[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.83 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk069-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk069-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk069.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.0 = GCGCGATAGCGATAGC-1

using 9990 reads

====================================================================================

graph has 4435 edges initially, 99 edges after simplification

total ucounts = 526
nonsolo ucounts = 214[2^97, 3^34, 4^30, 5^5, 6^4, 7^6, 9, 11, 15, 35, 82, 106, 123, 135, 137, 138, 164, 166, 203, 231, 232, 235, 238, 249, 253, 258, 260, 274, 275, 286, 287, 294, 308, 311, 315, 318, 319, 327, 345, 375, 397, 402, 472, 585]
surviving nonsolo ucounts = 35[35, 82, 106, 123, 135, 137, 138, 164, 166, 203, 231, 232, 235, 238, 249, 253, 258, 260, 274, 275, 286, 287, 294, 308, 311, 315, 318, 319, 327, 345, 375, 397, 402, 472, 585]
ids = [269, 457, 260, 24, 248, 32, 499, 187, 327, 133, ...]

====================================================================================

UMI info for barcode GCGCGATAGCGATAGC-1 contig 1 = AGGAGTCAGA...
umi ATCGAAGGAC = 285 reads: +385 validated
umi ATCTTTAAAC = 376 reads: +385 validated
umi CAAGTGCGGC = 321 reads: +385 validated
umi CAGCACGCAA = 159 reads: +385 validated
umi CAGTGGTCTA = 313 reads: +385 validated
umi CATTCACTCT = 310 reads: +385 validated
umi CTCTCCGTGG = 344 reads: +385 validated
umi CTGGGTGCCG = 276 reads: +385 validated
umi GATTTCCATC = 239 reads: +385 validated
umi TAATAATTTA = 249 reads: +385 validated
umi TAATTGGTTC = 307 reads: +385 validated
umi TAGTCGGGGC = 405 reads: +385 validated
umi TCTGGCCCAA = 296 reads: +385 validated
umi TGAATCGGCA = 82 reads: -20 +365 non-validated
umi TTTGCCATAG = 263 reads: +385 validated

UMI info for barcode GCGCGATAGCGATAGC-1 contig 2 = AGGTCTCAGA...
umi ATACGGACAT = 210 reads: +5 -1XX +113 -1XX +41 -1XX +23 -1XX +4 -1XX +102 -1XX +41 -1XX +14 -53X +2 -3X +2 -1X +3 -2X +2 -2 +4 -1 +8 invalidated
umi ATATGCGTCA = 237 reads: +433 validated
umi CGTATCTACT = 97 reads: +156 -7XX +2 -2X +266 invalidated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 640 reads
cdr3 = CQQYNHYSTF at 354, score = 8 + 7
umis assigned: [145, 151, 179, 187, 190, 198, 286, 299, 336, 388] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4166
start codons at 27, 33, 89, 102, 238, 241, 334, 454
confident = true

TIG 2[bases=583]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=8)
438-461 ==> 0-23 on |21|IGHD3-3|D-REGION| [len=31] (mis=1)
464-512 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 41 reads
cdr3 = CARRGPYYEFWSGSGVFDYW at 421, score = 9 + 7
umis assigned: [133, 141, 260]
of which 3 are surviving nonsolos
reads assigned: 508
start codons at 79, 198, 235, 296, 314, 382
confident = true

REJECT CONTIGS

TIG 1[bases=774]
0-44 ==> 53-97 on |287|IGKV3D-11|5'UTR| [len=97] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
17-58 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
44-361 ==> 0-317 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=7)
360-600 ==> 40-280 on rc of segment before IGKJ4 exon 1 [len=280] (mis=3)
600-638 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
638-774 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [24, 191, 248]
of which 3 are surviving nonsolos
reads assigned: 652
start codons at 44, 186, 249, 252, 436, 680
confident = false
did not find CDR3

TIG 2[bases=662]
0-46 ==> 0-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
46-414 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=6)
413-451 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
451-662 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [33, 42, 89, 100, 199, 327, 341, 418, 423, 426] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2420
start codons at 46, 61, 70, 73, 98, 365, 368, 397
confident = false
did not find CDR3
now this is a cell
paired!

GTATATTACTGTGCGAGACGGGGACCGTATTACGAGTTTTGGAGTGGTTCGGGCGTATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATCATTATTCGACGTTCGGCCAAGGGACCGAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.1 = GCGCGATAGCGATATA-1

using 953 reads

====================================================================================

graph has 380 edges initially, 44 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 201, 368, 380]
surviving nonsolo ucounts = 3[201, 368, 380]
ids = [2, 4, 3]

====================================================================================

UMI info for barcode GCGCGATAGCGATATA-1 contig 1 = GGAGTCAGTC...
umi CATTCTTCTA = 365 reads: +388 validated

UMI info for barcode GCGCGATAGCGATATA-1 contig 2 = GGAGTCAGAC...
umi CATATGTCAA = 385 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYSTPRTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 26, 32, 88, 101, 237, 456
confident = false

TIG 2[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYYSYTWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.8 = GCGCGATAGGAACTGC-1

using 798 reads

====================================================================================

graph has 268 edges initially, 8 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[220, 281, 296]
surviving nonsolo ucounts = 3[220, 281, 296]
ids = [1, 2, 3]

====================================================================================

UMI info for barcode GCGCGATAGGAACTGC-1 contig 1 = GAGGAATCAG...
umi GGATTAAGGC = 283 reads: +388 validated

UMI info for barcode GCGCGATAGGAACTGC-1 contig 2 = AGAGCCCTGG...
umi TACTTAAATG = 295 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=562]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
388-426 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQRSNWPITF at 365, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 44, 249, 252, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.12 = GCGCGATAGGTGCAAC-1

using 399 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 394]
surviving nonsolo ucounts = 1[394]
ids = [3]

