[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.34 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk067-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk067-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk067.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.0 = GCCTCTACAGCAGTTT-1

using 16388 reads

====================================================================================

graph has 6332 edges initially, 62 edges after simplification

total ucounts = 1091
nonsolo ucounts = 551[2^193, 3^120, 4^68, 5^46, 6^22, 7^17, 8^8, 9^6, 10^2, 11^3, 12^2, 14, 16, 17, 27, 31, 38, 43, 50, 53, 59, 70, 107, 112, 116, 118, 120, 134, 141, 151, 156, 158, 168, 174, 181, 187, 193, 225, 237, 241, 245, 255^2, 258, 268, 269, 270, 276, 278, 279^2, 281, 283, 287, 289^2, 291, 292, 297, 298, 299, 301, 302, 305, 312, 318, 326, 334, 336, 358, 375, 380, 381, 398, 553]
surviving nonsolo ucounts = 56[27, 31, 50, 59, 107, 112, 116, 118, 120, 134, 141, 151, 156, 158, 168, 174, 181, 193, 225, 237, 241, 245, 255^2, 258, 268, 269, 270, 276, 278, 279^2, 281, 283, 287, 289^2, 291, 292, 297, 298, 299, 301, 302, 305, 312, 318, 326, 334, 336, 358, 375, 380, 381, 398, 553]
ids = [651, 733, 269, 927, 794, 583, 536, 1081, 88, 590, ...]

====================================================================================

UMI info for barcode GCCTCTACAGCAGTTT-1 contig 1 = GGAGTCAGTC...
umi AACATACTCT = 291 reads: +391 validated
umi AACGACACAA = 286 reads: +391 validated
umi AATATTCGAA = 240 reads: +391 validated
umi AATGGCGTTG = 279 reads: +391 validated
umi ACCAGTCCAA = 120 reads: +391 validated
umi ACGTCCGGTC = 269 reads: +391 validated
umi ACTAATCCTA = 372 reads: +391 validated
umi ACTATACCAG = 277 reads: +391 validated
umi ACTCAGTTCC = 280 reads: +391 validated
umi AGCACTTCTA = 295 reads: +391 validated
umi ATCCGGTTCC = 288 reads: +391 validated
umi ATCGAAACAG = 296 reads: +391 validated
umi ATGCCCGCCT = 312 reads: +391 validated
umi CACTCACCTC = 399 reads: +391 validated
umi CATCCATACA = 332 reads: +391 validated
umi CATTCACGCC = 301 reads: +391 validated
umi CCAGCGGGGA = 385 reads: +391 validated
umi CTAAAGATCA = 275 reads: +391 validated
umi CTAGACTTAC = 239 reads: +391 validated
umi CTCGGTGCAA = 280 reads: +391 validated
umi CTTCGTACAA = 276 reads: +391 validated
umi GACACGATAG = 254 reads: +391 validated
umi GACACTCTCT = 290 reads: +391 validated
umi GACTTAGGCC = 298 reads: +391 validated
umi GATCACAGCA = 380 reads: +391 validated
umi GATCTTAGCT = 135 reads: +391 validated
umi GGACTCGGAG = 302 reads: +391 validated
umi GGCCACGATA = 274 reads: +391 validated
umi GTATGAGTCT = 256 reads: +391 validated
umi GTATTTCTCA = 355 reads: +391 validated
umi GTCACCCTGT = 290 reads: +391 validated
umi GTCCTATCGG = 232 reads: +391 validated
umi GTCCTGAGTG = 556 reads: +391 validated
umi GTTCTGTCAC = 174 reads: +391 validated
umi GTTTTACGTT = 338 reads: +391 validated
umi TACCGGCATA = 323 reads: +391 validated
umi TACTACATCG = 308 reads: +391 validated
umi TATGCATTAT = 160 reads: +365 -2 +1 -11 +1 -1 +10 non-validated
umi TCATATCTCA = 167 reads: +391 validated
umi TCCGTGGACT = 321 reads: +391 validated
umi TCGTCAGTCG = 262 reads: +391 validated
umi TGTAGTTCCT = 244 reads: +391 validated
umi TTCTAGGTTC = 144 reads: +391 validated

UMI info for barcode GCCTCTACAGCAGTTT-1 contig 2 = AGCTCTGGGA...
umi ACAATTATCG = 272 reads: +418 validated
umi CGGATCCGCC = 142 reads: +418 validated
umi CTTTAAATTA = 115 reads: +418 validated
umi GATATCGGAC = 112 reads: +418 validated
umi GTCTTGTGGC = 151 reads: +418 validated
umi GTGTACAATC = 31 reads: +223 -46 +99 -1 +3 -1 +1 -1 +2 -1 +5 -1 +1 -1 +2 -1 +1 -3 +3 -1 +2 -1 +6 -1 +8 -2 +1 non-validated
umi TACCCGCCCC = 109 reads: +379 -3 +36 non-validated
umi TCTTATTCCA = 61 reads: +418 validated
umi TTTGCCCCTT = 120 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=553]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=17)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 42 umis using 1797 reads
cdr3 = CQHYDNLPRVAF at 353, score = 9 + 7
umis assigned: [18, 26, 52, 59, 88, 102, 104, 105, 106, 128] and 33 others
of which 43 are surviving nonsolos
reads assigned: 11998
start codons at 26, 32, 88, 101, 240, 363, 459
confident = true

