[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.47 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk098-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk098-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk098.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.0 = TCTCATAAGCTAACTC-1

using 330 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[11, 319]
surviving nonsolo ucounts = 1[319]
ids = [0]

====================================================================================

UMI info for barcode TCTCATAAGCTAACTC-1 contig 1 = GTCAGTCTCA...
umi AAGTTACCGA = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-506 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSTPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.7 = TCTCATAAGGCGACAT-1

using 148 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[142]
surviving nonsolo ucounts = 1[142]
ids = [3]

====================================================================================

UMI info for barcode TCTCATAAGGCGACAT-1 contig 1 = GCCTCAGGAA...
umi TATCGACTCG = 137 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=564]
0-33 ==> 19-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
33-379 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
371-409 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
409-564 ==> 0-155 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQAWDSSTAVF at 348, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 33, 38, 94, 181, 327, 331
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.8 = TCTCATAAGGCGATAC-1

using 223 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode TCTCATAAGGCGATAC-1 contig 1 = GAGTGCTTTC...
umi CTAGCTTGCT = 211 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=490]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
469-490 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 378, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 18, 39, 83, 169, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.22 = TCTCATACAACACGCC-1

using 145 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

UMI info for barcode TCTCATACAACACGCC-1 contig 1 = GTCTCAGGAG...
umi AACCTACCAC = 144 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-35 ==> 7-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
35-379 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-502 ==> 0-79 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CCSHAGSYIWVF at 359, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 35, 171, 174, 192, 246, 342, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.35 = TCTCATACACACTGCG-1

using 946 reads

====================================================================================

graph has 1446 edges initially, 2 edges after simplification

total ucounts = 436
nonsolo ucounts = 199[2^89, 3^39, 4^27, 5^17, 6^7, 7^4, 8^5, 9^6, 10^3, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.47 = TCTCATACAGACGCAA-1

using 201 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 198]
surviving nonsolo ucounts = 1[198]
ids = [2]

====================================================================================

UMI info for barcode TCTCATACAGACGCAA-1 contig 1 = GGGGCGGGGG...
umi TTAGCCTCCC = 190 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=553]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=3)
28-377 ==> 0-349 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=17)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
431-553 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CMTPHNSAWVF at 370, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 28, 170, 302, 314, 353, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.54 = TCTCATACAGGATCGA-1

using 275 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2, 3, 4, 6, 8^2, 10, 230]
surviving nonsolo ucounts = 1[230]
ids = [2]

====================================================================================

UMI info for barcode TCTCATACAGGATCGA-1 contig 1 = GGGGTCACAA...
umi CAACGTACAA = 225 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=521]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-521 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.55 = TCTCATACAGGCTGAA-1

using 302 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 296]
surviving nonsolo ucounts = 1[296]
ids = [1]

====================================================================================

UMI info for barcode TCTCATACAGGCTGAA-1 contig 1 = ATCAGTCCCA...
umi GAGATCATGA = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.60 = TCTCATACATACTACG-1

using 6750 reads

====================================================================================

graph has 4335 edges initially, 48 edges after simplification

total ucounts = 830
nonsolo ucounts = 429[2^142, 3^88, 4^55, 5^61, 6^26, 7^13, 8^9, 9^7, 10^2, 11^2, 12^3, 13^2, 21, 31, 42^2, 62, 64, 118^2, 159, 240, 263, 276, 281, 310, 312, 365, 557, 606, 923]
surviving nonsolo ucounts = 18[31, 42^2, 62, 64, 118^2, 159, 240, 263, 276, 281, 310, 312, 365, 557, 606, 923]
ids = [623, 9, 592, 204, 11, 18, 632, 306, 265, 773, ...]

