[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.27 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk094-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk094-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk094.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.0 = TATTACCGTCAACATC-1

using 15846 reads

====================================================================================

graph has 7496 edges initially, 72 edges after simplification

total ucounts = 1219
nonsolo ucounts = 607[2^231, 3^119, 4^80, 5^49, 6^27, 7^15, 8^14, 9^4, 10, 11, 12^3, 13, 17, 22, 25, 28, 33, 90, 91, 104, 115^2, 126, 127^2, 135^2, 143, 156, 162, 173^2, 178, 189, 192, 201, 203^2, 207, 210, 220, 221, 226, 231, 242, 244, 246, 249^2, 251, 256, 259, 260, 264^2, 265^2, 266, 270, 281, 284, 288, 292, 311, 313, 315, 318, 322, 331, 333, 343, 381, 382, 443]
surviving nonsolo ucounts = 55[90, 91, 104, 115^2, 127^2, 135^2, 143, 156, 162, 173^2, 178, 189, 192, 201, 203^2, 207, 210, 220, 221, 226, 231, 242, 244, 246, 249^2, 251, 256, 259, 260, 264^2, 265^2, 266, 270, 281, 284, 288, 292, 313, 315, 318, 322, 331, 333, 343, 381, 382, 443]
ids = [340, 318, 858, 690, 1194, 780, 1108, 434, 1006, 333, ...]

====================================================================================

UMI info for barcode TATTACCGTCAACATC-1 contig 1 = AGTGCTTTCT...
umi AAATCCCCGC = 331 reads: +436 validated
umi AACGCTATTC = 266 reads: +436 validated
umi AGGATACGGA = 211 reads: +436 validated
umi ATAGCTGGCC = 23 reads: -382X +1 -7XX +1 -5XX +4 -1XX +14 -1XX +20 invalidated
umi CATACAAGGG = 204 reads: +436 validated
umi CATTTGGGCT = 136 reads: +5 -1 +430 non-validated
umi CCGCAGTGGG = 256 reads: +436 validated
umi CGCTCTTTCG = 204 reads: +436 validated
umi CGGAGTCCAA = 232 reads: +436 validated
umi CGTCCCTGAT = 252 reads: +436 validated
umi CTAGACGCGC = 173 reads: +436 validated
umi CTATCGCCCT = 319 reads: +393 -1 +42 non-validated
umi CTATCTGGGA = 289 reads: +436 validated
umi GACAGACCTT = 247 reads: +436 validated
umi GACTATGCTC = 114 reads: +436 validated
umi GCCGGACAAT = 265 reads: +436 validated
umi GGATTTACAC = 127 reads: +436 validated
umi GGGTAGCGCT = 272 reads: +436 validated
umi GTTCGGCCGT = 249 reads: +436 validated
umi TACGAATTCT = 234 reads: +436 validated
umi TATATTACGG = 288 reads: +436 validated
umi TATGACTTCA = 271 reads: +436 validated
umi TATTAAATCG = 253 reads: +436 validated
umi TCCTGGTTGG = 139 reads: +436 validated
umi TCTCACAGGC = 257 reads: +436 validated
umi TTAACTCCCT = 129 reads: +436 validated
umi TTCCAAGTCC = 281 reads: +436 validated
umi TTTACCTTTC = 195 reads: +436 validated
umi TTTCGTTATA = 166 reads: +436 validated

UMI info for barcode TATTACCGTCAACATC-1 contig 2 = GCTGTGCTGT...
umi AAGTCACCTG = 267 reads: +379 validated
umi AGTGCATGAG = 199 reads: +379 validated
umi ATCCCCTTCG = 214 reads: +379 validated
umi CCAATGTACT = 73 reads: +47 -2X +268 -3 +56 -3 invalidated
umi CCACAGCCAA = 266 reads: +379 validated
umi CGCCAGACAC = 253 reads: +379 validated
umi CGGAGCAATA = 245 reads: +379 validated
umi GAAAGTGGGC = 219 reads: +379 validated
umi TCATTACATC = 384 reads: +379 validated
umi TTGAAGCGGC = 187 reads: +379 validated
umi TTGTGTATCT = 205 reads: +379 validated
umi TTTAAGTCTC = 291 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=613]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=24)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
453-613 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 28 umis using 875 reads
cdr3 = CARRVVGPTGYFDYW at 377, score = 9 + 6
umis assigned: [16, 27, 207, 264, 407, 434, 472, 534, 541, 561] and 19 others
of which 28 are surviving nonsolos
reads assigned: 6254
start codons at 17, 38, 82, 168, 183, 227, 252, 345, 507
confident = true

