[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.77 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk073-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk073-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk073.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.0 = GGACATTAGAGACGAA-1

using 38771 reads

====================================================================================

graph has 15997 edges initially, 162 edges after simplification

total ucounts = 1737
nonsolo ucounts = 942[2^275, 3^176, 4^123, 5^87, 6^51, 7^35, 8^20, 9^8, 10^18, 11^6, 12^4, 13^4, 14, 15^2, 16^3, 18, 19, 21, 27, 29, 37^2, 41, 44, 47, 65, 67, 83, 89, 94, 95, 101, 117, 122, 123, 131, 140^2, 141, 142^2, 146, 150, 151, 152, 158, 163, 165, 175, 176, 181, 186, 190, 195^2, 198, 199, 200, 202, 203, 204, 206, 220, 223, 225, 226, 229, 230^3, 237^2, 238, 240, 246, 248, 251, 255, 260^2, 263, 264, 265, 268, 270, 274, 276, 279, 281, 284^3, 288, 294, 299, 301, 302, 304, 308^4, 309, 315^3, 316, 317, 318, 320, 323, 324^2, 326, 338, 343, 344, 349, 350, 356, 357, 359, 363, 369^2, 373, 380, 384, 390, 398, 401, 406, 429, 430, 476, 480, 486, 520, 610, 646, 669, 726, 950, 1373]
surviving nonsolo ucounts = 104[89, 140, 142, 146, 150, 151, 152, 158, 163, 175, 176, 181, 186, 190, 195^2, 198, 199, 200, 202, 203, 204, 206, 220, 223, 225, 226, 229, 230^3, 237^2, 238, 246, 248, 251, 255, 260^2, 263, 264, 265, 268, 270, 274, 276, 279, 281, 284^3, 288, 294, 299, 301, 302, 304, 308^4, 309, 315^3, 316, 317, 318, 320, 323, 324^2, 326, 338, 343, 344, 349, 350, 356, 357, 359, 363, 369^2, 373, 380, 384, 390, 398, 401, 406, 429, 430, 476, 480, 486, 520, 610, 646, 669, 726, 950, 1373]
ids = [246, 1071, 1026, 699, 598, 143, 1581, 128, 1630, 424, ...]

====================================================================================

UMI info for barcode GGACATTAGAGACGAA-1 contig 1 = TGGGGGGAGT...
umi AACCACCCAG = 247 reads: +388 validated
umi ACAATAACGA = 383 reads: +388 validated
umi ACCACTTTAA = 196 reads: +388 validated
umi ACCCATGCTG = 329 reads: +388 validated
umi ATATACCCAG = 310 reads: +388 validated
umi ATCGTCCATC = 344 reads: +388 validated
umi CATGTCCCGT = 323 reads: +388 validated
umi CATTGCCTTT = 299 reads: +388 validated
umi CCAGGCACGT = 282 reads: +388 validated
umi CCATGCTCTT = 305 reads: +388 validated
umi CCCAGCCAGC = 325 reads: +388 validated
umi CCGTAATATC = 318 reads: +388 validated
umi CCTATGATCA = 153 reads: -3 +385 non-validated
umi CTACTCCGCT = 194 reads: +388 validated
umi CTGCCTTCAC = 274 reads: +388 validated
umi GAAACACCGT = 280 reads: +388 validated
umi GCTCATCCGT = 325 reads: +388 validated
umi GGGTTGCCTA = 145 reads: +248 -1XX +139 invalidated
umi GTCAACGAAC = 376 reads: +388 validated
umi TAAAAACCGC = 287 reads: +388 validated
umi TAATCACTCT = 307 reads: +388 validated
umi TACGTTGCAC = 186 reads: +388 validated
umi TAGCACCACG = 525 reads: +13 -1XX +374 invalidated
umi TAGGTCATCG = 372 reads: +388 validated
umi TCATAGTGCA = 310 reads: +388 validated
umi TCATTGAGCA = 270 reads: +388 validated
umi TCTAAATCCG = 361 reads: +388 validated
umi TGCCAAGTAG = 306 reads: +388 validated
umi TTAAGCCCAC = 647 reads: +388 validated
umi TTACGATCTA = 205 reads: +388 validated
umi TTATCTTCGC = 225 reads: +388 validated
umi TTCACACGCT = 389 reads: +388 validated
umi TTCACCGAAA = 185 reads: -344X +1 -5X +1 -2X +6 -1X +3 -3X +9 -1XX +12 invalidated
umi TTTATTCGCT = 352 reads: +388 validated

