[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.27 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk096-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk096-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk096.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.0 = TCGTACCTCTTACCTA-1

using 167 reads

====================================================================================

graph has 64 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 4[2, 3, 45, 106]
surviving nonsolo ucounts = 2[45, 106]
ids = [7, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.3 = TCGTAGAAGAAGGGTA-1

using 117 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 1[115]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.6 = TCGTAGAAGATACACA-1

using 73 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 68]
surviving nonsolo ucounts = 1[68]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=411]
0-337 ==> 14-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=1)
337-374 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
374-411 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQDYNYPPVF at 313, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 48, 61, 143, 197
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.7 = TCGTAGAAGATCACGG-1

using 240 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 230]
surviving nonsolo ucounts = 1[230]
ids = [6]

====================================================================================

UMI info for barcode TCGTAGAAGATCACGG-1 contig 1 = GCTGCTCAGT...
umi TTGCCACTGG = 213 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=447]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-376 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-447 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGSSPGTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 28, 236, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.11 = TCGTAGAAGCCAGAAC-1

using 235 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[111, 124]
surviving nonsolo ucounts = 2[111, 124]
ids = [1, 0]

====================================================================================

UMI info for barcode TCGTAGAAGCCAGAAC-1 contig 1 = AACTGCTCAG...
umi GTACCTCCGA = 110 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=464]
0-29 ==> 18-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
29-374 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-464 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQRSNWPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 29, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.26 = TCGTAGACAAGAGGCT-1

using 219 reads

====================================================================================

graph has 366 edges initially, 2 edges after simplification

total ucounts = 139
nonsolo ucounts = 43[2^24, 3^10, 4^5, 5, 6, 7^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.32 = TCGTAGACACAACTGT-1

using 56 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 51]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.44 = TCGTAGACAGTATAAG-1

using 230 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[99, 130]
surviving nonsolo ucounts = 2[99, 130]
ids = [2, 0]

====================================================================================

UMI info for barcode TCGTAGACAGTATAAG-1 contig 1 = GTCAGTCTCA...
umi CCTCATAACC = 131 reads: +388 validated
umi TCCGCATCCC = 100 reads: -35 +353 non-validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 36 reads
cdr3 = CQQSYSTPITF at 350, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 225
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.45 = TCGTAGACAGTATGCT-1

using 55 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 1[55]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.57 = TCGTAGACATTTGCCC-1

using 171 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 166]
surviving nonsolo ucounts = 1[166]
ids = [2]

====================================================================================

UMI info for barcode TCGTAGACATTTGCCC-1 contig 1 = ACCACACCCC...
umi GGACTGGCTG = 157 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-46 ==> 13-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
46-399 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
448-482 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
482-522 ==> 0-40 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 388, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 46, 244, 249, 266, 310, 343
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.59 = TCGTAGAGTACTCAAC-1

using 205 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[97, 106]
surviving nonsolo ucounts = 2[97, 106]
ids = [0, 2]

====================================================================================

UMI info for barcode TCGTAGAGTACTCAAC-1 contig 1 = GGTAGCTCAG...
umi AACAGTGCAA = 87 reads: +391 validated
umi CTCCCCGGTC = 101 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=585]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=1)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-585 ==> 0-158 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 36 reads
cdr3 = CQSYDSSNRWVF at 363, score = 6 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 186
start codons at 36, 99, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.63 = TCGTAGAGTAGGAGTC-1

using 115 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.68 = TCGTAGAGTCAGAATA-1

using 136 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 31, 98]
surviving nonsolo ucounts = 2[31, 98]
ids = [6, 5]

====================================================================================

UMI info for barcode TCGTAGAGTCAGAATA-1 contig 1 = CATGGACATG...
umi TCAGACTCCT = 85 reads: -8 +380 non-validated
umi TCGTGTGTCC = 28 reads: +317 -5 +3 -1X +55 -7 invalidated

