[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.29 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk076-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk076-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk076.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.0 = GGCAATTAGGCCGAAT-1

using 10966 reads

====================================================================================

graph has 5215 edges initially, 70 edges after simplification

total ucounts = 740
nonsolo ucounts = 362[2^120, 3^78, 4^52, 5^27, 6^20, 7^6, 8^10, 9^6, 10^3, 11^5, 12, 13, 14, 15^2, 20, 44, 56, 63, 79, 84, 89, 93, 98, 99, 114, 139, 205, 213, 227, 230, 259, 260, 262^2, 278, 288, 297, 407, 422, 617, 673, 726, 1348, 1369]
surviving nonsolo ucounts = 26[44, 56, 84, 93, 98, 99, 114, 139, 205, 213, 227, 230, 259, 260, 262^2, 278, 288, 297, 407, 422, 617, 673, 726, 1348, 1369]
ids = [281, 515, 650, 649, 468, 5, 338, 603, 313, 402, ...]

====================================================================================

UMI info for barcode GGCAATTAGGCCGAAT-1 contig 1 = GCTGTGGGTC...
umi AAAGGACCTC = 100 reads: +379 validated
umi AGGATACTTA = 229 reads: +379 validated
umi CCGAGCGCGA = 258 reads: +379 validated
umi CCTGAAGGTT = 287 reads: +379 validated
umi CCTTGCTCCG = 50 reads: +20 -1X +1 -1XX +3 -1XX +3 -1XX +1 -5XX +2 -4XX +258 -1 +3 -19 +55 invalidated
umi CGCGTTTTAC = 205 reads: +379 validated
umi CGTACTACGC = 294 reads: +379 validated
umi CGTGTCACTG = 114 reads: +379 validated
umi GATCGACTAT = 228 reads: +379 validated
umi GGCGCAGGGG = 98 reads: +379 validated
umi TAAATCACAC = 55 reads: +379 validated
umi TAAATGTAGT = 278 reads: +379 validated
umi TCCTTTGTCG = 142 reads: +379 validated
umi TGGCGCAGGG = 93 reads: +379 validated
umi TGGCTACGCG = 85 reads: +284 -1 +94 non-validated

UMI info for barcode GGCAATTAGGCCGAAT-1 contig 2 = GAGAGTCCTG...
umi ACCGACACCC = 245 reads: +436 validated
umi CCTACCCTGC = 43 reads: -22 +338 -27 +47 -1 +1 non-validated
umi GTCCACACTA = 266 reads: +436 validated
umi TCTGGCTCTA = 227 reads: +436 validated
umi TTGATGTCGA = 410 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=628]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=3)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 387 reads
cdr3 = CQSADSSGFVVF at 353, score = 8 + 8
umis assigned: [5, 130, 269, 289, 292, 313, 329, 338, 410, 468] and 5 others
of which 14 are surviving nonsolos
reads assigned: 2461
start codons at 38, 99, 168, 172, 186
confident = true

TIG 2[bases=535]
0-28 ==> 117-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
28-378 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=14)
383-403 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=3)
403-464 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=4)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 76 reads
cdr3 = CARTKRGYSYGWDYYHYHMDVW at 367, score = 9 + 7
umis assigned: [71, 281, 485, 622, 705]
of which 5 are surviving nonsolos
reads assigned: 1167
start codons at 28, 72, 235, 395, 399, 421
confident = true

REJECT CONTIGS

TIG 1[bases=363]
2-46 ==> 5956-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=4)
28-91 ==> 5677-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
40-228 ==> 0-188 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=2)
227-363 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [77, 106, 131, 188, 306, 662]
of which 6 are surviving nonsolos
reads assigned: 5082
start codons at 40, 46, 102, 269
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCGAGGACCAAACGTGGATACAGCTATGGATGGGACTACTACCATTACCACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> AGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTTTTGTGGTATTCGGCGGAGGGACCAAGGTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.8 = GGCAATTAGTGCCAGA-1

using 450 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[450]
surviving nonsolo ucounts = 1[450]
ids = [0]

====================================================================================

UMI info for barcode GGCAATTAGTGCCAGA-1 contig 1 = GGAGGAACTG...
umi GTAGGTGCGA = 449 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNNWPPLTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 443
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.10 = GGCAATTAGTGGTAAT-1

using 352 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 5, 8, 330]
surviving nonsolo ucounts = 1[330]
ids = [2]

====================================================================================

UMI info for barcode GGCAATTAGTGGTAAT-1 contig 1 = ACTTTCTGAG...
umi CATGGTATGG = 327 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=550]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-550 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 35, 79, 159, 229, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.18 = GGCAATTCAACTGGCC-1

using 53 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 4, 6, 9, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.20 = GGCAATTCAAGGTTCT-1

using 424 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 3, 4, 406]
surviving nonsolo ucounts = 1[406]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=507]
1-347 ==> 7-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=4)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
436-507 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARLRMTTVTIPAGGRDNWFDPW at 336, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 394
start codons at 145, 192, 197, 214, 229, 258, 291, 351
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.24 = GGCAATTCAATGAATG-1

using 32 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 9, 16]
surviving nonsolo ucounts = 1[16]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.30 = GGCAATTCACCTCGTT-1

using 806 reads

====================================================================================

graph has 250 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 34, 95, 246, 423]
surviving nonsolo ucounts = 4[34, 95, 246, 423]
ids = [2, 1, 8, 5]

====================================================================================

UMI info for barcode GGCAATTCACCTCGTT-1 contig 1 = CAACAACCAC...
umi ACTCGTGAGT = 90 reads: +417 -1X +12 invalidated
umi CAGTTTAGAC = 1 reads: -375 +2 -1 +3 -1 +6 -1 +1 -1 +1 -2 +3 -3 +6 -1 +12 -1 +10 non-validated