TIG 2[bases=633]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=15)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 443 reads
cdr3 = CQSVDSSGTYVF at 358, score = 8 + 8
umis assigned: [54, 233, 281, 437, 440, 522, 540, 668, 977, 1169] and 2 others
of which 11 are surviving nonsolos
reads assigned: 2763
start codons at 43, 104, 173, 191, 232, 323, 386, 554
confident = true

REJECT CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
16-63 ==> 5674-5721 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
31-349 ==> 0-318 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=27)
390-419 ==> 8-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [35, 76, 192, 318, 333, 340, 365, 411, 594, 792] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3569
start codons at 31, 37, 95, 106, 341, 461
confident = false
did not find CDR3
now this is a cell
paired!

GCCGCGGACACGGCTGTGTATTACTGTGCGAGAAGGGTCGTGGGACCGACGGGATACTTTGACTACTGGGGCCAGGGAAACCTGGTCACCGTCTCCTCAG <==> AATGAAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGTGGACAGCAGTGGGACTTATGTCTTCGGAAGTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.2 = TATTACCGTCAGGACA-1

using 868 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 11, 849]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.13 = TATTACCGTGCAGGTA-1

using 18 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.21 = TATTACCGTTAGATGA-1

using 260 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode TATTACCGTTAGATGA-1 contig 1 = TGATCAGGAC...
umi AATTTTTAGT = 247 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=473]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-357 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
428-473 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMNTLPGGFTF at 367, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 31, 64, 100, 188, 350, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.25 = TATTACCGTTCCTCCA-1

using 251 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode TATTACCGTTCCTCCA-1 contig 1 = GGAATCAGTC...
umi ACATCCCCCG = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.29 = TATTACCGTTTCCACC-1

using 233 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 227]
surviving nonsolo ucounts = 1[227]
ids = [3]

====================================================================================

UMI info for barcode TATTACCGTTTCCACC-1 contig 1 = GAGCTGCTCA...
umi GACTGTTTAT = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=443]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-443 ==> 0-25 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSTGYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 30, 238, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.40 = TATTACCTCATGTCCC-1

using 9718 reads

====================================================================================

graph has 5048 edges initially, 58 edges after simplification

total ucounts = 976
nonsolo ucounts = 450[2^172, 3^87, 4^68, 5^24, 6^22, 7^12, 8^6, 9^15, 10^4, 11, 12^2, 13, 14, 15^2, 23, 40, 56, 57, 58, 85, 104, 129, 143, 157, 161, 184, 220, 256, 262, 275, 276, 279, 281, 285, 294, 300, 303, 309, 313, 322, 333, 337, 355, 356, 362, 364, 385]
surviving nonsolo ucounts = 26[57, 85, 143, 161, 184, 220, 256, 262, 275, 276, 279, 281, 285, 294, 300, 303, 309, 313, 322, 333, 337, 355, 356, 362, 364, 385]
ids = [863, 38, 447, 687, 131, 953, 490, 257, 228, 423, ...]

====================================================================================

UMI info for barcode TATTACCTCATGTCCC-1 contig 1 = AAATTCAGGT...
umi ACTCATACGG = 151 reads: +433 validated
umi AGGGGATCTA = 329 reads: +433 validated
umi TGTAACTGGC = 55 reads: -417 +1 -1 +9 -1X +4 invalidated
umi TTTCCATCTT = 225 reads: +433 validated

