[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.66 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk070-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk070-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk070.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.8 = GCTCCTAAGACGCACA-1

using 1416 reads

====================================================================================

graph has 526 edges initially, 40 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[238, 259, 275, 316, 324]
surviving nonsolo ucounts = 5[238, 259, 275, 316, 324]
ids = [4, 3, 7, 6, 2]

====================================================================================

UMI info for barcode GCTCCTAAGACGCACA-1 contig 1 = ATCAGTCCCA...
umi GATATCGTAC = 237 reads: +388 validated

UMI info for barcode GCTCCTAAGACGCACA-1 contig 2 = GGAGTCAGTC...
umi CGCCAACAAA = 324 reads: +388 validated

UMI info for barcode GCTCCTAAGACGCACA-1 contig 3 = CTGGGCCTAA...
umi TCAAGGGATC = 268 reads: +382 validated

UMI info for barcode GCTCCTAAGACGCACA-1 contig 4 = GGCTGGGGTC...
umi CGTTAAACCC = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CHQYESVPYTF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 26, 32, 88, 101, 240, 336, 363, 456
confident = false

TIG 3[bases=587]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-370 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-587 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQVWDSDGHYVVF at 352, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 37, 98, 167, 335, 371, 380
confident = false

TIG 4[bases=598]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-394 ==> 0-352 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
430-598 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CCSYAGGYTWVF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 42, 178, 181, 199, 243, 250, 253, 349, 376
confident = false

REJECT CONTIGS

TIG 1[bases=560]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 28, 97, 350, 466
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.16 = GCTCCTAAGCCTCGTG-1

using 141 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [3]

====================================================================================

UMI info for barcode GCTCCTAAGCCTCGTG-1 contig 1 = ATCCAACAAC...
umi GGCAATGCAC = 134 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=516]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
401-428 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
479-516 ==> 0-37 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARIMVRGVIMAPFDIW at 397, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 55, 142, 253, 319, 352, 382, 409, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.20 = GCTCCTAAGGACATTA-1

using 47 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^3, 9, 10, 20]
surviving nonsolo ucounts = 1[20]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.29 = GCTCCTAAGGCTAGAC-1

using 342 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3, 4^2, 15, 311]
surviving nonsolo ucounts = 1[311]
ids = [9]

====================================================================================

UMI info for barcode GCTCCTAAGGCTAGAC-1 contig 1 = GTCAGACCCT...
umi TTACGTTTTC = 308 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.30 = GCTCCTAAGGCTAGCA-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 1[13]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.44 = GCTCCTAAGTTCGCAT-1

using 45 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 4^2, 6, 8, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.47 = GCTCCTACAAAGGTGC-1

using 40 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 9, 23]
surviving nonsolo ucounts = 1[23]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.51 = GCTCCTACAAGAGGCT-1

using 236 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 231]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GCTCCTACAAGAGGCT-1 contig 1 = GGGAGGGGTC...
umi AAGACACGAC = 224 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=547]
62-410 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
489-547 ==> 0-58 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDLLWFGETRAFDIW at 407, score = 9 + 8
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 222
start codons at 18, 62, 106, 424, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.53 = GCTCCTACAAGGACAC-1

using 352 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3, 5, 6, 328]
surviving nonsolo ucounts = 1[328]
ids = [1]

====================================================================================

UMI info for barcode GCTCCTACAAGGACAC-1 contig 1 = GGGGAGGAAC...
umi ACTCCTTTAT = 329 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNNWPPRTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.54 = GCTCCTACAAGTAGTA-1

using 423 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3^3, 404]
surviving nonsolo ucounts = 1[404]
ids = [10]

====================================================================================

UMI info for barcode GCTCCTACAAGTAGTA-1 contig 1 = GGAGTCAGTC...
umi GTGGTTCCTA = 408 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.71 = GCTCCTACACTACAGT-1

using 883 reads

====================================================================================

graph has 420 edges initially, 32 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 5, 7, 244, 302, 319]
surviving nonsolo ucounts = 3[244, 302, 319]
ids = [2, 8, 4]