TIG 2[bases=680]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=50)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
498-680 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 119 reads
cdr3 = CARGSMNGWLLFDSW at 422, score = 7 + 6
umis assigned: [71, 427, 536, 583, 722, 733, 794, 927, 1081]
of which 9 are surviving nonsolos
reads assigned: 1091
start codons at 80, 225, 231, 236, 315, 383, 437, 441
confident = true

REJECT CONTIGS

TIG 1[bases=336]
3-84 ==> 5919-6000 on rc of segment after IGHD1-1 exon 1 [len=6000] (mis=0)
106-154 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
154-336 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
umis assigned: [215, 269, 517, 651]
of which 4 are surviving nonsolos
reads assigned: 443
start codons at 
confident = false
did not find CDR3
now this is a cell
paired!

ACTGAGGACACGGCCTTTTATTATTGTGCAAGAGGAAGCATGAATGGCTGGCTCCTCTTTGACTCCTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG <==> ACCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACATTATGATAATCTCCCTCGGGTCGCTTTCGGCGGAGGGACCAAGGTGGAGATAACAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.6 = GCCTCTACAGCTGCAC-1

using 288 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 4^2, 275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================

UMI info for barcode GCCTCTACAGCTGCAC-1 contig 1 = GTCAGACTCA...
umi GCATTCTTCG = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-465 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.18 = GCCTCTACATATACGC-1

using 333 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3, 6, 7, 61, 246]
surviving nonsolo ucounts = 2[61, 246]
ids = [13, 10]

====================================================================================

UMI info for barcode GCCTCTACATATACGC-1 contig 1 = GAGAGAGGAG...
umi GCACCTTATA = 245 reads: +424 validated
umi TCTCGTCGAA = 56 reads: +414 -10 non-validated

GOOD CONTIGS

TIG 1[bases=561]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-561 ==> 0-64 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [10, 13]
of which 2 are surviving nonsolos
reads assigned: 292
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.22 = GCCTCTACATCCAACA-1

using 250 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 3, 4, 8, 224]
surviving nonsolo ucounts = 1[224]
ids = [8]

====================================================================================

UMI info for barcode GCCTCTACATCCAACA-1 contig 1 = CAGCACTGGT...
umi GAACCGTAAC = 219 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
0-22 ==> 229-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
22-367 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
366-404 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
404-493 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQVWYSNSDHVVF at 337, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 22, 217, 224, 320, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.25 = GCCTCTACATCTCGCT-1

using 15365 reads

====================================================================================

graph has 6807 edges initially, 78 edges after simplification

total ucounts = 1216
nonsolo ucounts = 566[2^226, 3^120, 4^69, 5^42, 6^24, 7^18, 8^5, 9^3, 10, 11^2, 12^3, 20, 25, 44, 60, 68, 77, 88, 98, 155, 161, 185, 195^2, 206, 211, 221, 224, 229, 235, 236, 241, 245, 246, 247, 262, 268^2, 274, 277, 282, 283, 284, 287, 291, 293, 298, 301, 304^2, 305, 311, 318, 324, 325, 328, 329, 331, 337, 341, 347^2, 428, 452]
surviving nonsolo ucounts = 49[3, 44, 68, 88, 98, 155, 161, 185, 195^2, 206, 211, 221, 224, 229, 235, 236, 241, 245, 246, 247, 262, 268^2, 274, 277, 282, 283, 284, 287, 291, 293, 298, 301, 304^2, 305, 311, 318, 324, 325, 328, 329, 331, 337, 341, 347^2, 428]
ids = [422, 800, 273, 10, 768, 499, 136, 644, 648, 739, ...]

====================================================================================

UMI info for barcode GCCTCTACATCTCGCT-1 contig 1 = GGGAGGGTCC...
umi AAAGATAGTC = 87 reads: +433 validated
umi AGGGCAATAC = 288 reads: +433 validated
umi ATATTACCTT = 228 reads: +433 validated
umi ATTGGCTAAC = 70 reads: +394 -1 +1 -37 non-validated
umi ATTTGTTTGC = 326 reads: +433 validated
umi CTACTAACCT = 244 reads: +433 validated
umi CTATTCGCCT = 139 reads: +433 validated
umi GCTCGTCTGC = 427 reads: +433 validated
umi GGGCAGTCTT = 262 reads: +433 validated
umi GTCCCGCACT = 89 reads: +424 -9 non-validated
umi GTTATCTTGG = 42 reads: +300 -7 +106 -20 non-validated
umi TCTCGTAACT = 214 reads: +433 validated
umi TGAAAGCGCA = 302 reads: +433 validated
umi TGCCTTGATA = 286 reads: +433 validated