UMI info for barcode TATTACCTCATGTCCC-1 contig 2 = AGGAGTCAGA...
umi AACTCCTAGG = 358 reads: +388 validated
umi AAGATGTGCA = 83 reads: +2 -1 +1 -1 +383 non-validated
umi AAGATGTGTA = 340 reads: +388 validated
umi AATTAATTAT = 365 reads: +388 validated
umi ATCACACGTA = 384 reads: +388 validated
umi ATTCTTCTTG = 271 reads: +388 validated
umi CACTAACGTT = 257 reads: +388 validated
umi CGGCTACCTT = 279 reads: +388 validated
umi CTGGCATATA = 301 reads: +388 validated
umi CTTCAGCTGT = 274 reads: +388 validated
umi GAAACATTCG = 142 reads: +388 validated
umi GAAGGTTTAC = 282 reads: +388 validated
umi GATGTCCTCA = 257 reads: +388 validated
umi GATTTGCTCC = 320 reads: +388 validated
umi GCGCATACTG = 353 reads: +388 validated
umi GTCTCTTACA = 313 reads: +388 validated
umi GTGCTTGATA = 293 reads: +388 validated
umi TAAATTGCGT = 159 reads: +388 validated
umi TACGGTTTGG = 311 reads: +388 validated
umi TTGGGTCCGT = 306 reads: +388 validated
umi TTTGCTGGCC = 365 reads: +388 validated
umi TTTTCTACCG = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
0-64 ==> 81-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
64-414 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=1)
444-497 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
497-599 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 61 reads
cdr3 = CARGRDYYGSGAPGYYGMDVW at 403, score = 9 + 7
umis assigned: [131, 184, 863, 953]
of which 4 are surviving nonsolos
reads assigned: 751
start codons at 20, 64, 108, 425, 454, 515, 576
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1063 reads
cdr3 = CQQYNSYTYTF at 354, score = 8 + 8
umis assigned: [32, 38, 39, 63, 209, 228, 257, 356, 413, 423] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6208
start codons at 27, 33, 89, 102, 334, 457
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGGAAGGGATTACTATGGTTCGGGGGCCCCGGGCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACACGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.46 = TATTACCTCCCGGATG-1

using 288 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode TATTACCTCCCGGATG-1 contig 1 = GGCACCAGGG...
umi ATCATCATCC = 260 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=560]
0-31 ==> 3-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=3)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
416-560 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLLSYSGAWVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 31, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.51 = TATTACCTCCTTTCGG-1

using 527 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[251, 268]
surviving nonsolo ucounts = 2[251, 268]
ids = [6, 3]

====================================================================================

UMI info for barcode TATTACCTCCTTTCGG-1 contig 1 = GCTCTGCTTC...
umi GAGAACGATC = 244 reads: +391 validated

UMI info for barcode TATTACCTCCTTTCGG-1 contig 2 = GTCAGACTCA...
umi CCCAAGGTTG = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-574 ==> 0-132 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 205, 259, 358, 385, 406
confident = false

TIG 2[bases=462]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-462 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.58 = TATTACCTCGTAGGTT-1

using 191 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 4, 176]
surviving nonsolo ucounts = 1[176]
ids = [9]

====================================================================================

UMI info for barcode TATTACCTCGTAGGTT-1 contig 1 = AGAGCTGCTC...
umi TGAGATGTTT = 158 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=509]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-367 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-509 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYRNSITF at 355, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 31, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.75 = TATTACCTCTTGCATT-1

using 180 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [3]

====================================================================================

UMI info for barcode TATTACCTCTTGCATT-1 contig 1 = GGAGTCTCCC...
umi TACATGGTTA = 161 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=468]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=5)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
junction support: 1 umis using 11 reads
cdr3 = CARGLVATIEYW at 401, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 59, 233, 257
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.78 = TCAACGAAGACAGAGA-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.79 = TCAACGAAGACAGGCT-1

using 363 reads

====================================================================================

graph has 117 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[362]
surviving nonsolo ucounts = 1[362]
ids = [1]

====================================================================================

UMI info for barcode TCAACGAAGACAGGCT-1 contig 1 = AGGAATCAGA...
umi TTCCTACAAG = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CHQYNSYPLTF at 354, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.82 = TCAACGAAGAGTCTGG-1

using 423 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 181, 234]
surviving nonsolo ucounts = 2[181, 234]
ids = [7, 8]

====================================================================================