====================================================================================

UMI info for barcode TCTCATACATACTACG-1 contig 1 = CATTCAGTGA...
umi AAGCAGAGTA = 64 reads: +405 -1 +3 non-validated
umi AATACGGTGC = 118 reads: +409 validated
umi CACCTACTAC = 61 reads: +394 -15 non-validated
umi CGCGTTCTTT = 411 reads: -382X +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CTGCGATTAC = 764 reads: -376X +1 -5XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi GTTGCTCTCG = 40 reads: +357 -1 +5 -1 +45 non-validated
umi TAGAATTGGC = 29 reads: +208 -1 +2 -1 +2 -1 +66 -6 +103 -19 non-validated
umi TATTTAATTA = 117 reads: +400 -9 non-validated

UMI info for barcode TCTCATACATACTACG-1 contig 2 = AGTCTGGGCC...
umi AAGAGTCTCA = 41 reads: +39 -2 +337 -1 non-validated
umi ACCGTATATC = 288 reads: -1XX +378 invalidated
umi CTCGATAGTA = 311 reads: +379 validated
umi CTGCCATACA = 311 reads: +379 validated
umi TTATTATGGC = 265 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=627]
0-36 ==> 43-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
36-386 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=24)
399-445 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
445-627 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 2 umis using 20 reads
cdr3 = CARSIEAAGHDYW at 375, score = 9 + 6
umis assigned: [11, 18, 204, 317, 390, 592, 623, 632]
of which 8 are surviving nonsolos
reads assigned: 1174
start codons at 36, 192, 268, 336, 403
confident = true

TIG 2[bases=630]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-370 ==> 0-330 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=16)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 5 umis using 182 reads
cdr3 = CQVWDPTIDQVF at 355, score = 8 + 8
umis assigned: [9, 51, 373, 388, 773]
of which 5 are surviving nonsolos
reads assigned: 1196
start codons at 40, 101, 226, 338
confident = true

REJECT CONTIGS

TIG 1[bases=496]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-496 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [208]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 33, 241, 367, 461
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGACCTGAGGACACGGCCGTCTATTATTGTGCGAGAAGTATAGAGGCAGCTGGCCATGATTACTGGGGCCAGGGAACCCTGGTCATCGTCTCCTCAG <==> ACCAGGGTCGAAGCCGGGGATGAGGCCGACTATTATTGTCAGGTTTGGGATCCTACTATAGACCAGGTGTTCGGCGGAGGGACCAAGTTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.62 = TCTCATACATATGCTG-1

using 1068 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 258, 804]
surviving nonsolo ucounts = 2[258, 804]
ids = [1, 5]

====================================================================================

UMI info for barcode TCTCATACATATGCTG-1 contig 1 = AGGAATCAGT...
umi CTTATTTCAA = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.64 = TCTCATACATCCGTGG-1

using 248 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=368]
4-204 ==> 99-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=12)
281-329 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
329-368 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CVRGGRSLWFGDLLDYW at 247, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 61, 119, 122, 270
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.68 = TCTCATACATCGTCGG-1

using 439 reads

====================================================================================

graph has 665 edges initially, 4 edges after simplification

total ucounts = 214
nonsolo ucounts = 93[2^40, 3^23, 4^9, 5^10, 6^5, 7^2, 8^2, 9, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.76 = TCTCATAGTAAGTTCC-1

using 211 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[211]
surviving nonsolo ucounts = 1[211]
ids = [0]

====================================================================================

UMI info for barcode TCTCATAGTAAGTTCC-1 contig 1 = GTGGGTCCAG...
umi CCTTCTCCAT = 207 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-542 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSADSSGTSVVF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.78 = TCTCATAGTACAGACG-1

using 19 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.80 = TCTCATAGTACTTGAC-1

using 805 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 794]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.84 = TCTCATAGTATAAACG-1

using 276 reads

====================================================================================

graph has 67 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [1]

====================================================================================

UMI info for barcode TCTCATAGTATAAACG-1 contig 1 = GGGCCTCAGG...
umi CCAGTCGATA = 272 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=15)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
414-625 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQAWDSTTHVVF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 35, 40, 96, 183, 329, 333, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.90 = TCTCATAGTCCGAACC-1

using 92 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 83]
surviving nonsolo ucounts = 1[83]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.99 = TCTCATAGTGCGCTTG-1

using 25876 reads

====================================================================================

