[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.71 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk072-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk072-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk072.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.0 = GGAATAAAGAGACGAA-1

using 788 reads

====================================================================================

graph has 298 edges initially, 8 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 173, 188, 417]
surviving nonsolo ucounts = 3[173, 188, 417]
ids = [4, 0, 8]

====================================================================================

UMI info for barcode GGAATAAAGAGACGAA-1 contig 1 = GAGTCAGACT...
umi ATTATCGGCA = 170 reads: +388 validated

UMI info for barcode GGAATAAAGAGACGAA-1 contig 2 = AGTCTGGGCC...
umi GCATAGCGGA = 415 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 408
start codons at 40, 101, 170, 338, 374, 383
confident = false

REJECT CONTIGS

TIG 1[bases=569]
0-78 ==> 5532-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
31-391 ==> 0-360 on |277|IGKV2D-30|L-REGION+V-REGION| [len=360] (mis=0)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARYTLASGITF at 351, score = 3 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 31, 64, 92, 100, 188, 350, 370, 475
confident = false
not full
frameshifted full length transcript of length 569
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.3 = GGAATAAAGAGGTTGC-1

using 290 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 49, 233]
surviving nonsolo ucounts = 2[49, 233]
ids = [0, 2]

====================================================================================

UMI info for barcode GGAATAAAGAGGTTGC-1 contig 1 = ACCCAAAAAC...
umi ATCCGAAAAC = 227 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=511]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-511 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 54, 252, 257, 274, 318, 351
confident = false

REJECT CONTIGS

TIG 1[bases=364]
0-339 ==> 6-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
338-364 ==> 0-26 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 35
start codons at 49, 63, 199
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.7 = GGAATAAAGCAATATG-1

using 1035 reads

====================================================================================

graph has 748 edges initially, 2 edges after simplification

total ucounts = 137
nonsolo ucounts = 57[2^25, 3^11, 4^7, 5^8, 6, 7, 8, 10, 27, 746]
surviving nonsolo ucounts = 1[746]
ids = [68]

====================================================================================

REJECT CONTIGS

TIG 1[bases=467]
4-218 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
218-256 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
256-467 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 186, score = 7 + 8
umis assigned: [68]
of which 1 are surviving nonsolos
reads assigned: 731
start codons at 16, 19, 70, 169, 196, 220, 388
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.15 = GGAATAAAGGCTAGAC-1

using 20 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.17 = GGAATAAAGGGTTCCC-1

using 32 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.18 = GGAATAAAGGTAAACT-1

using 259 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=479]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
49-116 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=23)
436-479 ==> 0-43 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
cdr3 = CVKEEDAFDIW at 422, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 80, 231, 236, 297, 315, 383, 438, 467
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.19 = GGAATAAAGGTAGCCA-1

using 168 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 5, 156]
surviving nonsolo ucounts = 1[156]
ids = [4]

====================================================================================

UMI info for barcode GGAATAAAGGTAGCCA-1 contig 1 = GGGGAGTCAG...
umi GACGGATCAT = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSNIPPRMF at 355, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 28, 34, 90, 103, 239, 382, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.24 = GGAATAAAGTAGGCCA-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.25 = GGAATAAAGTAGGTGC-1

using 191 reads

====================================================================================

graph has 233 edges initially, 4 edges after simplification

total ucounts = 52
nonsolo ucounts = 39[2^11, 3^9, 4^3, 5^7, 6^3, 7^3, 10, 16, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.26 = GGAATAAAGTAGTGCG-1

using 12813 reads

====================================================================================

graph has 5232 edges initially, 34 edges after simplification

total ucounts = 624
nonsolo ucounts = 277[2^87, 3^50, 4^36, 5^20, 6^20, 7^8, 8^5, 9^2, 10^2, 11^2, 12, 13^2, 14^2, 16, 26, 46, 64, 118, 119, 138^2, 144, 147, 151, 190, 229, 231, 253, 255, 259, 269, 282, 283, 290, 292, 296, 297, 300, 312, 316, 320, 340, 342, 344, 360, 393, 465, 489, 493, 575, 614, 664, 696]
surviving nonsolo ucounts = 37[46, 64, 118, 119, 138^2, 144, 147, 190, 229, 231, 253, 255, 259, 269, 282, 283, 290, 292, 296, 297, 300, 312, 316, 320, 340, 342, 344, 360, 393, 465, 489, 493, 575, 614, 664, 696]
ids = [318, 276, 310, 579, 333, 369, 102, 260, 421, 515, ...]

====================================================================================

UMI info for barcode GGAATAAAGTAGTGCG-1 contig 1 = ACTTTCTGAG...
umi AGGCGATTGG = 659 reads: -32 +2 -1XX +377 invalidated
umi AGGCGGTTTT = 336 reads: +412 validated
umi ATCACGTGTC = 229 reads: +412 validated
umi CCCAGCATCG = 450 reads: -372X +1 -7X +1 -2XX +1 -5XX +1 -10XX +1 -1XX +1 -1XX +8 invalidated
umi CTATGCCGGG = 44 reads: +399 -13 non-validated
umi GTACCCTCTA = 23 reads: -341X +1 -5XX +1 -2XX +1 -1XX +1 -1XX +1 -4XX +1 -11XX +1 -3XX +37 invalidated
umi GTGAGAGTTC = 192 reads: +412 validated
umi GTTCAAATGG = 227 reads: +412 validated
umi TATTTGGAGG = 272 reads: +412 validated
umi TCGGTGTTTA = 227 reads: +412 validated
umi TGGACATTCG = 305 reads: -380X +1 -2X +1 -5XX +1 -10XX +1 -1XX +1 -1XX +8 invalidated
umi TTAGGTTCAC = 120 reads: +412 validated
umi TTCATAAACC = 189 reads: +412 validated
umi TTCGACCTGA = 261 reads: +412 validated

UMI info for barcode GGAATAAAGTAGTGCG-1 contig 2 = GGAGTCAGAC...
umi AACCTCAATC = 613 reads: +388 validated
umi ATAATTTAGG = 393 reads: +388 validated
umi ATGCCTTCCG = 348 reads: +388 validated
umi CCAGGAGCGC = 284 reads: -322 +1 -2X +1 -3X +1 -1X +1 -5XX +1 -10XX +1 -2XX +37 invalidated
umi CGACTGTAGC = 286 reads: +388 validated
umi CGGTCGATCA = 259 reads: +388 validated
umi CTCCCTATCT = 296 reads: +388 validated
umi CTTTTCGAGA = 119 reads: +388 validated
umi GCAACCTCTC = 131 reads: -348X +1 -2X +37 invalidated
umi GCAGGGTACA = 232 reads: +388 validated
umi GCGGCGACAG = 300 reads: +388 validated
umi GGAAATCGGT = 141 reads: +388 validated
umi GGTCTCCTAT = 338 reads: +388 validated
umi GTAAGGACGA = 696 reads: +388 validated
umi GTATCCTGCG = 338 reads: +388 validated
umi TAAACGGACT = 291 reads: +388 validated
umi TAATCTCACA = 273 reads: +388 validated
umi TAGACACCAT = 298 reads: +388 validated
umi TGGAAATAGG = 286 reads: +388 validated
umi TGTCTGCGTT = 576 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=14)
410-447 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
447-549 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 10 umis using 305 reads
cdr3 = CASGDDYGDLYW at 380, score = 9 + 8
umis assigned: [105, 106, 133, 216, 276, 404, 421, 430, 486, 515] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3486
start codons at 35, 79, 393, 465, 526
confident = true

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 881 reads
cdr3 = CQQYNSYSWTF at 353, score = 8 + 8
umis assigned: [19, 125, 147, 206, 249, 266, 281, 310, 333, 340] and 10 others
of which 20 are surviving nonsolos
reads assigned: 6388
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = true
now this is a cell
paired!

TCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGTGGGGATGACTACGGTGATCTTTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCCTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.27 = GGAATAAAGTCCGTAT-1

using 295 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[291]
surviving nonsolo ucounts = 1[291]
ids = [0]

====================================================================================

UMI info for barcode GGAATAAAGTCCGTAT-1 contig 1 = GAACTGCTCA...
umi CAGTAATCAC = 292 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 67-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
30-375 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNNWPPGTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 30, 99, 235, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.31 = GGAATAAAGTGGCACA-1

using 316 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 18, 292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================

UMI info for barcode GGAATAAAGTGGCACA-1 contig 1 = TGGGGGAGGA...
umi TCCTTCTGGT = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-500 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 33, 39, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.32 = GGAATAAAGTTCCACA-1

using 454 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[454]
surviving nonsolo ucounts = 1[454]
ids = [0]

====================================================================================

UMI info for barcode GGAATAAAGTTCCACA-1 contig 1 = GGAACTGCTC...
umi CGACGTATTA = 457 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CLQYYNWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 448
start codons at 31, 86, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.41 = GGAATAACAAGCTGGA-1

using 225 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 220]
surviving nonsolo ucounts = 1[220]
ids = [2]

====================================================================================

UMI info for barcode GGAATAACAAGCTGGA-1 contig 1 = GCTTCAGCTG...
umi TAAGTACCTT = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-46 ==> 68-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
46-399 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-558 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.62 = GGAATAACAGGACCCT-1

using 246 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [5]

====================================================================================

UMI info for barcode GGAATAACAGGACCCT-1 contig 1 = GGGGTCTCAG...
umi TCCAATCTGG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-537 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.71 = GGAATAACATGTTCCC-1

using 1333 reads

====================================================================================

graph has 2014 edges initially, 12 edges after simplification

total ucounts = 645
nonsolo ucounts = 267[2^100, 3^64, 4^46, 5^24, 6^10, 7^8, 8^3, 9^6, 10^4, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.77 = GGAATAAGTAGCGCAA-1

using 3889 reads

====================================================================================

graph has 2895 edges initially, 56 edges after simplification

total ucounts = 518
nonsolo ucounts = 391[2^57, 3^42, 4^31, 5^38, 6^39, 7^33, 8^30, 9^25, 10^17, 11^13, 12^13, 13^14, 14^9, 15^8, 16^4, 17^5, 18^4, 19^2, 23, 24, 81, 145, 251, 256, 342]
surviving nonsolo ucounts = 5[81, 145, 251, 256, 342]
ids = [416, 33, 357, 318, 385]

====================================================================================

UMI info for barcode GGAATAAGTAGCGCAA-1 contig 1 = AGCTCAGGAA...
umi GTTTCCTTTC = 239 reads: +391 validated
umi TCAGCAATCG = 56 reads: +38 -5XX +345 -3 invalidated

UMI info for barcode GGAATAAGTAGCGCAA-1 contig 2 = TGGGAGTGAC...
umi ACCTTAACTG = 134 reads: -3 +421 non-validated
umi TAGCCCCTCT = 306 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=527]
0-33 ==> 53-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
33-386 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=8)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-527 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQSHDSSTPWVF at 360, score = 6 + 8
umis assigned: [357, 416]
of which 2 are surviving nonsolos
reads assigned: 290
start codons at 33, 96, 187, 238, 370
confident = true

TIG 2[bases=567]
24-382 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=5)
402-448 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
448-567 ==> 0-119 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 53 reads
cdr3 = CAHRRVSSSWPRIDNW at 369, score = 7 + 7
umis assigned: [33, 385]
of which 2 are surviving nonsolos
reads assigned: 436
start codons at 24, 68, 175, 247, 250, 330, 339, 502
confident = true
now this is a cell
paired!

GTGGACACAGCCACATATTACTGTGCACACAGACGCGTAAGTAGCAGCTGGCCACGAATTGACAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTGAGGACTGAGGACGAGGCTGATTACTACTGTCAGTCTCATGATAGCAGCACTCCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.81 = GGAATAAGTCAAAGCG-1

using 347 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [2]

====================================================================================

UMI info for barcode GGAATAAGTCAAAGCG-1 contig 1 = TGGGGAGGAA...
umi TCCCTTCGAC = 345 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPPFTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 37, 106, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.84 = GGAATAAGTCTAGCCG-1

using 392 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 384]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.89 = GGAATAAGTGATGTCT-1

using 892 reads

====================================================================================

graph has 286 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 884]
surviving nonsolo ucounts = 1[884]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=328]
28-85 ==> 296-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
134-168 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
168-328 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 74, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 872
start codons at 29, 222
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.94 = GGAATAAGTGTCCTCT-1

using 42 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3, 8, 9, 17]
surviving nonsolo ucounts = 1[17]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.102 = GGAATAAGTTCCACTC-1

using 282 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode GGAATAAGTTCCACTC-1 contig 1 = AGCTTCAGCT...
umi AAAAGTGTAC = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=618]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-618 ==> 0-183 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.106 = GGAATAAGTTCTCATT-1

using 1198 reads

====================================================================================

graph has 422 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[172, 319, 338, 366]
surviving nonsolo ucounts = 4[172, 319, 338, 366]
ids = [4, 1, 5, 6]

====================================================================================

UMI info for barcode GGAATAAGTTCTCATT-1 contig 1 = GATCAGGACT...
umi TCCTGCGACA = 336 reads: +397 validated
umi TCCTGCGACG = 367 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 103 reads
cdr3 = CMQGLQSPRTF at 366, score = 9 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 693
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
17-69 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
44-344 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 365, score = 6 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 485
start codons at 44, 249, 471
confident = false
not full
full length stopped transcript of length 565
frameshifted full length stopped transcript of length 565
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.107 = GGAATAAGTTGTGGAG-1

using 2587 reads

====================================================================================

graph has 3541 edges initially, 20 edges after simplification

total ucounts = 1075
nonsolo ucounts = 495[2^179, 3^103, 4^72, 5^43, 6^28, 7^22, 8^10, 9^10, 10^9, 11^5, 12^7, 13, 14, 15, 17^2, 18, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.109 = GGAATAATCACCGGGT-1

using 342 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[13, 327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

UMI info for barcode GGAATAATCACCGGGT-1 contig 1 = GGGCCTCAGG...
umi GCAGTAGGCT = 325 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-375 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
414-625 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQAWDSSTGVVF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.110 = GGAATAATCACGATGT-1

using 431 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^2, 3, 10, 194, 212]
surviving nonsolo ucounts = 2[194, 212]
ids = [7, 2]

====================================================================================

UMI info for barcode GGAATAATCACGATGT-1 contig 1 = AGCTGTGGGC...
umi AAGACAGGGC = 205 reads: +385 validated

UMI info for barcode GGAATAATCACGATGT-1 contig 2 = GGAGTCAGAC...
umi GTTAAAGTAT = 194 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-589 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CNSRDSSGNHRVVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 40, 159, 188, 239, 338
confident = false

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.111 = GGAATAATCACTGGGC-1

using 325 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 12, 305]
surviving nonsolo ucounts = 1[305]
ids = [8]

====================================================================================

UMI info for barcode GGAATAATCACTGGGC-1 contig 1 = GAGTGCTTTC...
umi TTGCCCATGA = 306 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=660]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
427-478 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
478-660 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 48 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 378, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 18, 39, 83, 169
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.113 = GGAATAATCATAAAGG-1

using 242 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [2]

====================================================================================

UMI info for barcode GGAATAATCATAAAGG-1 contig 1 = ACTTTCTGAG...
umi TAAAGCTACA = 233 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=516]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-516 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 35, 79, 159, 229, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.115 = GGAATAATCCAAACTG-1

using 325 reads

====================================================================================

graph has 199 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2, 3^2, 4^2, 8, 11^2, 12, 16, 248]
surviving nonsolo ucounts = 1[248]
ids = [12]

====================================================================================

UMI info for barcode GGAATAATCCAAACTG-1 contig 1 = AGTCTGGGCC...
umi TCATCGCCTA = 237 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=582]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-582 ==> 0-160 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.116 = GGAATAATCCACGAAT-1

using 24 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.120 = GGAATAATCCGTAGGC-1

using 12026 reads

====================================================================================

graph has 6049 edges initially, 74 edges after simplification

total ucounts = 954
nonsolo ucounts = 475[2^157, 3^106, 4^65, 5^37, 6^24, 7^18, 8^13, 9^14, 10^2, 12^2, 13^2, 14, 16^2, 18, 19^2, 20^2, 30, 125, 146, 172, 173, 195, 220, 221, 240, 252, 253, 258, 260, 269, 271, 278, 291, 353, 362, 370, 506, 576, 645, 710, 791, 836, 954]
surviving nonsolo ucounts = 26[125, 146, 172, 173, 195, 220, 221, 240, 252, 253, 258, 260, 269, 271, 278, 291, 353, 362, 370, 506, 576, 645, 710, 791, 836, 954]
ids = [953, 543, 148, 488, 931, 83, 417, 44, 504, 813, ...]