UMI info for barcode GGACATTAGAGACGAA-1 contig 2 = TGGGGATGCT...
umi AGGCCATGTT = 486 reads: +439 validated
umi AGTCTTGGTT = 428 reads: +439 validated
umi ATTGATATAG = 224 reads: +439 validated
umi ATTGCATGGG = 294 reads: +439 validated
umi CACCCCTTTC = 264 reads: +439 validated
umi CACTCTACGG = 479 reads: +439 validated
umi CAGGTCATGT = 172 reads: +439 validated
umi CATCTGTAGG = 339 reads: +432 -7 non-validated
umi CATGTTTCCT = 315 reads: +439 validated
umi CCAAGCAGGC = 370 reads: +439 validated
umi CGTCTTCGGC = 398 reads: +439 validated
umi CTACATACTT = 264 reads: +433 -6 non-validated
umi CTTTTCCAAA = 307 reads: -2X +437 invalidated
umi GCAATATCTT = 176 reads: +422 -1 +13 -1 +2 non-validated
umi GGTGGCCCTG = 613 reads: +266 -1XX +1 -2XX +1 -1XX +1 -4XX +3 -3XX +1 -6XX +2 -1XX +1 -2X +1 -142X invalidated
umi TAATTTGCCC = 312 reads: +439 validated
umi TATAAAGCTG = 223 reads: +353 -2 +84 non-validated
umi TATGCAATAC = 435 reads: +439 validated
umi TCATCGGGAT = 263 reads: +439 validated
umi TCGTTCCGGG = 205 reads: +439 validated
umi TCTGGTCCGT = 232 reads: +439 validated
umi TGACATATCA = 320 reads: +439 validated
umi TGACTGGACC = 375 reads: +439 validated
umi TGCTCTGTAA = 404 reads: +439 validated
umi TTGAATCTAT = 411 reads: +439 validated
umi TTGTATATCT = 225 reads: +439 validated

UMI info for barcode GGACATTAGAGACGAA-1 contig 3 = GGGGTCACAA...
umi AAACGCAGCG = 290 reads: +382 validated
umi ACGACATTTA = 241 reads: +382 validated
umi ACGTAAGTTG = 152 reads: +382 validated
umi ATAGAGACGC = 87 reads: +382 validated
umi CAAACCATAC = 356 reads: +382 validated
umi CACGCTTCGC = 236 reads: +382 validated
umi CATAGCTCTC = 298 reads: +382 validated
umi CTCGACCTTT = 236 reads: +382 validated
umi CTCGTTGGGG = 230 reads: +382 validated
umi CTTCTAGGGA = 220 reads: +382 validated
umi GAGCTTACCC = 77 reads: +127 -1XX +2 -1XX +1 -1XX +7 -2XX +6 -1XX +2 -1XX +1 -1XX +1 -2XX +3 -76 +4 -2XX +9 -1XX +15 -1XX +26 -1XX +27 -1XX +10 -1XX +1 -1XX +2 -1XX +3 -4XX +1 -1XX +1 -4X +14 -1XX +13 -1XX invalidated
umi GCCCCGGCAC = 259 reads: +382 validated
umi GCTTCTACGG = 140 reads: +382 validated
umi GTGAATTACC = 272 reads: +382 validated
umi GTGACCCTGC = 259 reads: +382 validated
umi GTGTTTTCGT = 479 reads: +382 validated
umi TACTGTCAGG = 253 reads: +382 validated
umi TCCACCAGGG = 186 reads: +382 validated
umi TCCATATTGG = 259 reads: +382 validated
umi TGCGTTTAGT = 242 reads: +382 validated
umi TGTTCACTTT = 320 reads: +382 validated
umi TTACTTATCC = 154 reads: +382 validated
umi TTTAAGGTAA = 201 reads: +382 validated