UMI info for barcode GCCTCTACATCTCGCT-1 contig 2 = TGGGGGATCA...
umi ACAGCGCTGG = 273 reads: +397 validated
umi ACCGGTCCGT = 231 reads: -362X +3 -1XX +6 -2XX +6 -5XX +7 -1XX +4 invalidated
umi AGCTAATACG = 284 reads: +397 validated
umi AGCTATACGA = 332 reads: +397 validated
umi ATTGGCCCTT = 222 reads: +397 validated
umi ATTTTCCCTT = 302 reads: +397 validated
umi CCACTGTCCG = 231 reads: +397 validated
umi CCCTGCTTCA = 307 reads: +397 validated
umi CCGCATTAGG = 318 reads: +397 validated
umi CGCATTACAG = 316 reads: +397 validated
umi CGTGCTCGAA = 348 reads: +397 validated
umi GAACTCCCGT = 305 reads: +397 validated
umi GAATGACTAC = 250 reads: +397 validated
umi GATTGACCAT = 334 reads: +397 validated
umi GCATAACTAT = 269 reads: +397 validated
umi GCATGGACAA = 195 reads: +295 -1XX +101 invalidated
umi GCCCCGCCTT = 198 reads: +397 validated
umi GGTAGTGAAG = 306 reads: +397 validated
umi GGTGTCGTCG = 197 reads: +397 validated
umi TACATACTCT = 330 reads: +397 validated
umi TACTTTGGGC = 250 reads: +397 validated
umi TAGTGTATGA = 233 reads: +397 validated
umi TATGGTCCTG = 217 reads: +397 validated
umi TATTTCACAG = 290 reads: +397 validated
umi TCAGGCCCAT = 347 reads: +397 validated
umi TCCATCCCTT = 205 reads: +397 validated
umi TCGAACGACT = 252 reads: +397 validated
umi TCGCATAGGT = 298 reads: +397 validated
umi TGAGGCCCCC = 307 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=565]
61-409 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=12)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 253 reads
cdr3 = CARGLRTTVTDSTYYFDYW at 406, score = 9 + 7
umis assigned: [10, 172, 215, 273, 282, 494, 499, 685, 718, 768] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2969
start codons at 17, 61, 105
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1135 reads
cdr3 = CMQALQTPPTF at 371, score = 9 + 8
umis assigned: [88, 103, 158, 160, 272, 283, 360, 384, 389, 438] and 19 others
of which 28 are surviving nonsolos
reads assigned: 7813
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true

REJECT CONTIGS

TIG 1[bases=667]
5-81 ==> 7091-7167 on segment before IGLV3-24 exon 1 [len=7167] (mis=0)
18-123 ==> 7221-7326 on segment before IGLV3-15 exon 1 [len=7632] (mis=0)
100-270 ==> 19-189 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=23)
304-418 ==> 0-114 on segment before IGLV2-23 exon 1 [len=2836] (mis=0)
418-456 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
456-667 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [111, 148, 194, 243, 404, 1110]
of which 5 are surviving nonsolos
reads assigned: 1367
start codons at 82, 186, 236, 280, 396
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGAGGTCTGCGGACTACCGTGACCGACTCTACATACTACTTTGACTACTGGGGCCAGGGATCCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCGGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.48 = GCCTCTAGTATGAATG-1

using 325 reads

====================================================================================

graph has 117 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^3, 312]
surviving nonsolo ucounts = 1[312]
ids = [0]

====================================================================================

UMI info for barcode GCCTCTAGTATGAATG-1 contig 1 = AGGAGTCAGA...
umi AGTAAAGGTC = 289 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=509]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-509 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYYSYTWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.59 = GCCTCTAGTCTTCTCG-1

using 303 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3^2, 294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode GCCTCTAGTCTTCTCG-1 contig 1 = TGGGGGATCA...
umi CTCATCTTCT = 295 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=463]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
435-463 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPLFTF at 371, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 35, 68, 104, 192, 354, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.68 = GCCTCTAGTGTGACGA-1

using 192 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 7, 175]
surviving nonsolo ucounts = 1[175]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=483]
0-51 ==> 7-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
0-69 ==> 10071-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=6)
51-404 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
405-423 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
424-483 ==> 0-59 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
cdr3 = CARVGYSSSSSYHYYYAMDVW at 393, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 51, 202, 249, 348, 444
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.80 = GCCTCTATCAACACGT-1

using 314 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[313]
surviving nonsolo ucounts = 1[313]
ids = [1]

====================================================================================

UMI info for barcode GCCTCTATCAACACGT-1 contig 1 = GTCAGACCCA...
umi TTTCTTGCGA = 308 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
408-469 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNSYSGF at 350, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 23, 29, 85, 98, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.102 = GCCTCTATCCATGAGT-1

using 198 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 188]
surviving nonsolo ucounts = 1[188]
ids = [1]

====================================================================================