GOOD CONTIGS

TIG 1[bases=434]
1-352 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=33)
351-389 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
389-434 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYHSYSPTF at 328, score = 8 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 109
start codons at 1, 7, 63, 76, 212, 215, 308
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.74 = TCGTAGAGTCGGCTCA-1

using 297 reads

====================================================================================

graph has 234 edges initially, 26 edges after simplification

total ucounts = 66
nonsolo ucounts = 20[2^12, 3, 4^2, 10, 15, 46, 65, 80]
surviving nonsolo ucounts = 4[15, 46, 65, 80]
ids = [47, 27, 5, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.83 = TCGTAGAGTGTTCGAT-1

using 4629 reads

====================================================================================

graph has 2046 edges initially, 18 edges after simplification

total ucounts = 374
nonsolo ucounts = 164[2^72, 3^26, 4^13, 5^3, 6^5, 7^2, 8^2, 9^3, 10^2, 11^2, 12, 14, 23, 47, 76, 82, 94, 98, 102^2, 105, 106, 109, 110^2, 116, 117, 118, 123, 125^2, 131, 133^2, 142^2, 148, 152, 156^2, 171, 176, 184, 263]
surviving nonsolo ucounts = 33[10, 23, 47, 76, 82, 94, 98, 102^2, 105, 106, 109, 110^2, 116, 117, 118, 123, 125^2, 131, 133^2, 142^2, 148, 152, 156^2, 171, 176, 184, 263]
ids = [184, 354, 102, 227, 33, 183, 145, 81, 127, 299, ...]

====================================================================================

UMI info for barcode TCGTAGAGTGTTCGAT-1 contig 1 = AGAGCTCTGG...
umi AAAAAGCTCT = 177 reads: +385 validated
umi AAACCGCACT = 148 reads: +385 validated
umi AATTGACCCT = 145 reads: +385 validated
umi ACATTGGTTG = 84 reads: +385 validated
umi ACCATCGGAG = 132 reads: +385 validated
umi ACGGGATCTG = 184 reads: +385 validated
umi CCACACTTGG = 47 reads: -15 +370 non-validated
umi CCGAATTCAT = 125 reads: +26 -1X +1 -2X +1 -10X +1 -1 +342 invalidated
umi CGATGCCGAG = 263 reads: +385 validated
umi CGGAGCCTAA = 116 reads: +385 validated
umi CGGGCTGACG = 104 reads: +385 validated
umi CGTGAGCTGT = 108 reads: +385 validated
umi CGTTTTAGGA = 146 reads: +385 validated
umi CTATAGATTC = 96 reads: +385 validated
umi CTTAATCAGG = 170 reads: +385 validated
umi GAGTCGCTGT = 95 reads: +385 validated
umi GGTCTCCCGG = 75 reads: +332 -53 non-validated
umi TCCAAGTGGA = 158 reads: +385 validated
umi TCCTCCGCAC = 177 reads: +385 validated
umi TCGCCACGTA = 107 reads: +385 validated
umi TCGCCTCTCG = 135 reads: +385 validated
umi TGCTACAGTA = 142 reads: +385 validated
umi TTAACAACCC = 124 reads: +385 validated
umi TTATGCTTCT = 126 reads: +385 validated

UMI info for barcode TCGTAGAGTGTTCGAT-1 contig 2 = ATACTTTCTG...
umi ATTCCAAGCA = 101 reads: +421 validated
umi CAAGTCAAGG = 116 reads: +421 validated
umi CCATGGTGCG = 110 reads: +421 validated
umi CCGTCGTTCC = 110 reads: +421 validated
umi CCTGGCTATC = 119 reads: +421 validated
umi GAATCAATGT = 129 reads: +421 validated
umi GAGTTCCGGA = 10 reads: -88 +134 -36 +56 -1 +2 -1 +1 -2 +2 -2 +4 -1 +1 -1 +1 -36 +52 non-validated
umi TTCGTAGCCG = 23 reads: +80 -20 +285 -36 non-validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=8)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 507 reads
cdr3 = CQQYNDWPPITF at 365, score = 9 + 8
umis assigned: [1, 3, 24, 33, 34, 47, 102, 110, 121, 124] and 14 others
of which 24 are surviving nonsolos
reads assigned: 3104
start codons at 44, 113, 249, 252, 378, 471
confident = true