UMI info for barcode GGACATTAGAGACGAA-1 contig 4 = AGCTCTGGGA...
umi AATTGATTGC = 199 reads: +424 validated
umi AATTTTAGCG = 294 reads: +424 validated
umi CCCAGCACTC = 239 reads: +424 validated
umi GATGTTTCAA = 183 reads: +424 validated
umi GCTTTTAGGA = 182 reads: +424 validated
umi GTAACTTTAG = 321 reads: +424 validated
umi GTTGCAGGCC = 230 reads: -389X +2 -1XX +1 -5XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +1 -1XX +1 -1XX +1 -4XX +1 -1XX +1 -2XX +2 invalidated
umi TAAATACACC = 283 reads: +424 validated
umi TAAATTCTGG = 865 reads: -372X +2 -6XX +1 -3XX +3 -2XX +7 -1XX +1 -1XX +2 -2XX +2 -2XX +17 invalidated
umi TTCGATACTT = 140 reads: +424 validated
umi TTCTACTCCA = 90 reads: +5 -2XX +1 -1XX +5 -2XX +26 -1XX +10 -1XX +33 -1XX +4 -2XX +4 -1XX +3 -1XX +19 -8X +13 -2XX +2 -3XX +4 -2XX +4 -2XX +3 -1XX +34 -4XX +1 -2XX +2 -1XX +1 -2XX +2 -1XX +1 -7XX +1 -199XX invalidated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 33 umis using 1631 reads
cdr3 = CQQSYITPLTF at 358, score = 9 + 9
umis assigned: [24, 85, 111, 118, 252, 280, 470, 482, 519, 529] and 24 others
of which 34 are surviving nonsolos
reads assigned: 10176
start codons at 31, 37, 93, 106, 242, 461
confident = true

TIG 2[bases=531]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=9)
424-460 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 23 umis using 572 reads
cdr3 = CARHSGLRSCLYSW at 387, score = 9 + 7
umis assigned: [214, 229, 316, 318, 376, 402, 424, 457, 473, 498] and 16 others
of which 26 are surviving nonsolos
reads assigned: 8415
start codons at 5, 21, 30, 42, 86
confident = true

TIG 3[bases=631]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=4)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 22 umis using 891 reads
cdr3 = CCSYAGTRVF at 362, score = 8 + 8
umis assigned: [7, 137, 143, 246, 328, 389, 434, 772, 783, 842] and 13 others
of which 22 are surviving nonsolos
reads assigned: 5347
start codons at 38, 177, 239, 246, 372
confident = true

TIG 4[bases=606]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=9)
427-454 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
458-504 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
504-606 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 8 umis using 157 reads
cdr3 = CTYGSGSYYRVGDYW at 428, score = 8 + 6
umis assigned: [80, 82, 540, 936, 1028, 1091, 1155, 1175, 1176, 1630] and 1 others
of which 10 are surviving nonsolos
reads assigned: 2979
start codons at 80, 133, 231, 236, 303, 360, 389, 435, 522, 583
confident = true

REJECT CONTIGS

TIG 1[bases=570]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=6)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [128, 699, 796, 944, 956, 1390, 1479, 1507, 1638]
of which 9 are surviving nonsolos
reads assigned: 2425
start codons at 30, 99, 352, 476
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.6 = GGACATTAGAGTCGGT-1

using 342 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 5, 326]
surviving nonsolo ucounts = 1[326]
ids = [9]

====================================================================================

UMI info for barcode GGACATTAGAGTCGGT-1 contig 1 = AGTCTCAGTC...
umi TACACTGTTT = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-468 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYTTLLTF at 347, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.7 = GGACATTAGAGTCTGG-1

using 376 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 7, 357]
surviving nonsolo ucounts = 1[357]
ids = [0]

====================================================================================

UMI info for barcode GGACATTAGAGTCTGG-1 contig 1 = GGAGTCAGTC...
umi AATCACAGGG = 330 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-493 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.17 = GGACATTAGCCTCGTG-1

using 178 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [1]

====================================================================================