====================================================================================

UMI info for barcode GGAATAATCCGTAGGC-1 contig 1 = AGTCCTGGTG...
umi AACTTTCAGT = 265 reads: +388 validated
umi ACACACCCTC = 151 reads: +14 -1XX +1 -16XX +1 -1XX +3 -6XX +345 invalidated
umi ACAGCTTCTT = 647 reads: -136 +1 -1XX +250 invalidated
umi ACTACTCCCT = 729 reads: -338X +2 -10XX +1 -2XX +3 -1XX +31 invalidated
umi AGGCTGTCAC = 512 reads: -130X +1 -1XX +256 invalidated
umi CCCGTGCTAT = 296 reads: +388 validated
umi CTAGCAACCA = 221 reads: +388 validated
umi GAATTGGTCC = 108 reads: +37 -1X +1 -4X +345 invalidated
umi GAGTGTGTTG = 963 reads: -338X +2 -10XX +1 -2XX +3 -1XX +31 invalidated
umi GATAATGACG = 255 reads: +388 validated
umi GCCTATTCCT = 105 reads: +14 -1 +1 -16XX +1 -1XX +3 -6XX +309 -1 +1 -34 invalidated
umi GCGTTTTTGA = 855 reads: -339X +1 -10XX +1 -2XX +3 -1XX +31 invalidated
umi GTTTCCAGTC = 795 reads: -341 +1 -1X +1 -6XX +1 -2XX +3 -1XX +31 invalidated
umi TATCAGTCAG = 274 reads: +388 validated
umi TCCAAGCTCC = 524 reads: -351X +1 -2XX +1 -4XX +1 -4XX +1 -3XX +1 -10XX +1 -1XX +1 -4XX +2 invalidated
umi TCTATCTTCG = 356 reads: +388 validated
umi TCTGCTCCTA = 258 reads: +388 validated
umi TGGGTTCCTT = 255 reads: +388 validated

UMI info for barcode GGAATAATCCGTAGGC-1 contig 2 = AGCTCTGGGA...
umi AAGCGCTACC = 242 reads: +430 validated
umi ACTTCCTGAC = 173 reads: +430 validated
umi ATAGTGCACC = 357 reads: +430 validated
umi GTGCTCGTCC = 281 reads: +430 validated
umi TTAATTTCTT = 274 reads: +428 -1 +1 non-validated
umi TTTCACTCCG = 196 reads: +430 validated
umi TTTTTAACTA = 114 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=644]
0-45 ==> 41-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
45-398 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 757 reads
cdr3 = CQSYDSSNVVF at 372, score = 6 + 8
umis assigned: [38, 83, 89, 137, 178, 340, 417, 488, 503, 504] and 8 others
of which 18 are surviving nonsolos
reads assigned: 7363
start codons at 45, 108, 199, 250, 382, 394
confident = true

TIG 2[bases=581]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=8)
433-454 ==> 0-21 on |18|IGHD3-10|D-REGION| [len=27] (mis=2)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 104 reads
cdr3 = CARYDYYGSGRAGRRFDYW at 422, score = 9 + 7
umis assigned: [44, 148, 201, 642, 867, 931, 953]
of which 7 are surviving nonsolos
reads assigned: 1602
start codons at 80, 236, 383, 441
confident = true
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGATACGATTACTATGGTTCGGGGAGGGCCGGTCGGAGATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.135 = GGAATAATCTTTAGGG-1

using 28 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.141 = GGACAAGAGAGCTATA-1

using 27 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 22]
surviving nonsolo ucounts = 1[22]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.144 = GGACAAGAGATCGATA-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.150 = GGACAAGAGCGGATCA-1

using 279 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGAGCGGATCA-1 contig 1 = ACCCAAAAAC...
umi ACCAGGAGGT = 2 reads: -86 +30 -1X +11 -1X +14 -1X +4 -1X +2 -1X +9 -1X +33 -1 +1 -239 invalidated
umi CCAATCTCCT = 263 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-537 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0, 2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.159 = GGACAAGAGGTAAACT-1

using 650 reads

====================================================================================

graph has 258 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3, 4, 279, 354]
surviving nonsolo ucounts = 2[279, 354]
ids = [12, 0]

====================================================================================

UMI info for barcode GGACAAGAGGTAAACT-1 contig 1 = AGGAGTCAGT...
umi AAAAGGACCT = 352 reads: +388 validated

UMI info for barcode GGACAAGAGGTAAACT-1 contig 2 = AGAAGCAGAG...
umi TTTCGTACGG = 282 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYTTLLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=621]
0-28 ==> 12-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-365 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
410-621 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CNSRDSSGNHVVF at 343, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 28, 147, 176, 227, 326, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.167 = GGACAAGCAAACCCAT-1

using 519 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[518]
surviving nonsolo ucounts = 1[518]
ids = [1]

====================================================================================

UMI info for barcode GGACAAGCAAACCCAT-1 contig 1 = AGTGCTGGGG...
umi GAATAGGCCG = 515 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=640]
0-44 ==> 118-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
44-384 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
401-429 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 70 reads
cdr3 = CFSYGTSGRTF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 509
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.171 = GGACAAGCAAGCCGTC-1

using 310 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 302]
surviving nonsolo ucounts = 1[302]
ids = [3]

====================================================================================

UMI info for barcode GGACAAGCAAGCCGTC-1 contig 1 = GGGGATCAGT...
umi GTTGTTCTTA = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.173 = GGACAAGCAAGTCTGT-1

using 938 reads

====================================================================================

graph has 318 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 290, 644]
surviving nonsolo ucounts = 2[290, 644]
ids = [0, 1]

====================================================================================

UMI info for barcode GGACAAGCAAGTCTGT-1 contig 1 = ATCAGTCCCA...
umi AAATTCAGTG = 293 reads: +388 validated
umi AGCTTTACAT = 640 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 175 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 918
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.185 = GGACAAGCAGACGTAG-1

using 325 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[5^3, 6, 11, 285]
surviving nonsolo ucounts = 1[285]
ids = [10]

====================================================================================

UMI info for barcode GGACAAGCAGACGTAG-1 contig 1 = ACCCAAAAAC...
umi GCTGCACGCG = 274 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=578]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-578 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.208 = GGACAAGCATGTTGAC-1

using 1902 reads

====================================================================================

graph has 2394 edges initially, 14 edges after simplification

total ucounts = 746
nonsolo ucounts = 306[2^111, 3^73, 4^44, 5^30, 6^18, 7^10, 8^3, 9^3, 10^3, 11, 12^2, 13^3, 14^2, 15, 25, 294]
surviving nonsolo ucounts = 1[294]
ids = [153]

====================================================================================

UMI info for barcode GGACAAGCATGTTGAC-1 contig 1 = GAGGAACTGC...
umi AGTCACTCGA = 298 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=16)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYTDGPRMTF at 354, score = 9 + 8
umis assigned: [153]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 33, 102, 175, 238, 241, 370, 381, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.209 = GGACAAGCATTACCTT-1

using 12801 reads

====================================================================================

graph has 4976 edges initially, 64 edges after simplification

total ucounts = 640
nonsolo ucounts = 291[2^97, 3^50, 4^32, 5^23, 6^14, 7^9, 8^9, 9^3, 10^4, 11, 12, 15, 44, 61, 76, 77, 79, 81, 84, 99, 118, 148, 177, 179, 186, 189, 201, 215^2, 226, 236, 239, 259, 265, 267, 272, 276^3, 278, 281, 286, 292, 294^2, 295, 305, 310, 314, 316, 318, 320, 331, 342, 362, 370, 377, 385, 650]
surviving nonsolo ucounts = 37[76, 77, 179, 186, 189, 201, 215^2, 226, 239, 259, 265, 267, 272, 276^3, 278, 281, 286, 292, 294^2, 295, 305, 310, 314, 316, 318, 320, 331, 342, 362, 370, 377, 385, 650]
ids = [127, 458, 359, 358, 335, 22, 14, 371, 386, 446, ...]

====================================================================================

UMI info for barcode GGACAAGCATTACCTT-1 contig 1 = ACCCAAAAAC...
umi AACTAATCCG = 208 reads: +436 validated
umi TGGGCATGAG = 246 reads: +436 validated

UMI info for barcode GGACAAGCATTACCTT-1 contig 2 = TGGGGGATCA...
umi AACTGGACTA = 278 reads: +397 validated
umi ACGATCTCGC = 314 reads: +397 validated
umi ATGTATAGCT = 315 reads: +397 validated
umi ATTTCAGCAA = 291 reads: +397 validated
umi CCCTTGAGCG = 385 reads: +397 validated
umi CCTCGCTCGT = 268 reads: +397 validated
umi CTACCTATTC = 277 reads: +397 validated
umi CTTTGGGCTT = 315 reads: +397 validated
umi GAGGCCTTGC = 183 reads: +397 validated
umi GCAGGGACGT = 363 reads: +397 validated
umi GCATTGACCG = 188 reads: +397 validated
umi GCCAATGGTT = 180 reads: +397 validated
umi GCGTGCGTGC = 216 reads: +397 validated
umi GGCCGGTAGG = 316 reads: +397 validated
umi GGCTCTCATC = 227 reads: +397 validated
umi GTGGAGCTAG = 336 reads: +397 validated
umi GTTACACCAT = 292 reads: +397 validated
umi GTTTAGGCAT = 241 reads: +397 validated
umi TAAGCATGGG = 277 reads: +397 validated
umi TAATAACGGG = 83 reads: +264 -1XX +78 -1 +4 -7 +42 invalidated
umi TCATTTTAGG = 6 reads: -334 +4 -2X +1 -1XX +2 -3XX +1 -7XX +1 -1XX +11 -1XX +28 invalidated
umi TCCTTATGGC = 1 reads: -397 non-validated
umi TCGCGCAGCA = 3 reads: -327X +3 -1X +1 -2X +1 -3XX +2 -4XX +2 -2XX +2 -3XX +1 -5XX +33 -5 invalidated
umi TCTATCTATA = 297 reads: +397 validated
umi TCTGTGGGGC = 277 reads: +397 validated
umi TGCAGGTTCC = 265 reads: +397 validated
umi TTGCCTTTAC = 289 reads: +397 validated
umi TTGGATTGGT = 368 reads: +397 validated
umi TTGTTTCCCT = 273 reads: +397 validated
umi TTTACATCGC = 300 reads: +397 validated
umi TTTTCGTCGG = 342 reads: +397 validated