UMI info for barcode GCCTCTATCCATGAGT-1 contig 1 = CTGTTTCTGC...
umi ATGGCACAAA = 176 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=527]
0-43 ==> 193-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
43-396 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=6)
402-433 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=6)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
476-527 ==> 0-51 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CATDLIEYCSGGGCHKGDYW at 385, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 43, 199, 260, 346, 494
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.131 = GCCTCTATCTTCCTTC-1

using 28 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.134 = GCCTCTATCTTTACAC-1

using 209 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 3[2^2, 193]
surviving nonsolo ucounts = 1[193]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.140 = GCGACCAAGATAGGAG-1

using 322 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2^2, 309]
surviving nonsolo ucounts = 1[309]
ids = [10]

====================================================================================

UMI info for barcode GCGACCAAGATAGGAG-1 contig 1 = GGTGGTAGCT...
umi TCTTACCAAC = 290 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=603]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
39-382 ==> 0-343 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=9)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
433-603 ==> 0-170 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQSYDNENRKEVF at 366, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 39, 193, 244, 376, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.142 = GCGACCAAGCCCAGCT-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.144 = GCGACCAAGCCGGTAA-1

using 265 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 259]
surviving nonsolo ucounts = 1[259]
ids = [1]

====================================================================================

UMI info for barcode GCGACCAAGCCGGTAA-1 contig 1 = AGCTTCAGCT...
umi CCTAAGACAG = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-493 ==> 0-58 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CAAWDDSLNGPVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.150 = GCGACCAAGGCTAGAC-1

using 339 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 325]
surviving nonsolo ucounts = 1[325]
ids = [5]

====================================================================================

UMI info for barcode GCGACCAAGGCTAGAC-1 contig 1 = AGGAGTCAGA...
umi GAAAGCTAAG = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=2)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=33)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-495 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYHSYSPTF at 354, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.152 = GCGACCAAGGGTCGAT-1

using 282 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode GCGACCAAGGGTCGAT-1 contig 1 = GAGGAATCAG...
umi GTACCAATGC = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-511 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.157 = GCGACCAAGTACGATA-1

using 960 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 343, 607]
surviving nonsolo ucounts = 2[343, 607]
ids = [5, 8]

====================================================================================

UMI info for barcode GCGACCAAGTACGATA-1 contig 1 = ATCAGTCCCA...
umi GATGTCTAGC = 349 reads: +388 validated
umi TCTCATTACT = 611 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 142 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5, 8]
of which 2 are surviving nonsolos
reads assigned: 940
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.158 = GCGACCAAGTAGTGCG-1

using 354 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[137, 212]
surviving nonsolo ucounts = 2[137, 212]
ids = [0, 5]

====================================================================================

UMI info for barcode GCGACCAAGTAGTGCG-1 contig 1 = GCAGCGCTCT...
umi GCTCGTTCGT = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=523]
0-25 ==> 138-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
25-340 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
413-523 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CTSYAGGSNVVF at 349, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 25, 233, 332, 359, 374
confident = false

REJECT CONTIGS

TIG 1[bases=497]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
0-58 ==> 7988-8046 on rc of segment before IGHV2-70 exon 2 [len=8046] (mis=0)
7-76 ==> 10071-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=6)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
443-497 ==> 0-54 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
cdr3 = CARGGW at 400, score = 9 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 58, 118, 209, 256, 293, 355, 463
confident = false
VJ delta = -34
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.162 = GCGACCAAGTTGAGTA-1

using 76 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 12[2^3, 4^2, 5^2, 7, 9^2, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.175 = GCGACCACAATGGAAT-1

using 337 reads

====================================================================================

graph has 171 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 326]
surviving nonsolo ucounts = 1[326]
ids = [7]

====================================================================================

UMI info for barcode GCGACCACAATGGAAT-1 contig 1 = GAGCTACAAC...
umi TTTCAAGAGC = 315 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=521]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-521 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYYSTPFTF at 369, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.176 = GCGACCACACAACGTT-1

using 358 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[358]
surviving nonsolo ucounts = 1[358]
ids = [0]

====================================================================================

UMI info for barcode GCGACCACACAACGTT-1 contig 1 = GACTGATCAG...
umi CCCGCTTGGT = 347 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=527]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
400-437 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-527 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQALQSPRGLTF at 370, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 34, 67, 103, 191, 353, 373, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.178 = GCGACCACACAGACAG-1

using 349 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 344]
surviving nonsolo ucounts = 1[344]
ids = [3]

====================================================================================

UMI info for barcode GCGACCACACAGACAG-1 contig 1 = GGAGTCAGTC...
umi TAGGGGGTCT = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.181 = GCGACCACACATTCGA-1

using 370 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 366]
surviving nonsolo ucounts = 1[366]
ids = [3]

====================================================================================

UMI info for barcode GCGACCACACATTCGA-1 contig 1 = GAGCTACAAC...
umi TTTATTCCTA = 349 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=494]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-494 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYYSTPFTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.182 = GCGACCACACCAGGCT-1

using 597 reads

====================================================================================

graph has 236 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[278, 319]
surviving nonsolo ucounts = 2[278, 319]
ids = [1, 0]

====================================================================================