UMI info for barcode GGACATTAGCCTCGTG-1 contig 1 = CTCCTCTAAA...
umi ATTGGAAATG = 170 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=479]
0-38 ==> 20-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
38-391 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
392-410 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
411-474 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
junction support: 1 umis using 15 reads
cdr3 = CARVGYSSSASYFYYYAMDVW at 380, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 38, 189, 236, 335, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.22 = GGACATTAGCTGCCCA-1

using 706 reads

====================================================================================

graph has 220 edges initially, 12 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3^2, 193, 234, 265]
surviving nonsolo ucounts = 3[193, 234, 265]
ids = [4, 2, 7]

====================================================================================

UMI info for barcode GGACATTAGCTGCCCA-1 contig 1 = CTCCCCCTCT...
umi CAGTATGCTT = 193 reads: +388 validated

UMI info for barcode GGACATTAGCTGCCCA-1 contig 2 = AGCCTGGGCC...
umi ATAGCTGACC = 237 reads: -375 +1 non-validated
umi CCTTTCTCTT = 264 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=692]
0-59 ==> 20-79 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
59-93 ==> 80-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=1)
93-446 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
443-481 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
481-692 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAAWDDSLSGVVF at 414, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 16, 93, 247, 397, 422, 427
confident = false

TIG 2[bases=627]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-378 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQAWDSSTVVF at 355, score = 6 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 496
start codons at 40, 45, 101, 188, 334, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.24 = GGACATTAGGAATCGC-1

using 697 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3^2, 8, 219, 461]
surviving nonsolo ucounts = 2[219, 461]
ids = [6, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.30 = GGACATTAGGCTACGA-1

using 576 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 6, 8, 173, 382]
surviving nonsolo ucounts = 2[173, 382]
ids = [0, 2]

====================================================================================

UMI info for barcode GGACATTAGGCTACGA-1 contig 1 = ACACCCTGTG...
umi AAAGCGTCGC = 173 reads: +388 validated
umi AGTAAGCATA = 360 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-38 ==> 9-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
38-389 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=8)
388-426 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
426-504 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 76 reads
cdr3 = CQQANSFPITF at 365, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 523
start codons at 38, 44, 100, 113, 249, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.31 = GGACATTAGGTGCAAC-1

using 999 reads

====================================================================================

graph has 980 edges initially, 6 edges after simplification

total ucounts = 277
nonsolo ucounts = 97[2^41, 3^24, 4^7, 5^7, 6^5, 7^8, 9, 13, 14, 222, 258]
surviving nonsolo ucounts = 2[222, 258]
ids = [3, 244]

====================================================================================

UMI info for barcode GGACATTAGGTGCAAC-1 contig 1 = TGGGGTTTGG...
umi AAAGAACAAC = 212 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=491]
39-392 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
396-416 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=3)
429-484 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGYVDTAMAPRTEGYYYGMDVW at 381, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 39, 190, 195, 342, 394, 408, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.37 = GGACATTAGTCTTGCA-1

using 404 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[402]
surviving nonsolo ucounts = 1[402]
ids = [0]

====================================================================================

UMI info for barcode GGACATTAGTCTTGCA-1 contig 1 = GGGGAGGAAC...
umi CAAAGATTGC = 405 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQRRTWPPAF at 357, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 399
start codons at 36, 85, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.38 = GGACATTAGTGCGTGA-1

using 1217 reads

====================================================================================

graph has 1668 edges initially, 32 edges after simplification

total ucounts = 529
nonsolo ucounts = 221[2^78, 3^51, 4^30, 5^19, 6^18, 7^8, 8^7, 9^5, 12, 13, 15, 18, 62]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.48 = GGACATTCAAGTCTGT-1

using 333 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[326]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.50 = GGACATTCAATTCCTT-1

using 516 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 254, 256]
surviving nonsolo ucounts = 2[254, 256]
ids = [2, 1]

====================================================================================

UMI info for barcode GGACATTCAATTCCTT-1 contig 1 = ATCATCCAAC...
umi CATTGGCGAA = 247 reads: +430 validated

UMI info for barcode GGACATTCAATTCCTT-1 contig 2 = GGGGATCAGA...
umi CTCGTTCGGG = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-548 ==> 0-60 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 58, 214, 256, 322, 355, 445, 542
confident = false

