 14 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2477 = TGCACCTCAGACAAGC-1

using 20 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2481 = TGCACCTCAGAGCCAA-1

using 25 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2482 = TGCACCTCAGATCGGA-1

using 272 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 267]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2485 = TGCACCTCAGCAGTTT-1

using 1238 reads

====================================================================================

graph has 1600 edges initially, 30 edges after simplification

total ucounts = 643
nonsolo ucounts = 262[2^121, 3^60, 4^36, 5^22, 6^9, 7^6, 8, 9^3, 10, 11^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2493 = TGCACCTCAGTCCTTC-1

using 832 reads

====================================================================================

graph has 234 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 295, 527]
surviving nonsolo ucounts = 2[295, 527]
ids = [6, 2]

====================================================================================

UMI info for barcode TGCACCTCAGTCCTTC-1 contig 1 = AGAGCTCTGG...
umi ACAACCTAAG = 492 reads: -341X +1 -2XX +3 -1XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi GTTACGAGAT = 299 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=1)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=16)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNYWPCTF at 365, score = 9 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 781
start codons at 44, 113, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2499 = TGCACCTCATCCGGGT-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2501 = TGCACCTCATCGGTTA-1

using 2553 reads

====================================================================================

graph has 2960 edges initially, 48 edges after simplification

total ucounts = 1149
nonsolo ucounts = 558[2^231, 3^135, 4^73, 5^49, 6^19, 7^19, 8^13, 9^5, 10^6, 11^3, 12^2, 13, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2504 = TGCACCTCATGCTAGT-1

using 425 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[3, 4, 409]
surviving nonsolo ucounts = 1[409]
ids = [5]

====================================================================================

UMI info for barcode TGCACCTCATGCTAGT-1 contig 1 = TCTCTGCTTC...
umi CTTGTTAATC = 398 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=582]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-582 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQSYDSSLNGSVF at 375, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 389
start codons at 51, 135, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2506 = TGCACCTCATGTTCCC-1

using 24 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2509 = TGCACCTCATTAGGCT-1

using 29 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2522 = TGCACCTGTACCGGCT-1

using 27405 reads

====================================================================================

graph has 19452 edges initially, 509 edges after simplification

total ucounts = 3931
nonsolo ucounts = 2859[2^524, 3^413, 4^297, 5^270, 6^207, 7^197, 8^161, 9^138, 10^112, 11^110, 12^96, 13^71, 14^68, 15^52, 16^28, 17^27, 18^17, 19^13, 20^8, 21^4, 22^5, 23^2, 24^4, 26, 27, 29, 30, 31^2, 43, 45, 46, 53, 76, 83, 210, 216, 229, 233, 238, 240, 245, 247, 273^3, 304, 308, 315, 331, 344, 354, 400, 406^2, 473, 526, 900]
surviving nonsolo ucounts = 24[83, 210, 216, 229, 233, 238, 240, 245, 247, 273^3, 304, 308, 315, 331, 344, 354, 400, 406^2, 473, 526, 900]
ids = [605, 671, 647, 790, 2009, 2131, 2398, 3187, 3787, 826, ...]

====================================================================================

UMI info for barcode TGCACCTGTACCGGCT-1 contig 1 = GGGGAGGAGT...
umi AAGATCACCT = 341 reads: +388 validated
umi AGTTTAGTAT = 73 reads: -358X +2 -3X +2 -3XX +1 -3XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +2 -4XX invalidated
umi ATGTGGTCGG = 233 reads: +388 validated
umi ATTCCGATGA = 277 reads: +388 validated
umi CAAAGCCCAC = 274 reads: +388 validated
umi GACATGTGGA = 235 reads: +388 validated
umi GACGCCTGCT = 272 reads: +388 validated
umi GCAACCCAGT = 238 reads: +388 validated
umi GGCATCTCTT = 237 reads: +388 validated
umi GTCGAGTTCA = 315 reads: +388 validated
umi TACGTTGTAC = 378 reads: -358X +2 -3XX +2 -3XX +1 -3XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +2 -4XX invalidated
umi TCATTATCAG = 384 reads: -363X +2 -3XX +1 -3XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +2 -4XX invalidated
umi TTCCTCGGGC = 387 reads: -359 +1 -3X +2 -3XX +1 -3XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +2 -4XX invalidated
umi TTGTATAATT = 240 reads: +388 validated
umi TTGTTCCGTT = 294 reads: +388 validated

UMI info for barcode TGCACCTGTACCGGCT-1 contig 2 = AGTGACTCCT...
umi ACTAAGACTG = 469 reads: -28 +2 -2X +404 invalidated
umi ATAGTCTATG = 216 reads: +436 validated
umi ATATTTTGCA = 212 reads: +436 validated
umi CGGTTTACGG = 302 reads: +436 validated
umi GGCGTATTTC = 332 reads: -30 +406 non-validated
umi TCATTACCGT = 344 reads: +436 validated
umi TCCTGCTATC = 246 reads: +436 validated
umi TTACTCCGAA = 523 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 470 reads
cdr3 = CQQGYTTPLSF at 358, score = 9 + 8
umis assigned: [123, 605, 790, 826, 898, 2009, 2026, 2131, 2398, 2569] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4132
start codons at 31, 37, 93, 106, 242, 461
confident = true

TIG 2[bases=527]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=16)
436-456 ==> 32-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 230 reads
cdr3 = CAHISTLFRSAYYRPYLDFW at 365, score = 7 + 6
umis assigned: [401, 647, 671, 1623, 2413, 3107, 3187, 3595]
of which 8 are surviving nonsolos
reads assigned: 2608
start codons at 20, 64, 243, 246, 326, 335
confident = true
now this is a cell
paired!

ACATATTACTGTGCGCACATCTCCACTCTTTTCCGGAGTGCTTATTATCGGCCCTACTTAGATTTTTGGGGCCAGGGAGTCCTGGTCTCCGTCTCCTCAG <==> ATCAACTGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGGGTTACACTACCCCTCTCTCTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2532 = TGCACCTGTCATACTG-1

using 74 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[3^3, 4^2, 5, 6^3, 7, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2533 = TGCACCTGTCATCGGC-1

using 986 reads

====================================================================================

graph has 340 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3^2, 972]
surviving nonsolo ucounts = 1[972]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2534 = TGCACCTGTCCAGTAT-1

using 424 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 4, 410]
surviving nonsolo ucounts = 1[410]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2538 = TGCACCTGTCCGCTGA-1

using 63 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 6, 7, 41]
surviving nonsolo ucounts = 1[41]
ids = [6]

====================================================================================

UMI info for barcode TGCACCTGTCCGCTGA-1 contig 1 = CATGGACATG...
umi CGCCTTACTG = 7 reads: +13 -1 +90 -24 +2 -1X +23 -1X +2 -1X +26 -47 +9 -1 +7 -1X +8 -1X +20 -1X +8 -11 +9 -1 +3 -1 +1 -2 +1 -1 +1 -1 +6 -1 +2 -1 +1 -1 +3 -1 +2 -1X +3 -2 +4 -6X +1 -34 invalidated
umi CTCGGGTGTA = 32 reads: -13 +375 non-validated

GOOD CONTIGS

TIG 1[bases=399]
1-354 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
350-389 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
junction support: 1 umis using 7 reads
cdr3 = CQQSYSTSYTF at 328, score = 9 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 38
start codons at 1, 7, 63, 76, 212
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2542 = TGCACCTGTCGAGATG-1

using 71 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 59]
surviving nonsolo ucounts = 1[59]
ids = [4]

====================================================================================