TIG 2[bases=529]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=8)
407-458 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 68 reads
cdr3 = CARAPKSGYSYNYFDPW at 376, score = 9 + 7
umis assigned: [81, 88, 104, 113, 117, 174, 184, 354]
of which 8 are surviving nonsolos
reads assigned: 712
start codons at 37, 81
confident = true

REJECT CONTIGS

TIG 1[bases=491]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=12)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-491 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CTTWDDSLSGRVF at 367, score = 7 + 8
umis assigned: [234]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 46, 350, 375, 380
confident = false
not full
full length stopped transcript of length 491
frameshifted full length stopped transcript of length 491
VJ delta = 20
not full
now this is a cell
paired!

GACACGGCCGTCTATTACTGTGCGAGAGCCCCAAAGAGTGGTTATAGTTACAACTACTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTTCTGTCAGCAGTATAATGACTGGCCTCCTATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.86 = TCGTAGAGTTATCGGT-1

using 267 reads

====================================================================================

graph has 130 edges initially, 30 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 116, 148]
surviving nonsolo ucounts = 2[116, 148]
ids = [0, 2]

====================================================================================

UMI info for barcode TCGTAGAGTTATCGGT-1 contig 1 = AGGAATCAGA...
umi CCAACATACC = 115 reads: +388 validated
umi TGATATCCAT = 68 reads: +11 -1XX +4 -1XX +30 -2XX +2 -1XX +9 -2XX +26 -1XX +3 -3XX +14 -1XX +23 -1XX +5 -1XX +6 -1XX +1 -2XX +2 -2XX +2 -2XX +1 -2X +2 -1X +3 -1 +1 -108 +14 -1XX +15 -1XX +2 -1XX +26 -1XX +3 -1XX +2 -1XX +1 -2XX +5 -1XX +22 -1XX +2 -2XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYNSYPRTF at 354, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 178
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.100 = TCGTAGATCCAAACTG-1

using 155 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 1[155]
ids = [0]

====================================================================================

UMI info for barcode TCGTAGATCCAAACTG-1 contig 1 = GAGGAACTGC...
umi GATAGTAATG = 138 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNNWPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.107 = TCGTAGATCGGCTTGG-1

using 98 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[97]
surviving nonsolo ucounts = 1[97]
ids = [1]

====================================================================================

UMI info for barcode TCGTAGATCGGCTTGG-1 contig 1 = ACAACAGGCA...
umi GAAACGTGTC = 89 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=489]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
387-425 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
425-489 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQYYSTPWTF at 364, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.108 = TCGTAGATCGGTCCGA-1

using 116 reads

====================================================================================

graph has 66 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[35, 81]
surviving nonsolo ucounts = 2[35, 81]
ids = [1, 0]

====================================================================================

UMI info for barcode TCGTAGATCGGTCCGA-1 contig 1 = ACCATGGCCT...
umi GGTATTGGTA = 76 reads: -1 +10 -1 +376 non-validated

GOOD CONTIGS

TIG 1[bases=452]
3-357 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
353-391 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
391-452 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CSSHAGSTRVLF at 327, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 74
start codons at 3, 160, 211, 310, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.109 = TCGTAGATCGTCGTTC-1

using 35 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 1[35]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.110 = TCGTAGATCGTTGACA-1

using 113 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 107]
surviving nonsolo ucounts = 1[107]
ids = [0]

====================================================================================

UMI info for barcode TCGTAGATCGTTGACA-1 contig 1 = GGCTTTCTGA...
umi ATTCAAATCT = 105 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=536]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
463-536 ==> 0-73 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CARRDYYGSERVDFDYW at 381, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 15, 24, 36, 80, 96, 184, 303, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.115 = TCGTAGATCTGGTGTA-1

using 6549 reads

====================================================================================