UMI info for barcode GGCAATTCACCTCGTT-1 contig 2 = GCTCTGCTTC...
umi TACTGGACAC = 243 reads: +394 validated

UMI info for barcode GGCAATTCACCTCGTT-1 contig 3 = AGACCCTGTC...
umi CATTCTCACT = 431 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=482]
0-52 ==> 252-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
52-405 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
434-482 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
junction support: 0 umis using 0 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 394, score = 8 + 7
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 52, 208, 250, 316, 349, 439
confident = false

TIG 2[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGSYVF at 375, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 3[bases=544]
0-26 ==> 27-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
26-371 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
380-408 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYYSYPRTF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 422
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.36 = GGCAATTCACTAGTAC-1

using 222 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 4, 6, 202]
surviving nonsolo ucounts = 1[202]
ids = [1]

====================================================================================

UMI info for barcode GGCAATTCACTAGTAC-1 contig 1 = TCAGTTAGGA...
umi ATAATCTGGC = 181 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=491]
0-23 ==> 29-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
23-371 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
408-491 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQLYGTSLFTF at 347, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 23, 231, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.42 = GGCAATTCAGCCAATT-1

using 445 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 432]
surviving nonsolo ucounts = 1[432]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=544]
0-68 ==> 5924-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=4)
41-293 ==> 0-252 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=27)
295-333 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
333-544 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 425
start codons at 41, 198, 242, 294
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.52 = GGCAATTCATGATCCA-1

using 362 reads

====================================================================================

graph has 110 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 351]
surviving nonsolo ucounts = 1[351]
ids = [4]

====================================================================================

UMI info for barcode GGCAATTCATGATCCA-1 contig 1 = GAGCTGCTCA...
umi CACTATCTCC = 326 reads: +388 validated
umi GCAACCGACA = 3 reads: -23 +29 -1X +10 -1X +15 -11 +3 -1X +1 -2X +20 -1X +16 -7X +2 -16X +4 -2X +8 -3X +3 -1 +1 -1X +2 -2 +7 -1 +1 -1 +8 -1X +4 -1X +1 -1 +3 -173 invalidated

GOOD CONTIGS

TIG 1[bases=503]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-503 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSPLVTF at 354, score = 9 + 8
umis assigned: [4, 6]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 30, 238, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.58 = GGCAATTCATTGGGCC-1

using 269 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 263]
surviving nonsolo ucounts = 1[263]
ids = [3]

====================================================================================

UMI info for barcode GGCAATTCATTGGGCC-1 contig 1 = GGGGGAGTCA...
umi TTTCCCATAT = 265 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
35-163 ==> 0-128 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=10)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CHQYESVPYTF at 356, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 35, 91, 104, 243, 339, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.72 = GGCAATTGTCTAGCCG-1

using 712 reads

====================================================================================

graph has 276 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 706]
surviving nonsolo ucounts = 1[706]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=444]
10-210 ==> 153-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=19)
233-284 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=7)
284-444 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDLFEHASTSRWFDSW at 199, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 696
start codons at 8, 77, 121, 154, 221, 237, 338
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.80 = GGCAATTGTGGTCCGT-1

using 130 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[12, 118]
surviving nonsolo ucounts = 1[118]
ids = [0]

====================================================================================

UMI info for barcode GGCAATTGTGGTCCGT-1 contig 1 = AACCACATCT...
umi AACTTACAGC = 117 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=485]
0-48 ==> 16-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
48-401 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=26)
436-478 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CARGIHSYGAYHYYNLDVW at 390, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 48, 246, 251, 283, 345, 412
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.84 = GGCAATTGTGTTTGTG-1

using 375 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[373]
surviving nonsolo ucounts = 1[373]
ids = [1]

====================================================================================

UMI info for barcode GGCAATTGTGTTTGTG-1 contig 1 = GGGGAGGAAT...
umi CTATTCTAGT = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-511 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.86 = GGCAATTGTTACTGAC-1

using 1516 reads

====================================================================================

graph has 1978 edges initially, 20 edges after simplification

total ucounts = 564
nonsolo ucounts = 235[2^90, 3^51, 4^32, 5^21, 6^15, 7^7, 8^9, 9^2, 10, 11, 12^2, 13, 15, 19, 300]
surviving nonsolo ucounts = 1[300]
ids = [39]

====================================================================================

UMI info for barcode GGCAATTGTTACTGAC-1 contig 1 = GGAGTCAGAC...
umi AATGAACGCA = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [39]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.93 = GGCAATTGTTCGAATC-1

using 584 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[579]
surviving nonsolo ucounts = 1[579]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=388]
21-215 ==> 157-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=17)
214-252 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
252-388 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQHDSLPFTF at 191, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 573
start codons at 24, 78, 177, 201, 294
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.104 = GGCAATTTCAAGATCC-1

using 43409 reads

====================================================================================