UMI info for barcode TGCACCTGTCGAGATG-1 contig 1 = GAATCAGTCC...
umi TTAAGGGGCT = 54 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=432]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-432 ==> 0-19 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 54
start codons at 25, 31, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2551 = TGCACCTGTGCCTGGT-1

using 157 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 4, 144]
surviving nonsolo ucounts = 1[144]
ids = [2]

====================================================================================

UMI info for barcode TGCACCTGTGCCTGGT-1 contig 1 = GAAGAGCTGC...
umi GCTTTTTTTA = 145 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYGSSLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2556 = TGCACCTGTGGTGTAG-1

using 1539 reads

====================================================================================

graph has 2043 edges initially, 38 edges after simplification

total ucounts = 713
nonsolo ucounts = 338[2^155, 3^69, 4^44, 5^31, 6^12, 7^10, 8^8, 9^2, 10^2, 11, 12, 15, 17^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2578 = TGCACCTTCAACCATG-1

using 246 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^4, 7, 220]
surviving nonsolo ucounts = 1[220]
ids = [7]

====================================================================================

UMI info for barcode TGCACCTTCAACCATG-1 contig 1 = AGCTTCAGCT...
umi CCTAGGATAC = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-505 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2579 = TGCACCTTCAACGAAA-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2607 = TGCACCTTCCGCAGTG-1

using 227 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 6, 209]
surviving nonsolo ucounts = 1[209]
ids = [5]

====================================================================================

UMI info for barcode TGCACCTTCCGCAGTG-1 contig 1 = CTGTGCCCCA...
umi CCCTCCAGGA = 197 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=582]
12-370 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
395-445 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
445-582 ==> 0-137 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 357, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 12, 56, 235, 238, 241, 327, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2623 = TGCACCTTCGGCTACG-1

using 387 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 12[2, 3^3, 4^2, 5^2, 7, 9, 16, 316]
surviving nonsolo ucounts = 1[316]
ids = [10]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2632 = TGCACCTTCTCAAGTG-1

using 686 reads

====================================================================================

graph has 298 edges initially, 6 edges after simplification

total ucounts = 236
nonsolo ucounts = 165[2^55, 3^42, 4^24, 5^22, 6^5, 7^7, 8^3, 9^2, 10^3, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2645 = TGCACCTTCTTTACAC-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2646 = TGCACCTTCTTTCCTC-1

using 205 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 199]
surviving nonsolo ucounts = 1[199]
ids = [2]

====================================================================================

UMI info for barcode TGCACCTTCTTTCCTC-1 contig 1 = GTCAGTCTCA...
umi AGTTCACTTT = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=12)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-473 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSHNSPRTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2653 = TGCCAAAAGACCCACC-1

using 227 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[24, 201]
surviving nonsolo ucounts = 1[201]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=623]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
8-40 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
35-373 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
374-412 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
412-623 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 35, 40, 96, 183, 329, 333
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2661 = TGCCAAAAGAGTACAT-1

using 23 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2663 = TGCCAAAAGAGTGAGA-1

using 11227 reads

====================================================================================

graph has 6433 edges initially, 96 edges after simplification

total ucounts = 1333
nonsolo ucounts = 620[2^209, 3^136, 4^76, 5^57, 6^35, 7^28, 8^13, 9^6, 10^9, 11^5, 12, 13^4, 14^3, 15^3, 16^2, 84, 103, 106, 109, 168, 184, 192, 197, 201, 214, 217, 220, 227, 228, 229, 230, 235, 239, 241, 242, 247, 259, 276^2, 286, 298, 305, 306, 338, 352, 380, 468, 549]
surviving nonsolo ucounts = 33[84, 103, 106, 109, 168, 184, 192, 197, 201, 214, 217, 220, 227, 228, 229, 230, 235, 239, 241, 242, 247, 259, 276^2, 286, 298, 305, 306, 338, 352, 380, 468, 549]
ids = [909, 539, 1287, 672, 266, 1027, 469, 1149, 1051, 777, ...]

====================================================================================

UMI info for barcode TGCCAAAAGAGTGAGA-1 contig 1 = GCAGAGCCTG...
umi ACGTATCGCA = 309 reads: +433 validated
umi CACGCTTTCC = 347 reads: +433 validated
umi CGAATAATAA = 193 reads: +433 validated
umi CTTTGGGCCA = 112 reads: +433 validated
umi GAGTTATATA = 337 reads: +433 validated
umi GCCAGACTGG = 382 reads: +433 validated
umi GTACCTCGCT = 232 reads: +433 validated
umi TCAGAATGTT = 183 reads: +433 validated
umi TCATACACCG = 225 reads: +433 validated
umi TCTTTTGTCT = 230 reads: +433 validated
umi TTTAGTCCTT = 105 reads: +433 validated

UMI info for barcode TGCCAAAAGAGTGAGA-1 contig 2 = AGCTTCAGCT...
umi ATTGTCAATA = 553 reads: +394 validated
umi CAGCATACAG = 294 reads: +394 validated
umi CAGTAAGCCT = 168 reads: +394 validated
umi CAGTGCTGGC = 273 reads: +394 validated
umi CATATTAGCA = 251 reads: +394 validated
umi CCCTGGTTGA = 234 reads: +394 validated
umi CCTACTTTTC = 239 reads: +394 validated
umi CGCTTTACGG = 214 reads: +394 validated
umi CGTGTATGGC = 102 reads: +394 validated
umi GCGGGAATTC = 238 reads: +394 validated
umi GCGTTTAGGT = 210 reads: +394 validated
umi GGCGGCTGCT = 227 reads: +394 validated
umi GTATGAAACG = 237 reads: +394 validated
umi GTTGAGCACA = 84 reads: +394 validated
umi GTTGTGCCCA = 302 reads: +394 validated
umi TAGTTGGCTC = 229 reads: +394 validated
umi TCCCCACCGT = 204 reads: +394 validated
umi TCTCATAGTG = 284 reads: +394 validated
umi TGATAGTGGT = 200 reads: +294 -1XX +1 -2XX +1 -2XX +93 invalidated
umi TTCTTCAACT = 241 reads: +394 validated
umi TTGACTTTCC = 217 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-52 ==> 0-52 on |206|IGHV6-1|5'UTR| [len=52] (mis=0)
52-417 ==> 0-365 on |207|IGHV6-1|L-REGION+V-REGION| [len=365] (mis=0)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 208 reads
cdr3 = CARDVDTAMGVDFDYW at 406, score = 10 + 7
umis assigned: [63, 239, 469, 672, 707, 741, 849, 1027, 1031, 1131] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2609
start codons at 52, 96, 293, 299, 430
confident = true

TIG 2[bases=651]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
402-440 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
440-651 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 715 reads
cdr3 = CAAWDDSLSGPGVVF at 367, score = 7 + 8
umis assigned: [183, 263, 266, 272, 286, 386, 432, 505, 539, 766] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4922
start codons at 46, 200, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=426]
4-280 ==> 2223-2499 on rc of segment before IGHD2-8 exon 1 [len=2499] (mis=1)
305-355 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
355-426 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1118]
of which 1 are surviving nonsolos
reads assigned: 464
start codons at 20, 36, 42, 69, 260, 304, 307, 336
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCAAGAGACGTGGATACAGCTATGGGCGTCGACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCCGGGGGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2664 = TGCCAAAAGCCACGCT-1

using 262 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [4]

====================================================================================