UMI info for barcode GCGACCACACCAGGCT-1 contig 1 = GGGGTCACAA...
umi TATAAATAGC = 266 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=26)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
423-557 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CFSYGNTGRVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 38, 249, 372
confident = false

REJECT CONTIGS

TIG 1[bases=558]
0-33 ==> 64-97 on |291|IGKV3D-20|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
33-175 ==> 0-142 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=0)
175-379 ==> 144-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=5) [SHIFT!]
384-422 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPPGITF at 355, score = 10 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 33, 239, 242, 365, 464
confident = false
not full
frameshifted full length stopped transcript of length 558
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.195 = GCGACCACAGAGCCAA-1

using 334 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 330]
surviving nonsolo ucounts = 1[330]
ids = [2]

====================================================================================

UMI info for barcode GCGACCACAGAGCCAA-1 contig 1 = GGGAGTCAGT...
umi TGTTGACCTG = 332 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=26)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYTAPYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 27, 33, 89, 102, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.202 = GCGACCACAGTTTACG-1

using 188 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 183]
surviving nonsolo ucounts = 1[183]
ids = [2]

====================================================================================

UMI info for barcode GCGACCACAGTTTACG-1 contig 1 = GAGGAATCAG...
umi CGTACCATTT = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-463 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQHNSYPPTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 28, 34, 103, 185, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.217 = GCGACCAGTAGGGTAC-1

using 228 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 219]
surviving nonsolo ucounts = 1[219]
ids = [2]

====================================================================================

UMI info for barcode GCGACCAGTAGGGTAC-1 contig 1 = TGAGCGCAGA...
umi GGATTCCGAA = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-570 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.223 = GCGACCAGTCAAAGAT-1

using 131 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[130]
surviving nonsolo ucounts = 1[130]
ids = [0]

====================================================================================

UMI info for barcode GCGACCAGTCAAAGAT-1 contig 1 = GGGATCACAC...
umi AATCAGGTAA = 125 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=476]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 13 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.224 = GCGACCAGTCACACGC-1

using 84 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 82]
surviving nonsolo ucounts = 1[82]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.227 = GCGACCAGTCCATCCT-1

using 5968 reads

====================================================================================

graph has 2701 edges initially, 52 edges after simplification

total ucounts = 445
nonsolo ucounts = 163[2^57, 3^32, 4^18, 5^15, 6^5, 7^4, 8^2, 12, 13, 14, 18, 20, 26, 39, 40, 74, 85, 98, 119, 130, 140, 155, 162, 165, 182, 226, 245, 256, 260^2, 284, 298, 320, 322, 345, 380, 567]
surviving nonsolo ucounts = 21[40, 74, 85, 98, 119, 130, 162, 165, 182, 226, 245, 256, 260^2, 284, 298, 320, 322, 345, 380, 567]
ids = [275, 1, 127, 116, 25, 19, 31, 215, 280, 43, ...]

====================================================================================

UMI info for barcode GCGACCAGTCCATCCT-1 contig 1 = GAGCTCTGGG...
umi ACACTACACA = 128 reads: +418 validated
umi ACCATAACCC = 117 reads: +418 validated
umi ACCGTGCTGA = 154 reads: +371 -4 +11 -1 +1 -1X +29 invalidated
umi AGGTACGGGT = 260 reads: +418 validated
umi CAGATTACAG = 101 reads: +401 -1 +3 -13 non-validated
umi CATTCCCTTT = 85 reads: +391 -27 non-validated
umi CTTGCTCTCC = 164 reads: +409 -9 non-validated
umi GCAATTCGCT = 356 reads: +18 -2X +2 -1XX +395 invalidated
umi GCCTTATGCA = 323 reads: +418 validated
umi GGTTTGTGTT = 45 reads: +409 -9 non-validated
umi GTAGGTACGC = 174 reads: +410 -8 non-validated
umi GTCACTACCT = 246 reads: +418 validated
umi GTTGCTGCTA = 262 reads: +418 validated
umi TATAGTCATC = 264 reads: +418 validated
umi TTCCAACCTG = 44 reads: -293X +1 -1X +123 invalidated
umi TTTTGGCGCG = 383 reads: +418 validated

UMI info for barcode GCGACCAGTCCATCCT-1 contig 2 = ACTGGTTGTT...
umi AAACATACTT = 75 reads: +353 -11 +10 -1 +25 non-validated
umi ACTTGGATCG = 227 reads: +400 validated
umi ATTTTTCTAA = 284 reads: +400 validated
umi GTCGTAGCAG = 326 reads: +400 validated
umi TTATCGCGAC = 302 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=569]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
430-451 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=2)
452-498 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 212 reads
cdr3 = CARSIAAAGTPHDYW at 422, score = 9 + 7
umis assigned: [19, 25, 31, 59, 116, 127, 215, 232, 247, 275] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3034
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 456
confident = true

TIG 2[bases=646]
0-110 ==> 65-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
110-473 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
472-510 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
510-646 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 130 reads
cdr3 = CQQYYSTSWTF at 449, score = 9 + 8
umis assigned: [1, 43, 100, 289, 407]
of which 5 are surviving nonsolos
reads assigned: 1190
start codons at 110, 179, 432, 552
confident = true
now this is a cell
paired!