graph has 15471 edges initially, 174 edges after simplification

total ucounts = 1639
nonsolo ucounts = 894[2^287, 3^184, 4^114, 5^62, 6^43, 7^36, 8^11, 9^5, 10^6, 11^3, 12^2, 13^3, 14^3, 19, 20^2, 23, 25^3, 26^2, 29, 36, 37, 50, 67, 69, 85, 86, 87, 93, 103, 104, 107, 108, 116, 126, 128, 144, 146, 161, 168, 172, 178, 184, 196, 208, 214, 221^2, 224, 226, 238, 243, 246, 252, 253, 255, 256, 258, 259, 260, 262^2, 268, 271^2, 273, 283, 284, 286^2, 288, 289, 290, 293, 295, 296^2, 297, 304^2, 306, 307^2, 308, 309, 313, 314^2, 315, 316, 319, 321, 322, 325, 328, 330, 332, 334^2, 335^4, 337, 339, 340^2, 341, 345, 346, 349^2, 351, 357, 358, 365, 371, 380, 383, 384, 385, 387, 391, 397, 401, 403, 412, 421, 430, 448, 473, 535, 562, 589, 602, 603, 633, 634, 680, 707, 714, 721, 737, 743, 973]
surviving nonsolo ucounts = 116[69, 85, 103, 107, 108, 116, 126, 144, 146, 161, 168, 172, 178, 184, 196, 208, 214, 221^2, 224, 226, 238, 243, 246, 252, 253, 255, 256, 258, 259, 260, 262^2, 268, 271^2, 273, 283, 284, 286^2, 288, 289, 290, 293, 295, 296^2, 297, 304^2, 306, 307^2, 308, 309, 313, 314^2, 315, 316, 319, 321, 322, 325, 328, 330, 332, 334^2, 335^4, 337, 339, 340^2, 341, 345, 346, 349^2, 351, 357, 358, 365, 371, 380, 383, 384, 385, 387, 391, 397, 401, 403, 412, 421, 430, 448, 473, 535, 562, 589, 602, 603, 633, 634, 680, 707, 714, 721, 737, 743, 973]
ids = [1408, 1320, 192, 1295, 518, 1540, 1618, 914, 978, 243, ...]

====================================================================================

UMI info for barcode GGCAATTTCAAGATCC-1 contig 1 = ACTTTCTGAG...
umi AAAAGACTCC = 334 reads: +433 validated
umi ACAGCCTGTA = 347 reads: +433 validated
umi ATTTAGCACA = 280 reads: +433 validated
umi CAACCTGGCC = 426 reads: +433 validated
umi CCCACGACGC = 221 reads: +433 validated
umi TCCTGTCTGA = 86 reads: +405 -28 non-validated
umi TGATTGCGGC = 70 reads: +321 -1 +2 -1 +16 -23 +69 non-validated
umi TTGTACTCCC = 144 reads: -408 +7 -2X +11 -1X +2 -1X +1 invalidated
umi TTGTTCACGG = 413 reads: +433 validated
umi TTTCCACTTC = 537 reads: -163X +1 -1XX +268 invalidated
umi TTTCCTTTCC = 131 reads: +433 validated

UMI info for barcode GGCAATTTCAAGATCC-1 contig 2 = TACAACAGGC...
umi AAAACCTCAT = 303 reads: +400 validated
umi AACTAACCTA = 220 reads: +400 validated
umi AACTACCCTA = 297 reads: +400 validated
umi AAGTATCAGT = 451 reads: +400 validated
umi ACAAATTGCA = 342 reads: +400 validated
umi ACACGTTCGG = 312 reads: +400 validated
umi ACACTTCCTT = 316 reads: +400 validated
umi ACCGGCCGGT = 386 reads: +400 validated
umi ACTACTCGCT = 338 reads: +400 validated
umi ACTTTCCTAC = 316 reads: +400 validated
umi AGAGTCTATC = 242 reads: +400 validated
umi AGATCCCCGC = 392 reads: +400 validated
umi AGATCGTTGA = 361 reads: +400 validated
umi ATACCTGACC = 475 reads: +400 validated
umi ATACCTGCCA = 356 reads: +400 validated
umi ATCCTTAGGG = 398 reads: +400 validated
umi ATGCGTGTAC = 273 reads: +400 validated
umi ATTTAATCCT = 386 reads: +400 validated
umi CAACGCCTCC = 319 reads: +400 validated
umi CAGGCCCGGC = 353 reads: +400 validated
umi CATTTACCCT = 332 reads: +400 validated
umi CCACATGTTA = 331 reads: +400 validated
umi CCAGAATGCG = 257 reads: +400 validated
umi CCCGATCACC = 328 reads: +400 validated
umi CCGAGGTGAA = 258 reads: +400 validated
umi CCTCCATGTA = 333 reads: +400 validated
umi GATTACTCTC = 168 reads: +400 validated
umi GCACCAATCG = 345 reads: +400 validated
umi GCACTGCCGA = 401 reads: +400 validated
umi GCCGCGCGTG = 311 reads: +400 validated
umi GCGATCCTCA = 378 reads: +400 validated
umi GCTATAATAC = 288 reads: +400 validated
umi GCTGTAAAGC = 146 reads: +400 validated
umi GGATGCACTC = 387 reads: +191 -1XX +208 invalidated
umi GGGTTGTCTA = 190 reads: -365 +3 -1X +6 -3X +8 -1XX +5 -1XX +3 -2XX +2 invalidated
umi GTAGCACCTT = 325 reads: +400 validated
umi GTCATGATGC = 227 reads: +400 validated
umi GTCATTGGCG = 284 reads: +400 validated
umi GTCTGGGCTG = 308 reads: +400 validated
umi GTGTTGCTCC = 316 reads: +400 validated
umi GTTCCCTGAG = 265 reads: +400 validated
umi GTTCTGTTCA = 544 reads: -337X +1 -11XX +2 -11XX +6 -1XX +27 -1XX +3 invalidated
umi TAAATCCGAC = 276 reads: +400 validated
umi TAAATCGTCT = 261 reads: +400 validated
umi TAATGACCGC = 294 reads: +400 validated
umi TACCTATCTA = 334 reads: +400 validated
umi TAGAATGCAA = 339 reads: +400 validated
umi TAGTTCTCAG = 253 reads: +400 validated
umi TATTCTTTAC = 341 reads: +400 validated
umi TCAATCCCGT = 312 reads: +400 validated
umi TCATCCGTGC = 333 reads: +400 validated
umi TCCAGTCTGT = 359 reads: +400 validated
umi TCCCTGGGCG = 204 reads: +400 validated
umi TCCTGCATGC = 305 reads: +400 validated
umi TCGGGCTGCA = 255 reads: +400 validated
umi TCTACAGTAT = 326 reads: +400 validated
umi TCTTATAACA = 286 reads: +400 validated
umi TGCACATCCG = 297 reads: +400 validated
umi TGGATGAGTA = 261 reads: +400 validated
umi TTAAACCCCT = 375 reads: +242 -2XX +1 -1XX +154 invalidated
umi TTACACTCAA = 261 reads: +400 validated
umi TTAGGACCCC = 292 reads: +400 validated
umi TTTAGTACTC = 327 reads: +400 validated
umi TTTTATCTGT = 339 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=539]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=24)
419-468 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=12)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 232 reads
cdr3 = CARDIPGPQASCGADCYTTW at 377, score = 9 + 9
umis assigned: [5, 163, 459, 473, 559, 1320, 1408, 1594, 1600, 1616] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2912
start codons at 14, 35, 79
confident = true