UMI info for barcode TGCCAAAAGCCACGCT-1 contig 1 = GGGGGCTGGG...
umi TGCCACTCTC = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
45-386 ==> 0-341 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=22)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-544 ==> 0-111 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CTSYTSSDTYVF at 369, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 45, 253, 256, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2671 = TGCCAAAAGCTAGTGG-1

using 16 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2675 = TGCCAAAAGCTTCGCG-1

using 111 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 106]
surviving nonsolo ucounts = 1[106]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=528]
0-351 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
353-392 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
392-528 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 0, 6, 62, 75, 214, 337, 434
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2682 = TGCCAAAAGGCAAAGA-1

using 1330 reads

====================================================================================

graph has 1717 edges initially, 22 edges after simplification

total ucounts = 454
nonsolo ucounts = 233[2^79, 3^41, 4^41, 5^23, 6^14, 7^11, 8^9, 9, 10^2, 11^6, 13, 15^2, 16, 19, 143]
surviving nonsolo ucounts = 1[143]
ids = [39]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2683 = TGCCAAAAGGCCCTTG-1

using 24 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2693 = TGCCAAAAGTGAAGTT-1

using 307 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 296]
surviving nonsolo ucounts = 1[296]
ids = [0]

====================================================================================

UMI info for barcode TGCCAAAAGTGAAGTT-1 contig 1 = GAATCAGTCC...
umi ACTTAGAGGG = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2696 = TGCCAAAAGTGGCACA-1

using 27 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2702 = TGCCAAACAACCGCCA-1

using 873 reads

====================================================================================

graph has 410 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 14[3, 4^2, 5, 6, 8^2, 9, 12, 16, 24, 41, 283, 447]
surviving nonsolo ucounts = 3[24, 283, 447]
ids = [4, 11, 12]

====================================================================================

UMI info for barcode TGCCAAACAACCGCCA-1 contig 1 = GGGGTCTCAG...
umi GCAAGTCCTT = 268 reads: +388 validated

UMI info for barcode TGCCAAACAACCGCCA-1 contig 2 = AGGAGTCAGA...
umi ACTAAGTGGG = 24 reads: -45 +193 -1 +58 -12 +61 -2 +16 non-validated
umi GCTAAGGTAA = 451 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-554 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 38, 195, 246, 345, 372
confident = false

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNSYSYTF at 354, score = 8 + 8
umis assigned: [4, 12]
of which 2 are surviving nonsolos
reads assigned: 466
start codons at 27, 33, 89, 102, 292, 331, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2705 = TGCCAAACAAGCCGTC-1

using 305 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [2]

====================================================================================

UMI info for barcode TGCCAAACAAGCCGTC-1 contig 1 = GACTGATCAG...
umi GCAGCCGCAT = 299 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=567]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
393-431 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPPTF at 370, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2708 = TGCCAAACAATAAGCA-1

using 353 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [5]

====================================================================================

UMI info for barcode TGCCAAACAATAAGCA-1 contig 1 = AGCATCATCC...
umi GTTGTCTCAG = 348 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=568]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
458-497 ==> 10-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRSVGNNPSYYGSGEYPW at 403, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 61, 217, 259, 325, 358, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2713 = TGCCAAACAATGAAAC-1

using 317 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[14, 300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode TGCCAAACAATGAAAC-1 contig 1 = GATCAGGACT...
umi ATACTACCCG = 286 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2715 = TGCCAAACAATGGACG-1

using 832 reads

====================================================================================

graph has 801 edges initially, 8 edges after simplification

total ucounts = 209
nonsolo ucounts = 57[2^26, 3^10, 4^3, 5^5, 6^5, 7, 8, 9, 14, 15^2, 227, 236]
surviving nonsolo ucounts = 2[227, 236]
ids = [134, 95]

====================================================================================

UMI info for barcode TGCCAAACAATGGACG-1 contig 1 = AGAGCTCTGG...
umi GACTATAGAA = 223 reads: +388 validated

UMI info for barcode TGCCAAACAATGGACG-1 contig 2 = GTCTCAGGAG...
umi GTTCATGACC = 215 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=492]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-492 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPLFTF at 368, score = 9 + 8
umis assigned: [95]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 44, 252, 378, 474
confident = false

TIG 2[bases=456]
35-357 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
426-456 ==> 0-30 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CCSFTVNTRSYVF at 359, score = 7 + 8
umis assigned: [134]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 35, 192, 236, 246, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2737 = TGCCAAACAGGAACGT-1

using 269 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4^2, 256]
surviving nonsolo ucounts = 1[256]
ids = [1]

====================================================================================

UMI info for barcode TGCCAAACAGGAACGT-1 contig 1 = GAGGAATCAG...
umi AGAATCTTTG = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2743 = TGCCAAACAGTGGAGT-1

using 254 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [5]

====================================================================================

UMI info for barcode TGCCAAACAGTGGAGT-1 contig 1 = GGGGGTCTCA...
umi TGTATATTCT = 242 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=584]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
430-584 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYTSSSTEVVF at 363, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2747 = TGCCAAACATCTACGA-1

using 374 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[4, 5^2, 7, 349]
surviving nonsolo ucounts = 1[349]
ids = [8]

====================================================================================

UMI info for barcode TGCCAAACATCTACGA-1 contig 1 = GCTCTGCTTC...
umi TTCGGTGTGT = 335 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-583 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2748 = TGCCAAACATCTGGTA-1

using 112 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 17[2^2, 3^3, 4^3, 6, 7^2, 8, 9, 10^2, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2752 = TGCCAAACATGCCTAA-1

using 5738 reads

====================================================================================

graph has 4646 edges initially, 32 edges after simplification

total ucounts = 950
nonsolo ucounts = 473[2^224, 3^93, 4^56, 5^32, 6^23, 7^7, 8^8, 9^3, 10^4, 11, 12, 14, 15^2, 16, 18, 54, 116, 118, 127, 136, 180^2, 238, 262, 278, 287, 298, 348, 364, 365, 380]
surviving nonsolo ucounts = 14[54, 116, 127, 180^2, 238, 262, 278, 287, 298, 348, 364, 365, 380]
ids = [570, 825, 785, 217, 921, 550, 42, 450, 596, 651, ...]

====================================================================================

UMI info for barcode TGCCAAACATGCCTAA-1 contig 1 = CCTGGGTCAG...
umi AATATGCTAC = 259 reads: +385 validated
umi CAATCTTCTT = 365 reads: +385 validated
umi GAGAAGGGCT = 240 reads: +385 validated
umi GATATGAGTC = 360 reads: +385 validated
umi GCGACGACTT = 383 reads: +385 validated
umi GTCCGCCGGA = 300 reads: +385 validated

UMI info for barcode TGCCAAACATGCCTAA-1 contig 2 = AGCTCTGAGA...
umi ATTATCTCCT = 349 reads: +430 validated
umi CAATCCTCTC = 184 reads: +416 -2 +10 -1 +1 non-validated
umi CTCATGTCTA = 276 reads: +430 validated
umi GCACGGTTAT = 56 reads: +430 validated
umi GCTCACTTCT = 288 reads: +430 validated
umi TCTCTCGTAA = 132 reads: +430 validated
umi TGGCTACCTC = 117 reads: +430 validated
umi TTTCATGGAT = 182 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=573]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
399-437 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 294 reads
cdr3 = CQQYASSPGTF at 376, score = 8 + 8
umis assigned: [42, 218, 550, 554, 591, 651]
of which 6 are surviving nonsolos
reads assigned: 1884
start codons at 52, 260, 386, 479
confident = true

TIG 2[bases=580]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=3)
459-509 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
509-580 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 116 reads
cdr3 = CAKAQGRLEWLLYNAFDIW at 421, score = 9 + 8
umis assigned: [190, 217, 450, 570, 596, 785, 825, 921]
of which 8 are surviving nonsolos
reads assigned: 1545
start codons at 79, 230, 235, 382, 461, 490
confident = true
now this is a cell
paired!