====================================================================================

UMI info for barcode GCGCGATAGGTGCAAC-1 contig 1 = GAGTCAGACT...
umi GCCCTCAATA = 354 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.13 = GCGCGATAGGTTCCTA-1

using 828 reads

====================================================================================

graph has 310 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 259, 559]
surviving nonsolo ucounts = 2[259, 559]
ids = [0, 9]

====================================================================================

UMI info for barcode GCGCGATAGGTTCCTA-1 contig 1 = TGGGGGCAGG...
umi AAAGTTTGCT = 262 reads: +388 validated
umi TTCGTCCGGT = 562 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 142 reads
cdr3 = CQQSYTTLLTF at 361, score = 9 + 9
umis assigned: [0, 9]
of which 2 are surviving nonsolos
reads assigned: 809
start codons at 34, 40, 96, 109, 245, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.14 = GCGCGATAGTAGGTGC-1

using 35 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 25]
surviving nonsolo ucounts = 1[25]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.17 = GCGCGATAGTTACCCA-1

using 325 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 6, 9, 18, 285]
surviving nonsolo ucounts = 1[285]
ids = [7]

====================================================================================

UMI info for barcode GCGCGATAGTTACCCA-1 contig 1 = GAATCAGACC...
umi TTCGCTACCT = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
381-413 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYPPTF at 352, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.23 = GCGCGATCACAGCCCA-1

using 1381 reads

====================================================================================

graph has 406 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 108, 1268]
surviving nonsolo ucounts = 2[108, 1268]
ids = [2, 0]

====================================================================================

UMI info for barcode GCGCGATCACAGCCCA-1 contig 1 = AGTCCCAGTC...
umi ATTCCCCTTG = 115 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQLNSYPGTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 20, 26, 82, 231, 450
confident = false

REJECT CONTIGS

TIG 1[bases=338]
4-187 ==> 169-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=5)
185-236 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
236-338 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 1255
start codons at 6, 78, 180, 254, 315
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.25 = GCGCGATCACCGTTGG-1

using 4752 reads

====================================================================================

graph has 2604 edges initially, 30 edges after simplification

total ucounts = 531
nonsolo ucounts = 166[2^75, 3^35, 4^15, 5^10, 6^5, 7^3, 8, 9^3, 10, 11^2, 13, 22, 101, 107, 163, 278, 280, 281, 291, 292, 302, 324, 328, 366, 373, 383]
surviving nonsolo ucounts = 13[107, 163, 278, 280, 281, 291, 292, 302, 324, 328, 366, 373, 383]
ids = [199, 483, 12, 442, 304, 191, 172, 213, 106, 424, ...]

====================================================================================

UMI info for barcode GCGCGATCACCGTTGG-1 contig 1 = GACATGGGAA...
umi CCTGGAATGA = 294 reads: +442 validated
umi GTATTACTGG = 2 reads: -375X +1 -2XX +1 -3XX +2 -1XX +1 -5XX +2 -6XX +3 -2XX +20 -1XX +1 -1XX +4 -11 invalidated
umi TTATTATTCC = 133 reads: +423 -19 non-validated

UMI info for barcode GCGCGATCACCGTTGG-1 contig 2 = AGAGCTCTGG...
umi AAGGGTGTCT = 277 reads: +385 validated
umi ACAAGATCGG = 369 reads: +385 validated
umi ATGTAGCCCA = 327 reads: +385 validated
umi CCCCGGCTTC = 294 reads: +385 validated
umi CGGAAGGTTG = 303 reads: +385 validated
umi GCGTTGATGG = 286 reads: +385 validated
umi GTCCCCGATG = 129 reads: -351X +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi TCATATGCAT = 325 reads: +385 validated
umi TCGCATTGGA = 281 reads: +385 validated
umi TGGTATTTCA = 372 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=591]
47-395 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
406-437 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=5)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
489-591 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARSPGYCSGGSCYGGYYFDYW at 392, score = 9 + 7
umis assigned: [191, 351, 483]
of which 2 are surviving nonsolos
reads assigned: 423
start codons at 3, 47, 91, 507, 568
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 386 reads
cdr3 = CQQYGSSPLTF at 368, score = 9 + 9
umis assigned: [12, 25, 106, 172, 213, 304, 357, 424, 442, 469]
of which 10 are surviving nonsolos
reads assigned: 2920
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

TACTGTGCGAGAAGCCCTGGGTATTGTAGTGGTGGTAGCTGCTACGGGGGGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.29 = GCGCGATCAGACAAAT-1

using 240 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [0]

====================================================================================

UMI info for barcode GCGCGATCAGACAAAT-1 contig 1 = AGCTTCAGCT...
umi GTAGGATGGG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
435-567 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CAAWDDSLNGKVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.30 = GCGCGATCAGACGCAA-1

using 24 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.35 = GCGCGATCAGTACACT-1

using 328 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 325]
surviving nonsolo ucounts = 1[325]
ids = [1]

====================================================================================

UMI info for barcode GCGCGATCAGTACACT-1 contig 1 = TGAGCTACAA...
umi GCCCGCCAAT = 299 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=503]
0-31 ==> 144-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
31-394 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
399-431 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
431-503 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYGTPQTF at 370, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 31, 100, 353, 383, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.36 = GCGCGATCAGTCACTA-1

using 227 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode GCGCGATCAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi GCGAAAACAA = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-494 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.44 = GCGCGATCATGCCACG-1

using 353 reads

====================================================================================

graph has 524 edges initially, 2 edges after simplification

total ucounts = 192
nonsolo ucounts = 65[2^29, 3^16, 4^7, 5^5, 6^4, 7, 8, 9, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.51 = GCGCGATCATTGGGCC-1

using 337 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [2]