GCCGAGGACACGGCTGTGTATTACTGTGCGAGAAGTATAGCAGCAGCTGGTACTCCCCATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.236 = GCGACCAGTTCGAATC-1

using 290 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 16, 269]
surviving nonsolo ucounts = 1[269]
ids = [0]

====================================================================================

UMI info for barcode GCGACCAGTTCGAATC-1 contig 1 = GAGTCAGACT...
umi ACGTTACAGT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
413-491 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYALSF at 352, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 25, 31, 87, 100, 236, 239, 332, 371, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.237 = GCGACCAGTTGGACCC-1

using 3837 reads

====================================================================================

graph has 1851 edges initially, 20 edges after simplification

total ucounts = 350
nonsolo ucounts = 118[2^45, 3^26, 4^7, 5^5, 6^7, 7^6, 8^2, 9, 10^2, 11^2, 12, 19, 57, 58, 96, 202, 236, 247, 256, 262, 264, 300, 306, 309, 609]
surviving nonsolo ucounts = 13[57, 58, 96, 202, 236, 247, 256, 262, 264, 300, 306, 309, 609]
ids = [198, 225, 38, 124, 245, 281, 227, 6, 255, 145, ...]

====================================================================================

UMI info for barcode GCGACCAGTTGGACCC-1 contig 1 = GCTGGGGTCT...
umi AACCGGCTCT = 264 reads: +394 validated
umi ACTGCCAGCC = 98 reads: +394 validated
umi CCGCAGCTTG = 655 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -2XX +1 -36X +3 -2XX +1 -3XX +2 -10XX +96 invalidated
umi CCTCGGTTTT = 204 reads: +394 validated
umi CTCCAGCGCA = 301 reads: +394 validated
umi GCACCCAGCA = 308 reads: +394 validated
umi GTAATTGGGA = 56 reads: +365 -8 +21 non-validated
umi GTCATCGCCG = 260 reads: +394 validated
umi TAATATACCT = 232 reads: +394 validated
umi TAGGCACCCT = 265 reads: +394 validated
umi TCGCATTTCG = 252 reads: +394 validated

UMI info for barcode GCGACCAGTTGGACCC-1 contig 2 = GAGCATCACC...
umi AACTTGTCTA = 271 reads: +463 validated
umi GCTCCAGCTC = 50 reads: +431 -1 +31 non-validated

GOOD CONTIGS

TIG 1[bases=646]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-393 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 355 reads
cdr3 = CSSYTSSSTPYVVF at 365, score = 8 + 8
umis assigned: [6, 38, 119, 124, 145, 182, 225, 227, 245, 255] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2808
start codons at 41, 198, 242, 249, 396
confident = true

TIG 2[bases=548]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=0)
430-457 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=1)
475-525 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
525-548 ==> 0-23 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 27 reads
cdr3 = CARDNGEGGYYDILTGYYLRSVRGYGMDVW at 404, score = 8 + 7
umis assigned: [13, 198]
of which 2 are surviving nonsolos
reads assigned: 315
start codons at 62, 218, 260, 265, 297, 326, 359, 417, 482, 543
confident = true
now this is a cell
paired!

GGAGGCTATTACGATATTTTGACTGGTTATTATTTACGTTCTGTTCGGGGCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCCGTATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.240 = GCGACCAGTTGTGGCC-1

using 88 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[85]
surviving nonsolo ucounts = 1[85]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=444]
0-349 ==> 4-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
352-390 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
390-444 ==> 0-54 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGTWDSSLSAGPWVF at 317, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 150, 201, 325
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.242 = GCGACCATCAACTCTT-1

using 198 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 186]
surviving nonsolo ucounts = 1[186]
ids = [2]

====================================================================================

UMI info for barcode GCGACCATCAACTCTT-1 contig 1 = CCTCCTTGGG...
umi ACTGTTTCAG = 179 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=515]
0-38 ==> 21-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
38-391 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
440-474 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
474-515 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 380, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 38, 236, 241, 258, 302, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.256 = GCGACCATCCGGCACA-1

using 457 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 446]
surviving nonsolo ucounts = 1[446]
ids = [6]

====================================================================================

UMI info for barcode GCGACCATCCGGCACA-1 contig 1 = AGAGCTGCTC...
umi CGGTTCCGGC = 451 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYGSSPVTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 440
start codons at 31, 239, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.258 = GCGACCATCCTAGGGC-1

using 360 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[353]
surviving nonsolo ucounts = 1[353]
ids = [4]

====================================================================================

UMI info for barcode GCGACCATCCTAGGGC-1 contig 1 = GGGAGTCTCA...
umi GAATGTACCC = 341 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-469 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQSYTTPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.266 = GCGACCATCGGCGCAT-1

using 257 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^3, 248]
surviving nonsolo ucounts = 1[248]
ids = [6]

====================================================================================