====================================================================================

UMI info for barcode GCTCCTACACTACAGT-1 contig 1 = GAATCAGTCC...
umi CAGACCCTTT = 238 reads: +110 -1XX +13 -1XX +263 invalidated

UMI info for barcode GCTCCTACACTACAGT-1 contig 2 = AGCATCATCC...
umi TGCAGGAGAG = 308 reads: +430 validated

UMI info for barcode GCTCCTACACTACAGT-1 contig 3 = GGGGAGTCTC...
umi CGCAACGCCT = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=651]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
443-491 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
491-651 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 403, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 61, 217, 259, 325, 358, 448, 545
confident = false

TIG 3[bases=504]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.75 = GCTCCTACAGACACTT-1

using 109 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 1[109]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.79 = GCTCCTACAGATGGGT-1

using 7897 reads

====================================================================================

graph has 3480 edges initially, 54 edges after simplification

total ucounts = 622
nonsolo ucounts = 287[2^103, 3^62, 4^39, 5^20, 6^18, 7^9, 8^6, 9^3, 10^4, 17, 105, 108, 137, 138, 147, 236, 265, 280, 296, 302, 305, 312, 337, 344, 352, 356, 358, 360, 428, 443, 494, 506]
surviving nonsolo ucounts = 22[105, 108, 137, 138, 147, 236, 265, 280, 296, 302, 305, 312, 337, 344, 352, 356, 358, 360, 428, 443, 494, 506]
ids = [134, 214, 432, 118, 325, 605, 282, 66, 495, 562, ...]

====================================================================================

UMI info for barcode GCTCCTACAGATGGGT-1 contig 1 = AATGCCTGGG...
umi AAGGCTCCAA = 432 reads: -74 +308 non-validated
umi ACGTTATCAA = 280 reads: +382 validated
umi CACTACGATC = 345 reads: +382 validated
umi CATCTATCGG = 355 reads: +382 validated
umi CATTGACATG = 354 reads: +382 validated
umi CCCTGTCAAT = 445 reads: -140X +242 invalidated
umi CTCACAATTG = 274 reads: +260 -1XX +121 invalidated
umi GTGCCGCTTC = 137 reads: +382 validated
umi TATTTACTGC = 359 reads: +382 validated
umi TCAAATGCAC = 312 reads: +382 validated
umi TGGTATGAGT = 341 reads: +382 validated
umi TGTAGGGTTG = 305 reads: +382 validated

UMI info for barcode GCTCCTACAGATGGGT-1 contig 2 = AGCTCTCAGA...
umi AATTTATGCC = 305 reads: +430 validated
umi ATATAAGGAT = 136 reads: +430 validated
umi TCATAGCGAT = 296 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=574]
0-56 ==> 41-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
56-401 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=4)
401-438 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
438-574 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 705 reads
cdr3 = CQQYNNWPLTF at 377, score = 9 + 9
umis assigned: [27, 66, 159, 183, 195, 225, 282, 432, 484, 485] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3877
start codons at 1, 56, 125, 257, 261, 480
confident = true

TIG 2[bases=580]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=2)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-580 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 39 reads
cdr3 = CARDLQKKYGPGNFPQDYW at 421, score = 8 + 7
umis assigned: [35, 118, 495]
of which 3 are surviving nonsolos
reads assigned: 727
start codons at 79, 235, 356, 382, 446
confident = true