UMI info for barcode TCAACGAAGAGTCTGG-1 contig 1 = GCTCTGCTTC...
umi CTATGGTCGC = 181 reads: +394 validated

UMI info for barcode TCAACGAAGAGTCTGG-1 contig 2 = AGAGCTCTGG...
umi TTGGTACATG = 226 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-551 ==> 0-106 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=474]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-474 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQHATSPFTF at 368, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.95 = TCAACGAAGGCAGTCA-1

using 219 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode TCAACGAAGGCAGTCA-1 contig 1 = GAGGAGTCAG...
umi GCATTTTGGG = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-488 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSYSTLLTF at 355, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.101 = TCAACGAAGTATGACA-1

using 284 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================

UMI info for barcode TCAACGAAGTATGACA-1 contig 1 = GATCAGGACT...
umi TAGCAACTAA = 272 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.102 = TCAACGAAGTCTCAAC-1

using 97 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 12[2^3, 3, 4, 5, 7, 11, 14^2, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.108 = TCAACGACAACGATGG-1

using 76 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 4, 66]
surviving nonsolo ucounts = 1[66]
ids = [3]

====================================================================================

UMI info for barcode TCAACGACAACGATGG-1 contig 1 = GGCTCAGGAG...
umi GACTGCACTT = 64 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-32 ==> 3-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
32-379 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=10)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
414-494 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CYSTDSSGNRRVF at 347, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 63
start codons at 32, 93, 162, 180, 231, 293, 330
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.112 = TCAACGACACACTGCG-1

using 180 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[180]
surviving nonsolo ucounts = 1[180]
ids = [0]

====================================================================================

UMI info for barcode TCAACGACACACTGCG-1 contig 1 = GCTCTGCTTC...
umi TCGCTCTCGT = 173 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=506]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
442-506 ==> 0-64 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.114 = TCAACGACACATCTTT-1

using 2946 reads

====================================================================================

graph has 4328 edges initially, 30 edges after simplification

total ucounts = 1259
nonsolo ucounts = 575[2^239, 3^136, 4^78, 5^40, 6^33, 7^11, 8^8, 9^9, 10^6, 11^4, 12, 13^2, 14, 16, 17, 18^2, 20, 22, 177]
surviving nonsolo ucounts = 3[2, 6, 177]
ids = [56, 921, 942]

====================================================================================

UMI info for barcode TCAACGACACATCTTT-1 contig 1 = GGAATCAGTC...
umi TATAAACAGC = 174 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-492 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [942]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.120 = TCAACGACACTGCCAG-1

using 111 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 1[109]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.122 = TCAACGACAGAAGCAC-1

using 769 reads

====================================================================================

graph has 890 edges initially, 6 edges after simplification

total ucounts = 266
nonsolo ucounts = 119[2^44, 3^25, 4^22, 5^9, 6^8, 7^5, 8^4, 12, 198]
surviving nonsolo ucounts = 1[198]
ids = [83]

====================================================================================

UMI info for barcode TCAACGACAGAAGCAC-1 contig 1 = AGCTGGGAAG...
umi CACTATCAGG = 198 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=517]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=7)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
433-517 ==> 0-84 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CVLYMGSGISVF at 369, score = 7 + 8
umis assigned: [83]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 30, 45, 54, 57, 82, 349, 352, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.125 = TCAACGACAGTCAGCC-1

using 173 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.126 = TCAACGACAGTTCCCT-1

using 270 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 261]
surviving nonsolo ucounts = 1[261]
ids = [5]

====================================================================================

UMI info for barcode TCAACGACAGTTCCCT-1 contig 1 = GGAATCAGTC...
umi TTGCGGTTAG = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-504 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.128 = TCAACGACATCCAACA-1

using 16 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 11]
surviving nonsolo ucounts = 1[11]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.134 = TCAACGACATGCAATC-1

using 455 reads

====================================================================================

graph has 144 edges initially, 8 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[127^2, 199]
surviving nonsolo ucounts = 3[127^2, 199]
ids = [0, 2, 4]

====================================================================================

UMI info for barcode TCAACGACATGCAATC-1 contig 1 = GGAGTCTCCC...
umi TAGTAATTCT = 123 reads: +418 validated