====================================================================================

UMI info for barcode GCGCGATCATTGGGCC-1 contig 1 = GAGTCAGTCC...
umi CTCTTCGTCC = 341 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYDNLPPTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.52 = GCGCGATCATTTGCTT-1

using 47 reads

====================================================================================

graph has 46 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3, 4, 6, 8^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.54 = GCGCGATGTAAAGGAG-1

using 591 reads

====================================================================================

graph has 244 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2, 4, 13, 236, 336]
surviving nonsolo ucounts = 2[236, 336]
ids = [3, 4]

====================================================================================

UMI info for barcode GCGCGATGTAAAGGAG-1 contig 1 = TGATCAGGAC...
umi TATCACCCAA = 236 reads: +397 validated
umi TGACCATGTT = 44 reads: -332 +7 -3XX +2 -14XX +1 -2XX +2 -1XX +22 -1XX +2 -2XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=564]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQTPWTF at 367, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 275
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.61 = GCGCGATGTATCACCA-1

using 57 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 47]
surviving nonsolo ucounts = 1[47]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.67 = GCGCGATGTGAGTATA-1

using 90 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 57
nonsolo ucounts = 18[2^13, 3^3, 5, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.70 = GCGCGATGTTCAGTAC-1

using 221 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================

UMI info for barcode GCGCGATGTTCAGTAC-1 contig 1 = GAGCTACAAC...
umi TTGCGCTGCT = 207 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-516 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.72 = GCGCGATGTTGACGTT-1

using 5024 reads

====================================================================================

graph has 2632 edges initially, 30 edges after simplification

total ucounts = 551
nonsolo ucounts = 200[2^91, 3^44, 4^19, 5^11, 6^3, 7^2, 8^3, 9^5, 10, 11, 14, 16, 18, 95, 110, 117, 163, 172, 175, 205, 217, 237, 240, 248, 251, 267, 275, 277, 331, 678]
surviving nonsolo ucounts = 18[6, 95, 110, 117, 163, 172, 175, 205, 217, 237, 240, 248, 251, 267, 275, 277, 331, 678]
ids = [511, 273, 150, 297, 528, 364, 271, 121, 428, 450, ...]

====================================================================================

UMI info for barcode GCGCGATGTTGACGTT-1 contig 1 = GGGGTCACAA...
umi AATTAATTGT = 275 reads: +388 validated
umi AGATCTCTAA = 241 reads: +388 validated
umi AGCATCATTA = 267 reads: +388 validated
umi ATGCCACTAT = 337 reads: +388 validated
umi ATGGATTATG = 204 reads: +388 validated
umi CAATATCGGT = 113 reads: +388 validated
umi CCAATGTATC = 252 reads: +388 validated
umi CCTGTCGCAT = 247 reads: +388 validated
umi CTGTATCTGT = 174 reads: +388 validated
umi GAATGATGCA = 685 reads: -346X +42 invalidated
umi GTGCACTCTA = 170 reads: +388 validated
umi TCAATTTTTC = 218 reads: +388 validated
umi TCGCCCAAAC = 239 reads: +388 validated
umi TTATGCACAG = 278 reads: +388 validated
umi TTCTTGCTGT = 166 reads: +388 validated

UMI info for barcode GCGCGATGTTGACGTT-1 contig 2 = GCTCCCTCTG...
umi CTTAACGGTT = 92 reads: +372 -1 +54 non-validated
umi GATAAGGTGC = 116 reads: +427 validated
umi TTATTTACGT = 6 reads: -59 +16 -1 +39 -1 +7 -1 +2 -1 +6 -22 +56 -89 +56 -45 +1 -1 +3 -1 +11 -1 +4 -1 +1 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=14)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
426-637 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 539 reads
cdr3 = CCSYAGTRKYVF at 362, score = 8 + 8
umis assigned: [43, 69, 75, 120, 121, 150, 181, 202, 271, 289] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3791
start codons at 38, 246, 372, 390, 558
confident = true

TIG 2[bases=578]
121-450 ==> 0-329 on |138|IGHV3-43|L-REGION+V-REGION| [len=354] (mis=53)
498-548 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=6)
548-578 ==> 0-30 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 15 reads
cdr3 = CVKPHSLGWSPSGAFDIW at 463, score = 7 + 8
umis assigned: [273, 297, 511]
of which 3 are surviving nonsolos
reads assigned: 210
start codons at 13, 121, 266, 272, 347, 356, 424, 529
confident = true
>vscore_69.72_83.0%
ATGGAGTTGGGACTGGGCTGGATTTTCCTTTTGGCTATCTTAAAAGGTGTCCAGTGTGAAGTGCAGTTGGCGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCTGGTCCCTGAGACTCTCCTGTACAATATCTGGATTCACCTTTGATGACTATGTCCTACACTGGGTCCGGCAAGTTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTGGCTGGAAGAGTGGTTATGTTGGCTATGCGGACTCTGTGAAGGGCCGGTTCACCATATCCAGAGACATCGCCGAGAACTCCCTCTATCTACAAATGAACAGTCTGAGGACTGACGACACGGCTTTGTATTACTGTGTGAAGCC
now this is a cell
paired!