TIG 2[bases=562]
0-26 ==> 149-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
26-389 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 62 umis using 2744 reads
cdr3 = CQQYYSTPLTF at 365, score = 9 + 9
umis assigned: [4, 56, 59, 87, 146, 157, 160, 204, 242, 262] and 54 others
of which 64 are surviving nonsolos
reads assigned: 19817
start codons at 26, 95, 348, 468
confident = true

REJECT CONTIGS

TIG 1[bases=561]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=18)
395-425 ==> 0-30 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [17, 25, 107, 120, 150, 161, 192, 249, 272, 318] and 17 others
of which 27 are surviving nonsolos
reads assigned: 11276
start codons at 30, 99, 260, 352, 467
confident = false
did not find CDR3
now this is a cell
paired!

CTTTATTATTGTGCGAGAGACATACCGGGGCCTCAAGCGAGTTGCGGTGCTGACTGCTACACAACCTGGGGCCGGGGAACCCGAGTCACCGTCTCATCCG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAACAGTATTATAGTACTCCGCTCACCTTCGGCGGAGGGACCAAGGTGGAGATCCAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.105 = GGCAATTTCAAGCCTA-1

using 14458 reads

====================================================================================

graph has 10020 edges initially, 128 edges after simplification

total ucounts = 2096
nonsolo ucounts = 972[2^367, 3^213, 4^123, 5^70, 6^64, 7^33, 8^18, 9^15, 10^12, 11^9, 12^7, 13^2, 15, 16, 17, 19^2, 29, 102, 117, 159, 168, 192, 193, 226, 229, 236, 248^2, 249, 252, 253, 256^2, 259, 260, 264, 273, 282, 296, 332, 336, 338, 343, 344, 353, 361, 414, 418, 639, 885]
surviving nonsolo ucounts = 31[117, 159, 168, 192, 193, 226, 229, 236, 248^2, 249, 252, 253, 256^2, 259, 260, 264, 273, 282, 296, 332, 336, 338, 343, 344, 353, 361, 414, 418, 639]
ids = [1709, 586, 1904, 1183, 1449, 1142, 1635, 1124, 1414, 1984, ...]

====================================================================================

UMI info for barcode GGCAATTTCAAGCCTA-1 contig 1 = AAATTCAGGT...
umi AGCCGTTACG = 242 reads: +445 validated
umi ATCAGAGACA = 298 reads: +445 validated
umi ATCTACTCAC = 270 reads: +445 validated
umi CCATTATTCC = 159 reads: -153 +292 non-validated
umi CTCCCTTGAC = 297 reads: +26 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +399 invalidated
umi CTGTACTGCC = 204 reads: +445 validated
umi GTATATACCC = 349 reads: +445 validated
umi GTCGTCCTAG = 340 reads: +445 validated
umi TCAAACTCCA = 421 reads: +445 validated
umi TTAATACCTG = 244 reads: -332 +113 non-validated

UMI info for barcode GGCAATTTCAAGCCTA-1 contig 2 = GCTCTGCTTC...
umi AAATGGCCGG = 256 reads: +403 validated
umi CGCGCCACAG = 256 reads: +403 validated
umi GCCCACGCGC = 261 reads: +403 validated
umi TGTTTAGCAC = 173 reads: +325 -1XX +77 invalidated
umi TTTCAGCCCA = 257 reads: +403 validated

UMI info for barcode GGCAATTTCAAGCCTA-1 contig 3 = GATCAGGACT...
umi AGACCCGCCA = 348 reads: +397 validated
umi CACCGCATGA = 162 reads: +397 validated
umi CCCACTTCGC = 364 reads: +397 validated
umi CGAAAGTATC = 349 reads: +397 validated
umi CTTACTCCCA = 223 reads: +397 validated
umi CTTTGCAATT = 194 reads: +397 validated
umi GAAAAGCGAC = 340 reads: +397 validated
umi GTCGACCTGA = 633 reads: +397 validated
umi TCCGGTGTGA = 120 reads: +397 validated
umi TTCGCTCACG = 247 reads: +397 validated