UMI info for barcode TCAACGACATGCAATC-1 contig 2 = AAACCACACC...
umi TTTTTTCCTT = 194 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=498]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-498 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 59, 233
confident = false

TIG 2[bases=505]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
450-484 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-505 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 390, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 48, 246, 251, 268, 312, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.135 = TCAACGACATGCCCGA-1

using 508 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 500]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.144 = TCAACGAGTAGCCTAT-1

using 494 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 139, 350]
surviving nonsolo ucounts = 2[139, 350]
ids = [4, 3]

====================================================================================

UMI info for barcode TCAACGAGTAGCCTAT-1 contig 1 = TGGGGAGTCA...
umi TAACTCGAGG = 323 reads: +388 validated
umi TCAGCAGGCT = 131 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
19-370 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=22)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
407-494 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CQQSFRSPLTF at 346, score = 9 + 9
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 451
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.151 = TCAACGAGTCGCTTCT-1

using 62 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[17, 44]
surviving nonsolo ucounts = 2[17, 44]
ids = [1, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.153 = TCAACGAGTCTAGCGC-1

using 16 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.154 = TCAACGAGTCTCACCT-1

using 138 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 134]
surviving nonsolo ucounts = 1[134]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.156 = TCAACGAGTCTCCCTA-1

using 300 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode TCAACGAGTCTCCCTA-1 contig 1 = GGGGATCAGT...
umi ATACCCTTCT = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.167 = TCAACGAGTTACGGAG-1

using 283 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode TCAACGAGTTACGGAG-1 contig 1 = AGTCAGACTC...
umi GCTCATCCTG = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNSYPLTF at 351, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 24, 30, 86, 99, 235, 238, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.168 = TCAACGAGTTACGTCA-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.171 = TCAACGAGTTCCCTTG-1

using 712 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 15, 689]
surviving nonsolo ucounts = 1[689]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=373]
9-200 ==> 172-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
198-237 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
237-373 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYGSPRTF at 176, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 672
start codons at 159, 189, 279
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.180 = TCAACGATCAGGCGAA-1

using 278 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5^2, 266]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.185 = TCAACGATCCCATTAT-1

using 182 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 1[182]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=484]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-50 ==> 11314-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
36-68 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-484 ==> 12-44 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 50, 248, 253, 270, 314, 347
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.189 = TCAACGATCCTCAATT-1

using 300 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode TCAACGATCCTCAATT-1 contig 1 = AGTCAGTCTC...
umi ACAATCACAC = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CHQSYSTPLTF at 351, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 24, 30, 86, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.192 = TCAACGATCGCAAGCC-1

using 210 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[210]
surviving nonsolo ucounts = 1[210]
ids = [0]

====================================================================================

UMI info for barcode TCAACGATCGCAAGCC-1 contig 1 = GGAGAAGAGC...
umi GGGCCACTGC = 204 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=500]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-500 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQHATSPFTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.209 = TCAATCTAGAAGGACA-1

using 1819 reads

====================================================================================

graph has 2348 edges initially, 42 edges after simplification

total ucounts = 692
nonsolo ucounts = 350[2^115, 3^69, 4^57, 5^37, 6^17, 7^12, 8^15, 9^9, 10^8, 11^2, 12, 13^3, 16, 17^2, 18, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.212 = TCAATCTAGACTAGAT-1

using 580 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 574]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.223 = TCAATCTAGCTCCTCT-1

using 301 reads

====================================================================================

graph has 118 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 8, 286]
surviving nonsolo ucounts = 1[286]
ids = [1]

====================================================================================

UMI info for barcode TCAATCTAGCTCCTCT-1 contig 1 = AGAGCTGCTC...
umi AATGAGTCAG = 287 reads: +391 validated
umi TCGGTTGTAT = 6 reads: -152X +1 -3XX +1 -1XX +1 -2XX +1 -1XX +1 -1XX +73 -2X +7 -1X +8 -1XX +21 -1X +20 -1X +2 -2X +2 -1X +1 -83 invalidated