UMI info for barcode GGACAAGCATTACCTT-1 contig 3 = ATACTTTCTG...
umi CGATGAGGCC = 277 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=524]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-524 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 35 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [14, 560]
of which 2 are surviving nonsolos
reads assigned: 448
start codons at 54, 252, 257, 274, 318, 351
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 27 umis using 1129 reads
cdr3 = CMQALQTPWTF at 371, score = 9 + 8
umis assigned: [17, 52, 118, 133, 216, 230, 273, 317, 335, 351] and 21 others
of which 29 are surviving nonsolos
reads assigned: 7642
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true

TIG 3[bases=502]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
398-461 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
461-502 ==> 0-41 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDTGQYRYYYYGMDVW at 376, score = 9 + 7
umis assigned: [247]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 37, 81, 418, 479
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.211 = GGACAAGGTAAATGAC-1

using 296 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGGTAAATGAC-1 contig 1 = AGCTGTGGGC...
umi GTAAATTTGA = 267 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=483]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=1)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=16)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=7)
422-483 ==> 0-61 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CNSRDSTGYQRVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 40, 159, 188, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.213 = GGACAAGGTAACGACG-1

using 342 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 338]
surviving nonsolo ucounts = 1[338]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGGTAACGACG-1 contig 1 = GGAGTCAGAC...
umi TCAATATTGA = 335 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=541]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
374-405 ==> 6-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNSYF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 32, 88, 101, 333, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.216 = GGACAAGGTAGCGATG-1

using 526 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 5, 516]
surviving nonsolo ucounts = 1[516]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.217 = GGACAAGGTATCAGTC-1

using 235 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 228]
surviving nonsolo ucounts = 1[228]
ids = [1]

====================================================================================

UMI info for barcode GGACAAGGTATCAGTC-1 contig 1 = CAAAAACCAC...
umi GGACGGCAGT = 217 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=553]
0-51 ==> 8-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
51-404 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
453-487 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
487-553 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 393, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 51, 249, 254, 271, 315, 348, 541
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.218 = GGACAAGGTCAACATC-1

using 230 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode GGACAAGGTCAACATC-1 contig 1 = GGGAGAGGAG...
umi TTATGTGCTT = 220 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=522]
0-74 ==> 6-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
74-429 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=26)
425-445 ==> 0-20 on |10|IGHD1-26|D-REGION| [len=20] (mis=3)
446-495 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
495-522 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAKDILGATTYGMDVW at 416, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 74, 219, 225, 230, 309, 377, 452, 513
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.222 = GGACAAGGTGAAATCA-1

using 200 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGGTGAAATCA-1 contig 1 = GAGCTCTGGG...
umi GAATTAACCT = 197 reads: +434 -1 +6 -2 +2 non-validated

GOOD CONTIGS

TIG 1[bases=539]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=14)
479-525 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 1 umis using 14 reads
cdr3 = CARDAPYMIGGGTAQWVPMGMDVW at 422, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 80, 231, 236, 294, 297, 306, 383, 432, 443, 466, 476, 482, 506
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.228 = GGACAAGGTGTTCTTT-1

using 393 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[393]
surviving nonsolo ucounts = 1[393]
ids = [0]

====================================================================================

UMI info for barcode GGACAAGGTGTTCTTT-1 contig 1 = GGGGAGGAAC...
umi TAGCCACTCC = 395 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 390
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.230 = GGACAAGGTTCAGCGC-1

using 749 reads

====================================================================================

graph has 224 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 7, 737]
surviving nonsolo ucounts = 1[737]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=304]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-26 ==> 5711-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
25-74 ==> 0-49 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
76-132 ==> 292-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6) [SHIFT!]
130-168 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
168-304 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 724
start codons at 25, 118, 210
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.233 = GGACAAGGTTCGTCTC-1

using 285 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 5, 270]
surviving nonsolo ucounts = 1[270]
ids = [4]

====================================================================================

UMI info for barcode GGACAAGGTTCGTCTC-1 contig 1 = CCACATCCCT...
umi CGCCAATGCT = 238 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=480]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=0)
394-422 ==> 0-28 on |19|IGHD3-16|D-REGION| [len=37] (mis=5)
427-478 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDEVITFGGVITYNWFDPW at 384, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 42, 193, 198, 240, 245, 262, 339, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.241 = GGACAAGTCAATCTCT-1

using 690 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[689]
surviving nonsolo ucounts = 1[689]
ids = [1]

====================================================================================

UMI info for barcode GGACAAGTCAATCTCT-1 contig 1 = GTCAGTCTCA...
umi TCTGAACCCC = 692 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 119 reads
cdr3 = CQQSYSTPQTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 680
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.242 = GGACAAGTCACTCCTG-1

using 303 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode GGACAAGTCACTCCTG-1 contig 1 = GGGAGTCTCA...
umi TTACGCACAC = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPVAF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.243 = GGACAAGTCACTGGGC-1

using 23794 reads

====================================================================================

graph has 8090 edges initially, 58 edges after simplification

total ucounts = 995
nonsolo ucounts = 448[2^153, 3^93, 4^46, 5^22, 6^24, 7^8, 8^6, 9^3, 10, 11^3, 12, 13, 14^2, 18, 33, 34, 54^2, 56, 60, 75, 99, 102, 120, 121, 149, 158, 176, 178, 183, 187, 188, 189, 198, 207, 209, 210, 211, 212, 213, 220, 225, 229, 231, 244, 247, 250, 252, 255, 256^2, 259, 264, 265, 275, 279, 281, 285^2, 287, 289^2, 298, 301, 304, 305, 306, 310, 311, 312, 315, 320, 322^2, 323, 324^3, 327, 328, 335, 346^3, 349, 358^2, 373, 377, 379, 388, 389, 395, 399, 414, 419, 460, 473]
surviving nonsolo ucounts = 77[54^2, 56, 102, 120, 121, 149, 176, 178, 183, 187, 188, 189, 198, 207, 209, 210, 211, 212, 213, 220, 225, 229, 231, 244, 247, 250, 252, 255, 256^2, 259, 264, 265, 275, 279, 281, 285^2, 287, 289^2, 301, 304, 305, 306, 310, 311, 312, 315, 320, 322^2, 323, 324^3, 327, 328, 335, 346^3, 349, 358^2, 373, 377, 379, 388, 389, 395, 399, 414, 419, 460, 473]
ids = [434, 708, 19, 557, 719, 438, 261, 66, 898, 847, ...]

====================================================================================

UMI info for barcode GGACAAGTCACTGGGC-1 contig 1 = GGGGAGGAGT...
umi AATTAAGATC = 243 reads: +394 validated
umi ACACTGGCTT = 325 reads: +394 validated
umi ACCAAGGGGT = 251 reads: +394 validated
umi ACCCTTTCCC = 325 reads: +394 validated
umi ACCTATAGGG = 444 reads: +144 -7XX +2 -1XX +1 -3XX +1 -2XX +2 -1XX +1 -1XX +1 -2XX +1 -35X +2 -12XX +2 -5XX +2 -1XX +165 invalidated
umi ACGGCACATG = 318 reads: +394 validated
umi AGCACATCGG = 310 reads: +394 validated
umi AGCTAGGGTC = 301 reads: +394 validated
umi AGGCCATGTA = 356 reads: +394 validated
umi AGTCTGGGTT = 291 reads: +394 validated
umi ATAACCCTTG = 375 reads: +394 validated
umi ATCCCTTCGT = 318 reads: +394 validated
umi ATGATAGCCT = 324 reads: +394 validated
umi ATTCCCCTCG = 420 reads: +194 -1XX +199 invalidated
umi CACGCCAACT = 212 reads: +394 validated
umi CAGTTACTCT = 221 reads: +394 validated
umi CCATACTCCC = 351 reads: +394 validated
umi CCCATCAGCA = 306 reads: +394 validated
umi CCGCTGTCCA = 304 reads: +394 validated
umi CGGTCATGTC = 287 reads: +394 validated
umi CTATGGTCCC = 347 reads: +394 validated
umi CTCCCTCTTC = 391 reads: +394 validated
umi CTTCATGTAT = 406 reads: +55 -6XX +1 -3XX +2 -10XX +2 -1XX +1 -17X +1 -3XX +2 -12XX +278 invalidated
umi GAACACTCGC = 211 reads: +394 validated
umi GAACGCGTCT = 289 reads: +394 validated
umi GAAGAATAGC = 255 reads: +394 validated
umi GAAGCATAAT = 422 reads: +394 validated
umi GACGAACCCT = 324 reads: +394 validated
umi GAGAGCATAT = 227 reads: +394 validated
umi GATGAATCAC = 260 reads: +394 validated
umi GATTACCGTT = 103 reads: +394 validated
umi GCACAAGTAT = 385 reads: +394 validated
umi GGCCCATCCG = 258 reads: +394 validated
umi GGTAGAGTAA = 288 reads: +394 validated
umi GTACCTCTCG = 321 reads: +394 validated
umi GTAGGGGGTA = 207 reads: +394 validated
umi GTATTGTGGG = 378 reads: +394 validated
umi GTCGCCTTAC = 199 reads: +394 validated
umi GTGACGTGCC = 325 reads: +394 validated
umi TAAGCATCTT = 346 reads: -363 +6 -3XX +14 -1XX +2 -1XX +4 invalidated
umi TACCAATTAG = 348 reads: +394 validated
umi TACTGTACTA = 122 reads: +394 validated
umi TACTGTTATA = 229 reads: +394 validated
umi TCCACTTCTA = 290 reads: +394 validated
umi TCCTACACGT = 435 reads: -361X +1 -1XX +6 -3XX +14 -1XX +2 -1XX +4 invalidated
umi TCTATATTTG = 306 reads: +394 validated
umi TGAGCCGGGG = 377 reads: +394 validated
umi TGCACACCCC = 350 reads: +394 validated
umi TGGTTAATTA = 289 reads: +394 validated
umi TGTTTATCGA = 179 reads: +394 validated
umi TTATAAACGT = 312 reads: +394 validated
umi TTGTTCTCAA = 328 reads: +394 validated
umi TTTACAGGAA = 207 reads: +394 validated
umi TTTCTACGCT = 190 reads: +394 validated