UMI info for barcode GGCAATTTCAAGCCTA-1 contig 4 = TGAGCGCAGA...
umi AGGCACGTTA = 246 reads: +397 validated
umi ATGCAGCTAG = 254 reads: +397 validated
umi CATATTCGGT = 257 reads: +397 validated
umi GGGTATATCT = 249 reads: +397 validated
umi GTACCATCTC = 194 reads: +397 validated
umi TATTGCTTTT = 225 reads: +397 validated
umi TCCAAGCCTC = 911 reads: -363X +2 -1X +5 -4XX +9 -1XX +1 -1XX +10 invalidated

GOOD CONTIGS

TIG 1[bases=580]
0-64 ==> 37-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
64-420 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
446-509 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
509-580 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 263 reads
cdr3 = CARDQGGVAAAATPHYYYYMDVW at 409, score = 9 + 7
umis assigned: [328, 420, 451, 742, 1066, 1124, 1461, 1491, 1636, 1913]
of which 10 are surviving nonsolos
reads assigned: 2781
start codons at 20, 64, 108, 466
confident = false

TIG 2[bases=665]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-269 ==> 0-218 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
281-419 ==> 218-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=14)
416-454 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
454-665 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 170 reads
cdr3 = CQSYDASLRAFVF at 387, score = 6 + 7
umis assigned: [36, 935, 1319, 1904, 2042]
of which 5 are surviving nonsolos
reads assigned: 1174
start codons at 51, 208, 259, 370, 397, 586
confident = false
see insertion of AAATCGGCCCTC at pos 218 on |321|IGLV1-40|L-REGION+V-REGION|

TIG 3[bases=563]
0-30 ==> 5-35 on |276|IGKV2D-30|5'UTR| [len=35] (mis=0)
30-390 ==> 0-360 on |277|IGKV2D-30|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 430 reads
cdr3 = CMQGTHWPPTF at 366, score = 9 + 8
umis assigned: [297, 586, 750, 895, 1142, 1183, 1191, 1485, 1709, 1984]
of which 10 are surviving nonsolos
reads assigned: 2905
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false

TIG 4[bases=644]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
433-644 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 218 reads
cdr3 = CGTWDSSLSAGHNYVF at 357, score = 7 + 8
umis assigned: [343, 468, 656, 1414, 1449, 1635, 1686]
of which 6 are surviving nonsolos
reads assigned: 2260
start codons at 36, 190, 241, 365, 397, 565
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.107 = GGCAATTTCACAGGCC-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.118 = GGCAATTTCATGCATG-1

using 851 reads

====================================================================================

graph has 286 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^2, 258, 581]
surviving nonsolo ucounts = 2[258, 581]
ids = [6, 9]

====================================================================================

UMI info for barcode GGCAATTTCATGCATG-1 contig 1 = GCTCTGCTTC...
umi GCTAAGTCGG = 244 reads: +391 validated
umi TCATTCAGTG = 538 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-584 ==> 0-142 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 127 reads
cdr3 = CQSYDSSLSGSVF at 375, score = 8 + 8
umis assigned: [6, 9]
of which 2 are surviving nonsolos
reads assigned: 773
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.121 = GGCAATTTCATTGCCC-1

using 387 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 1[382]
ids = [4]

====================================================================================

UMI info for barcode GGCAATTTCATTGCCC-1 contig 1 = GTGGGCTCAG...
umi GTCCTTCTTT = 373 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=570]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-570 ==> 0-153 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CYSTDSSGNHRVF at 350, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.133 = GGCAATTTCGAGCCCA-1

using 56 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^3, 3, 8, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.135 = GGCAATTTCGCACTCT-1

using 341 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[333]
surviving nonsolo ucounts = 1[333]
ids = [8]

====================================================================================

UMI info for barcode GGCAATTTCGCACTCT-1 contig 1 = TTGGGGTGGG...
umi TGGCTTCCCT = 327 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
45-383 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
436-549 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTNSTTPGVF at 369, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 45, 181, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.140 = GGCAATTTCGCTAGCG-1

using 245 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=539]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=4)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-539 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CVLYM at 369, score = 7 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 30, 45, 54, 57, 82, 349, 352, 381
confident = false
not full
frameshifted full length transcript of length 539
VJ delta = 0
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.149 = GGCAATTTCTCCCTGA-1

using 273 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [1]

====================================================================================

UMI info for barcode GGCAATTTCTCCCTGA-1 contig 1 = GAATCAGTCC...
umi CACTATTCAT = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-501 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.158 = GGCAATTTCTTCATGT-1

using 568 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3^2, 216, 336]
surviving nonsolo ucounts = 2[216, 336]
ids = [9, 8]

====================================================================================

UMI info for barcode GGCAATTTCTTCATGT-1 contig 1 = GGGGAGGAAC...
umi CCGGGTGCCT = 306 reads: +382 validated

UMI info for barcode GGCAATTTCTTCATGT-1 contig 2 = GGTGATCAGC...
umi GACATAGCTC = 217 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=493]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=12)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQGSNWLLTF at 357, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 36, 241, 244, 460
confident = false

TIG 2[bases=532]
0-31 ==> 48-79 on |117|IGHV3-21|5'UTR| [len=79] (mis=0)
31-382 ==> 0-351 on |118|IGHV3-21|L-REGION+V-REGION| [len=351] (mis=5)
398-461 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
461-532 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQVRLTGTPRYYYYGMDVW at 373, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 31, 187, 334, 418
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.160 = GGCAATTTCTTGAGAC-1

using 951 reads

====================================================================================

graph has 969 edges initially, 10 edges after simplification

total ucounts = 316
nonsolo ucounts = 119[2^57, 3^22, 4^13, 5^8, 6^4, 7^4, 8, 9^2, 10, 11, 14, 18^2, 19, 139, 175]
surviving nonsolo ucounts = 5[9, 14, 19, 139, 175]
ids = [0, 52, 82, 108, 16]