graph has 3491 edges initially, 68 edges after simplification

total ucounts = 637
nonsolo ucounts = 255[2^110, 3^51, 4^25, 5^4, 6^3, 7^3, 8^3, 9, 10^2, 11^2, 12^2, 17, 18, 21, 22, 27, 32, 38, 42^3, 47, 49, 64, 68, 69, 75, 76, 79, 81, 84, 85, 86, 88^2, 91^3, 92, 94, 98, 99, 101, 103, 104^3, 109, 117, 119, 128, 177, 182, 185, 194, 275, 279, 328, 453, 478]
surviving nonsolo ucounts = 48[2, 4, 7, 17, 22, 27, 38, 42^3, 47, 49, 64, 69, 75, 76, 79, 81, 84, 85, 86, 88^2, 91^3, 92, 94, 98, 99, 101, 103, 104^3, 109, 117, 119, 128, 177, 182, 185, 194, 275, 279, 328, 453, 478]
ids = [124, 160, 184, 598, 337, 253, 515, 367, 400, 602, ...]

====================================================================================

UMI info for barcode TCGTAGATCTGGTGTA-1 contig 1 = GGGGGCTGGG...
umi AAGTACGGTA = 110 reads: +388 validated
umi ACTCATTTAG = 131 reads: +388 validated
umi ATAATGCGTT = 100 reads: +388 validated
umi ATGCGCTGTA = 117 reads: +388 validated
umi CAAGAGGTTT = 65 reads: +388 validated
umi CCGCTGAGTA = 100 reads: +388 validated
umi CGCCTTGGCT = 119 reads: +388 validated
umi CTCTCGACTG = 82 reads: +388 validated
umi CTGCACACAC = 94 reads: +388 validated
umi GAGTGACACA = 88 reads: +15 -7 +366 non-validated
umi GGGAACCATA = 44 reads: +254 -1X +133 invalidated
umi GTAACGTTCT = 77 reads: +388 validated
umi GTCGCATGCT = 92 reads: +388 validated
umi TGATCTCCTG = 450 reads: -323 +65 non-validated
umi TGCGGATGGC = 90 reads: +388 validated
umi TGTCTCCGTT = 78 reads: +388 validated

UMI info for barcode TCGTAGATCTGGTGTA-1 contig 2 = AGCTCTGGGA...
umi AAATTGCTCG = 102 reads: +424 validated
umi AACATAACCC = 88 reads: +374 -24 +26 non-validated
umi ACAAATCGCC = 147 reads: -89 +335 non-validated
umi CAATGACGGT = 70 reads: +424 validated
umi CATATTCCTT = 75 reads: +408 -1 +9 -6 non-validated
umi CCTACGGGGT = 106 reads: +338 -1 +62 -23 non-validated
umi CGTGTTACAA = 93 reads: +424 validated
umi CTTCCCGCTG = 93 reads: +424 validated
umi GAACCACTGC = 86 reads: +424 validated
umi GACAGATAGT = 83 reads: +408 -16 non-validated
umi GATTTGAATC = 42 reads: +342 -82 non-validated
umi TCCTTTCTTC = 103 reads: +411 -1 +12 non-validated
umi TCGAGTAGTA = 38 reads: +304 -1 +4 -1 +1 -1 +3 -15 +56 -38 non-validated
umi TGTCATTCAC = 87 reads: +424 validated
umi TTCCTCTAGC = 17 reads: -4 +167 -1 +92 -1 +77 -1 +5 -32 +44 non-validated
umi TTCGTGTCCC = 43 reads: +272 -3 +1 -1 +2 -1 +3 -1 +2 -4 +3 -2 +1 -1 +1 -4 +1 -1 +2 -3 +43 -1 +12 -59 non-validated

GOOD CONTIGS

TIG 1[bases=644]
45-384 ==> 0-339 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 15 umis using 227 reads
cdr3 = CSSYTGRNDWVF at 369, score = 8 + 7
umis assigned: [33, 74, 100, 123, 155, 227, 254, 303, 311, 361] and 6 others
of which 16 are surviving nonsolos
reads assigned: 1799
start codons at 45, 256
confident = true