UMI info for barcode GGACAAGTCACTGGGC-1 contig 2 = GAGGAGCCCC...
umi AAATGTTCGC = 238 reads: +424 validated
umi AACATATTTG = 52 reads: +424 validated
umi AATTGCGGCA = 177 reads: +424 validated
umi AATTTATCAA = 267 reads: +424 validated
umi ACAACTTGTA = 213 reads: +424 validated
umi AGCACCATCC = 241 reads: +424 validated
umi AGGATAATGG = 190 reads: +419 -5 non-validated
umi AGTAACAGGC = 185 reads: +424 validated
umi ATTATCAATG = 137 reads: +424 validated
umi ATTCTATTCC = 197 reads: +424 validated
umi ATTGTTGGTT = 261 reads: +424 validated
umi CCGCCGCTAA = 234 reads: +406 -18 non-validated
umi CGGTCGCCCG = 321 reads: +424 validated
umi CGTCCTTCCT = 55 reads: +301 -4 +119 non-validated
umi CGTTCTTCCA = 121 reads: +420 -4 non-validated
umi CTCACACTGG = 274 reads: +424 validated
umi GACCGTGTCA = 262 reads: +424 validated
umi GTGTTTGGCT = 280 reads: +424 validated
umi TACCCTGGCT = 54 reads: +413 -11 non-validated
umi TGATAACGAA = 176 reads: +355 -1X +2 -2X +3 -2X +42 -1 +1 -1 +1 -1 +1 -1 +8 -2 invalidated
umi TGCCATTGGG = 340 reads: +424 validated
umi TTTACGTCGG = 229 reads: +406 -1 +1 -16 non-validated

GOOD CONTIGS

TIG 1[bases=561]
31-84 ==> 0-53 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
90-390 ==> 53-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 52 umis using 2428 reads
cdr3 = CQQSYSTPLAF at 364, score = 9 + 8
umis assigned: [64, 76, 88, 99, 102, 116, 159, 170, 175, 196] and 44 others
of which 54 are surviving nonsolos
reads assigned: 15886
start codons at 31, 37, 99, 112, 467
confident = true
see insertion of AGTCTC at pos 53 on |253|IGKV1D-39|L-REGION+V-REGION|

TIG 2[bases=565]
0-70 ==> 166-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
70-423 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=12)
444-494 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 255 reads
cdr3 = CARDPDFGRDNDVFDFW at 412, score = 9 + 7
umis assigned: [13, 19, 66, 67, 71, 160, 173, 190, 261, 268] and 12 others
of which 22 are surviving nonsolos
reads assigned: 4405
start codons at 70, 226, 287, 373, 446, 475
confident = true

REJECT CONTIGS

TIG 1[bases=471]
1-351 ==> 2-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=5)
349-400 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
400-471 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [600]
of which 1 are surviving nonsolos
reads assigned: 467
start codons at 122, 170, 242, 344
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTGTATATTACTGTGCAAGAGATCCGGACTTCGGGAGAGACAACGATGTCTTTGATTTCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCTCGCTTTCGGCGGCGGGACCAAGGTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.255 = GGACAAGTCGCCGTGA-1

using 285 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGTCGCCGTGA-1 contig 1 = GGAGTCAGAC...
umi CTTCTTTATA = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYSTYSGTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.263 = GGACAAGTCTCAAGTG-1

using 76 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[73]
surviving nonsolo ucounts = 1[73]
ids = [2]

====================================================================================

UMI info for barcode GGACAAGTCTCAAGTG-1 contig 1 = ACTCAGGACA...
umi TACTACATCA = 70 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=431]
0-19 ==> 32-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
19-375 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CQSYDSSLSGLYVF at 343, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 70
start codons at 19, 173, 176, 227, 326, 353, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.271 = GGACAGAAGAAGGACA-1

using 22180 reads

====================================================================================

graph has 10125 edges initially, 116 edges after simplification

total ucounts = 1582
nonsolo ucounts = 718[2^244, 3^162, 4^87, 5^68, 6^37, 7^23, 8^14, 9^14, 10^4, 11^4, 12^6, 14, 15^3, 120, 124, 127, 131, 137, 158, 161, 165, 172, 203, 205, 212^2, 217, 219, 233, 235, 240, 260^2, 269, 288, 290, 292, 310^2, 316^2, 321, 325, 327, 333, 334, 344, 347, 352, 379^2, 386, 392, 527, 563, 569, 640, 648, 757, 785, 842, 895, 1042, 1148]
surviving nonsolo ucounts = 50[120, 124, 131, 137, 158, 161, 165, 172, 203, 205, 212^2, 217, 219, 233, 235, 240, 260^2, 269, 288, 290, 292, 310^2, 316^2, 321, 325, 327, 333, 334, 344, 347, 352, 379^2, 386, 392, 527, 563, 569, 640, 648, 757, 785, 842, 895, 1042, 1148]
ids = [1079, 9, 427, 1324, 317, 21, 183, 1057, 186, 751, ...]

====================================================================================

UMI info for barcode GGACAGAAGAAGGACA-1 contig 1 = AGCTCTGGGA...
umi AAATACGCTA = 162 reads: +415 validated
umi ACCGTAATTA = 312 reads: +415 validated
umi ACTCCTATAT = 161 reads: +415 validated
umi ATATCGCTCT = 160 reads: +415 validated
umi ATCGCACTAC = 235 reads: +415 validated
umi ATTAACCCGA = 561 reads: -385X +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi CTAGTAGACT = 494 reads: -377 +1 -7X +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi CTTGGCTTAG = 1536 reads: -377X +1 -7XX +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GACGCCGCTC = 583 reads: -385X +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GAGCGAAGGG = 506 reads: -385X +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi GGACAATATA = 731 reads: -380 +7 -1XX +1 -1XX +2 -1XX +3 -2XX +15 -1XX +1 invalidated
umi TAAGCAACAT = 218 reads: +415 validated
umi TCATTGCACT = 1580 reads: -385X +2 -3XX +1 -4XX +2 -6XX +1 -1XX +1 -1XX +2 -3XX +3 invalidated
umi TCTTCCGGCA = 272 reads: +415 validated
umi TTACTCCTCA = 293 reads: +415 validated