TIG 2[bases=478]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-478 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.51 = GGACATTCACACAGAG-1

using 23 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.55 = GGACATTCACAGCGTC-1

using 257 reads

====================================================================================

graph has 91 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 250]
surviving nonsolo ucounts = 1[250]
ids = [0]

====================================================================================

UMI info for barcode GGACATTCACAGCGTC-1 contig 1 = GGAGTCAGTC...
umi AGTATCCGTT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-460 ==> 0-46 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQLNSYPLTF at 353, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 26, 32, 88, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.61 = GGACATTCACGTTGGC-1

using 145 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 4, 7, 123]
surviving nonsolo ucounts = 1[123]
ids = [7]

====================================================================================

UMI info for barcode GGACATTCACGTTGGC-1 contig 1 = GCTACAACAG...
umi TGCTCCGCTG = 122 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=486]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
431-486 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQYYSTPPYTF at 367, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 28, 97, 350, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.65 = GGACATTCAGAAGCAC-1

using 28 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.71 = GGACATTCAGTCACTA-1

using 414 reads

====================================================================================

graph has 226 edges initially, 4 edges after simplification

total ucounts = 39
nonsolo ucounts = 5[2, 5^2, 7, 361]
surviving nonsolo ucounts = 3[2, 7, 361]
ids = [7, 22, 36]

====================================================================================

UMI info for barcode GGACATTCAGTCACTA-1 contig 1 = AGAGCTGCTC...
umi TGATGAAGGC = 336 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGSSPRTF at 355, score = 9 + 8
umis assigned: [36]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.85 = GGACATTCATTAGCCA-1

using 872 reads

====================================================================================

graph has 258 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 251, 613]
surviving nonsolo ucounts = 2[251, 613]
ids = [6, 3]

====================================================================================

UMI info for barcode GGACATTCATTAGCCA-1 contig 1 = GCTACAACAG...
umi GTAATAAGTG = 246 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=501]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
431-501 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYYSTPMYTF at 367, score = 10 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 28, 97, 350, 391, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.90 = GGACATTGTAAGGGCT-1

using 363 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 3, 350]
surviving nonsolo ucounts = 1[350]
ids = [5]

====================================================================================

UMI info for barcode GGACATTGTAAGGGCT-1 contig 1 = GCTCTGCCTC...
umi CGCGAGCCCT = 332 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=589]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-589 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.95 = GGACATTGTACCGCTG-1

using 64 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 58]
surviving nonsolo ucounts = 1[58]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.98 = GGACATTGTAGAGTGC-1

using 306 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [1]

====================================================================================

UMI info for barcode GGACATTGTAGAGTGC-1 contig 1 = AGCTGTGGGC...
umi ATAAGCCGCC = 293 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=477]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
422-477 ==> 0-55 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CNSRDSSGNHYVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 40, 159, 188, 239, 338, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.106 = GGACATTGTCCAGTGC-1

using 275 reads

====================================================================================

graph has 115 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 7, 259]
surviving nonsolo ucounts = 1[259]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=568]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=4)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 30, 99, 352, 474
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.111 = GGACATTGTCTTTCAT-1

using 14 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.115 = GGACATTGTGCAACTT-1

using 305 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 291]
surviving nonsolo ucounts = 1[291]
ids = [4]

====================================================================================

UMI info for barcode GGACATTGTGCAACTT-1 contig 1 = CTGGGCCTCA...
umi GGGTTACAGG = 275 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=574]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-367 ==> 0-330 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
413-574 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQAWDGSTAVF at 352, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 37, 42, 98, 185, 236, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.134 = GGACATTTCAAACCGT-1

using 577 reads

====================================================================================

graph has 910 edges initially, 8 edges after simplification

total ucounts = 290
nonsolo ucounts = 121[2^57, 3^25, 4^16, 5^6, 6^8, 7^5, 8^2, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.135 = GGACATTTCAACGCTA-1

using 400 reads

====================================================================================

graph has 164 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2^2, 3^2, 5, 6, 7, 8^2, 10, 16, 19, 309]
surviving nonsolo ucounts = 1[309]
ids = [11]

====================================================================================