TIG 2[bases=575]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=26)
456-504 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 105 reads
cdr3 = CCRGGPLTGFPDDYW at 428, score = 9 + 7
umis assigned: [14, 18, 47, 161, 185, 233, 272, 332, 347, 349] and 6 others
of which 16 are surviving nonsolos
reads assigned: 1253
start codons at 80, 133, 236, 303, 360, 389, 462
confident = true

REJECT CONTIGS

TIG 1[bases=469]
0-49 ==> 0-49 on |208|IGHV7-4-1|5'UTR| [len=49] (mis=0)
0-49 ==> 5951-6000 on rc of segment after IGHV7-4-1 exon 1 [len=6000] (mis=0)
49-91 ==> 0-42 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=1)
95-179 ==> 0-84 on rc of segment before IGHV7-27 exon 1 [len=84] (mis=10)
175-278 ==> 42-145 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=3)
291-327 ==> 317-353 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=4)
350-398 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
398-469 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [22, 45, 178, 204, 236, 253, 592, 621]
of which 8 are surviving nonsolos
reads assigned: 912
start codons at 49, 315
confident = false
full length stopped transcript of length 469
frameshifted full length stopped transcript of length 469
did not find CDR3

TIG 2[bases=465]
0-60 ==> 0-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
25-78 ==> 2883-2936 on segment before IGLVV-58 exon 1 [len=3104] (mis=3)
60-256 ==> 0-196 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=8)
254-465 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [80, 81, 230, 381]
of which 4 are surviving nonsolos
reads assigned: 1160
start codons at 60, 221
confident = false
did not find CDR3
now this is a cell
paired!

AGCGAGGACACAGCCGTGTATTATTGTTGCAGAGGAGGTCCCCTCACTGGCTTCCCCGATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAGGCAGAAACGATTGGGTGTTCGGCGGAGGGACCCAGTTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.117 = TCGTAGATCTTATCTG-1

using 258 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [3]

====================================================================================

UMI info for barcode TCGTAGATCTTATCTG-1 contig 1 = AGAGCTCTGG...
umi TTCTCCGGCT = 260 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=16)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYSSSPVTF at 368, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 44, 93, 186, 252, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.120 = TCGTAGATCTTGACGA-1

using 4152 reads

====================================================================================

graph has 2274 edges initially, 30 edges after simplification

total ucounts = 405
nonsolo ucounts = 161[2^70, 3^35, 4^11, 5^10, 6^6, 7, 8, 9, 26, 32, 54, 62, 71, 81, 87, 88, 90, 92, 94, 98, 122, 134, 138, 153, 157, 163, 164, 179, 182, 186, 192, 193, 314, 357]
surviving nonsolo ucounts = 25[26, 32, 54, 71, 81, 87, 88, 90, 92, 94, 98, 122, 134, 138, 153, 157, 163, 164, 179, 182, 186, 192, 193, 314, 357]
ids = [254, 115, 181, 257, 272, 222, 397, 232, 274, 114, ...]

====================================================================================

UMI info for barcode TCGTAGATCTTGACGA-1 contig 1 = GCCCCACCAT...
umi CGCAACTCAT = 163 reads: +418 validated

UMI info for barcode TCGTAGATCTTGACGA-1 contig 2 = TGAGCGCAGA...
umi CAGTTACTTG = 66 reads: +48 -1 +337 -8 non-validated
umi CAGTTTACTT = 31 reads: -5 +345 -1 +18 -9 +16 non-validated
umi CTATCTGCGT = 55 reads: -1 +351 -42 non-validated
umi GCGCCTGTTG = 92 reads: +394 validated
umi GGAATCTCCT = 139 reads: +394 validated
umi GGTGAGCCCT = 28 reads: +12 -19 +200 -1 +10 -1 +151 non-validated
umi GTCCCGCTGA = 155 reads: +394 validated
umi GTGCTCGGGT = 81 reads: +394 validated
umi GTGGAAACAG = 63 reads: +31 -3X +1 -1XX +1 -6XX +323 -28 invalidated
umi TCGACGCGTT = 80 reads: +21 -1 +2 -1 +6 -3X +1 -1X +1 -6XX +308 -1 +42 invalidated
umi TTGTCGAACC = 117 reads: +394 validated
umi TTTCTCATTC = 88 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=497]
8-366 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
378-426 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
426-497 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAHRHYKRAYFDYW at 353, score = 7 + 7
umis assigned: [157]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 8, 52, 231, 234, 314, 323
confident = true

