[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.33 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GE...
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.0 = GGCGACTAGACAATAC-1

using 1898 reads

====================================================================================

graph has 1660 edges initially, 32 edges after simplification

total ucounts = 635
nonsolo ucounts = 273[2^126, 3^67, 4^29, 5^28, 6^7, 7^2, 8^4, 9, 11^5, 15, 130, 249, 281]
surviving nonsolo ucounts = 3[130, 249, 281]
ids = [158, 255, 66]

====================================================================================

UMI info for barcode GGCGACTAGACAATAC-1 contig 1 = GGCAGAACTC...
umi CCGTGTCGGC = 226 reads: +382 validated

UMI info for barcode GGCGACTAGACAATAC-1 contig 2 = GGAGTCAGAC...
umi ACCTTTGTGG = 280 reads: +382 validated
umi ATGCCCCATG = 128 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=573]
0-23 ==> 20-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
23-360 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
367-405 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
405-573 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSADSSGTGVVF at 338, score = 8 + 8
umis assigned: [255]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 23, 84, 153, 171
confident = true

TIG 2[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 59 reads
cdr3 = CQQYYSYPPTF at 353, score = 9 + 8
umis assigned: [66, 158]
of which 2 are surviving nonsolos
reads assigned: 403
start codons at 32, 88, 101, 237, 456
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.8 = GGCGACTAGAGCAATT-1

using 4741 reads

====================================================================================

graph has 2792 edges initially, 24 edges after simplification

total ucounts = 456
nonsolo ucounts = 211[2^78, 3^51, 4^29, 5^12, 6^7, 7^2, 8^4, 9, 10^4, 11, 15, 20, 23, 36, 37, 43, 44, 53, 57, 62, 66, 119, 123, 159, 266, 335, 339, 342, 345...
surviving nonsolo ucounts = 16[36, 37, 44, 53, 57, 62, 119, 159, 266, 335, 339, 342, 345, 348, 417, 614]
ids = [252, 437, 395, 139, 415, 413, 346, 257, 155, 280, ...]

====================================================================================

UMI info for barcode GGCGACTAGAGCAATT-1 contig 1 = CCACATCCCT...
umi CCACTGCCGT = 415 reads: +418 validated

UMI info for barcode GGCGACTAGAGCAATT-1 contig 2 = GAGCTACAAC...
umi AATTATGGGG = 348 reads: +400 validated
umi CACCTTTTTC = 338 reads: +400 validated
umi CAGAGCCTTC = 534 reads: -363 +1 -1XX +1 -2XX +1 -4XX +3 -6XX +1 -4XX +1 -4XX +1 -5XX +2 invalidated
umi CCCCCCTCTA = 266 reads: +400 validated
umi CCCTTTCTCC = 350 reads: +400 validated
umi GAGCATGGGT = 161 reads: +400 validated
umi GGAAGCCTGT = 333 reads: +400 validated
umi TCACTTTCAC = 109 reads: +400 validated
umi TGCGACGGAC = 44 reads: +400 validated
umi TTCTGTCATC = 341 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=531]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=17)
440-460 ==> 32-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
... 43157 lines elided ...
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 34, 103, 176, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2027 = GGGTCTGGTCGAGATG-1

using 160 reads

====================================================================================

graph has 180 edges initially, 8 edges after simplification

total ucounts = 61
nonsolo ucounts = 32[2^8, 3^8, 4^7, 5^3, 6^2, 7, 8, 9, 12]
surviving nonsolo ucounts = 16[2^4, 3^4, 4^4, 5, 6^2, 7]
ids = [9, 27, 28, 41, 29, 42, 50, 59, 10, 11, ...]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2031 = GGGTCTGGTCGTCTTC-1

using 59 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[59]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2032 = GGGTCTGGTCTAAAGA-1

using 1127 reads

====================================================================================

graph has 412 edges initially, 8 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2, 41, 64, 154, 175, 194, 234, 258]
surviving nonsolo ucounts = 6[64, 154, 175, 194, 234, 258]
ids = [5, 11, 2, 8, 3, 7]

====================================================================================

UMI info for barcode GGGTCTGGTCTAAAGA-1 contig 1 = ATCACACAAC...
umi TAGGATTGTG = 164 reads: +409 validated
umi TATCTACAGT = 228 reads: +409 validated
umi TCCCAGTTCA = 61 reads: +409 validated
umi TGTTCTCTAT = 147 reads: +409 validated

UMI info for barcode GGGTCTGGTCTAAAGA-1 contig 2 = GATCAGGACT...
umi TCGGACGTAT = 259 reads: +403 validated
umi TCGTCACGTA = 189 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=596]
0-57 ==> 3-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
57-410 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-596 ==> 0-130 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 66 reads
cdr3 = CVTDLATTVDYW at 399, score = 9 + 7
umis assigned: [2, 3, 5, 11]
of which 4 are surviving nonsolos
reads assigned: 595
start codons at 57, 213, 255, 277, 292, 321, 354
confident = true

TIG 2[bases=569]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 47 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [7, 8]
of which 2 are surviving nonsolos
reads assigned: 443
start codons at 30, 63, 99, 187, 349, 369, 475
confident = true
now this is a cell
paired!

AGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGTAACAGATCTGGCTACTACCGTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACA...