graph has 7061 edges initially, 52 edges after simplification

total ucounts = 554
nonsolo ucounts = 266[2^65, 3^37, 4^21, 5^20, 6^12, 7^7, 8^3, 9^2, 11^4, 13, 14, 17, 19^2, 21, 44, 97, 99, 121, 124, 125, 127, 135, 138^2, 143, 148, 152, 158, 163, 166^2, 172, 175, 177, 185, 189, 194, 199, 212, 215^2, 218, 223^2, 228, 229, 230, 234, 237, 238, 241^2, 242, 243, 245^2, 246^2, 252, 257, 259, 261, 266, 267, 269, 270, 272, 273^2, 274, 275, 277, 279, 287^2, 289, 290^2, 293, 294, 296^2, 297, 312^2, 315^2, 317, 323, 326, 331, 337^2, 340, 343, 351, 356, 405, 533, 625, 1045, 1050, 1451]
surviving nonsolo ucounts = 81[97, 121, 125, 135, 138, 148, 152, 158, 163, 166^2, 172, 175, 177, 185, 189, 194, 199, 212, 215^2, 218, 223^2, 228, 229, 230, 234, 237, 238, 241^2, 242, 243, 245^2, 246, 252, 257, 259, 266, 267, 269, 270, 272, 273^2, 274, 275, 277, 279, 287^2, 289, 290^2, 293, 294, 296^2, 297, 312^2, 315^2, 317, 323, 326, 331, 337^2, 340, 343, 351, 356, 405, 533, 625, 1045, 1050, 1451]
ids = [160, 83, 526, 487, 394, 495, 81, 167, 186, 63, ...]

====================================================================================

UMI info for barcode TCTCATAGTGCGCTTG-1 contig 1 = TATGGGGAGT...
umi AACCTTGTCA = 286 reads: -320X +1 -1XX +1 -2XX +1 -5XX +1 -9XX +1 -9XX +37 invalidated
umi ACATTACATA = 199 reads: +179 -1XX +208 invalidated
umi ACATTAGTTA = 335 reads: +388 validated
umi ACTCCTATTG = 535 reads: +388 validated
umi ACTCGTATCA = 167 reads: +388 validated
umi ACTCTGGAGG = 235 reads: +388 validated
umi ACTGACGTCA = 223 reads: +388 validated
umi AGCCAAGCTG = 244 reads: +388 validated
umi AGGGACATGC = 337 reads: +388 validated
umi ATACCGGCTT = 313 reads: +388 validated
umi ATGGTCAACG = 218 reads: +388 validated
umi ATGTTTGCTA = 339 reads: +388 validated
umi ATTCTGTTCC = 157 reads: +388 validated
umi CACATTTTGA = 405 reads: +388 validated
umi CACCATTCTA = 163 reads: +388 validated
umi CACGGCGCGG = 298 reads: +388 validated
umi CACGTAAGCT = 314 reads: +388 validated
umi CAGCTCATAC = 316 reads: +388 validated
umi CAGTCAAATG = 269 reads: +388 validated
umi CATCGTCAAT = 314 reads: +388 validated
umi CATGCCGATA = 286 reads: +388 validated
umi CATTATAGCA = 272 reads: +388 validated
umi CCGGCGTCAG = 355 reads: +388 validated
umi CCGTTGTGAG = 242 reads: +388 validated
umi CTACACTCAA = 241 reads: +383 -1XX +2 -1XX +1 invalidated
umi CTAGCCATCT = 208 reads: +388 validated
umi CTATCTCCAC = 279 reads: +388 validated
umi CTCAGGATAT = 312 reads: +388 validated
umi CTGGGTCCGC = 341 reads: +388 validated
umi CTTTTTGGCC = 361 reads: +388 validated
umi GAAGCTCCGC = 323 reads: +388 validated
umi GAGTTTGGTC = 241 reads: +388 validated
umi GATCCTGTAT = 165 reads: -351X +37 invalidated
umi GATCTTGTGC = 256 reads: +388 validated
umi GCCACTCGTA = 293 reads: +388 validated
umi GCGCGAGAGT = 281 reads: +388 validated
umi GGAACAAGGA = 274 reads: +388 validated
umi GTGAGCCTTC = 141 reads: +388 validated
umi GTGAGTGTCC = 296 reads: +388 validated
umi GTTTCGCCAA = 242 reads: +129 -1XX +258 invalidated
umi TAAAGTGAGG = 290 reads: +388 validated
umi TAATTAGGGA = 277 reads: +388 validated
umi TAATTTCCTT = 270 reads: +388 validated
umi TACCCGCCGA = 229 reads: +388 validated
umi TAGGCATTCG = 266 reads: +388 validated
umi TATACTTGAA = 272 reads: +388 validated
umi TCACATTATG = 291 reads: +388 validated
umi TCCGCAGTGC = 241 reads: +388 validated
umi TGATACCCAA = 247 reads: +388 validated
umi TGCCTTCGGC = 149 reads: +388 validated
umi TGTAATAGGC = 334 reads: +183 -1XX +1 -2XX +201 invalidated
umi TTCATGTGCT = 193 reads: +388 validated
umi TTGTGTGCTC = 273 reads: +388 validated