REJECT CONTIGS

TIG 1[bases=392]
0-25 ==> 6-31 on |183|IGHV4-34|5'UTR| [len=31] (mis=0)
0-25 ==> 3160-3185 on rc of segment before IGHV7-34-1 exon 2 [len=3185] (mis=0)
4-34 ==> 1353-1383 on rc of segment before IGHV7-81 exon 2 [len=1396] (mis=1)
12-46 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
25-245 ==> 0-220 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=8)
271-321 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
321-392 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [134, 151, 214, 325, 439, 543, 605]
of which 7 are surviving nonsolos
reads assigned: 1919
start codons at 2, 25, 46, 90, 176, 273
confident = false
frameshifted full length stopped transcript of length 392
did not find CDR3
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGATCTCCAAAAGAAGTATGGTCCAGGGAACTTCCCCCAAGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.86 = GCTCCTACAGGCTGAA-1

using 366 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[363]
surviving nonsolo ucounts = 1[363]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=544]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-185 ==> 0-150 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
202-282 ==> 260-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
295-333 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
333-544 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDKSLRGAVF at 266, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 35, 119, 192, 249, 276
confident = false
not full
full length transcript of length 544
VJ delta = 115
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.96 = GCTCCTACATCGTCGG-1

using 34 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[4^2, 5, 7, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.107 = GCTCCTAGTAAGCACG-1

using 261 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 249]
surviving nonsolo ucounts = 1[249]
ids = [4]

====================================================================================

UMI info for barcode GCTCCTAGTAAGCACG-1 contig 1 = GTCAGTCTCA...
umi GACCGTTATG = 248 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQSYSSPRTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.121 = GCTCCTAGTCAACATC-1

using 1565 reads

====================================================================================

graph has 2022 edges initially, 34 edges after simplification

total ucounts = 635
nonsolo ucounts = 310[2^146, 3^70, 4^33, 5^26, 6^16, 7^9, 8^5, 9^3, 10, 239]
surviving nonsolo ucounts = 1[239]
ids = [577]

====================================================================================

UMI info for barcode GCTCCTAGTCAACATC-1 contig 1 = AGCTTCAGCT...
umi TTACACCCGT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-575 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDSLSGRVF at 367, score = 7 + 8
umis assigned: [577]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.122 = GCTCCTAGTCAGATAA-1

using 313 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 7, 298]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.123 = GCTCCTAGTCCAACTA-1

using 350 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 343]
surviving nonsolo ucounts = 1[343]
ids = [1]

====================================================================================

UMI info for barcode GCTCCTAGTCCAACTA-1 contig 1 = GAGGAATCAG...
umi ATGAAGTGAG = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-482 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.144 = GCTCCTAGTGGCAAAC-1

using 270 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.149 = GCTCCTAGTGTGGCTC-1

using 62 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^2, 3^3, 5^2, 6^3, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.153 = GCTCCTAGTTCCCGAG-1

using 1567 reads

====================================================================================

graph has 2108 edges initially, 23 edges after simplification

total ucounts = 796
nonsolo ucounts = 313[2^140, 3^87, 4^40, 5^12, 6^10, 7^6, 8^4, 9^4, 10^2, 11, 12, 14, 15^3, 16, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.154 = GCTCCTAGTTCTGAAC-1

using 12412 reads

====================================================================================

graph has 7083 edges initially, 122 edges after simplification

total ucounts = 1648
nonsolo ucounts = 806[2^328, 3^183, 4^109, 5^63, 6^33, 7^20, 8^14, 9^4, 10^3, 12^2, 13, 14, 15, 16^3, 33, 55, 66, 70, 96, 97, 110, 122, 138, 150, 151, 176, 178, 182, 191^2, 193, 205, 207, 213, 219, 223, 224, 225, 226, 228, 232, 236, 246^2, 248, 252, 257, 262, 273, 328, 349, 360, 410, 483, 633]
surviving nonsolo ucounts = 40[4, 55, 66, 70, 97, 110, 122, 138, 150, 151, 176, 178, 182, 191^2, 193, 205, 207, 213, 219, 223, 224, 225, 226, 228, 232, 236, 246^2, 248, 252, 257, 262, 273, 328, 349, 360, 410, 483, 633]
ids = [768, 1566, 543, 189, 404, 1176, 58, 552, 1631, 658, ...]