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2037 = GGGTCTGGTCTCTTAT-1

using 217 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================

UMI info for barcode GGGTCTGGTCTCTTAT-1 contig 1 = GATCAGGACT...
umi ATGGGGGATC = 196 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=519]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-519 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2084 = GGGTCTGGTTGGAGGT-1

using 434 reads

====================================================================================

graph has 158 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[49, 77, 301]
surviving nonsolo ucounts = 3[49, 77, 301]
ids = [2, 3, 0]

====================================================================================

UMI info for barcode GGGTCTGGTTGGAGGT-1 contig 1 = GGAGTCAGAC...
umi ATATCTTTCA = 274 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=496]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-496 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2089 = GGGTCTGGTTTAAGCC-1

using 271 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================

UMI info for barcode GGGTCTGGTTTAAGCC-1 contig 1 = GCTGGGGTCT...
umi AACCTCAGTC = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-556 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2096 = GGGTCTGTCAAAGACA-1

using 64 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 63
nonsolo ucounts = 1[2]
surviving nonsolo ucounts = 1[2]
ids = [47]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2098 = GGGTCTGTCAACTCTT-1

using 170 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 3, 157]
surviving nonsolo ucounts = 1[157]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2105 = GGGTCTGTCACTCCTG-1

using 23 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2111 = GGGTCTGTCAGCTTAG-1

using 9669 reads

====================================================================================

graph has 8817 edges initially, 191 edges after simplification

total ucounts = 2075
nonsolo ucounts = 1354[2^304, 3^193, 4^159, 5^134, 6^96, 7^91, 8^77, 9^59, 10^54, 11^53, 12^23, 13^35, 14^22, 15^12, 16^10, 17^8, 18^8, 19^3, 20^2, 22, 24, ...
surviving nonsolo ucounts = 4[107, 142, 222, 275]
ids = [1010, 965, 936, 1044]

====================================================================================

UMI info for barcode GGGTCTGTCAGCTTAG-1 contig 1 = GAGAGACTGA...
umi CTCAGTATTG = 214 reads: +406 validated
umi CTTTCGGGTT = 109 reads: +406 validated
umi GAATCTCTTC = 271 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=654]
0-37 ==> 0-37 on |391|IGLV9-49|5'UTR| [len=37] (mis=0)
37-406 ==> 0-369 on |392|IGLV9-49|L-REGION+V-REGION| [len=369] (mis=7)
405-443 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
443-654 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 76 reads
cdr3 = CGADHGSGNNFVWVF at 370, score = 5 + 8
umis assigned: [936, 1010, 1044]
of which 3 are surviving nonsolos
reads assigned: 585
start codons at 37, 188, 235, 353, 383
confident = true

REJECT CONTIGS

TIG 1[bases=561]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=21)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [965]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 30, 63, 99, 250, 369, 467
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2114 = GGGTCTGTCAGTGCAT-1

using 221 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 2[2, 207]
surviving nonsolo ucounts = 1[207]
ids = [7]

====================================================================================

UMI info for barcode GGGTCTGTCAGTGCAT-1 contig 1 = GCACAAGAGG...
umi GTCGTGGCCG = 1 reads: -394 non-validated
umi GTCGTGTCCT = 202 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-33 ==> 18-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
33-389 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
427-566 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 357, score = 7 + 8
umis assigned: [6, 7]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 33, 187, 190, 241, 340, 367, 391, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2115 = GGGTCTGTCAGTTGAC-1

using 734 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[5, 285, 435]
surviving nonsolo ucounts = 2[285, 435]
ids = [10, 1]

====================================================================================

UMI info for barcode GGGTCTGTCAGTTGAC-1 contig 1 = GCTGTGCTGT...
umi TCCTTACAGG = 259 reads: +373 validated

UMI info for barcode GGGTCTGTCAGTTGAC-1 contig 2 = GGAACTGCTC...
umi AAACTATAGC = 431 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=7)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-553 ==> 0-137 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQSPDSQGVF at 358, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 43, 104, 173, 191
confident = false

TIG 2[bases=549]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPLTF at 352, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 426
start codons at 31, 173, 178, 236, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2123 = GGGTCTGTCCACTCCA-1

using 245 reads

====================================================================================

graph has 85 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 237]
surviving nonsolo ucounts = 1[237]
ids = [6]

====================================================================================

UMI info for barcode GGGTCTGTCCACTCCA-1 contig 1 = GGAGTCAGTC...
umi TTCGGTGCCG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=6)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
414-487 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQLHDYPITF at 353, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 26, 32, 88, 237, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2127 = GGGTCTGTCCCTCTTT-1

using 74 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 5, 60]
surviving nonsolo ucounts = 1[60]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 77.2135 = GGGTCTGTCCTTCAAT-1

using 240 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3, 5, 18, 205]
surviving nonsolo ucounts = 1[205]
ids = [11]

====================================================================================

UMI info for barcode GGGTCTGTCCTTCAAT-1 contig 1 = GGGAGCTTCA...
umi TTGAGGCTAC = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=633]
34-386 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSWDSSLSAWVF at 355, score = 7 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 34, 173, 245, 363
confident = false
NOT paired!
sorting bam, mem = 0.20
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ...

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

182.197 seconds used processing barcodes, peak mem = 0.33