ACGGCTTTGTATTACTGTGTGAAGCCGCATAGTCTTGGCTGGTCTCCCTCGGGGGCCTTTGATATTTGGGGCCAAGGGACAATGGTCACCGTCTCTTCCG <==> TCTGGTCTCCAGGCTGAGGACGAGGCTGACTATTACTGCTGCTCATATGCAGGTACTAGAAAATATGTCTTCGGAAGTGGGACCAAGGTCACCGTCTTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.75 = GCGCGATGTTTGACAC-1

using 169 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode GCGCGATGTTTGACAC-1 contig 1 = GATCAGGACT...
umi CCAGCCCGGT = 162 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=521]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-521 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.84 = GCGCGATTCCACGACG-1

using 269 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 262]
surviving nonsolo ucounts = 1[262]
ids = [1]

====================================================================================

UMI info for barcode GCGCGATTCCACGACG-1 contig 1 = GCTCTGCTTC...
umi CAGACAAGAT = 239 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=605]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-605 ==> 0-160 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.87 = GCGCGATTCCGAGCCA-1

using 288 reads

====================================================================================

graph has 157 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 11, 272]
surviving nonsolo ucounts = 1[272]
ids = [2]

====================================================================================

UMI info for barcode GCGCGATTCCGAGCCA-1 contig 1 = GTGGGTCCAG...
umi GCGCTTCAAC = 271 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=637]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-355 ==> 0-320 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=28)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSADSISPLATRVTF at 350, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 35, 165, 183, 302
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.95 = GCGCGATTCGTTGCCT-1

using 246 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 240]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GCGCGATTCGTTGCCT-1 contig 1 = GGGATACTTT...
umi CATCCTTGGC = 238 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=529]
40-388 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=8)
410-458 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARAGSYHTPFDYW at 385, score = 9 + 7
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 237
start codons at 40, 84
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.97 = GCGCGATTCTCCTATA-1

using 164 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 156]
surviving nonsolo ucounts = 1[156]
ids = [1]

====================================================================================

UMI info for barcode GCGCGATTCTCCTATA-1 contig 1 = CAGAGCTCTG...
umi GTGGCACGGG = 145 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=522]
0-45 ==> 7-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
45-393 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
430-522 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSPQTF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 45, 253, 379
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.117 = GCGGGTTAGCAATATG-1

using 259 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 247]
surviving nonsolo ucounts = 1[247]
ids = [4]

====================================================================================

UMI info for barcode GCGGGTTAGCAATATG-1 contig 1 = GCTGTGCTGT...
umi ATCATGGGGT = 225 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=511]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-511 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.127 = GCGGGTTAGCTAACAA-1

using 199 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 193]
surviving nonsolo ucounts = 1[193]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.130 = GCGGGTTAGCTGGAAC-1

using 520 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 231, 281]
surviving nonsolo ucounts = 2[231, 281]
ids = [3, 5]

====================================================================================

UMI info for barcode GCGGGTTAGCTGGAAC-1 contig 1 = AGGAGTCAGA...
umi GCGCATTGTG = 231 reads: +388 validated
umi TAATCAGTAT = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 72 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 506
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.133 = GCGGGTTAGGACTGGT-1

using 6528 reads

====================================================================================

graph has 3476 edges initially, 20 edges after simplification

total ucounts = 841
nonsolo ucounts = 314[2^150, 3^64, 4^40, 5^12, 6^8, 7^4, 8^5, 9^4, 10^2, 15, 16, 128, 134, 151, 162, 170, 173, 185, 197, 200, 207, 209, 222, 231, 232, 239, 245, 251, 255, 270, 274, 280, 290, 381]
surviving nonsolo ucounts = 23[128, 134, 151, 162, 170, 173, 185, 197, 200, 207, 209, 222, 231, 232, 239, 245, 251, 255, 270, 274, 280, 290, 381]
ids = [442, 132, 9, 451, 31, 4, 726, 380, 359, 372, ...]

====================================================================================

UMI info for barcode GCGGGTTAGGACTGGT-1 contig 1 = GCTGGGGTCT...
umi AAAGAGACAC = 173 reads: +388 validated
umi AAATATGCCT = 150 reads: +388 validated
umi AAGCACAGCC = 168 reads: +388 validated
umi AGATCGCTAA = 134 reads: +388 validated
umi AGTCACTTGC = 245 reads: +388 validated
umi AGTGTATTGC = 259 reads: +388 validated
umi ATCGCTGGGT = 274 reads: +388 validated
umi CCACTTACCT = 276 reads: +388 validated
umi CCTGCAGCGT = 223 reads: +388 validated
umi CCTTGTCTAT = 249 reads: +388 validated
umi CGATGACGCC = 236 reads: +388 validated
umi CGCATCTCCT = 197 reads: +388 validated
umi CGGTATACCA = 206 reads: +388 validated
umi CGTAGCGGTT = 197 reads: +388 validated
umi GAAAAGGGGG = 127 reads: +388 validated
umi GAATCTATCA = 161 reads: +388 validated
umi GATTTTCGGA = 255 reads: +388 validated
umi GGATCATTAG = 208 reads: +388 validated
umi GGTACTTGTT = 282 reads: +388 validated
umi TCTCACTTGC = 246 reads: +388 validated
umi TCTCCTTTTG = 403 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -39XX +3 -2XX +1 -3XX +2 -10XX +90 invalidated
umi TGACGCCCCG = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 645 reads
cdr3 = CSSYTSSSTRVF at 365, score = 8 + 8
umis assigned: [4, 9, 31, 132, 159, 166, 192, 297, 333, 341] and 12 others
of which 22 are surviving nonsolos
reads assigned: 4732
start codons at 41, 198, 242, 249
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.137 = GCGGGTTAGGCCCGTT-1

using 81 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 8, 67]
surviving nonsolo ucounts = 1[67]
ids = [1]

====================================================================================

UMI info for barcode GCGGGTTAGGCCCGTT-1 contig 1 = TCCCCTAGAT...
umi ATCCACCATC = 56 reads: +434 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=472]
0-24 ==> 35-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
24-377 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
426-460 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 366, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 56
start codons at 24, 222, 227, 244, 288, 321
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.138 = GCGGGTTAGGCTCTTA-1

using 100 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 93]
surviving nonsolo ucounts = 1[93]
ids = [4]