====================================================================================

UMI info for barcode GCTCCTAGTTCTGAAC-1 contig 1 = AGCTCTCAGA...
umi ACAATTTCGT = 178 reads: +430 validated
umi ACTGCCCGTT = 192 reads: +430 validated
umi AGGATTGAAT = 190 reads: +430 validated
umi ATTAAAACAG = 96 reads: +430 validated
umi ATTGATCCTT = 247 reads: +430 validated
umi CAATCACCTC = 210 reads: +430 validated
umi CACAGGATGT = 232 reads: +430 validated
umi CATCATACCA = 65 reads: +430 validated
umi CATCTCGCAA = 139 reads: +430 validated
umi CCTCAGCTAA = 250 reads: +423 -7 non-validated
umi CTCTGATCCT = 250 reads: +430 validated
umi CTGACTGGGA = 363 reads: +430 validated
umi GACCTCAGAG = 181 reads: +430 validated
umi GAGGGCATTC = 278 reads: +430 validated
umi GTTTCTTTCA = 222 reads: +430 validated
umi TATAACAGGA = 269 reads: +426 -1 +3 non-validated
umi TCCCAGCGCC = 236 reads: +430 validated
umi TCTTCCAGCT = 199 reads: +430 validated
umi TTTCCAAGAC = 192 reads: +430 validated
umi TTTTAGATAG = 147 reads: +430 validated

UMI info for barcode GCTCCTAGTTCTGAAC-1 contig 2 = CTGGGCCTCA...
umi AAACATGACG = 245 reads: +376 validated
umi ACGTTTCTAT = 70 reads: +376 validated
umi ACTTCCCCCT = 108 reads: +20 -1 +2 -3XX +1 -2X +2 -3XX +1 -2XX +1 -1XX +3 -1XX +28 -1XX +7 -1XX +2 -1XX +1 -3XX +2 -1XX +1 -1XX +1 -159XX +1 -6XX +117 invalidated
umi CAGCCTCCCG = 329 reads: +376 validated
umi CCGTTCTCCC = 220 reads: +376 validated
umi CGCATTTGAA = 154 reads: +376 validated
umi CTCCGTCGCC = 234 reads: +376 validated
umi GGCAACCTCC = 638 reads: -326 +50 non-validated
umi GGTCGTCGGC = 259 reads: +376 validated
umi GTATGCGCTG = 230 reads: +376 validated
umi GTATGTCGCT = 221 reads: +376 validated
umi GTATTAACAA = 229 reads: +376 validated
umi TAGACTTCTT = 59 reads: +47 -2 +327 non-validated
umi TTAAGGGACG = 489 reads: +376 validated
umi TTATCATTAA = 351 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=26)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 18 umis using 436 reads
cdr3 = CARGNDFLSAFFFADFDYW at 421, score = 8 + 6
umis assigned: [123, 210, 280, 404, 427, 475, 487, 543, 552, 623] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4061
start codons at 79, 235, 382, 563
confident = true

TIG 2[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=17)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 563 reads
cdr3 = CQAWDSSTAVF at 352, score = 6 + 8
umis assigned: [13, 189, 221, 519, 618, 658, 745, 969, 991, 1023] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3774
start codons at 37, 42, 98, 185, 335
confident = true
now this is a cell
paired!

GCTGTGTATTTCTGTGCGAGAGGAAACGATTTTTTGTCTGCTTTTTTCTTTGCCGACTTTGACTACTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATAGATGAAGCTGACTATTACTGTCAGGCGTGGGACAGTAGCACTGCGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.157 = GCTCCTAGTTTGTGTG-1

using 202 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3^2, 194]
surviving nonsolo ucounts = 1[194]
ids = [1]

====================================================================================

UMI info for barcode GCTCCTAGTTTGTGTG-1 contig 1 = ACCCAAAAAC...
umi CCGCTTTCAT = 194 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=543]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=21)
404-424 ==> 0-20 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
437-472 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
472-543 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARTYCSGGTCYDGW at 396, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 54, 205, 252, 257, 274, 318, 351, 430, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.160 = GCTCCTATCAACACGT-1

using 274 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3^2, 4, 254]
surviving nonsolo ucounts = 1[254]
ids = [7]