====================================================================================

UMI info for barcode GGCAATTTCTTGAGAC-1 contig 1 = ACATGGGAAG...
umi AAAAATGAGC = 9 reads: -51 +183 -24 +16 -1 +23 -1 +15 -137 non-validated
umi AAGTTTGTCA = 177 reads: +451 validated
umi AGCCGATGTC = 11 reads: -446 +2 -1X +1 -1X invalidated
umi ATGCCCACGG = 19 reads: +127 -27 +5 -1 +56 -65 +128 -42 non-validated
umi CAGCCAACAG = 138 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=547]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 21 reads
cdr3 = CARGQRRLAAAGKGRYFDYW at 385, score = 9 + 7
umis assigned: [0, 16, 52, 82, 108]
of which 5 are surviving nonsolos
reads assigned: 349
start codons at 2, 25, 46, 90, 176
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.166 = GGCCGATAGAAGGACA-1

using 364 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 360]
surviving nonsolo ucounts = 1[360]
ids = [2]

====================================================================================

UMI info for barcode GGCCGATAGAAGGACA-1 contig 1 = GGAGTCAGAC...
umi GGATCGTTGC = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-504 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNSFPWTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.174 = GGCCGATAGCTAACAA-1

using 1155 reads

====================================================================================

graph has 1762 edges initially, 8 edges after simplification

total ucounts = 608
nonsolo ucounts = 217[2^95, 3^47, 4^28, 5^17, 6^12, 7^7, 8^3, 9^4, 10, 13, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.191 = GGCCGATAGTGGAGAA-1

using 229 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 10, 211]
surviving nonsolo ucounts = 1[211]
ids = [8]

====================================================================================

UMI info for barcode GGCCGATAGTGGAGAA-1 contig 1 = GGAGGAACTG...
umi TGGAAAAGCG = 194 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=501]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-501 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQRSNWPLTF at 355, score = 8 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 34, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.195 = GGCCGATAGTTGCAGG-1

using 297 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 7, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode GGCCGATAGTTGCAGG-1 contig 1 = GAATCAGTCC...
umi CGGTTACACG = 245 reads: +388 validated
umi TTTTCTATTC = 2 reads: -212X +6 -1X +9 -1X +25 -1X +3 -2X +2 -119 +7 invalidated

GOOD CONTIGS

TIG 1[bases=488]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-488 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1, 5]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.201 = GGCCGATCAAGGACTG-1

using 18 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.210 = GGCCGATCACTTAACG-1

using 348 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[342]
surviving nonsolo ucounts = 1[342]
ids = [1]

====================================================================================

UMI info for barcode GGCCGATCACTTAACG-1 contig 1 = GAGAAGAGCT...
umi ACCCGAGGCT = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=16)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYVSSPYTF at 359, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 35, 339, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.214 = GGCCGATCAGCATGAG-1

using 377 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[374]
surviving nonsolo ucounts = 1[374]
ids = [0]

====================================================================================

UMI info for barcode GGCCGATCAGCATGAG-1 contig 1 = AAGAGCTGCT...
umi ACACTTGGGT = 325 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=500]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-380 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
417-500 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQHATSPFTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 32, 240, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.217 = GGCCGATCAGGTTTCA-1

using 953 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 293, 648]
surviving nonsolo ucounts = 2[293, 648]
ids = [2, 7]

====================================================================================

UMI info for barcode GGCCGATCAGGTTTCA-1 contig 1 = TGGGGAGGAA...
umi CCATTTGCAG = 297 reads: +379 validated
umi TGTCGTTTAT = 642 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=552]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-370 ==> 0-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 138 reads
cdr3 = CQERGGWWTF at 358, score = 9 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 926
start codons at 37, 245, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.219 = GGCCGATCAGTAAGAT-1

using 144 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 139]
surviving nonsolo ucounts = 1[139]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.222 = GGCCGATCATCACAAC-1

using 485 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[152, 332]
surviving nonsolo ucounts = 2[152, 332]
ids = [1, 2]

====================================================================================

UMI info for barcode GGCCGATCATCACAAC-1 contig 1 = GAAGAGCTGC...
umi ACATATTCGC = 334 reads: +382 validated

UMI info for barcode GGCCGATCATCACAAC-1 contig 2 = ATCACATAAC...
umi AAAGTACTGC = 152 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-415 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPQF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 33, 241, 367, 457
confident = false

TIG 2[bases=595]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=39)
456-506 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
506-595 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARSRSYGANDAGWVDSHFYGMDVW at 400, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 58, 256, 355, 419, 438, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.231 = GGCCGATGTACATGTC-1

using 143 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3^3, 20, 105]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.232 = GGCCGATGTACCGCTG-1

using 704 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 335, 361]
surviving nonsolo ucounts = 2[335, 361]
ids = [4, 1]

====================================================================================

UMI info for barcode GGCCGATGTACCGCTG-1 contig 1 = GGAGAAGAGC...
umi AATTAGTAGA = 318 reads: +385 validated

UMI info for barcode GGCCGATGTACCGCTG-1 contig 2 = ATCACATAAC...
umi ATCCATGTCT = 339 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=508]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-508 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPITF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 36, 244, 370, 463
confident = false

TIG 2[bases=541]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
419-470 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
470-541 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDGDYGRFDPW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.240 = GGCCGATGTATGAATG-1

using 6107 reads

====================================================================================

graph has 2510 edges initially, 46 edges after simplification

total ucounts = 249
nonsolo ucounts = 107[2^38, 3^18, 4^10, 5, 6^6, 7^3, 8^2, 9, 58, 76, 109, 112, 146, 148, 149, 160, 166, 172, 199, 211, 217, 218, 223, 225, 226, 228^2, 231, 237, 245, 259, 261, 280, 297, 303, 324]
surviving nonsolo ucounts = 28[58, 76, 109, 112, 146, 148, 149, 160, 166, 172, 199, 211, 217, 218, 223, 225, 226, 228^2, 231, 237, 245, 259, 261, 280, 297, 303, 324]
ids = [131, 60, 232, 95, 96, 99, 88, 100, 210, 225, ...]