UMI info for barcode TCTCATAGTGCGCTTG-1 contig 2 = AGTGCTTTCT...
umi AACGTACTGA = 243 reads: +466 validated
umi ACCGATTCTT = 149 reads: +456 -10 non-validated
umi AGAAGTCCGA = 225 reads: +466 validated
umi AGAGATATAT = 153 reads: +466 validated
umi AGATACCTGC = 102 reads: +466 validated
umi ATACAGAAGT = 223 reads: +466 validated
umi ATCGGCACAC = 291 reads: +466 validated
umi ATTACAGGCA = 98 reads: +405 -1 +3 -1 +11 -1 +2 -18 +9 -1 +14 non-validated
umi CAATCGACGA = 297 reads: +466 validated
umi CATAACCTGT = 285 reads: +466 validated
umi CATTCTCCCT = 148 reads: +452 -14 non-validated
umi CCCTATTTGC = 197 reads: +466 validated
umi CGTATTTCGA = 271 reads: +466 validated
umi CTTTGTGTTA = 214 reads: +466 validated
umi GATTCCAAGT = 182 reads: +460 -6 non-validated
umi GCCGTCGCGG = 216 reads: +466 validated
umi GTTAAACCCG = 256 reads: +466 validated
umi TAATCACATG = 221 reads: +466 validated
umi TATCGGTTGA = 258 reads: +466 validated
umi TGACGAGCGA = 117 reads: +466 validated
umi TGTTTCTACC = 174 reads: +466 validated
umi TTCAAGCCTA = 125 reads: +466 validated
umi TTCTGCCCAT = 491 reads: -429 +1 -2XX +1 -1XX +1 -8XX +1 -11XX +2 -1XX +1 -6XX +1 invalidated
umi TTGGCTGACA = 257 reads: +98 -1XX +367 invalidated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 50 umis using 2222 reads
cdr3 = CQQSYSTPWTF at 358, score = 9 + 8
umis assigned: [14, 45, 46, 62, 63, 64, 65, 87, 94, 117] and 43 others
of which 53 are surviving nonsolos
reads assigned: 14168
start codons at 1, 31, 37, 93, 106, 242, 381, 461
confident = true

TIG 2[bases=585]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
420-483 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
483-585 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 17 umis using 310 reads
cdr3 = CASKSLAVAGTQGSYSYYYYYMDVW at 377, score = 9 + 7
umis assigned: [17, 48, 76, 81, 83, 115, 145, 160, 183, 206] and 14 others
of which 24 are surviving nonsolos
reads assigned: 5114
start codons at 17, 38, 82, 168, 440, 501, 562
confident = true

REJECT CONTIGS

TIG 1[bases=304]
7-32 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
55-93 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
91-139 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
93-304 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [110, 166, 310, 355, 521]
of which 3 are surviving nonsolos
reads assigned: 3495
start codons at 57, 225
confident = false
did not find CDR3
now this is a cell
paired!

AGCAAGTCGCTAGCAGTGGCTGGTACTCAAGGTAGTTACTCTTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCATGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.114 = TCTCATAGTTGGTTTG-1

using 99 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 92]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.134 = TCTCATATCATCACCC-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 98.137 = TCTCATATCATTTGGG-1

using 260 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [3]

====================================================================================

UMI info for barcode TCTCATATCATTTGGG-1 contig 1 = GGAGAAGAGC...
umi GGTATCGGTA = 235 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=463]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-463 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPGTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 36, 244, 370
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk098-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk098-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.285 seconds used processing barcodes, peak mem = 0.23