GCCGTATATTACTGTGCGAAAGCCCAAGGCCGTTTGGAGTGGTTATTATATAATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGACGATTTTGCAGTGTATTACTGTCAGCAGTATGCTAGCTCACCAGGGACGTTCGGCCAAGGGACCAAGGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2760 = TGCCAAAGTAAAGTCA-1

using 370 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 7, 352]
surviving nonsolo ucounts = 1[352]
ids = [4]

====================================================================================

UMI info for barcode TGCCAAAGTAAAGTCA-1 contig 1 = GTCAGTCTCA...
umi CCAGATTACA = 356 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYTTPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2765 = TGCCAAAGTACAGTGG-1

using 11891 reads

====================================================================================

graph has 5957 edges initially, 80 edges after simplification

total ucounts = 1144
nonsolo ucounts = 530[2^199, 3^119, 4^68, 5^35, 6^29, 7^13, 8^12, 9^6, 10^2, 11, 12^2, 13, 14, 15^2, 16, 17, 20, 30, 87, 124, 145, 161, 164, 176, 181, 191, 194, 195, 199, 201, 218, 223, 224, 229, 237, 243^2, 245^2, 250, 258, 260, 261^2, 264, 267, 287, 296, 308, 333, 339, 458, 475, 1023]
surviving nonsolo ucounts = 36[87, 124, 145, 161, 164, 176, 181, 191, 194, 195, 199, 201, 218, 223, 224, 229, 237, 243^2, 245^2, 250, 258, 260, 261^2, 264, 267, 287, 296, 308, 333, 339, 458, 475, 1023]
ids = [982, 197, 471, 712, 130, 41, 679, 584, 866, 671, ...]

====================================================================================

UMI info for barcode TGCCAAAGTACAGTGG-1 contig 1 = AGCTTCAGCT...
umi AAGTTGCACT = 244 reads: +391 validated
umi AATAATGCTG = 178 reads: +391 validated
umi ACCTCACCTG = 256 reads: +391 validated
umi ACTTTATCGG = 162 reads: +391 validated
umi ATAAACTATG = 248 reads: +391 validated
umi ATCATTTGGC = 124 reads: +391 validated
umi ATGGGTCCCT = 479 reads: -47X +1 -2X +341 invalidated
umi CAAATCGGTT = 199 reads: +391 validated
umi CATCCTTGCC = 285 reads: +391 validated
umi CCATATCCTT = 244 reads: +391 validated
umi CGACTAAGGA = 334 reads: +391 validated
umi CGCAGAATAT = 267 reads: +391 validated
umi CGTCAGAAAA = 223 reads: +391 validated
umi CTAATGCGTG = 238 reads: +391 validated
umi CTTCAAGAGT = 258 reads: +391 validated
umi GATGGGGTAA = 1050 reads: +47 -14XX +1 -6XX +1 -296X +1 -8XX +1 -8XX +1 -5XX +2 invalidated
umi GCTTAGCATT = 459 reads: -389 +2 non-validated
umi GGAACTTGGG = 198 reads: +391 validated
umi GGATTGCAGC = 180 reads: +391 validated
umi GTATAGGATA = 310 reads: +391 validated
umi TATATTATAC = 232 reads: +391 validated
umi TATGCTTGGC = 240 reads: +391 validated
umi TATTTTGTCG = 198 reads: +391 validated
umi TCATGGGTCA = 219 reads: +391 validated
umi TCCAGACGTT = 244 reads: +391 validated
umi TGTAATACGG = 265 reads: +391 validated
umi TGTGTCGGCT = 260 reads: +391 validated
umi TTGCCACTTT = 195 reads: +391 validated

UMI info for barcode TGCCAAAGTACAGTGG-1 contig 2 = ACATGGGAAA...
umi ACCATGTAGT = 248 reads: +430 validated
umi ATTTAAGTGT = 225 reads: +430 validated
umi CAACATATAT = 262 reads: +430 validated
umi CGTCTCTGAA = 145 reads: +430 validated
umi TGATTTACTC = 89 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=8)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
437-648 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 26 umis using 1019 reads
cdr3 = CAAWNDRLGGPWVF at 367, score = 7 + 8
umis assigned: [39, 41, 89, 130, 177, 197, 227, 269, 339, 369] and 18 others
of which 28 are surviving nonsolos
reads assigned: 7652
start codons at 46, 200, 257, 350, 375, 380
confident = true

TIG 2[bases=578]
0-46 ==> 99-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
46-396 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=10)
413-476 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
476-578 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 103 reads
cdr3 = CARSSWVGVVEHYYYGMDVW at 385, score = 9 + 7
umis assigned: [80, 253, 273, 471, 982]
of which 5 are surviving nonsolos
reads assigned: 955
start codons at 2, 46, 90, 433, 494, 555
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGATCCAGTTGGGTCGGAGTGGTGGAACACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCGGTCCGGGGATGAGGCTGATTATTATTGTGCAGCATGGAATGACAGGTTGGGTGGTCCTTGGGTGTTCGGCGGAGGGACCAAGTTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2770 = TGCCAAAGTACCGGCT-1

using 324 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [2]

====================================================================================

UMI info for barcode TGCCAAAGTACCGGCT-1 contig 1 = GGGGGGTCTC...
umi CTCATCATTA = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
40-394 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 47 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2771 = TGCCAAAGTACGAAAT-1

using 3058 reads

====================================================================================

graph has 4031 edges initially, 22 edges after simplification

total ucounts = 1185
nonsolo ucounts = 571[2^223, 3^133, 4^79, 5^54, 6^32, 7^15, 8^11, 9^4, 10^10, 11^3, 12, 13^3, 14, 17, 377]
surviving nonsolo ucounts = 1[377]
ids = [446]

====================================================================================

UMI info for barcode TGCCAAAGTACGAAAT-1 contig 1 = AGAGCCCTGG...
umi CCCGTGTTTA = 343 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=490]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
426-490 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPLTF at 365, score = 9 + 9
umis assigned: [446]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 44, 252, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2773 = TGCCAAAGTAGGCTGA-1

using 399 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 6, 382]
surviving nonsolo ucounts = 1[382]
ids = [6]

====================================================================================

UMI info for barcode TGCCAAAGTAGGCTGA-1 contig 1 = GATCAGGACT...
umi GTTTATCACA = 383 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=9)
394-433 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQGTHWPPRYTF at 366, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 30, 63, 91, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2778 = TGCCAAAGTCAAAGAT-1

using 290 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 284]
surviving nonsolo ucounts = 1[284]
ids = [2]

====================================================================================

UMI info for barcode TGCCAAAGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi TCAGGTATGT = 272 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-522 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2787 = TGCCAAAGTCCAGTTA-1

using 619 reads

====================================================================================

graph has 270 edges initially, 18 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^2, 3^2, 7, 296, 304]
surviving nonsolo ucounts = 2[296, 304]
ids = [8, 1]

====================================================================================

UMI info for barcode TGCCAAAGTCCAGTTA-1 contig 1 = GAGGAACTGC...
umi AATGAAATTC = 308 reads: +382 validated

UMI info for barcode TGCCAAAGTCCAGTTA-1 contig 2 = GCTACAACAG...
umi TTCGAATCGA = 294 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQRRTWPPAF at 354, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 33, 82, 238, 457
confident = false