====================================================================================

UMI info for barcode GCTCCTATCAACACGT-1 contig 1 = GTGGGCTCAG...
umi CTAGTGCTAT = 248 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=577]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=5)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
414-577 ==> 0-163 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CYSTDSSGNGVF at 350, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 35, 96, 165, 183, 234, 296, 333, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.164 = GCTCCTATCACATACG-1

using 18 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 1[18]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.191 = GCTCCTATCCTATGTT-1

using 243 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 235]
surviving nonsolo ucounts = 1[235]
ids = [6]

====================================================================================

UMI info for barcode GCTCCTATCCTATGTT-1 contig 1 = AGACCCAGTC...
umi TTGGGCGCGC = 234 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-20 ==> 7-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
20-173 ==> 0-153 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=3)
176-374 ==> 153-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=19)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYESYPLTF at 350, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 20, 26, 82, 95, 237, 360, 453
confident = false
see insertion of ACC at pos 153 on |246|IGKV1D-16|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.195 = GCTCCTATCCTTCAAT-1

using 225 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 220]
surviving nonsolo ucounts = 1[220]
ids = [4]

====================================================================================

UMI info for barcode GCTCCTATCCTTCAAT-1 contig 1 = ACCCAAAAAC...
umi TGAGTGCCTT = 213 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=574]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-574 ==> 0-84 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.205 = GCTCCTATCGGGAGTA-1

using 358 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 4, 345]
surviving nonsolo ucounts = 1[345]
ids = [3]

====================================================================================

UMI info for barcode GCTCCTATCGGGAGTA-1 contig 1 = TACAACAGGC...
umi ACTTTATCAT = 347 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=562]
0-26 ==> 149-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
26-389 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=14)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSTPLTF at 365, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 26, 95, 348, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.208 = GCTCCTATCGTCTGCT-1

using 291 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[291]
surviving nonsolo ucounts = 1[291]
ids = [0]

====================================================================================

UMI info for barcode GCTCCTATCGTCTGCT-1 contig 1 = TGAGCGCAGA...
umi ATAGTGACTG = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=580]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-580 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.210 = GCTCCTATCTAACCGA-1

using 6018 reads

====================================================================================

graph has 5020 edges initially, 50 edges after simplification

total ucounts = 1123
nonsolo ucounts = 577[2^228, 3^117, 4^90, 5^50, 6^25, 7^15, 8^15, 9^12, 10^5, 11^2, 12^2, 13, 14^2, 17, 31, 35, 50, 73, 183, 211, 221, 280, 463, 546, 567, 758]
surviving nonsolo ucounts = 12[9, 31, 50, 73, 183, 211, 221, 280, 463, 546, 567, 758]
ids = [972, 923, 324, 254, 902, 664, 526, 673, 276, 642, ...]

====================================================================================

UMI info for barcode GCTCCTATCTAACCGA-1 contig 1 = ACTTTCTGAG...
umi CTCTCACCCG = 219 reads: +427 validated
umi TGATTCCCAT = 9 reads: -26 +56 -24 +100 -1 +14 -19 +1 -1 +32 -1 +21 -1 +5 -1 +5 -1 +1 -2 +1 -1 +3 -1 +3 -1 +5 -1 +11 -12 +56 -20 non-validated