====================================================================================

UMI info for barcode GCGGGTTAGGCTCTTA-1 contig 1 = GAATCAGTCC...
umi GTACTTCCGC = 70 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=449]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-449 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 25, 31, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.145 = GCGGGTTAGTAATCCC-1

using 301 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 296]
surviving nonsolo ucounts = 1[296]
ids = [2]

====================================================================================

UMI info for barcode GCGGGTTAGTAATCCC-1 contig 1 = AGGAGTCAGA...
umi CGTGTTTTCC = 297 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNSYSPYTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.147 = GCGGGTTAGTATCGAA-1

using 205 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[62, 136]
surviving nonsolo ucounts = 2[62, 136]
ids = [8, 0]

====================================================================================

UMI info for barcode GCGGGTTAGTATCGAA-1 contig 1 = ACCAGGACAC...
umi CAATCGACAA = 106 reads: +388 validated

UMI info for barcode GCGGGTTAGTATCGAA-1 contig 2 = GCTGGGGTCT...
umi TAGAGCTAGG = 59 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=429]
13-364 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
363-401 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
401-429 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYDDLPITF at 340, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 13, 19, 75, 88, 350, 353
confident = false

TIG 2[bases=489]
0-41 ==> 1-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
41-385 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-489 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CCSYAGRYSWVF at 365, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 41, 180, 198, 249, 252, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.156 = GCGGGTTAGTTAGGTA-1

using 78 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[78]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.159 = GCGGGTTAGTTTCCTT-1

using 311 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 6, 293]
surviving nonsolo ucounts = 1[293]
ids = [1]

====================================================================================

UMI info for barcode GCGGGTTAGTTTCCTT-1 contig 1 = GGAGTCAGAC...
umi AACCTTACTG = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQANSFPLTF at 353, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 26, 32, 88, 101, 240, 258, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.160 = GCGGGTTCAAATTGCC-1

using 32 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[5, 10, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.163 = GCGGGTTCAAGGTTTC-1

using 355 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 350]
surviving nonsolo ucounts = 1[350]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=443]
4-81 ==> 5531-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-121 ==> 0-85 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
111-273 ==> 198-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
269-307 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
307-443 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTWTF at 249, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 36, 69, 105, 232, 252, 349
confident = false
not full
full length transcript of length 443
VJ delta = 137
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.174 = GCGGGTTCACGTCAGC-1

using 512 reads

====================================================================================

graph has 146 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[220, 289]
surviving nonsolo ucounts = 2[220, 289]
ids = [2, 0]

====================================================================================

UMI info for barcode GCGGGTTCACGTCAGC-1 contig 1 = ATACTTTCTG...
umi ATTTAAGGCA = 235 reads: +433 validated

UMI info for barcode GCGGGTTCACGTCAGC-1 contig 2 = GCTGGGGTCT...
umi GCAATCTGGT = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=578]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=52)
422-470 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
470-578 ==> 0-108 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CVRGADYTFFYSSGYFHSW at 382, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 37, 81, 524
confident = false

TIG 2[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 41, 249, 348, 375, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.180 = GCGGGTTCAGACACTT-1

using 262 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 251]
surviving nonsolo ucounts = 1[251]
ids = [5]

====================================================================================

UMI info for barcode GCGGGTTCAGACACTT-1 contig 1 = GGGGTCACAA...
umi TCCTTATCTT = 244 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.185 = GCGGGTTCAGCTCCGA-1

using 41 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.193 = GCGGGTTCAGTATCTG-1

using 56 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^2, 3^2, 4^2, 5^3, 6^2, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.200 = GCGGGTTCATCTCCCA-1

using 282 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 2[2, 270]
surviving nonsolo ucounts = 1[270]
ids = [5]

====================================================================================

UMI info for barcode GCGGGTTCATCTCCCA-1 contig 1 = TGGGGGATCA...
umi ATTCTAACAA = 270 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTRETF at 371, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.208 = GCGGGTTCATGTCTCC-1

using 10055 reads

====================================================================================

graph has 3842 edges initially, 66 edges after simplification

total ucounts = 631
nonsolo ucounts = 274[2^113, 3^66, 4^21, 5^15, 6^8, 7, 8^2, 9, 11, 13^3, 15, 27, 44, 58, 60, 86, 87, 99, 125, 127, 133, 152, 166, 178, 185, 202, 214, 215, 225^2, 226, 227, 230, 231, 236, 243, 247, 248, 250, 260, 261, 263, 265, 269, 274, 275, 282, 284, 289^2, 290, 371, 552]
surviving nonsolo ucounts = 39[27, 60, 87, 99, 125, 127, 133, 152, 166, 178, 185, 202, 214, 215, 225^2, 226, 227, 230, 231, 236, 243, 247, 248, 250, 260, 261, 263, 265, 269, 274, 275, 282, 284, 289^2, 290, 371, 552]
ids = [81, 37, 142, 327, 2, 608, 580, 341, 624, 522, ...]