TIG 2[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYNTPLTF at 367, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2789 = TGCCAAAGTCCGACGT-1

using 297 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 284]
surviving nonsolo ucounts = 1[284]
ids = [0]

====================================================================================

UMI info for barcode TGCCAAAGTCCGACGT-1 contig 1 = GGGGAGGAAT...
umi ATAATCATCG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-494 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2798 = TGCCAAAGTCTCGTTC-1

using 317 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 315]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2811 = TGCCAAAGTTAAGAAC-1

using 68 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[68]
surviving nonsolo ucounts = 1[68]
ids = [0]

====================================================================================

UMI info for barcode TGCCAAAGTTAAGAAC-1 contig 1 = TCACAAGAGG...
umi ATATGCCATG = 67 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=524]
0-34 ==> 128-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
34-374 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
428-524 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 17 reads
cdr3 = CCSEAGGGVPGLLF at 358, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 34, 188
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2813 = TGCCAAAGTTACGTCA-1

using 270 reads

====================================================================================

graph has 90 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 52, 212]
surviving nonsolo ucounts = 2[52, 212]
ids = [2, 0]

====================================================================================

UMI info for barcode TGCCAAAGTTACGTCA-1 contig 1 = GCTCTGCTTC...
umi ATACGGCCAA = 207 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=610]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-610 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 51, 205, 208, 259, 358, 385
confident = false

REJECT CONTIGS

TIG 1[bases=526]
0-34 ==> 45-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
0-45 ==> 3156-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=6)
27-50 ==> 6531-6554 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=0)
34-387 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=21)
433-469 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
469-526 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CAKDVLGG at 376, score = 9 + 4
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 51
start codons at 34, 153, 185, 190, 337
confident = false
frameshifted full length transcript of length 526
VJ delta = -29
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2815 = TGCCAAAGTTCAACCA-1

using 345 reads

====================================================================================

graph has 74 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 7, 326]
surviving nonsolo ucounts = 1[326]
ids = [6]

====================================================================================

UMI info for barcode TGCCAAAGTTCAACCA-1 contig 1 = GAGGAATCAG...
umi GTAACCCTTT = 327 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2825 = TGCCAAAGTTTGACTG-1

using 1865 reads

====================================================================================

graph has 2648 edges initially, 28 edges after simplification

total ucounts = 833
nonsolo ucounts = 374[2^143, 3^79, 4^47, 5^39, 6^29, 7^20, 8^4, 9^5, 10, 11^3, 12^2, 20, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2827 = TGCCAAATCAAACAAG-1

using 283 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 278]
surviving nonsolo ucounts = 1[278]
ids = [2]

====================================================================================

UMI info for barcode TGCCAAATCAAACAAG-1 contig 1 = GTGGGCTCAG...
umi ATCGAGCTCT = 269 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=578]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=14)
377-415 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
415-578 ==> 0-163 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CHSRDSRGPWVF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 36, 155, 235, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2831 = TGCCAAATCACCACCT-1

using 356 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[14, 340]
surviving nonsolo ucounts = 1[340]
ids = [1]

====================================================================================

UMI info for barcode TGCCAAATCACCACCT-1 contig 1 = AGAGCTCTGG...
umi CCATTTATTC = 308 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=2)
44-357 ==> 0-313 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=34)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
429-504 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQCGISPRTF at 368, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 44, 93, 252, 359, 376, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2838 = TGCCAAATCATAACCG-1

using 820 reads

====================================================================================

graph has 258 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3^2, 4, 320, 480]
surviving nonsolo ucounts = 2[320, 480]
ids = [6, 12]

====================================================================================

UMI info for barcode TGCCAAATCATAACCG-1 contig 1 = GAATCAGACC...
umi GCTTGTAGTC = 322 reads: +388 validated

UMI info for barcode TGCCAAATCATAACCG-1 contig 2 = TTATATTGTG...
umi TTGGCAACTC = 479 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=5)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYNSYPITF at 352, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 25, 31, 87, 100, 236, 406, 455
confident = false

TIG 2[bases=555]
45-393 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
401-432 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=1)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARAYYDFWSGYYNWVYFDYW at 390, score = 9 + 7
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 475
start codons at 45, 89
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2839 = TGCCAAATCATCTGTT-1

using 260 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 6, 244]
surviving nonsolo ucounts = 1[244]
ids = [8]

====================================================================================

UMI info for barcode TGCCAAATCATCTGTT-1 contig 1 = AGGAGTCAGA...
umi TCCTCGCGGC = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-485 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2844 = TGCCAAATCCCATTTA-1

using 2090 reads

====================================================================================

graph has 448 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 2078]
surviving nonsolo ucounts = 1[2078]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=346]
4-100 ==> 257-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=5)
97-135 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
135-346 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 68, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 2049
start codons at 51, 76, 81
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2847 = TGCCAAATCCGTTGCT-1

using 254 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode TGCCAAATCCGTTGCT-1 contig 1 = AGCTCTGAGA...
umi CACCATTCAG = 249 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=532]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-532 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2852 = TGCCAAATCGCGGATC-1

using 295 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

UMI info for barcode TGCCAAATCGCGGATC-1 contig 1 = AGGAATCAGT...
umi CACGTCGGCA = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=7)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQHKNYPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 27, 33, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2853 = TGCCAAATCGCTAGCG-1

using 33 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2868 = TGCCAAATCTGCCCTA-1

using 11675 reads

====================================================================================

graph has 4817 edges initially, 60 edges after simplification

total ucounts = 611
nonsolo ucounts = 288[2^112, 3^50, 4^32, 5^16, 6^11, 7^10, 8^6, 9^3, 10, 11, 12^3, 24, 55, 58, 89, 104^2, 107, 118, 126, 143, 152, 153, 180, 194, 201, 203, 219, 224, 225, 232, 235, 241^2, 247, 251^2, 256, 259, 260, 264, 275, 276, 283, 295, 310, 315, 334, 341, 354, 399, 467, 536, 901]
surviving nonsolo ucounts = 41[55, 58, 89, 104^2, 107, 118, 126, 152, 153, 180, 194, 201, 203, 219, 224, 225, 232, 235, 241^2, 247, 251^2, 256, 259, 260, 264, 275, 276, 283, 295, 310, 315, 334, 341, 354, 399, 467, 536, 901]
ids = [301, 415, 99, 103, 252, 461, 485, 449, 206, 249, ...]

====================================================================================

UMI info for barcode TGCCAAATCTGCCCTA-1 contig 1 = GTGGGTCCAG...
umi AAACCACTCG = 212 reads: +15 -1 +1 -4X +1 -1XX +3 -1XX +3 -1XX +1 -5XX +2 -4XX +310 -26 invalidated
umi AACTTCTATG = 225 reads: +379 validated
umi ATCGACGGTC = 232 reads: +379 validated
umi CACAGTGTCC = 307 reads: +379 validated
umi CAGTCTGTAA = 265 reads: +379 validated
umi CCTGCCGTAC = 104 reads: +379 validated
umi CGTACACCTG = 903 reads: -231X +148 invalidated
umi CTGCGACTTA = 239 reads: +379 validated
umi GACCGCGAGT = 298 reads: +379 validated
umi GGACGACTCT = 254 reads: +379 validated
umi GGGTTTACAG = 539 reads: +379 validated
umi GGTAGCATCT = 278 reads: +379 validated
umi TATCTACGTC = 72 reads: +47 -2X +314 -16 invalidated
umi TCCGGAGTAG = 239 reads: +379 validated
umi TCCGGTCGCC = 249 reads: +379 validated
umi TCCGTATCGT = 276 reads: +379 validated
umi TCGCCACTCC = 86 reads: +39 -4X +267 -1 +7 -61 invalidated
umi TCGTGGTACA = 219 reads: +379 validated
umi TGCCGGATTG = 264 reads: +379 validated