UMI info for barcode GGACAGAAGAAGGACA-1 contig 2 = AGGAGTCAGA...
umi AAACTGGGCT = 125 reads: +388 validated
umi ACCCAGGCAG = 692 reads: -352 +1 -3XX +1 -1XX +2 -1XX +1 -4XX +1 -2XX +1 -1XX +4 -1XX +1 -2XX +2 -7XX invalidated
umi ACTCTTAACG = 198 reads: +388 validated
umi AGAAACCGGC = 588 reads: +55 -3XX +1 -1XX +328 invalidated
umi AGGAATCAGA = 314 reads: +347 -9XX +3 -1 +28 invalidated
umi CAAGCGCCTC = 330 reads: +388 validated
umi CAATGCTTGC = 133 reads: +388 validated
umi CACACAACGG = 306 reads: +388 validated
umi CACCTAGCTC = 8 reads: -354X +2 -1X +2 -1XX +5 -1XX +9 -1XX +4 -1XX +1 -1XX +5 invalidated
umi CACTATGGGG = 347 reads: +388 validated
umi CATGATCGTT = 331 reads: +388 validated
umi CCCAAGACAT = 376 reads: +388 validated
umi CCCAATTACC = 321 reads: +388 validated
umi CCGAAAGCCG = 322 reads: +388 validated
umi CCGGACGGAA = 641 reads: +388 validated
umi CCTTCAACTG = 232 reads: +388 validated
umi CGCCCGGGCA = 291 reads: +388 validated
umi CTACATCATT = 342 reads: +388 validated
umi CTATGGGGGT = 198 reads: -358 +1 -1X +3 -3XX +9 -1XX +6 -1XX +5 invalidated
umi CTTAAGGGCG = 223 reads: +388 validated
umi GAAACATCAC = 350 reads: +388 validated
umi GACTTTTACC = 232 reads: -354X +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +1 -1XX +5 invalidated
umi GCCTTGTCTA = 214 reads: +388 validated
umi GGATCACACT = 257 reads: +388 validated
umi GTAAAATCCA = 175 reads: +388 validated
umi GTAGACACCG = 789 reads: -350X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +1 -1XX +5 invalidated
umi GTCATCTTAG = 121 reads: +388 validated
umi TAGATTCCGT = 289 reads: +388 validated
umi TATATACAGC = 259 reads: +388 validated
umi TCGTGTAACC = 132 reads: -388 non-validated
umi TGAAAGTGGT = 340 reads: +388 validated
umi TTTTCTCTGT = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=654]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=25)
432-448 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
494-654 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 8 umis using 219 reads
cdr3 = CARGADYGDYSRVYW at 418, score = 9 + 7
umis assigned: [21, 139, 183, 317, 344, 375, 739, 842, 882, 899] and 5 others
of which 15 are surviving nonsolos
reads assigned: 5901
start codons at 79, 235, 296, 299, 379, 385, 548
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-362 ==> 0-335 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 1277 reads
cdr3 = CQHYNDFLYTF at 354, score = 8 + 7
umis assigned: [9, 129, 186, 206, 255, 420, 427, 439, 454, 459] and 22 others
of which 32 are surviving nonsolos
reads assigned: 9607
start codons at 27, 33, 89, 102, 238, 241, 334, 367, 457
confident = true
now this is a cell
paired!

CCTGAGGACACGGCTGTCTATTACTGTGCGAGAGGCGCCGACTACGGTGACTACTCACGTGTCTACTGGGGCCAGGGAACCCAGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCGGATGATCTTGCAACCTATTACTGCCAACACTACAATGATTTTCTGTACACTTTTGGCCAGGGGACCAAGCTGGAGAGCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.274 = GGACAGAAGAGCTATA-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.278 = GGACAGAAGATCGGGT-1

using 6089 reads

====================================================================================

graph has 2506 edges initially, 8 edges after simplification

total ucounts = 380
nonsolo ucounts = 164[2^56, 3^33, 4^18, 5^9, 6^12, 7^5, 8^4, 9^3, 10^2, 11, 13, 18, 48, 104, 166, 187, 238, 243, 273, 281, 282, 288, 298, 310, 315, 323, 325, 337, 347, 405, 546]
surviving nonsolo ucounts = 18[104, 166, 187, 238, 243, 273, 281, 282, 288, 298, 310, 315, 323, 325, 337, 347, 405, 546]
ids = [54, 138, 370, 45, 341, 249, 109, 274, 226, 324, ...]

====================================================================================

UMI info for barcode GGACAGAAGATCGGGT-1 contig 1 = GGGAGAGCCC...
umi ACTCGCAAGC = 240 reads: +382 validated
umi AGAAACTCGG = 339 reads: +382 validated
umi AGATACGCGT = 106 reads: +382 validated
umi CACATAAGCA = 284 reads: +382 validated
umi CCCAGCTGCG = 166 reads: +382 validated
umi CGTAATCCTT = 325 reads: +382 validated
umi GATAGAGCAG = 329 reads: +382 validated
umi GCCATCATCC = 402 reads: +382 validated
umi GCGATTGCTT = 288 reads: +382 validated
umi GGTTTCCCAT = 268 reads: +382 validated
umi GTCCAACCAA = 547 reads: -173 +209 non-validated
umi TAATTATACT = 349 reads: +382 validated
umi TAATTATTCA = 280 reads: +382 validated
umi TCGGGCTATG = 296 reads: +382 validated
umi TGGGTCCTTG = 311 reads: +382 validated
umi TGTAAGATTC = 245 reads: +382 validated
umi TTGTAGCGAA = 191 reads: +382 validated
umi TTTCATTGCC = 315 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 888 reads
cdr3 = CHQRSHWPRSF at 368, score = 9 + 7
umis assigned: [45, 48, 54, 109, 138, 168, 210, 220, 226, 249] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5205
start codons at 47, 252, 255, 471
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.292 = GGACAGAAGGAGTTTA-1

using 317 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 309]
surviving nonsolo ucounts = 1[309]
ids = [4]

====================================================================================

UMI info for barcode GGACAGAAGGAGTTTA-1 contig 1 = GGGGAGTCAG...
umi CCTCATAATT = 303 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSTITF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.293 = GGACAGAAGGATATAC-1

using 849 reads

====================================================================================

graph has 362 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[338, 508]
surviving nonsolo ucounts = 2[338, 508]
ids = [0, 1]

====================================================================================

UMI info for barcode GGACAGAAGGATATAC-1 contig 1 = GGAACTGCTC...
umi AAGGAACGTC = 343 reads: +379 validated
umi AAGTAATAAC = 510 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=546]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=3)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 125 reads
cdr3 = CQQYNNWWTF at 352, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 834
start codons at 31, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.297 = GGACAGAAGGGCACTA-1

using 410 reads

====================================================================================

graph has 100 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[115, 292]
surviving nonsolo ucounts = 2[115, 292]
ids = [3, 4]

====================================================================================

UMI info for barcode GGACAGAAGGGCACTA-1 contig 1 = CGCTCTCGGG...
umi TACACTCTTA = 113 reads: +388 validated

UMI info for barcode GGACAGAAGGGCACTA-1 contig 2 = GGGCCTCAGG...
umi TCGTTCCAGG = 289 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=558]
21-372 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
371-409 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
409-558 ==> 0-149 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSTYVF at 345, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 21, 178, 222, 229, 232, 373, 541
confident = false

TIG 2[bases=560]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
373-411 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
411-560 ==> 0-149 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQAWDSSTVVF at 350, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 35, 40, 96, 183, 329, 333, 543
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.299 = GGACAGAAGGTGACCA-1

using 101 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 94]
surviving nonsolo ucounts = 1[94]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.302 = GGACAGAAGGTGTGGT-1

using 849 reads

====================================================================================

graph has 362 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[206, 243, 394]
surviving nonsolo ucounts = 3[206, 243, 394]
ids = [8, 5, 3]

====================================================================================

UMI info for barcode GGACAGAAGGTGTGGT-1 contig 1 = AAAAACCACA...
umi TTCGGCTATT = 195 reads: +436 validated

UMI info for barcode GGACAGAAGGTGTGGT-1 contig 2 = GGAGTCTCCC...
umi GGCCCAGGAG = 223 reads: +421 validated

UMI info for barcode GGACAGAAGGTGTGGT-1 contig 3 = CAGGTGTTTC...
umi GCGGCCATGG = 399 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=563]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-563 ==> 0-77 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false

TIG 2[bases=501]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
443-480 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
480-501 ==> 0-21 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARHENYGSGSYYPYW at 401, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 59, 233, 257, 392, 411, 420
confident = false

TIG 3[bases=542]
0-37 ==> 34-71 on |139|IGHV3-43|5'UTR| [len=80] (mis=0)
44-399 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=10)
421-471 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDRVSYGDYTYGMGVW at 386, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 390
start codons at 44, 80, 189, 200, 261, 264, 279, 347, 428
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.303 = GGACAGAAGGTTCCTA-1

using 324 reads

====================================================================================

graph has 158 edges initially, 10 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 7, 305]
surviving nonsolo ucounts = 1[305]
ids = [1]

====================================================================================

UMI info for barcode GGACAGAAGGTTCCTA-1 contig 1 = AGGAGTCAGT...
umi ACTCCACTGC = 308 reads: +391 validated
umi TCCCTGCTGA = 5 reads: -35 +13 -1X +2 -1X +10 -2X +27 -58 +5 -2X +1 -3X +5 -3XX +4 -1XX +29 -1XX +9 -1XX +1 -1XX +8 -1X +4 -6 +20 -1X +2 -1X +17 -1X +2 -1X +1 -1X +1 -1X +4 -1X +2 -101 invalidated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDNLPRGTF at 354, score = 9 + 8
umis assigned: [1, 9]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 27, 33, 89, 102, 241, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.307 = GGACAGAAGTGCGTGA-1

using 31 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 1[28]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.313 = GGACAGACAACAACCT-1

using 639 reads

====================================================================================

graph has 275 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 127, 238, 271]
surviving nonsolo ucounts = 3[127, 238, 271]
ids = [4, 1, 0]