====================================================================================

UMI info for barcode GCGGGTTCATGTCTCC-1 contig 1 = ATCACCCAAC...
umi AATCATCGAG = 61 reads: +345 -1 +1 -1 +1 -2X +1 -1 +3 -2 +4 -1 +2 -1 +18 -43 invalidated
umi ACTATCAGCT = 27 reads: -38 +340 -1 +19 -29 non-validated
umi ACTATCTGGC = 216 reads: +427 validated
umi AGCTATGCCC = 201 reads: +427 validated
umi ATGCTTACCA = 91 reads: +427 validated
umi CCGCTATTTT = 185 reads: +427 validated
umi CGCTATACTC = 186 reads: +427 validated
umi GTAGTTCAGC = 266 reads: +427 validated
umi TACAGTACCG = 235 reads: +427 validated
umi TAGTCACCTC = 199 reads: +427 validated
umi TTGTCTGTCT = 126 reads: +427 validated

UMI info for barcode GCGGGTTCATGTCTCC-1 contig 2 = GGGGAGGAGT...
umi AAAATACGCC = 127 reads: +391 validated
umi AATGTTGCTC = 258 reads: +391 validated
umi ACCGCTAGAT = 225 reads: +391 validated
umi ACCTTTTCGG = 228 reads: +391 validated
umi ACTATCCCCT = 246 reads: +391 validated
umi ATGGTCAACC = 267 reads: +391 validated
umi CTAGTGTCTC = 9 reads: -391 non-validated
umi CTTCTTCCGG = 257 reads: +391 validated
umi GAAATACTTG = 101 reads: +391 validated
umi GATCTGTTGC = 155 reads: +391 validated
umi GATGGCGTCA = 283 reads: +391 validated
umi GCACGTTCCT = 228 reads: +391 validated
umi GCCAGCTCGG = 293 reads: +391 validated
umi GCGCGTTTCA = 294 reads: +391 validated
umi GCTACCCATC = 159 reads: -349 +1 -2XX +2 -3XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi GGAAGGCGGC = 551 reads: +391 validated
umi GGCTAGTCTA = 279 reads: +391 validated
umi GGGTTTGTGC = 202 reads: +391 validated
umi TACCGCGCTA = 287 reads: +391 validated
umi TCCCTTTTGG = 226 reads: +391 validated
umi TCCGTGTGGC = 273 reads: +391 validated
umi TCCTATATTC = 265 reads: +391 validated
umi TCTAGTACGA = 190 reads: +391 validated
umi TGAACCGGAC = 282 reads: +391 validated
umi TTACGTAGGG = 132 reads: +391 validated
umi TTTCATTGAT = 249 reads: +391 validated
umi TTTTAACCCA = 4 reads: -391 non-validated

GOOD CONTIGS

TIG 1[bases=556]
0-58 ==> 0-58 on |74|IGHV1-45|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |75|IGHV1-45|L-REGION+V-REGION| [len=353] (mis=3)
435-485 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 143 reads
cdr3 = CASHGPAVAGTGGAFDIW at 400, score = 8 + 8
umis assigned: [37, 81, 84, 106, 142, 220, 262, 418, 457, 473] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1769
start codons at 58, 104, 118, 256, 261, 278, 340, 355, 391, 410, 466
confident = true

TIG 2[bases=558]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 775 reads
cdr3 = CQQYDNLLGITF at 358, score = 9 + 8
umis assigned: [2, 41, 67, 72, 82, 146, 288, 318, 327, 341] and 17 others
of which 27 are surviving nonsolos
reads assigned: 5985
start codons at 31, 37, 93, 106, 245, 368, 464
confident = true
now this is a cell
paired!

ACAGCCATGTATTACTGTGCAAGTCATGGGCCAGCAGTGGCTGGTACAGGCGGTGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCTCGGGATCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.215 = GCGGGTTGTAAGTGGC-1

using 348 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[64, 281]
surviving nonsolo ucounts = 2[64, 281]
ids = [1, 2]

====================================================================================

UMI info for barcode GCGGGTTGTAAGTGGC-1 contig 1 = CAAGAGGCAG...
umi AGTTATAGTA = 53 reads: +394 validated

UMI info for barcode GCGGGTTGTAAGTGGC-1 contig 2 = AGCTCTGGGA...
umi CTTCCTTCGC = 243 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=485]
0-30 ==> 21-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
30-386 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-485 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQSYDSSLSGLYVF at 354, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 30, 184, 187, 238, 337, 364, 388
confident = false

TIG 2[bases=538]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=29)
439-470 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=7)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
510-538 ==> 0-28 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAKQGPGYYDSSGYEFDYW at 422, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 80, 225, 231, 236, 315, 383, 447, 462, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.222 = GCGGGTTGTATCTGCA-1

using 1015 reads

====================================================================================

graph has 1425 edges initially, 18 edges after simplification

total ucounts = 487
nonsolo ucounts = 182[2^77, 3^58, 4^23, 5^9, 6^10, 7^2, 15, 37, 119]
surviving nonsolo ucounts = 1[119]
ids = [223]

====================================================================================

UMI info for barcode GCGGGTTGTATCTGCA-1 contig 1 = ATCATCCAAC...
umi CGTGCCTCTC = 101 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=538]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
413-432 ==> 0-19 on |18|IGHD3-10|D-REGION| [len=27] (mis=0)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
479-538 ==> 0-59 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARERITMVRGRFDYW at 400, score = 9 + 7
umis assigned: [223]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 58, 214, 256, 322, 355, 421, 497
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.227 = GCGGGTTGTCAGAATA-1

using 1034 reads

====================================================================================

graph has 1413 edges initially, 18 edges after simplification

total ucounts = 521
nonsolo ucounts = 222[2^114, 3^47, 4^22, 5^19, 6^7, 7^4, 8^2, 10, 11^2, 12, 13, 15, 25]
surviving nonsolo ucounts = 1[25]
ids = [384]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.229 = GCGGGTTGTCCATCCT-1

using 313 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[313]
surviving nonsolo ucounts = 1[313]
ids = [0]

====================================================================================