====================================================================================

UMI info for barcode GGCCGATGTATGAATG-1 contig 1 = TGGGGGGGGT...
umi AACGAGTGTG = 301 reads: -10 +1 -1X +1 -1X +2 -5X +1 -1XX +1 -6XX +1 -6XX +1 -3XX +1 -1XX +345 invalidated
umi CACCTGCCTC = 200 reads: +388 validated
umi CACTTCCTTT = 227 reads: +388 validated
umi CAGCCTCGCC = 277 reads: +17 -2XX +193 -1XX +138 -1XX +2 -3XX +1 -2XX +1 -2XX +1 -2XX +2 -2X +1 -1 +1 -1 +14 invalidated
umi CAGGTACCTT = 77 reads: +283 -1 +104 non-validated
umi CCATCTTAGT = 231 reads: +388 validated
umi CGTCTCCTTT = 148 reads: +388 validated
umi CTAAAAGGGT = 149 reads: +388 validated
umi CTAAACGCCT = 162 reads: +388 validated
umi CTCCCCGTAT = 297 reads: +388 validated
umi CTCGCGTTTT = 224 reads: +388 validated
umi GAGCCTTATG = 244 reads: +388 validated
umi TATGGTCTCT = 223 reads: +388 validated
umi TCACTACAGT = 245 reads: +17 -2XX +193 -1XX +138 -1XX +2 -3XX +1 -2XX +1 -2X +25 invalidated
umi TCCAACCTCT = 244 reads: +388 validated
umi TGCATTAAGG = 169 reads: +388 validated
umi TGTAATCCTC = 223 reads: +388 validated
umi TTAGTTTCTT = 170 reads: +388 validated
umi TTCGCTCATT = 111 reads: +388 validated

UMI info for barcode GGCCGATGTATGAATG-1 contig 2 = ACCCAAAAAC...
umi AATCTTAGGT = 218 reads: +415 validated
umi CGAAATTTCT = 149 reads: +415 validated
umi CGTCGCCTAG = 111 reads: +410 -5 non-validated
umi CTCTTCCTCC = 264 reads: +415 validated
umi GCCAACGGGC = 59 reads: +415 validated
umi TAACACTCCT = 226 reads: +406 -1 +2 -3 +3 non-validated

GOOD CONTIGS

TIG 1[bases=642]
43-395 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
431-642 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 17 umis using 519 reads
cdr3 = CSSYTSSSTRVF at 367, score = 8 + 8
umis assigned: [3, 53, 56, 58, 60, 69, 96, 99, 100, 111] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3819
start codons at 43, 200, 244, 251, 254
confident = true

TIG 2[bases=540]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 66 reads
cdr3 = CARERRSGGINDYW at 396, score = 8 + 7
umis assigned: [6, 88, 95, 114, 131, 168]
of which 6 are surviving nonsolos
reads assigned: 1012
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 427
confident = true

REJECT CONTIGS

TIG 1[bases=563]
0-80 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-239 ==> 0-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
240-391 ==> 209-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [34, 154, 156]
of which 3 are surviving nonsolos
reads assigned: 807
start codons at 30, 63, 99, 150, 187, 251, 350, 370, 377, 469
confident = false
did not find CDR3
now this is a cell
paired!

AGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGAAAGGAGGTCAGGGGGGATAAATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.241 = GGCCGATGTCAAACTC-1

using 300 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode GGCCGATGTCAAACTC-1 contig 1 = GAGGAACTGC...
umi CACACTACGC = 295 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=1)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNYWPYSF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 33, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.242 = GGCCGATGTCAAAGAT-1

using 60 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[60]
surviving nonsolo ucounts = 1[60]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.246 = GGCCGATGTCCGACGT-1

using 338 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

UMI info for barcode GGCCGATGTCCGACGT-1 contig 1 = CCACATCCCT...
umi ACAGTATCTG = 331 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=540]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=1)
399-420 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=0)
418-469 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARAQGYSSSWYSWFDPW at 384, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 42, 193, 198, 240, 245, 262, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.251 = GGCCGATGTCTCAACA-1

using 328 reads

====================================================================================

graph has 159 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode GGCCGATGTCTCAACA-1 contig 1 = GAGCTACAAC...
umi TAATGTTCGA = 304 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=519]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-519 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.265 = GGCCGATGTTCGAATC-1

using 494 reads

====================================================================================

graph has 242 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 231, 249]
surviving nonsolo ucounts = 2[231, 249]
ids = [3, 10]

====================================================================================

UMI info for barcode GGCCGATGTTCGAATC-1 contig 1 = AGCTGGGAGG...
umi TTCTATATAC = 237 reads: +403 validated

UMI info for barcode GGCCGATGTTCGAATC-1 contig 2 = GGGGCTTTCT...
umi CACTTTGCCA = 231 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=561]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=1)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=7)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
433-561 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CVLYLGSFSWVF at 369, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 30, 45, 54, 57, 82, 349, 352
confident = false

TIG 2[bases=634]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-634 ==> 0-181 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.272 = GGCCGATTCACCCGAG-1

using 254 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 246]
surviving nonsolo ucounts = 1[246]
ids = [2]