====================================================================================

UMI info for barcode GGACAGACAACAACCT-1 contig 1 = AGCTTCAGCT...
umi TTAAAATCGG = 125 reads: +388 validated

UMI info for barcode GGACAGACAACAACCT-1 contig 2 = GAGAGAGGAG...
umi CTAATGTGCG = 238 reads: +424 validated

UMI info for barcode GGACAGACAACAACCT-1 contig 3 = TGGGGCTTTC...
umi CAGAGTGACT = 257 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=482]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-482 ==> 0-47 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=607]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-607 ==> 0-110 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 73, 224, 229, 376, 454
confident = false

TIG 3[bases=518]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-518 ==> 0-64 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.314 = GGACAGACAACTGGCC-1

using 328 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 6, 319]
surviving nonsolo ucounts = 1[319]
ids = [3]

====================================================================================

UMI info for barcode GGACAGACAACTGGCC-1 contig 1 = TGAGCGCAGA...
umi GGTAGTGCCC = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-590 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.317 = GGACAGACAATGTAAG-1

using 556 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 176, 376]
surviving nonsolo ucounts = 2[176, 376]
ids = [0, 3]

====================================================================================

UMI info for barcode GGACAGACAATGTAAG-1 contig 1 = GCTGCGGGTA...
umi CCATGTGTGC = 170 reads: +388 validated

UMI info for barcode GGACAGACAATGTAAG-1 contig 2 = GGGGAGGAAC...
umi TGCTGCGTCA = 373 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=580]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-580 ==> 0-152 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=18)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYYNWPPYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 367
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.318 = GGACAGACAATTCCTT-1

using 329 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 322]
surviving nonsolo ucounts = 1[322]
ids = [4]

====================================================================================

UMI info for barcode GGACAGACAATTCCTT-1 contig 1 = GCTTCAGCTG...
umi TTTGTGCCTC = 320 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
440-556 ==> 0-116 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 46, 200, 203, 254, 353, 380, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.323 = GGACAGACACCTCGTT-1

using 331 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [1]

====================================================================================

UMI info for barcode GGACAGACACCTCGTT-1 contig 1 = AGGAGTCAGA...
umi CGATCAGCCG = 312 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
412-508 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYKRSSTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 27, 33, 102, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.333 = GGACAGACAGCTGTGC-1

using 135 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 4, 9, 114]
surviving nonsolo ucounts = 1[114]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.335 = GGACAGACAGTCAGCC-1

using 544 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 6, 32, 503]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.337 = GGACAGACATACAGCT-1

using 15327 reads

====================================================================================

graph has 7109 edges initially, 48 edges after simplification

total ucounts = 1162
nonsolo ucounts = 559[2^227, 3^120, 4^62, 5^38, 6^23, 7^15, 8^10, 9^5, 10^2, 11^3, 12^2, 13, 14^2, 15^2, 16, 17, 18, 42, 107, 117, 137, 142, 149, 153, 164, 191, 228, 237, 238, 239, 251, 252, 254, 255, 257, 260, 270, 280, 289, 291, 293, 294, 297, 301, 310, 312, 313, 320, 322, 328, 332, 333, 337, 346, 359, 371, 422, 482, 513, 529, 988]
surviving nonsolo ucounts = 43[15, 117, 137, 142, 149, 153, 164, 191, 228, 237, 238, 239, 251, 252, 254, 255, 257, 260, 270, 280, 289, 291, 293, 294, 297, 301, 310, 312, 313, 320, 322, 328, 332, 333, 337, 346, 359, 371, 422, 482, 513, 529, 988]
ids = [1128, 343, 370, 694, 173, 170, 1092, 140, 877, 849, ...]

====================================================================================

UMI info for barcode GGACAGACATACAGCT-1 contig 1 = CTCTCTCAGT...
umi AAAGCTAGAC = 294 reads: +388 validated
umi AACCTTCAAA = 255 reads: +388 validated
umi AACGGGCCGG = 258 reads: +388 validated
umi AACTAACTTG = 319 reads: +388 validated
umi ACAAGTATTG = 299 reads: +388 validated
umi ACCAGCCCAC = 260 reads: +388 validated
umi ACCGGCGCAG = 329 reads: +388 validated
umi ACCTATACAA = 508 reads: +388 validated
umi ACCTCAACGG = 287 reads: +388 validated
umi ACGTTTTTGT = 190 reads: +388 validated
umi ACTGTTTTTG = 307 reads: +388 validated
umi AGAGCTTCGC = 155 reads: +388 validated
umi AGATTGTACG = 153 reads: +388 validated
umi AGCCGTTTAG = 343 reads: +388 validated
umi AGGCAATTGG = 298 reads: +388 validated
umi ATTCATTCTC = 288 reads: +388 validated
umi CACTTCTATC = 119 reads: +388 validated
umi CATCTGATGG = 360 reads: +388 validated
umi CATTGTGTCT = 245 reads: +388 validated
umi CCCCGGCGTA = 331 reads: +388 validated
umi CCGCAAAGCA = 338 reads: +388 validated
umi CGAACACGGC = 328 reads: +388 validated
umi CGTCTTCGGT = 363 reads: +388 validated
umi CTCGAACTGG = 285 reads: +388 validated
umi CTGTCGGGTT = 278 reads: +388 validated
umi GCGACGAAGA = 143 reads: +388 validated
umi GGTTAGACAC = 317 reads: +388 validated
umi GTCCAAGCAT = 416 reads: +388 validated
umi TCAAGTGGTG = 232 reads: +388 validated
umi TCAATACAGT = 302 reads: +388 validated
umi TCTGGTCCGC = 244 reads: +388 validated
umi TGTCAAAAGG = 331 reads: +388 validated
umi TGTCGACTAC = 523 reads: -288X +100 invalidated
umi TTCTAAATAC = 248 reads: +388 validated

UMI info for barcode GGACAGACATACAGCT-1 contig 2 = ACATGGGAAG...
umi CAATTCTAGT = 271 reads: +454 validated
umi CATATCCAAA = 135 reads: +454 validated
umi GGTTGCCCGC = 258 reads: -40X +414 invalidated
umi TAGTTACGTA = 241 reads: +454 validated
umi TGCTTTCATA = 36 reads: -401X +1 -3XX +1 -2XX +1 -2XX +2 -1XX +3 -2XX +14 -1XX +20 invalidated
umi TTCTAACCTC = 163 reads: +454 validated
umi TTTCACTTCG = 15 reads: +77 -12 +66 -1 +7 -1 +77 -1 +10 -126 +1 -1 +3 -1 +2 -1 +67 non-validated

GOOD CONTIGS

TIG 1[bases=536]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=6)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
409-536 ==> 0-127 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 34 umis using 1539 reads
cdr3 = CQNYNSAPPVF at 348, score = 9 + 7
umis assigned: [17, 29, 31, 37, 87, 108, 122, 123, 124, 140] and 24 others
of which 34 are surviving nonsolos
reads assigned: 9814
start codons at 21, 27, 83, 96, 232, 331, 451
confident = true

TIG 2[bases=550]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=13)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 94 reads
cdr3 = CARGAYVSGYWGRTSTYFDYW at 385, score = 9 + 7
umis assigned: [320, 370, 759, 849, 1002, 1092, 1128]
of which 7 are surviving nonsolos
reads assigned: 1101
start codons at 2, 25, 46, 90, 176, 401
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGGCGCGTATGTCAGTGGCTACTGGGGCCGTACTAGTACATACTTTGACTACTGGGGCCAGGGAAGCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAGCCTGAAGATGTTGCAACCTATTACTGTCAAAACTATAACAGTGCCCCTCCAGTCTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.345 = GGACAGACATGATCCA-1

using 469 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 464]
surviving nonsolo ucounts = 1[464]
ids = [3]

====================================================================================

UMI info for barcode GGACAGACATGATCCA-1 contig 1 = GATCAGGACT...
umi GGGGTCCAAT = 436 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=514]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=15)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
424-514 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CMQALQSHTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 431
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.354 = GGACAGAGTCCGAACC-1

using 102 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[4, 8, 13, 72]
surviving nonsolo ucounts = 1[72]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.358 = GGACAGAGTCGTCTTC-1

using 116 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[116]
surviving nonsolo ucounts = 1[116]
ids = [0]

====================================================================================

UMI info for barcode GGACAGAGTCGTCTTC-1 contig 1 = AGAGAGGTGC...
umi AAGCTTCCTG = 115 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=540]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
478-540 ==> 0-62 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARVGPLFDYW at 414, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 72, 228, 349, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.362 = GGACAGAGTCTCGTTC-1

using 34 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.374 = GGACAGATCAAACCAC-1

using 343 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 10, 324]
surviving nonsolo ucounts = 1[324]
ids = [8]

====================================================================================