UMI info for barcode GCGGGTTGTCCATCCT-1 contig 1 = GGAGGAGTCA...
umi CCGTTCATCG = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.232 = GCGGGTTGTCGCATAT-1

using 60 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 53]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.247 = GCGGGTTGTTCAACCA-1

using 224 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode GCGGGTTGTTCAACCA-1 contig 1 = GGAACTGCTC...
umi ATCTAAGGGC = 174 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=478]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-478 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQHYHNWPPITF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 31, 100, 173, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.251 = GCGGGTTGTTTAAGCC-1

using 256 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 244]
surviving nonsolo ucounts = 1[244]
ids = [5]

====================================================================================

UMI info for barcode GCGGGTTGTTTAAGCC-1 contig 1 = AGTCTCAGTC...
umi GACGTTCGTG = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSYTTLLTF at 347, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.253 = GCGGGTTGTTTCCACC-1

using 269 reads

====================================================================================

graph has 362 edges initially, 4 edges after simplification

total ucounts = 133
nonsolo ucounts = 46[2^26, 3^4, 4^6, 5^3, 7, 8^3, 9, 17, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.257 = GCGGGTTTCAACTCTT-1

using 296 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 288]
surviving nonsolo ucounts = 1[288]
ids = [3]

====================================================================================

UMI info for barcode GCGGGTTTCAACTCTT-1 contig 1 = GGGGAGGAAC...
umi GTCTCCAATC = 234 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=511]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-511 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.258 = GCGGGTTTCAAGATCC-1

using 213 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 206]
surviving nonsolo ucounts = 1[206]
ids = [1]

====================================================================================

UMI info for barcode GCGGGTTTCAAGATCC-1 contig 1 = AGAGCTCTGG...
umi CCCTTAGGCA = 202 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=571]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYASSPPGGSF at 368, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 44, 108, 252, 378, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.261 = GCGGGTTTCACATGCA-1

using 10 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.263 = GCGGGTTTCACCTCGT-1

using 263 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode GCGGGTTTCACCTCGT-1 contig 1 = GGGACTGATC...
umi GGAGGAACAT = 263 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=575]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
402-439 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
439-575 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQSPRGLTF at 372, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 36, 69, 105, 193, 355, 375, 481
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.265 = GCGGGTTTCACTATTC-1

using 214 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[5, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode GCGGGTTTCACTATTC-1 contig 1 = GGCTGGGGTC...
umi AGTGTTTGTA = 184 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-383 ==> 0-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-557 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYAGASWVF at 366, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 42, 193, 199, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.274 = GCGGGTTTCCCAGGTG-1

using 36 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 1[34]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.278 = GCGGGTTTCCCTTGTG-1

using 229 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 226]
surviving nonsolo ucounts = 1[226]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.282 = GCGGGTTTCCGCGGTA-1

using 1656 reads

====================================================================================

graph has 940 edges initially, 12 edges after simplification

total ucounts = 188
nonsolo ucounts = 62[2^25, 3^12, 4^7, 5^2, 6^2, 7^2, 8, 10, 11, 15, 50, 55, 116, 123, 140, 262, 276, 314]
surviving nonsolo ucounts = 8[2, 50, 55, 116, 123, 140, 276, 314]
ids = [41, 17, 162, 1, 139, 183, 44, 151]

====================================================================================

UMI info for barcode GCGGGTTTCCGCGGTA-1 contig 1 = AGAGCTCTGG...
umi ATGTAGCTTG = 276 reads: +373 validated
umi TAGTCATCAG = 122 reads: +373 validated
umi TCCCCCTGAC = 73 reads: -245 +6 -1XX +8 -1XX +11 -1XX +20 -1XX +3 -1XX +7 -1XX +9 -3XX +5 -1XX +2 -1XX +1 -12X +1 -1XX +6 -2XX +6 -5XX +7 -1XX +4 invalidated
umi TCCTGGTCTC = 312 reads: +373 validated

UMI info for barcode GCGGGTTTCCGCGGTA-1 contig 2 = GGGAGAGGAG...
umi ATCGTGTGGT = 2 reads: -38 +17 -1 +1 -1 +18 -1 +2 -1 +13 -51 +56 -224 non-validated
umi TGTTCAGCGT = 51 reads: +424 validated
umi TTTAGGTCAT = 123 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=553]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-377 ==> 0-333 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 93 reads
cdr3 = CQQPGAF at 368, score = 9 + 7
umis assigned: [44, 139, 149, 151]
of which 3 are surviving nonsolos
reads assigned: 774
start codons at 44, 252, 459
confident = true

TIG 2[bases=597]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=11)
452-497 ==> 7-52 on |49|IGHJ1|J-REGION| [len=52] (mis=2)
497-597 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 2 umis using 17 reads
cdr3 = CARDTYSSSPMWHFQHW at 415, score = 9 + 7
umis assigned: [41, 162, 183]
of which 3 are surviving nonsolos
reads assigned: 175
start codons at 73, 224, 229, 282, 287, 290, 308, 376, 445, 478
confident = true
now this is a cell
paired!