UMI info for barcode GCGACCATCGGCGCAT-1 contig 1 = GTCAGTCCCA...
umi CCAGCGTTCC = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPPYTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 23, 29, 85, 98, 237, 360, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.271 = GCGACCATCGTTGCCT-1

using 193 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[192]
surviving nonsolo ucounts = 1[192]
ids = [1]

====================================================================================

UMI info for barcode GCGACCATCGTTGCCT-1 contig 1 = ACACAACAGC...
umi GATGCAGCAA = 180 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=501]
0-54 ==> 6-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
54-407 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
463-501 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CVTDLATTVDYW at 396, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 54, 210, 252, 274, 289, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.282 = GCGAGAAAGACTGGGT-1

using 532 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[6, 9, 195, 320]
surviving nonsolo ucounts = 3[9, 195, 320]
ids = [1, 3, 2]

====================================================================================

UMI info for barcode GCGAGAAAGACTGGGT-1 contig 1 = AGGAGTCAGA...
umi TCCTACTCCT = 320 reads: +388 validated

UMI info for barcode GCGAGAAAGACTGGGT-1 contig 2 = GAGAGAGGAG...
umi CTGCATTTGC = 8 reads: +34 -29 +1 -1 +2 -1X +2 -1 +2 -1 +1 -1 +1 -1 +10 -1 +2 -1 +1 -1 +4 -1 +6 -1 +137 -10 +53 -1 +2 -115 invalidated
umi TCGCCTCATC = 189 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNYPVTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 2[bases=564]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-564 ==> 0-67 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 193
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.284 = GCGAGAAAGACTTGAA-1

using 404 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 395]
surviving nonsolo ucounts = 1[395]
ids = [5]

====================================================================================

UMI info for barcode GCGAGAAAGACTTGAA-1 contig 1 = TGATCAGGAC...
umi TGCCAGTGTT = 394 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=564]
31-391 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=3)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQGTHWPITF at 367, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 390
start codons at 31, 64, 92, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.288 = GCGAGAAAGATCTGAA-1

using 160 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[156]
surviving nonsolo ucounts = 1[156]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAAGATCTGAA-1 contig 1 = AGCTTCAGCT...
umi CCCGCAACAT = 145 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-513 ==> 0-78 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.289 = GCGAGAAAGATCTGCT-1

using 165 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 14, 146]
surviving nonsolo ucounts = 3[3, 14, 146]
ids = [3, 1, 4]

====================================================================================

UMI info for barcode GCGAGAAAGATCTGCT-1 contig 1 = GGATCACCCA...
umi GCCGTGTCTT = 14 reads: -21 +153 -1 +1 -1 +6 -1 +2 -1 +8 -1 +8 -1 +61 -94 +21 -1 +12 -1 +14 non-validated
umi GCCGTGTGGT = 1 reads: -350 +8 -2 +4 -2X +7 -2 +1 -1X +1 -1 +1 -1X +2 -1 +11 -1 +3 -2 +5 -3 invalidated
umi GCCGTGTGTT = 3 reads: -40 +56 -4 +66 -1 +14 -228 non-validated
umi GCCGTTTCTT = 136 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=552]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
417-468 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
468-552 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CARGSTSWYDYW at 401, score = 8 + 7
umis assigned: [1, 2, 3, 4]
of which 3 are surviving nonsolos
reads assigned: 151
start codons at 59, 210, 257, 262, 294, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.290 = GCGAGAAAGATGCCAG-1

using 230 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [3]

====================================================================================

UMI info for barcode GCGAGAAAGATGCCAG-1 contig 1 = ACCCAAAAAC...
umi ATGGTGCTCA = 223 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=650]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-650 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.293 = GCGAGAAAGCCCGAAA-1

using 380 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 371]
surviving nonsolo ucounts = 1[371]
ids = [4]

====================================================================================

UMI info for barcode GCGAGAAAGCCCGAAA-1 contig 1 = AGACCCTGTC...
umi CCCTTGTATA = 375 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-26 ==> 27-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
26-371 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYYSYTWTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.299 = GCGAGAAAGGAATTAC-1

using 86 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 22, 57]
surviving nonsolo ucounts = 2[22, 57]
ids = [3, 2]

====================================================================================

UMI info for barcode GCGAGAAAGGAATTAC-1 contig 1 = GAGGAACTGC...
umi CTGGACCGAC = 49 reads: +382 validated
umi CTGGACTGAC = 22 reads: +282 -45 +55 non-validated

GOOD CONTIGS

TIG 1[bases=500]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=35)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CEQYNFWPRTF at 354, score = 8 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 70
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.300 = GCGAGAAAGGACGAAA-1

using 218 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 211]
surviving nonsolo ucounts = 1[211]
ids = [3]

====================================================================================