UMI info for barcode GGACAGATCAAACCAC-1 contig 1 = GAGTCAGTCT...
umi TTCCAACCGT = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-357 ==> 0-332 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=22)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQTNTSPRTF at 352, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.375 = GGACAGATCAAACCGT-1

using 879 reads

====================================================================================

graph has 295 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 277, 598]
surviving nonsolo ucounts = 2[277, 598]
ids = [2, 3]

====================================================================================

UMI info for barcode GGACAGATCAAACCGT-1 contig 1 = GCTCTGCCTC...
umi CCATGGCGTT = 265 reads: +394 validated

UMI info for barcode GGACAGATCAAACCGT-1 contig 2 = GGGACTGATC...
umi GACGATTATT = 601 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=541]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-541 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 101 reads
cdr3 = CMQALQTPLTF at 372, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 594
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.378 = GGACAGATCACCTCGT-1

using 699 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 208, 479]
surviving nonsolo ucounts = 2[208, 479]
ids = [4, 6]

====================================================================================

UMI info for barcode GGACAGATCACCTCGT-1 contig 1 = GGGGTCACAA...
umi CTTACATTGG = 204 reads: +388 validated
umi GCTGTGTAAC = 465 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=15)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-585 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 2 umis using 118 reads
cdr3 = CCSYAGSSTWVF at 362, score = 9 + 8
umis assigned: [4, 6]
of which 2 are surviving nonsolos
reads assigned: 661
start codons at 38, 174, 177, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.386 = GGACAGATCCAAGTAC-1

using 219 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================

UMI info for barcode GGACAGATCCAAGTAC-1 contig 1 = GAGGAGCCCA...
umi GTCCACTGGT = 204 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=532]
0-69 ==> 152-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
69-419 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=2)
423-443 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
439-487 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
487-532 ==> 0-45 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARVDVDTAMGSFDYW at 408, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 69, 225, 369, 435, 505
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.393 = GGACAGATCCGCGCAA-1

using 469 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 463]
surviving nonsolo ucounts = 1[463]
ids = [1]

====================================================================================

UMI info for barcode GGACAGATCCGCGCAA-1 contig 1 = GAAGGAACCT...
umi ACCCAATGCT = 462 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=641]
0-54 ==> 61-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
54-394 ==> 0-340 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=0)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQVWDSSTVVF at 369, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 459
start codons at 54, 115, 202, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.394 = GGACAGATCCGTCATC-1

using 316 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 16, 295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode GGACAGATCCGTCATC-1 contig 1 = ACAAGAGGCA...
umi CATAGCGATC = 281 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=585]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-585 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 31, 115, 188, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.395 = GGACAGATCCTGTACC-1

using 11159 reads

====================================================================================

graph has 5020 edges initially, 52 edges after simplification

total ucounts = 811
nonsolo ucounts = 371[2^126, 3^70, 4^45, 5^30, 6^24, 7^17, 8^3, 9^2, 10^2, 11, 12, 13^2, 14, 15, 18^2, 22^2, 41^2, 47, 48, 71, 72, 85, 86, 87, 141, 154, 175^2, 188, 200, 207^2, 211, 212, 215, 217, 218, 220, 222, 249, 250, 253^2, 265, 272, 277, 298, 305, 306, 314, 319, 323, 340, 349, 406, 523, 602]
surviving nonsolo ucounts = 41[41, 47, 48, 71, 72, 85, 86, 87, 141, 154, 175^2, 188, 200, 207^2, 211, 212, 215, 217, 218, 220, 222, 249, 250, 253^2, 265, 272, 277, 298, 305, 306, 314, 319, 323, 340, 349, 406, 523, 602]
ids = [256, 210, 93, 88, 741, 352, 289, 278, 533, 232, ...]

====================================================================================

UMI info for barcode GGACAGATCCTGTACC-1 contig 1 = ATACTTTCTG...
umi ACGCGCTAGT = 72 reads: -3 +439 non-validated
umi CACATAACGA = 156 reads: +442 validated
umi CCCTTTCATA = 87 reads: +15 -8 +419 non-validated
umi TTATTTCCCA = 214 reads: +442 validated

UMI info for barcode GGACAGATCCTGTACC-1 contig 2 = AGCTGTGGGC...
umi AACAGCTGGA = 275 reads: +382 validated
umi AAGCACTGCG = 220 reads: +380 -1XX +1 invalidated
umi AGGCGAAGGT = 215 reads: +382 validated
umi CACCCACTAC = 209 reads: +382 validated
umi CACCGGCCGC = 211 reads: +382 validated
umi CGATTATCGC = 257 reads: +382 validated
umi CGCCTTTTCA = 298 reads: +382 validated
umi GAACTAGAGA = 216 reads: +382 validated
umi GCTTATACTG = 254 reads: +382 validated
umi GGAGGGTCGA = 226 reads: +382 validated
umi GTTCTCATTA = 204 reads: +382 validated
umi TAACGGGTCG = 202 reads: +382 validated
umi TAATCGGTGT = 187 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=661]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=10)
416-479 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
479-661 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 4 umis using 62 reads
cdr3 = CARAPGGTLFRDKTYFYYGMDVW at 379, score = 9 + 7
umis assigned: [88, 232, 289, 754]
of which 4 are surviving nonsolos
reads assigned: 519
start codons at 16, 37, 81, 436
confident = true

TIG 2[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=14)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 416 reads
cdr3 = CNSRGSTGNHLVF at 355, score = 7 + 9
umis assigned: [14, 33, 138, 235, 237, 323, 329, 399, 474, 488] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2924
start codons at 40, 159, 239, 338
confident = true

REJECT CONTIGS

TIG 1[bases=563]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=25)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [87, 130, 305, 334, 393, 454, 558, 708, 719, 723]
of which 10 are surviving nonsolos
reads assigned: 2650
start codons at 30, 63, 99, 250, 283, 292, 349, 369, 469
confident = false
did not find CDR3

TIG 2[bases=621]
0-84 ==> 11259-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
38-377 ==> 0-339 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=17)
382-410 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
410-621 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [114, 160, 166, 200, 330, 452, 533]
of which 7 are surviving nonsolos
reads assigned: 1968
start codons at 28, 38, 99, 168, 336
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGCCCCAGGAGGGACGTTATTCAGGGATAAAACCTACTTCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGGCTCAGGCGGAAGATGAGGCTGACTATCACTGTAACTCCCGGGGCAGCACTGGTAACCATCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.397 = GGACAGATCGACGGAA-1

using 287 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[15, 269]
surviving nonsolo ucounts = 1[269]
ids = [3]

====================================================================================

UMI info for barcode GGACAGATCGACGGAA-1 contig 1 = ACTGCCCAGC...
umi TTGTCTGCAC = 270 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=539]
0-47 ==> 12-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
47-400 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
489-539 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARQMSRQILLITAAVRGAFDMW at 389, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 47, 221, 245, 380, 401, 452, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.398 = GGACAGATCGCCTGAG-1

using 220 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 7, 205]
surviving nonsolo ucounts = 1[205]
ids = [5]

====================================================================================

UMI info for barcode GGACAGATCGCCTGAG-1 contig 1 = ACCACATCCC...
umi GTCATCCCGC = 203 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=555]
0-47 ==> 257-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
47-400 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
393-420 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
421-471 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
471-555 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARIMVRGVIMAPFDIW at 389, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 47, 134, 245, 311, 344, 374, 401, 419
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.399 = GGACAGATCGCTTAGA-1

using 226 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3^2, 217]
surviving nonsolo ucounts = 1[217]
ids = [3]

====================================================================================

UMI info for barcode GGACAGATCGCTTAGA-1 contig 1 = ATCAGTCCCA...
umi CGCACTCACG = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-472 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.408 = GGACAGATCTTTACGT-1

using 352 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 346]
surviving nonsolo ucounts = 1[346]
ids = [5]

====================================================================================

UMI info for barcode GGACAGATCTTTACGT-1 contig 1 = GAATCAGTCC...
umi TGTCATGCCG = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=21)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 72.416 = GGACATTAGACTGTAA-1

using 296 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^4, 3, 4, 5, 270]
surviving nonsolo ucounts = 1[270]
ids = [7]

====================================================================================

UMI info for barcode GGACATTAGACTGTAA-1 contig 1 = GGGGTCTCAG...
umi CCTCTTTCAC = 2 reads: -11 +6 -2X +21 -1X +26 -321 invalidated
umi GACGTAGTGG = 259 reads: +388 validated
umi TTGTCTGAGC = 2 reads: -83 +2 -1 +5 -1X +13 -1 +27 -1X +2 -1X +2 -240X +3 -1 +5 invalidated

GOOD CONTIGS

TIG 1[bases=567]
38-399 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
426-567 ==> 0-141 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSYTSSSTLVF at 362, score = 8 + 9
umis assigned: [4, 7, 12]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 38, 195, 239, 246, 249, 558
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk072-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk072-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

30.284 seconds used processing barcodes, peak mem = 0.23