UMI info for barcode GGACATTTCAACGCTA-1 contig 1 = GGAGTCAGAC...
umi TATTGCGCTT = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-503 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.142 = GGACATTTCACCCGAG-1

using 723 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 325, 391]
surviving nonsolo ucounts = 2[325, 391]
ids = [1, 6]

====================================================================================

UMI info for barcode GGACATTTCACCCGAG-1 contig 1 = GGGAGGAACT...
umi ACCCGTCTAC = 322 reads: +385 validated
umi TACGAAGTTT = 386 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 62-97 on |291|IGKV3D-20|5'UTR| [len=97] (mis=0)
35-383 ==> 0-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CQQYGSSPRTF at 359, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 702
start codons at 35, 243, 246, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.147 = GGACATTTCCAAACTG-1

using 58 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2, 3, 4, 8^2, 9, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.164 = GGACATTTCTACTATC-1

using 8819 reads

====================================================================================

graph has 5180 edges initially, 62 edges after simplification

total ucounts = 901
nonsolo ucounts = 451[2^161, 3^90, 4^59, 5^50, 6^19, 7^14, 8^12, 9^6, 10^3, 11^3, 12^7, 13, 15, 20, 38, 55, 58, 83, 111, 170, 224, 226, 233, 255, 262, 270, 278, 282, 311, 316, 334, 339, 342, 430, 451, 457, 522, 687]
surviving nonsolo ucounts = 23[38, 55, 58, 83, 170, 224, 226, 233, 255, 262, 270, 278, 282, 311, 316, 334, 339, 342, 430, 451, 457, 522, 687]
ids = [436, 223, 112, 264, 626, 33, 474, 721, 345, 257, ...]

====================================================================================

UMI info for barcode GGACATTTCTACTATC-1 contig 1 = GAGCAGAGCT...
umi ATTCTTGCCA = 262 reads: +397 validated
umi CCAGGCCCAC = 258 reads: +397 validated
umi GCCAACGTAT = 338 reads: -366X +31 invalidated

UMI info for barcode GGACATTTCTACTATC-1 contig 2 = ACTTTCTGAG...
umi ACCTGGATAT = 53 reads: +316 -1 +90 -1 +4 -1 +8 non-validated
umi ATATGCGCCT = 332 reads: +421 validated
umi TCGCTTCCCC = 273 reads: +421 validated

UMI info for barcode GGACATTTCTACTATC-1 contig 3 = GATCAGGACT...
umi AACTCGCGCG = 224 reads: +400 validated
umi ATCTGGGTCC = 59 reads: +400 validated
umi CGACTTTCGT = 316 reads: +400 validated
umi GAAATCCCTT = 225 reads: +400 validated
umi GCACACGGCC = 281 reads: +400 validated
umi GTACCATAGG = 313 reads: +400 validated
umi TACTACGATG = 437 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=634]
26-388 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=6)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 85 reads
cdr3 = CETWDSKSVVF at 362, score = 7 + 8
umis assigned: [257, 345, 514]
of which 3 are surviving nonsolos
reads assigned: 847
start codons at 26, 190, 230, 345
confident = true

TIG 2[bases=527]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=16)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 48 reads
cdr3 = CATDHYYSSGSFDYW at 380, score = 9 + 7
umis assigned: [112, 199, 757]
of which 3 are surviving nonsolos
reads assigned: 650
start codons at 35, 79
confident = true

TIG 3[bases=566]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=2)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 229 reads
cdr3 = CMQGTHWPPVTF at 366, score = 9 + 8
umis assigned: [33, 223, 387, 474, 503, 582, 673]
of which 7 are surviving nonsolos
reads assigned: 1814
start codons at 30, 63, 91, 99, 187, 349, 369, 472
confident = true

REJECT CONTIGS

TIG 1[bases=556]
4-76 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
28-381 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=12)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [61, 73, 264, 336, 462, 530, 721]
of which 7 are surviving nonsolos
reads assigned: 2500
start codons at 28, 34, 90, 338, 371, 462
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.165 = GGACATTTCTAGAGTC-1

using 300 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 4^2, 281]
surviving nonsolo ucounts = 1[281]
ids = [1]