GACACGGCTGTCTATTACTGTGCGAGAGATACTTATAGCAGCAGTCCCATGTGGCACTTCCAACACTGGGGCCAGGGCACCATGGTCACCGTCTCCTCAG <==> TTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTATTGTCAGCAGCCTGGAGCTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.299 = GCGGGTTTCTCACATT-1

using 263 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=315]
2-142 ==> 205-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
141-179 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
179-315 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSSWPLTF at 118, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 2, 5, 221
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.300 = GCGGGTTTCTCCGGTT-1

using 275 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 268]
surviving nonsolo ucounts = 1[268]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=544]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-31 ==> 5706-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 30, 238, 364, 450
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 69.308 = GCGGGTTTCTTAGAGC-1

using 9060 reads

====================================================================================

graph has 3881 edges initially, 66 edges after simplification

total ucounts = 579
nonsolo ucounts = 237[2^88, 3^49, 4^25, 5^9, 6^9, 7^4, 8^6, 10, 11^2, 15^2, 17, 24, 25, 43, 44, 56, 82, 95, 104, 109, 122, 135, 140, 156, 166, 173, 175^2, 176, 177, 185, 190, 193, 197, 201^2, 211, 218^2, 219, 227, 230, 231^2, 237, 244, 245, 250, 301, 392, 516, 727]
surviving nonsolo ucounts = 38[25, 44, 56, 82, 95, 104, 109, 122, 135, 140, 156, 166, 173, 175^2, 176, 177, 185, 190, 193, 197, 201^2, 211, 218^2, 219, 227, 230, 231^2, 237, 244, 245, 250, 392, 516, 727]
ids = [269, 208, 451, 401, 202, 423, 69, 374, 420, 379, ...]

====================================================================================

UMI info for barcode GCGGGTTTCTTAGAGC-1 contig 1 = AGATCTCAGA...
umi AAAAACTCCT = 174 reads: +418 validated
umi ACGCCGCGCT = 213 reads: +418 validated
umi ACGCGGTCTG = 232 reads: +413 -5 non-validated
umi AGATATGTAC = 187 reads: +418 validated
umi CATTCACAGC = 76 reads: +400 -1 +2 -1X +9 -1 +1 -3 invalidated
umi CATTCACCTG = 160 reads: +418 validated
umi CCTTGCTAAT = 195 reads: +5 -2XX +7 -2XX +58 -1XX +12 -1XX +5 -1XX +1 -1XX +26 -1XX +20 -1XX +4 -1XX +4 -3XX +4 -1XX +24 -1XX +14 -2XX +1 -2XX +1 -1XX +5 -3XX +2 -1XX +1 -7X +1 -1X +1 -2X +5 -1XX +1 -2XX +5 -1XX +11 -1XX +24 -1XX +10 -1XX +6 -1XX +6 -1XX +15 -1XX +26 -7XX +1 -4XX +1 -8XX +1 -2XX +1 -3XX +1 -39XX invalidated
umi CGGTTAGTCA = 19 reads: +360 -58 non-validated
umi CGTGATAAAT = 192 reads: +411 -7 non-validated
umi GGACACATAC = 123 reads: +376 -5 +37 non-validated
umi GTACCGCGGG = 83 reads: +362 -1X +5 -3 +7 -1 +1 -1 +1 -1 +5 -1X +1 -2X +2 -1X +1 -1X +2 -19X invalidated
umi GTGAACAGGA = 108 reads: +392 -1 +25 non-validated
umi TGACAACCTC = 199 reads: +418 validated
umi TGTTCTCCAT = 196 reads: +418 validated
umi TTCACAACTG = 392 reads: +418 validated

UMI info for barcode GCGGGTTTCTTAGAGC-1 contig 2 = TGGGGGCTGG...
umi AAACATAACC = 204 reads: +385 validated
umi AAAGGAACCC = 518 reads: -272 +113 non-validated
umi AAATGCTATC = 174 reads: +385 validated
umi ACGACGTCAC = 254 reads: +217 -6XX +162 invalidated
umi ACGTATGGTC = 111 reads: +385 validated
umi CACCGAACCA = 231 reads: +385 validated
umi CCAGGTCGTG = 43 reads: +32 -1 +313 -2 +18 -1 +1 -1 +9 -4 +1 -1 +1 non-validated
umi CCTCCGACGC = 216 reads: +385 validated
umi CTACCACGTC = 187 reads: +385 validated
umi CTACCATGTC = 154 reads: +385 validated
umi CTGCCTGCTC = 247 reads: +385 validated
umi GAGAGTTATG = 169 reads: +385 validated
umi GGCATTCTAC = 138 reads: +385 validated
umi GGGAATTCCA = 235 reads: +385 validated
umi GTCTGAGTTA = 136 reads: +385 validated
umi GTGCCACGAC = 188 reads: +385 validated
umi GTTCTCCGTT = 231 reads: +385 validated
umi TAATTCAGGA = 53 reads: +385 validated
umi TTACTAAGAG = 218 reads: +385 validated
umi TTGCTGATGG = 219 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=568]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=9)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 146 reads
cdr3 = CARFNGWYYSAFDYW at 421, score = 9 + 7
umis assigned: [0, 64, 66, 92, 202, 203, 242, 269, 276, 374] and 5 others
of which 14 are surviving nonsolos
reads assigned: 2495
start codons at 79, 235, 296, 314, 382
confident = true

TIG 2[bases=642]
46-384 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
431-642 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 19 umis using 561 reads
cdr3 = CSSYTSTSVLF at 370, score = 8 + 8
umis assigned: [3, 4, 5, 58, 69, 177, 208, 233, 284, 285] and 10 others
of which 20 are surviving nonsolos
reads assigned: 3866
start codons at 46, 203, 254, 257
confident = true

REJECT CONTIGS

TIG 1[bases=658]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
56-407 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=6)
409-447 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
447-658 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CAPWDDSLSGPWVF at 377, score = 7 + 8
umis assigned: [102, 209, 265, 345]
of which 4 are surviving nonsolos
reads assigned: 1240
start codons at 56, 217, 360, 385, 390
confident = false
not full
full length stopped transcript of length 658
frameshifted full length stopped transcript of length 658
VJ delta = 20
not full
now this is a cell
paired!

GCCGAGGACACGGCTGTGTATTACTGTGCGAGGTTCAACGGCTGGTATTACTCTGCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACTAGCACCAGCGTGCTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk069-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk069-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

13.509 seconds used processing barcodes, peak mem = 0.23