UMI info for barcode TGCCAAATCTGCCCTA-1 contig 2 = GGAGTCTCCC...
umi AATTTGTGTT = 303 reads: +421 validated
umi ATAATTGCCC = 95 reads: +392 -1 +3 -1 +22 -1 +1 non-validated
umi CCAAGCTCGC = 152 reads: +406 -15 non-validated
umi CCGGGTGCAT = 221 reads: +421 validated
umi CCTATTGGCT = 250 reads: +421 validated
umi CCTCGTCTTG = 154 reads: +421 validated
umi CTTCATTCGG = 204 reads: +402 -16 +3 non-validated
umi CTTTATCTTC = 203 reads: +421 validated
umi GAAATTGGCT = 251 reads: +406 -15 non-validated
umi GAGTTTCTTG = 234 reads: +421 validated
umi GGAACATACC = 317 reads: +421 validated
umi GGCAACGCCA = 242 reads: +421 validated
umi GTAGTAGCCT = 56 reads: +17 -1 +342 -61 non-validated
umi GTTATCCCTA = 197 reads: +393 -28 non-validated
umi GTTGAATCGG = 127 reads: +421 validated
umi TACAATCCCG = 106 reads: +421 validated
umi TCGTAGGGCA = 227 reads: +421 validated
umi TGCTGTTAAT = 308 reads: +421 validated
umi TGGCTATCGG = 360 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
414-625 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 787 reads
cdr3 = CQSADSSGTWVF at 350, score = 8 + 8
umis assigned: [3, 24, 117, 160, 176, 252, 278, 312, 344, 381] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5171
start codons at 35, 96, 165, 183
confident = true

TIG 2[bases=582]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
430-480 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
480-582 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 14 umis using 250 reads
cdr3 = CARHLGELTGDAFDIW at 401, score = 8 + 8
umis assigned: [39, 103, 206, 239, 246, 249, 322, 329, 335, 349] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3935
start codons at 59, 233, 257, 392, 432, 461, 498, 559
confident = true

REJECT CONTIGS

TIG 1[bases=420]
7-359 ==> 0-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=5)
357-408 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
umis assigned: [94, 99]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 130, 178, 250, 352
confident = false
did not find CDR3
now this is a cell
paired!

TCGGACACCGCCATGTATTACTGTGCGAGACATCTGGGCGAACTAACTGGGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2876 = TGCCCATAGAAAGTGG-1

using 619 reads

====================================================================================

graph has 923 edges initially, 8 edges after simplification

total ucounts = 279
nonsolo ucounts = 129[2^50, 3^30, 4^17, 5^15, 6, 7^7, 8^4, 9^2, 10^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2883 = TGCCCATAGAGTACAT-1

using 372 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 363]
surviving nonsolo ucounts = 1[363]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=493]
0-82 ==> 8885-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=7)
25-339 ==> 0-314 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
336-356 ==> 312-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0) [SHIFT!]
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
412-493 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHLVTHPISF at 351, score = 5 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 25, 31, 236, 239, 454
confident = false
not full
frameshifted full length transcript of length 493
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2889 = TGCCCATAGCAACGGT-1

using 173 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 4, 160]
surviving nonsolo ucounts = 1[160]
ids = [5]

====================================================================================

UMI info for barcode TGCCCATAGCAACGGT-1 contig 1 = AGCACTAGAA...
umi GATTCCGGCA = 160 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=537]
0-60 ==> 20-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
60-411 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=20)
416-466 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CVKEEDAFDIW at 402, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 60, 211, 216, 277, 363, 418, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2894 = TGCCCATAGCCCAGCT-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2897 = TGCCCATAGCGTCTAT-1

using 390 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[177, 211]
surviving nonsolo ucounts = 2[177, 211]
ids = [3, 0]

====================================================================================

UMI info for barcode TGCCCATAGCGTCTAT-1 contig 1 = AGGAATCAGT...
umi GCATTACAGC = 190 reads: +388 validated
umi TTCGGCATTC = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-503 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 68 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 351
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2902 = TGCCCATAGGACTGGT-1

using 209 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATAGGACTGGT-1 contig 1 = CACAAGAGGC...
umi ACCTATGCCT = 203 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=571]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
427-571 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 34 reads
cdr3 = CCSEAGGGVPGLLF at 357, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 33, 187
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2905 = TGCCCATAGGCATGGT-1

using 178 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 6, 158]
surviving nonsolo ucounts = 1[158]
ids = [2]

====================================================================================

UMI info for barcode TGCCCATAGGCATGGT-1 contig 1 = AGAGGGAACC...
umi AGGCAATGTT = 158 reads: +385 validated
umi TTTTAAAACT = 1 reads: -385 non-validated

GOOD CONTIGS

TIG 1[bases=531]
10-358 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
357-395 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
395-531 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPWTF at 334, score = 8 + 8
umis assigned: [2, 9]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 10, 344, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2906 = TGCCCATAGGCCCGTT-1

using 284 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATAGGCCCGTT-1 contig 1 = GGGAGTCTCA...
umi CGGCGGCTCG = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2908 = TGCCCATAGGGCTTGA-1

using 375 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [1]

====================================================================================

UMI info for barcode TGCCCATAGGGCTTGA-1 contig 1 = CCACATCCCT...
umi CATGGATAGG = 375 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=571]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=1)
408-432 ==> 7-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=3)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
469-571 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CARAPGGGYDSSGYYAYW at 384, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 42, 193, 198, 240, 245, 262, 339, 409, 487, 548
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2909 = TGCCCATAGGGTCGAT-1

using 1456 reads

====================================================================================

graph has 986 edges initially, 6 edges after simplification

total ucounts = 230
nonsolo ucounts = 63[2^25, 3^10, 4^9, 5, 6^4, 7^6, 9^2, 10, 20, 91, 293, 297, 373]
surviving nonsolo ucounts = 4[91, 293, 297, 373]
ids = [40, 199, 210, 224]

====================================================================================

UMI info for barcode TGCCCATAGGGTCGAT-1 contig 1 = AGGAGTCAGT...
umi ACTCAGGCTA = 91 reads: +391 validated
umi TCTCCAGCAC = 294 reads: +391 validated
umi TTAGCCTTCG = 299 reads: +391 validated
umi TTGGCACCCT = 375 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 154 reads
cdr3 = CQQYDNLPPLTF at 354, score = 9 + 9
umis assigned: [40, 199, 210, 224]
of which 4 are surviving nonsolos
reads assigned: 1044
start codons at 27, 33, 89, 102, 241, 364, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2916 = TGCCCATAGTGAACGC-1

using 281 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATAGTGAACGC-1 contig 1 = GAAGAGCTGC...
umi CCTCGCACAC = 259 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=511]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
418-511 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYGNSPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 33, 262, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2918 = TGCCCATAGTGGCACA-1

using 304 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATAGTGGCACA-1 contig 1 = ATCAGTCCCA...
umi TGATCTCGCC = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQHKSYPFTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2919 = TGCCCATAGTTACCCA-1

using 48 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[5^2, 7^2, 8, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2920 = TGCCCATAGTTACGGG-1

using 171 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 161]
surviving nonsolo ucounts = 1[161]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATAGTTACGGG-1 contig 1 = TCAGTCCCAC...
umi AATTGCAGGG = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-22 ==> 5-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
22-373 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-492 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 22, 28, 97, 233, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2923 = TGCCCATAGTTGAGTA-1

using 242 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [3]