====================================================================================

UMI info for barcode GGCCGATTCACCCGAG-1 contig 1 = GAGGAACTGC...
umi GCCCGATCAA = 212 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=444]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-444 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQFDNWPPLTF at 354, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 33, 102
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.280 = GGCCGATTCATGTCCC-1

using 349 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[349]
surviving nonsolo ucounts = 1[349]
ids = [0]

====================================================================================

UMI info for barcode GGCCGATTCATGTCCC-1 contig 1 = AGGAGTCAGA...
umi TCACCTATAC = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.283 = GGCCGATTCCGCAGTG-1

using 126 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[123]
surviving nonsolo ucounts = 1[123]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=454]
0-349 ==> 2-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
348-386 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
386-454 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQHKSYPFTF at 325, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 110
start codons at 4, 73, 209, 428
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.285 = GGCCGATTCCGTTGCT-1

using 39 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 1[35]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.292 = GGCCGATTCGGAGCAA-1

using 10786 reads

====================================================================================

graph has 4161 edges initially, 44 edges after simplification

total ucounts = 425
nonsolo ucounts = 196[2^52, 3^44, 4^19, 5^18, 6^13, 7^4, 8^2, 9, 11, 13, 15^2, 31, 69, 89, 115, 123, 142, 161, 189, 199, 203, 219, 222, 229, 237, 238, 241, 248, 253, 269, 270, 273, 281, 289, 292, 305, 306, 310, 312, 313, 318, 322, 328, 340, 342, 352, 354, 363, 370, 453]
surviving nonsolo ucounts = 39[31, 69, 89, 115, 123, 142, 161, 189, 199, 203, 219, 222, 229, 237, 238, 241, 248, 253, 269, 270, 273, 281, 289, 292, 305, 306, 310, 312, 313, 318, 322, 328, 340, 342, 352, 354, 363, 370, 453]
ids = [288, 134, 341, 212, 137, 142, 277, 389, 10, 238, ...]

====================================================================================

UMI info for barcode GGCCGATTCGGAGCAA-1 contig 1 = AGGAGTCAGA...
umi AAAACGGCAT = 251 reads: +388 validated
umi AAAGTTCAGT = 3 reads: -369 +5 -1 +3 -1 +1 -2X +1 -1 +1 -1 +2 invalidated
umi AGTCCGGGAG = 372 reads: +388 validated
umi ATGACCACTC = 266 reads: +388 validated
umi CCAATTTAGA = 268 reads: +388 validated
umi CCTCGGGCCT = 293 reads: +388 validated
umi CGATTTAGGT = 323 reads: +388 validated
umi CGTAATACTT = 363 reads: +388 validated
umi CTCGTCTTAT = 341 reads: +388 validated
umi CTGTTTCTCT = 235 reads: +388 validated
umi GACGATTCTT = 228 reads: +388 validated
umi GCATTCAGTC = 253 reads: +388 validated
umi GCTCTATCTC = 332 reads: +388 validated
umi GCTGCACCAT = 162 reads: +388 validated
umi GGCAGGAGCG = 349 reads: +388 validated
umi GTGCGTCCGC = 247 reads: +388 validated
umi GTTAAAGGTA = 240 reads: +388 validated
umi TAAAACTGGT = 316 reads: +388 validated
umi TAGTGGAATC = 287 reads: +388 validated
umi TCGAATCCAT = 311 reads: +388 validated
umi TCGCCGGGAA = 455 reads: +388 validated
umi TCTCTATCGT = 358 reads: +388 validated
umi TTTTTCTGGC = 288 reads: +388 validated

UMI info for barcode GGCCGATTCGGAGCAA-1 contig 2 = GAGTGCTTTC...
umi ATGTATCCTC = 218 reads: +463 validated
umi CAGGCACCCT = 71 reads: -22 +377 -1 +11 -2 +50 non-validated
umi CCACAGTCTT = 275 reads: +463 validated
umi GAAGCACCGG = 168 reads: +463 validated
umi GATCACTATT = 232 reads: +463 validated
umi GATTGTGCAC = 304 reads: +443 -6 +14 non-validated
umi GGGATTGGGG = 301 reads: +463 validated
umi TCACTCGAAG = 77 reads: +427 -1 +20 -1 +14 non-validated
umi TCTGACGCGT = 285 reads: +211 -1XX +251 invalidated
umi TTACGCCGCT = 259 reads: +463 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1007 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [4, 10, 72, 95, 150, 177, 188, 202, 217, 228] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6437
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=552]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
418-481 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 133 reads
cdr3 = CARGRRPTRIQLWPPYYYYGMDVW at 378, score = 9 + 7
umis assigned: [101, 134, 152, 238, 255, 259, 289, 341, 376, 406]
of which 10 are surviving nonsolos
reads assigned: 2138
start codons at 18, 39, 83, 169, 413, 438
confident = true
now this is a cell
paired!

GCGAGAGGCAGGAGGCCTACTCGGATACAGCTATGGCCCCCCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.295 = GGCCGATTCGTGACAT-1

using 294 reads

====================================================================================

graph has 457 edges initially, 2 edges after simplification

total ucounts = 174
nonsolo ucounts = 46[2^25, 3^5, 4^7, 5^2, 7^2, 8, 9^2, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.300 = GGCCGATTCTCTAGGA-1

using 233 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 76.306 = GGCCGATTCTGTTTGT-1

using 242 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode GGCCGATTCTGTTTGT-1 contig 1 = GGGAATCAGT...
umi AGTGATGAAT = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk076-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk076-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

21.544 seconds used processing barcodes, peak mem = 0.24