UMI info for barcode GCTCCTATCTAACCGA-1 contig 2 = GGAGTCAGTC...
umi CACCTTTCCA = 75 reads: +120 -1XX +33 -1XX +15 -1XX +29 -2XX +63 -1XX +25 -1XX +31 -2XX +10 -1XX +4 -3XX +1 -2X +1 -41X invalidated
umi CAGTTCTGCA = 460 reads: +120 -1XX +18 -7XX +1 -206XX +2 -2XX +1 -3XX +1 -6XX +2 -3XX +1 -5XX +1 -2XX +1 -3XX +1 -1XX invalidated
umi CCATGCCGGA = 52 reads: -2 +118 -1XX +33 -1XX +15 -1XX +29 -2XX +63 -1XX +25 -1XX +31 -2XX +7 -4X +3 -49 invalidated
umi GATTTTACCA = 535 reads: +120 -1XX +18 -7XX +1 -206XX +2 -2XX +1 -3XX +1 -6XX +2 -3XX +1 -5XX +1 -2XX +1 -3XX +1 -1XX invalidated
umi GCCCCGTACC = 216 reads: +388 validated
umi GCGGATAACG = 282 reads: +388 validated
umi TCCGATTACC = 183 reads: +388 validated
umi TCGTAACGAT = 31 reads: +331 -57 non-validated
umi TCTACCCCTA = 761 reads: +120 -1XX +18 -7XX +1 -206XX +2 -2XX +1 -3XX +1 -6XX +2 -3XX +1 -5XX +1 -2XX +1 -3XX +1 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=533]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=24)
421-462 ==> 8-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAKVPPSRRYFDWGDIW at 380, score = 9 + 8
umis assigned: [526, 972]
of which 2 are surviving nonsolos
reads assigned: 227
start codons at 35, 79, 443
confident = true

TIG 2[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 104 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [254, 276, 324, 642, 664, 673, 902, 923, 928]
of which 9 are surviving nonsolos
reads assigned: 2540
start codons at 26, 32, 88, 101, 240, 363, 456
confident = true
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCGAAAGTTCCTCCGTCGAGGCGATATTTTGACTGGGGTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCCCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.226 = GCTCCTATCTGCTGCT-1

using 76 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 32
nonsolo ucounts = 17[2^5, 3^7, 4^2, 5, 6, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.228 = GCTCCTATCTGGGCCA-1

using 89 reads

====================================================================================

graph has 56 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^4, 78]
surviving nonsolo ucounts = 1[78]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.234 = GCTCCTATCTTGTCAT-1

using 661 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 651]
surviving nonsolo ucounts = 1[651]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.237 = GCTCTGTAGAAACGCC-1

using 261 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 27
nonsolo ucounts = 13[2^4, 3^3, 4^2, 5^2, 6, 206]
surviving nonsolo ucounts = 1[206]
ids = [9]

====================================================================================

UMI info for barcode GCTCTGTAGAAACGCC-1 contig 1 = GGGGAGGAAT...
umi CGCGCAAGGC = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-493 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.249 = GCTCTGTAGATCTGCT-1

using 454 reads

====================================================================================

graph has 286 edges initially, 10 edges after simplification

total ucounts = 30
nonsolo ucounts = 18[2^2, 3^3, 5^3, 6^2, 8, 10, 11, 15^2, 29, 39, 275]
surviving nonsolo ucounts = 1[275]
ids = [8]

====================================================================================

UMI info for barcode GCTCTGTAGATCTGCT-1 contig 1 = TGGGGAGGAA...
umi CTGTCAAACC = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-515 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.252 = GCTCTGTAGCAGATCG-1

using 262 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 255]
surviving nonsolo ucounts = 1[255]
ids = [2]

====================================================================================

UMI info for barcode GCTCTGTAGCAGATCG-1 contig 1 = GATCAGGACT...
umi ACTCCATCAA = 248 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=506]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-506 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.260 = GCTCTGTAGCTTTGGT-1

using 282 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 267]
surviving nonsolo ucounts = 1[267]
ids = [3]

====================================================================================

UMI info for barcode GCTCTGTAGCTTTGGT-1 contig 1 = GAATCAGTCC...
umi GCCCGCCCGT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 70.264 = GCTCTGTAGGCGCTCT-1

using 52 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 3, 4, 11, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk070-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk070-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.684 seconds used processing barcodes, peak mem = 0.23