====================================================================================

UMI info for barcode TGCCCATAGTTGAGTA-1 contig 1 = GCTGGGGTCT...
umi TGCATCGAGC = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-527 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2926 = TGCCCATCAAAGCAAT-1

using 2189 reads

====================================================================================

graph has 2347 edges initially, 48 edges after simplification

total ucounts = 564
nonsolo ucounts = 364[2^90, 3^57, 4^41, 5^35, 6^26, 7^30, 8^21, 9^16, 10^10, 11^8, 12^6, 13^6, 14^4, 15^9, 16^2, 19, 20, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2928 = TGCCCATCAACTGGCC-1

using 277 reads

====================================================================================

graph has 121 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATCAACTGGCC-1 contig 1 = GGGCCTCAGG...
umi GATCATCACT = 252 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=514]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-514 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2936 = TGCCCATCAATCGAAA-1

using 332 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 325]
surviving nonsolo ucounts = 1[325]
ids = [1]

====================================================================================

UMI info for barcode TGCCCATCAATCGAAA-1 contig 1 = GGGAGTCTCA...
umi CAGGTAATCC = 321 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSTPQLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2942 = TGCCCATCACAGACTT-1

using 221 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 10, 205]
surviving nonsolo ucounts = 1[205]
ids = [5]

====================================================================================

UMI info for barcode TGCCCATCACAGACTT-1 contig 1 = GCTGGGGTCT...
umi TTTCCGTCCT = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=573]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-573 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2948 = TGCCCATCACATTCGA-1

using 199 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 192]
surviving nonsolo ucounts = 2[3, 192]
ids = [2, 0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=501]
0-68 ==> 5540-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
23-383 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
409-437 ==> 9-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-501 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CIQPLQAPPF at 359, score = 9 + 6
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 186
start codons at 23, 56, 92, 180, 342, 479
confident = false
not full
frameshifted full length transcript of length 501
VJ delta = -7
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2951 = TGCCCATCACGTCTCT-1

using 16 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 1[14]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2956 = TGCCCATCAGACACTT-1

using 87 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2, 3, 7, 9^2, 10, 11^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2959 = TGCCCATCAGATTGCT-1

using 266 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^2, 10, 243]
surviving nonsolo ucounts = 1[243]
ids = [11]

====================================================================================

UMI info for barcode TGCCCATCAGATTGCT-1 contig 1 = GGGGAGTCAG...
umi TTCGTAGTCT = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=26)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYTAPYTF at 355, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 28, 34, 90, 103, 188, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2962 = TGCCCATCAGCTGCAC-1

using 682 reads

====================================================================================

graph has 314 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 670]
surviving nonsolo ucounts = 1[670]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=367]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-205 ==> 0-177 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
205-231 ==> 187-213 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2) [SHIFT!]
231-367 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 654
start codons at 28, 97, 273
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2964 = TGCCCATCAGCTTAAC-1

using 34 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 5^2, 6, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2969 = TGCCCATCAGGGATTG-1

using 23 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2974 = TGCCCATCAGTGAGTG-1

using 61 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[60]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2978 = TGCCCATCATCCTAGA-1

using 629 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3^2, 5, 225, 387]
surviving nonsolo ucounts = 2[225, 387]
ids = [4, 2]

====================================================================================

UMI info for barcode TGCCCATCATCCTAGA-1 contig 1 = GCTCTGCTTC...
umi CCCTTCTTTG = 221 reads: +394 validated

UMI info for barcode TGCCCATCATCCTAGA-1 contig 2 = GGAGTCAGAC...
umi CCCGCAGGTG = 364 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-515 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=506]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2979 = TGCCCATCATCGATGT-1

using 953 reads

====================================================================================

graph has 326 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 283, 657]
surviving nonsolo ucounts = 2[283, 657]
ids = [4, 2]

====================================================================================

UMI info for barcode TGCCCATCATCGATGT-1 contig 1 = GGAGAAGAGC...
umi ATGGATTCCT = 659 reads: +382 validated
umi CATTCACCCT = 287 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 156 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 933
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.2988 = TGCCCATGTAACGACG-1

using 917 reads

====================================================================================

graph has 308 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[4^2, 260, 314, 335]
surviving nonsolo ucounts = 3[260, 314, 335]
ids = [1, 0, 3]

====================================================================================

UMI info for barcode TGCCCATGTAACGACG-1 contig 1 = GAATCAGTCC...
umi ACGGGCAATA = 317 reads: +388 validated
umi ATAAGACCGC = 265 reads: +191 -2XX +3 -2XX +190 invalidated
umi TACCTGCTGT = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 168 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0, 1, 3]
of which 3 are surviving nonsolos
reads assigned: 900
start codons at 25, 31, 100, 236, 455
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3003 = TGCCCATGTCTAGGTT-1

using 241 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 234]
surviving nonsolo ucounts = 1[234]
ids = [1]

====================================================================================

UMI info for barcode TGCCCATGTCTAGGTT-1 contig 1 = ATCACATAAC...
umi GTTACGGTCC = 234 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=556]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
443-506 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
506-556 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGGWATGTTGLEKGYYYYAMDVW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 58, 118, 209, 256, 293, 355, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3009 = TGCCCATGTGGAAAGA-1

using 471 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4, 5, 459]
surviving nonsolo ucounts = 1[459]
ids = [3]

====================================================================================

UMI info for barcode TGCCCATGTGGAAAGA-1 contig 1 = TGGGGAGGAC...
umi GATCTTTTAG = 461 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=540]
22-367 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
404-540 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 81 reads
cdr3 = CQQFNKWPPTF at 343, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 457
start codons at 22, 91, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3016 = TGCCCATGTTATCCGA-1

using 305 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode TGCCCATGTTATCCGA-1 contig 1 = GAGGAATCAG...
umi CTGTGCATCC = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-503 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3027 = TGCCCATTCAACGAAA-1

using 434 reads

====================================================================================

graph has 598 edges initially, 2 edges after simplification

total ucounts = 157
nonsolo ucounts = 74[2^24, 3^17, 4^9, 5^10, 6^4, 7^2, 9^2, 10, 11, 14^2, 15, 46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3033 = TGCCCATTCAGTTTGG-1

using 123 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 27
nonsolo ucounts = 19[2^3, 3^3, 4^2, 5^2, 6^2, 7^2, 9^2, 11, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3035 = TGCCCATTCATCGGAT-1

using 65 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 4, 5, 47]
surviving nonsolo ucounts = 1[47]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3040 = TGCCCATTCCAGAAGG-1

using 392 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 4^2, 8, 371]
surviving nonsolo ucounts = 1[371]
ids = [7]

====================================================================================

UMI info for barcode TGCCCATTCCAGAAGG-1 contig 1 = ATCAGTCCCA...
umi TGGCAAGTCG = 374 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3045 = TGCCCATTCCGTACAA-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3061 = TGCCCATTCGCTTAGA-1

using 166 reads

====================================================================================

graph has 78 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 31, 132]
surviving nonsolo ucounts = 2[31, 132]
ids = [1, 2]

====================================================================================

UMI info for barcode TGCCCATTCGCTTAGA-1 contig 1 = GGAGGAACTG...
umi CTACGCCTTA = 122 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=497]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-497 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3065 = TGCCCATTCGTGGGAA-1

using 77 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[2^2, 4^3, 7, 11^2, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3067 = TGCCCATTCTACGAGT-1

using 48 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3^3, 36]
surviving nonsolo ucounts = 2[3, 36]
ids = [2, 3]