GOOD CONTIGS

TIG 1[bases=558]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-77 ==> 0-46 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
83-385 ==> 46-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=7)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPRTF at 361, score = 7 + 7
umis assigned: [1, 5]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 31, 245, 287, 352, 371, 464
confident = false
see insertion of CAGTCT at pos 46 on |283|IGKV3-20|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.226 = TCAATCTAGGAATCGC-1

using 262 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 9, 243]
surviving nonsolo ucounts = 1[243]
ids = [9]

====================================================================================

UMI info for barcode TCAATCTAGGAATCGC-1 contig 1 = AGAGCTCTGG...
umi TTAAGTTTCT = 235 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=519]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
429-519 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYGSSLFTF at 368, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.228 = TCAATCTAGGACTGGT-1

using 189 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[188]
surviving nonsolo ucounts = 1[188]
ids = [0]

====================================================================================

UMI info for barcode TCAATCTAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi CTCTTTTCTA = 189 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-566 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 32 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.231 = TCAATCTAGGCCCGTT-1

using 264 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 261]
surviving nonsolo ucounts = 1[261]
ids = [0]

====================================================================================

UMI info for barcode TCAATCTAGGCCCGTT-1 contig 1 = AGACTCAGTC...
umi AGTTGCATCA = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-469 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDSFSWTF at 347, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 20, 26, 82, 95, 231, 234, 327, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.237 = TCAATCTAGGTTCCTA-1

using 665 reads

====================================================================================

graph has 244 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 7, 246, 406]
surviving nonsolo ucounts = 2[246, 406]
ids = [2, 1]

====================================================================================

UMI info for barcode TCAATCTAGGTTCCTA-1 contig 1 = GGAGGAGTCA...
umi ACTACCTCAG = 382 reads: +388 validated

UMI info for barcode TCAATCTAGGTTCCTA-1 contig 2 = GTGGGCTCAG...
umi CACGTTGGGG = 242 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-494 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CQQSYSTPHTF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 29, 35, 91, 104, 240, 459
confident = false

TIG 2[bases=515]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=10)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-515 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CYSTDSSGNRRVF at 350, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.239 = TCAATCTAGTACGCGA-1

using 214 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[4, 8, 195]
surviving nonsolo ucounts = 1[195]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.240 = TCAATCTAGTACGTTC-1

using 69 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 1[67]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=393]
0-330 ==> 10-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=11)
337-375 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
cdr3 = CCSKAGRSYVF at 314, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 60
start codons at 129, 198, 339
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.251 = TCAATCTCAAGCCATT-1

using 2637 reads

====================================================================================

graph has 2406 edges initially, 12 edges after simplification

total ucounts = 634
nonsolo ucounts = 295[2^125, 3^69, 4^40, 5^23, 6^13, 7^7, 8^5, 9^3, 10^4, 11^3, 12, 314, 972]
surviving nonsolo ucounts = 2[314, 972]
ids = [240, 389]

====================================================================================

UMI info for barcode TCAATCTCAAGCCATT-1 contig 1 = GAGTCAGTCC...
umi CGCCCGAGGT = 294 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=509]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=17)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-509 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CKQYDNVSPEYTF at 352, score = 10 + 8
umis assigned: [240]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 25, 31, 87, 100, 239, 362, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.254 = TCAATCTCAAGGACAC-1

using 141 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 131]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 94.257 = TCAATCTCAATAAGCA-1

using 537 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[48, 162, 323]
surviving nonsolo ucounts = 3[48, 162, 323]
ids = [6, 1, 0]

====================================================================================

UMI info for barcode TCAATCTCAATAAGCA-1 contig 1 = GAGAAGAGCT...
umi CATATTCAGG = 323 reads: +388 validated

UMI info for barcode TCAATCTCAATAAGCA-1 contig 2 = GAGTGCTTTC...
umi CATTAAATGT = 152 reads: +436 validated
umi TGGCATCCTC = 46 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGSSPMYTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 35, 84, 243, 342, 383, 465
confident = true

TIG 2[bases=485]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-485 ==> 0-31 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 35 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 196
start codons at 18, 39, 83
confident = true
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk094-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk094-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

8.530 seconds used processing barcodes, peak mem = 0.23