TIG 2[bases=641]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 120 reads
cdr3 = CGTWDSSLSAGDVVF at 357, score = 7 + 8
umis assigned: [114, 115, 181, 232, 244, 254, 262, 272, 274, 320] and 2 others
of which 12 are surviving nonsolos
reads assigned: 982
start codons at 36, 190, 241, 365, 391
confident = true

REJECT CONTIGS

TIG 1[bases=594]
1-107 ==> 5504-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
60-420 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
421-458 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
458-594 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [54, 101, 108, 135, 159, 222, 257, 331, 332, 382] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2171
start codons at 60, 93, 121, 129, 217, 379, 399, 500
confident = false
did not find CDR3
now this is a cell
paired!

GACCCTGTGGACACAGCCACATATTACTGTGCACACAGACACTATAAGAGGGCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGGGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.127 = TCTATTGAGACTGGGT-1

using 229 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.134 = TCTATTGAGATGTGGC-1

using 233 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 3, 216]
surviving nonsolo ucounts = 1[216]
ids = [11]

====================================================================================

UMI info for barcode TCTATTGAGATGTGGC-1 contig 1 = AAAACCACAC...
umi TATAGCGTCC = 207 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=510]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-510 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.135 = TCTATTGAGCAGCGTA-1

using 57 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 51]
surviving nonsolo ucounts = 1[51]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.141 = TCTATTGAGGTGATAT-1

using 173 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 164]
surviving nonsolo ucounts = 1[164]
ids = [1]

====================================================================================

UMI info for barcode TCTATTGAGGTGATAT-1 contig 1 = AGGAGTCAGA...
umi ATGCACGATA = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=441]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-441 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 27, 33, 89, 102, 238, 241, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.142 = TCTATTGAGTACCGGA-1

using 289 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 12, 266]
surviving nonsolo ucounts = 1[266]
ids = [8]

====================================================================================

UMI info for barcode TCTATTGAGTACCGGA-1 contig 1 = GGGGTCTCAG...
umi TGCAAACATC = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-567 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.149 = TCTATTGAGTGTTTGC-1

using 239 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 234]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TCTATTGAGTGTTTGC-1 contig 1 = ATCACTCAAC...
umi CATATCATTA = 206 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=483]
58-411 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=29)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 12 reads
cdr3 = CAREAHSSDYLYYFDFW at 400, score = 10 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 205
start codons at 58, 209, 256, 261, 265, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.159 = TCTATTGCACAAGCCC-1

using 565 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[239, 324]
surviving nonsolo ucounts = 2[239, 324]
ids = [0, 2]

====================================================================================

UMI info for barcode TCTATTGCACAAGCCC-1 contig 1 = ACCCAAAAAC...
umi CCAACTTCGG = 230 reads: +436 validated

UMI info for barcode TCTATTGCACAAGCCC-1 contig 2 = AGCTTCAGCT...
umi TCCATACATC = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=19)
442-490 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
490-590 ==> 0-100 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKYYRDPYYHDSGAVDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 433, 544
confident = false

TIG 2[bases=550]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-550 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.161 = TCTATTGCACACTGCG-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.164 = TCTATTGCACCGAATT-1

using 346 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[342]
surviving nonsolo ucounts = 1[342]
ids = [0]

====================================================================================

UMI info for barcode TCTATTGCACCGAATT-1 contig 1 = AGGAATCAGA...
umi ACCCGAAGCG = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.165 = TCTATTGCACCGATAT-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 96.166 = TCTATTGCACGAAGCA-1

using 291 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3^3, 5, 274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

UMI info for barcode TCTATTGCACGAAGCA-1 contig 1 = AGCTTCAGCT...
umi ACTAGTCTCA = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=603]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-603 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!
sorting bam, mem = 0.04
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk096-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk096-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

4.870 seconds used processing barcodes, peak mem = 0.23