====================================================================================

UMI info for barcode TGCCCATTCTACGAGT-1 contig 1 = GGGAGTCTCA...
umi CGCGGGCGGG = 3 reads: -136 +56 -33 +56 -16 +15 -1 +40 -26 non-validated
umi CGCGTCCGGG = 32 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=450]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
364-402 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
402-450 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CQQSYSTF at 350, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 35
start codons at 23, 29, 85, 98, 183, 234, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3073 = TGCCCATTCTGCTTGC-1

using 762 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 13, 42, 699]
surviving nonsolo ucounts = 2[42, 699]
ids = [2, 7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3075 = TGCCCATTCTGTCAAG-1

using 26 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3085 = TGCCCTAAGACACTAA-1

using 1614 reads

====================================================================================

graph has 1936 edges initially, 42 edges after simplification

total ucounts = 735
nonsolo ucounts = 361[2^152, 3^88, 4^56, 5^30, 6^11, 7^9, 8^2, 9^6, 10, 11^3, 17, 19, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3087 = TGCCCTAAGACGCTTT-1

using 535 reads

====================================================================================

graph has 233 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3^2, 5, 197, 320]
surviving nonsolo ucounts = 2[197, 320]
ids = [5, 3]

====================================================================================

UMI info for barcode TGCCCTAAGACGCTTT-1 contig 1 = GAATCAGTCC...
umi CAATAGGTGG = 322 reads: +388 validated

UMI info for barcode TGCCCTAAGACGCTTT-1 contig 2 = GCTCTGCTTC...
umi CCTGTATTGC = 193 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=540]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-540 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3095 = TGCCCTAAGCAACGGT-1

using 349 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^2, 3^4, 331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=545]
0-68 ==> 5669-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
20-244 ==> 0-224 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
245-372 ==> 224-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=9) [SHIFT!]
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 348, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 20, 26, 95, 231, 451
confident = false
not full
frameshifted full length stopped transcript of length 545
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3096 = TGCCCTAAGCAGCCTC-1

using 89 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^2, 3, 4, 5, 14, 50]
surviving nonsolo ucounts = 1[50]
ids = [13]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3100 = TGCCCTAAGCCGATTT-1

using 318 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode TGCCCTAAGCCGATTT-1 contig 1 = GATCAGGACT...
umi TAATGATGTA = 310 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQALQTLFTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3103 = TGCCCTAAGCTTCGCG-1

using 103 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 16[2^5, 3^2, 4, 6, 7^2, 8, 9, 10, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3131 = TGCCCTACAAGGTGTG-1

using 220 reads

====================================================================================

graph has 135 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^2, 3^2, 4^2, 5, 7, 186]
surviving nonsolo ucounts = 1[186]
ids = [1]

====================================================================================

UMI info for barcode TGCCCTACAAGGTGTG-1 contig 1 = GGGAATCAGT...
umi AGGGAGATTC = 174 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3134 = TGCCCTACAATAGAGT-1

using 266 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [5]

====================================================================================

UMI info for barcode TGCCCTACAATAGAGT-1 contig 1 = AATCAGTCCC...
umi GATGTATGTG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3138 = TGCCCTACACATTCGA-1

using 907 reads

====================================================================================

graph has 608 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 209, 302, 384]
surviving nonsolo ucounts = 3[209, 302, 384]
ids = [7, 0, 1]

====================================================================================

UMI info for barcode TGCCCTACACATTCGA-1 contig 1 = AGCCTCAGCA...
umi GGAATGGCAG = 209 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=636]
0-31 ==> 29-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
31-390 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=4)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
425-636 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQTWGTGPWVF at 364, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 31, 192, 232, 248, 347
confident = false

REJECT CONTIGS

TIG 1[bases=474]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
6-58 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-354 ==> 0-321 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
351-388 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
388-474 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 33, 238, 241, 430
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3142 = TGCCCTACACCCATTC-1

using 439 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 424]
surviving nonsolo ucounts = 1[424]
ids = [0]

====================================================================================

UMI info for barcode TGCCCTACACCCATTC-1 contig 1 = GGGACTGATC...
umi ACCTGTCCAG = 427 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CMQALQTPLTF at 372, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 418
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3145 = TGCCCTACACGTCTCT-1

using 13 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3150 = TGCCCTACAGCATGAG-1

using 512 reads

====================================================================================

graph has 430 edges initially, 6 edges after simplification

total ucounts = 107
nonsolo ucounts = 37[2^24, 3^4, 4^5, 5, 10, 14, 333]
surviving nonsolo ucounts = 1[333]
ids = [5]

====================================================================================

UMI info for barcode TGCCCTACAGCATGAG-1 contig 1 = GGAGTCAGAC...
umi ACTCTAGCAT = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQANSFPITF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3154 = TGCCCTACAGGACGTA-1

using 526 reads

====================================================================================

graph has 251 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 516]
surviving nonsolo ucounts = 1[516]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=414]
0-241 ==> 110-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
240-278 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
278-414 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYRRPITF at 217, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 506
start codons at 101, 200, 320
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3156 = TGCCCTACAGTCACTA-1

using 121 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[20, 101]
surviving nonsolo ucounts = 1[101]
ids = [1]

====================================================================================

UMI info for barcode TGCCCTACAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi GGAACGGGCT = 92 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-508 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3159 = TGCCCTACATCCCATC-1

using 275 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 268]
surviving nonsolo ucounts = 1[268]
ids = [1]

====================================================================================

UMI info for barcode TGCCCTACATCCCATC-1 contig 1 = AGCTCTGAGA...
umi CGGCACATCA = 264 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=594]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-594 ==> 0-91 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3168 = TGCCCTACATTACGAC-1

using 410 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[406]
surviving nonsolo ucounts = 1[406]
ids = [2]

====================================================================================

UMI info for barcode TGCCCTACATTACGAC-1 contig 1 = AGGAGTCAGA...
umi GCGTGAGTGA = 406 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 401
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3181 = TGCCCTAGTATTCGTG-1

using 277 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 264]
surviving nonsolo ucounts = 1[264]
ids = [8]

====================================================================================

UMI info for barcode TGCCCTAGTATTCGTG-1 contig 1 = GAGAAGAGCT...
umi TTCAGTTTAC = 257 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-364 ==> 0-329 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-504 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYSASPLTF at 359, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 35, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3182 = TGCCCTAGTCAAACTC-1

using 899 reads

====================================================================================

graph has 905 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[897]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3189 = TGCCCTAGTCCGACGT-1

using 171 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================

UMI info for barcode TGCCCTAGTCCGACGT-1 contig 1 = GGGGAGAGGA...
umi ATGTAGGTTT = 159 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=536]
74-389 ==> 0-315 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=20)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
495-536 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARETDYGDYGYFDTW at 416, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 74, 230, 291, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3196 = TGCCCTAGTCTTGCGG-1

using 356 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 344]
surviving nonsolo ucounts = 1[344]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=569]
1-332 ==> 22-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=19)
361-409 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
409-569 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGDRRAAAFYYHYMDVW at 321, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 135, 177, 243, 276, 366, 463
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 99.3199 = TGCCCTAGTGATGTGG-1

using 1883 reads

====================================================================================

graph has 2457 edges initially, 50 edges after simplification

total ucounts = 1026
nonsolo ucounts = 412[2^217, 3^90, 4^46, 5^26, 6^13, 7^7, 8^6, 9^3, 10, 11^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.09
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk099-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk099-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

128.849 seconds used processing barcodes, peak mem = 0.24