====================================================================================

UMI info for barcode GGACATTTCTAGAGTC-1 contig 1 = GTCAGTCCCA...
umi ACTCAATGGA = 264 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=498]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-86 ==> 0-63 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
86-371 ==> 66-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=22)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-498 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQINSYPLTF at 347, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 180, 231, 450
confident = false
see deletion of 3 bases at pos 63 on |239|IGKV1-9|L-REGION+V-REGION|
>vscore_73.165_63.7%
ATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAGAGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGCAGGAGACAGAGTCACCATCACTTGTCGGGCCAGTCTGGACATTGACACTTATGTAGCCTGGTATCAGCAAAAACCAGGGAGAGCCCCTAAACTCCTAATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGGTCTGGGACACATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTACAACTTATTACTGTCAACAAATTAACAGTTATCCT
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.169 = GGACATTTCTCTTGAT-1

using 320 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 315]
surviving nonsolo ucounts = 1[315]
ids = [2]

====================================================================================

UMI info for barcode GGACATTTCTCTTGAT-1 contig 1 = GAGCTACAAC...
umi CTTCTTACAG = 312 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-511 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSTPPIFTF at 369, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 30, 99, 352, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.178 = GGACGTCAGAAACGAG-1

using 1024 reads

====================================================================================

graph has 1468 edges initially, 10 edges after simplification

total ucounts = 491
nonsolo ucounts = 189[2^83, 3^36, 4^27, 5^13, 6^7, 7^7, 8^4, 9^3, 10^2, 11, 12, 13, 14, 15, 18, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.179 = GGACGTCAGAATTCCC-1

using 14376 reads

====================================================================================

graph has 5901 edges initially, 94 edges after simplification

total ucounts = 1087
nonsolo ucounts = 454[2^195, 3^81, 4^59, 5^30, 6^12, 7^9, 8^5, 9^9, 10, 11^3, 12, 13, 14, 15, 24, 41, 46, 51, 91, 96, 97, 103, 121, 133, 136, 137, 188, 193, 216, 229, 230^2, 265, 279^2, 285, 293, 294, 296, 310, 312, 313, 334, 340, 357, 358, 360, 364, 365, 380, 383^2, 389, 396, 405, 415, 418, 460, 485, 489]
surviving nonsolo ucounts = 43[9, 46, 51, 91, 96, 103, 121, 136, 137, 188, 193, 216, 229, 230^2, 265, 279^2, 285, 293, 294, 296, 310, 312, 313, 334, 340, 357, 358, 360, 364, 365, 380, 383^2, 389, 396, 405, 415, 418, 460, 485, 489]
ids = [1078, 0, 744, 1025, 804, 1030, 1046, 583, 635, 94, ...]

====================================================================================

UMI info for barcode GGACGTCAGAATTCCC-1 contig 1 = TTGGGGAGGA...
umi CCCTAATTTG = 334 reads: +385 validated
umi CTCCTCTTTC = 230 reads: +385 validated
umi CTTATGCCGT = 362 reads: +385 validated
umi CTTCACTCGT = 360 reads: +385 validated
umi GAACCCTGGT = 225 reads: +385 validated
umi GCTCGAACGG = 140 reads: +385 validated
umi GGTAGTCGCT = 309 reads: +385 validated
umi GTTTCATTCT = 281 reads: +385 validated
umi TCTAAACTCA = 271 reads: +385 validated
umi TGTATCGGTA = 413 reads: -279X +106 invalidated

UMI info for barcode GGACGTCAGAATTCCC-1 contig 2 = TGGGGACTCC...
umi ATCTAGGCGG = 297 reads: +424 validated
umi CAACTTTCGC = 483 reads: +424 validated
umi CACTGCTTGA = 190 reads: +424 validated
umi CTACGACCTA = 296 reads: +424 validated
umi CTATACCTAT = 299 reads: +424 validated
umi GCAAGACCAT = 93 reads: -10 +409 -5 non-validated
umi GGGCCGGCCC = 321 reads: +424 validated
umi GTAGCCTTCG = 336 reads: +424 validated
umi GTCCAGTCCT = 385 reads: +424 validated
umi TAGTCATATC = 233 reads: +424 validated
umi TATGTTTTCC = 97 reads: +424 validated
umi TTCCGCCCCC = 463 reads: +424 validated
umi TTCGCCCTGT = 281 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=554]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 438 reads
cdr3 = CQQSYSSPTF at 360, score = 9 + 8
umis assigned: [348, 468, 504, 506, 530, 635, 683, 756, 896, 971]
of which 10 are surviving nonsolos
reads assigned: 2881
start codons at 33, 39, 95, 108, 244, 460
confident = true

TIG 2[bases=516]
21-379 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=5)
397-445 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
445-516 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 407 reads
cdr3 = CARRYYGDSPNYFDYW at 366, score = 7 + 7
umis assigned: [256, 286, 306, 441, 447, 583, 675, 703, 713, 800] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3738
start codons at 21, 169, 177, 244, 327, 336
confident = true

REJECT CONTIGS

TIG 1[bases=589]
1-115 ==> 73-187 on rc of segment before IGKV3-20 exon 1 [len=187] (mis=0)
112-414 ==> 46-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
415-453 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
453-589 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [190, 247, 261, 558, 568, 598, 705, 760, 785, 798] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3783
start codons at 61, 81, 274, 400, 495
confident = false
did not find CDR3

TIG 2[bases=315]
4-150 ==> 2499-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
181-244 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
244-315 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [181, 605]
of which 1 are surviving nonsolos
reads assigned: 545
start codons at 201
confident = false
did not find CDR3
now this is a cell
paired!

GTGGACACAGCCACATATTACTGTGCACGGAGGTACTACGGTGACTCTCCCAACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTTCGCCGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.180 = GGACGTCAGACAAGCC-1

using 964 reads

====================================================================================

graph has 342 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4, 5, 195, 756]
surviving nonsolo ucounts = 2[195, 756]
ids = [1, 4]

====================================================================================

UMI info for barcode GGACGTCAGACAAGCC-1 contig 1 = ACTCAGGACA...
umi CATTCGTTCG = 192 reads: +394 validated
umi TCTATATTGG = 740 reads: -234X +2 -1XX +1 -2XX +2 -3XX +1 -6XX +1 -5XX +1 -2XX +133 invalidated

GOOD CONTIGS

TIG 1[bases=624]
0-19 ==> 32-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
19-375 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
413-624 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 207 reads
cdr3 = CQSYDSSLSGLYVF at 343, score = 7 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 915
start codons at 19, 173, 176, 227, 326, 353, 377, 545
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.187 = GGACGTCAGAGTAATC-1

using 440 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 4, 6, 7, 11, 407]
surviving nonsolo ucounts = 1[407]
ids = [8]

====================================================================================

UMI info for barcode GGACGTCAGAGTAATC-1 contig 1 = AGTCCCACTC...
umi TGGAGTTTCG = 353 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-472 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.190 = GGACGTCAGCAGGCTA-1

using 206 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 196]
surviving nonsolo ucounts = 1[196]
ids = [4]

====================================================================================

UMI info for barcode GGACGTCAGCAGGCTA-1 contig 1 = GAAACAGAGC...
umi TACATTCCTG = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
426-482 ==> 0-56 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CSAWDSSLNVWVF at 359, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 38, 177, 367, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.199 = GGACGTCAGCTTTGGT-1

using 272 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 262]
surviving nonsolo ucounts = 1[262]
ids = [7]

====================================================================================

UMI info for barcode GGACGTCAGCTTTGGT-1 contig 1 = GGGGTCTCAG...
umi TGACGGGAGT = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=587]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-587 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.203 = GGACGTCAGGTTACCT-1

using 1230 reads

====================================================================================

graph has 1740 edges initially, 30 edges after simplification

total ucounts = 628
nonsolo ucounts = 247[2^110, 3^59, 4^29, 5^17, 6^14, 7^9, 8^2, 9^2, 11^2, 15, 16, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 73.205 = GGACGTCAGTAAGTAC-1

using 69 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[3^3, 5^2, 6, 9, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.10
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk073-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk073-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

15.042 seconds used processing barcodes, peak mem = 0.24