UMI info for barcode GCGAGAAAGGACGAAA-1 contig 1 = GATCAGGACT...
umi CAAGAGTCTC = 198 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=515]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
427-515 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQTPGTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.301 = GCGAGAAAGGACTGGT-1

using 144 reads

====================================================================================

graph has 230 edges initially, 10 edges after simplification

total ucounts = 141
nonsolo ucounts = 2[2, 3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.304 = GCGAGAAAGGCAGTCA-1

using 231 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAAGGCAGTCA-1 contig 1 = GAGAGAGGAG...
umi CTCACCGGTC = 228 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=566]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=31)
440-476 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
476-566 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CAKNSGIYAW at 415, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 73, 139, 229, 376, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.312 = GCGAGAAAGTACGCGA-1

using 123 reads

====================================================================================

graph has 172 edges initially, 8 edges after simplification

total ucounts = 28
nonsolo ucounts = 20[2^3, 3^5, 5^2, 6^2, 7^2, 8^2, 9^2, 11, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.313 = GCGAGAAAGTAGATGT-1

using 424 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[417]
surviving nonsolo ucounts = 1[417]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAAGTAGATGT-1 contig 1 = GAGTCAGTCC...
umi ACACCGCCTC = 421 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQLNSYPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 25, 31, 87, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.315 = GCGAGAAAGTCACGCC-1

using 211 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 6, 199]
surviving nonsolo ucounts = 1[199]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=627]
0-35 ==> 3-38 on |354|IGLV3-16|5'UTR| [len=38] (mis=0)
35-69 ==> 0-34 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=0)
69-380 ==> 36-347 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=1) [SHIFT!]
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-627 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 35, 94, 138, 181
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.322 = GCGAGAACAACTGGCC-1

using 234 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAACAACTGGCC-1 contig 1 = GGAGTCAGTC...
umi AACAATTGCG = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-482 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYDDLPITF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 26, 32, 88, 101, 363, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.323 = GCGAGAACAAGAAAGG-1

using 715 reads

====================================================================================

graph has 264 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 10, 697]
surviving nonsolo ucounts = 1[697]
ids = [4]

====================================================================================

UMI info for barcode GCGAGAACAAGAAAGG-1 contig 1 = GGGAATCAGT...
umi TATTATTCAT = 698 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 106 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 685
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.326 = GCGAGAACAAGTCTAC-1

using 261 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^5, 3, 6, 238]
surviving nonsolo ucounts = 1[238]
ids = [7]

====================================================================================

UMI info for barcode GCGAGAACAAGTCTAC-1 contig 1 = AGCTTCAGCT...
umi GCGCTGCTTG = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=17)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
434-490 ==> 0-56 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CAAWDDGLSDVLF at 367, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 46, 350, 380, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.327 = GCGAGAACAATAGCGG-1

using 1238 reads

====================================================================================

graph has 1513 edges initially, 12 edges after simplification

total ucounts = 452
nonsolo ucounts = 173[2^71, 3^35, 4^24, 5^12, 6^10, 7^9, 9, 10^2, 11, 12^3, 13, 15^2, 18, 296]
surviving nonsolo ucounts = 1[296]
ids = [204]

====================================================================================

UMI info for barcode GCGAGAACAATAGCGG-1 contig 1 = AGCTCTGAGA...
umi CGCTAGTTTA = 281 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=603]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-603 ==> 0-100 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [204]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.335 = GCGAGAACACCCATGG-1

using 789 reads

====================================================================================

graph has 292 edges initially, 14 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[7, 379, 400]
surviving nonsolo ucounts = 2[379, 400]
ids = [3, 5]

====================================================================================

UMI info for barcode GCGAGAACACCCATGG-1 contig 1 = GAGAAGAGCT...
umi TTCACACGAG = 421 reads: +148 -1XX +117 -1XX +118 invalidated

UMI info for barcode GCGAGAACACCCATGG-1 contig 2 = GAGAAGAGCT...
umi CTGGTAGTAG = 382 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYGSSPVTF at 359, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 35, 243, 246, 369, 462
confident = false

TIG 2[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYGSSLLTF at 359, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.336 = GCGAGAACAGACGCCT-1

using 427 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[424]
surviving nonsolo ucounts = 1[424]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAACAGACGCCT-1 contig 1 = GAGAAGAGCT...
umi CGTCCTCGGT = 431 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CQQYGSSPRTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 423
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.339 = GCGAGAACAGCAGTTT-1

using 244 reads

====================================================================================

graph has 370 edges initially, 2 edges after simplification

total ucounts = 147
nonsolo ucounts = 46[2^23, 3^14, 4, 5^4, 6, 7^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.340 = GCGAGAACAGCTGCAC-1

using 644 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 6, 12, 28, 169, 196, 228]
surviving nonsolo ucounts = 5[12, 28, 169, 196, 228]
ids = [4, 3, 7, 2, 6]

====================================================================================

UMI info for barcode GCGAGAACAGCTGCAC-1 contig 1 = GGGGATCTCA...
umi TGTCGCGTCT = 28 reads: +108 -2 +281 non-validated
umi TGTCGCGTGT = 10 reads: -4 +263 -124 non-validated
umi TGTCGCTCTT = 208 reads: +391 validated
umi TGTCGCTTCT = 160 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=569]
39-377 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
430-569 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 69 reads
cdr3 = CSSYTNSTTPGVF at 363, score = 8 + 8
umis assigned: [3, 4, 6, 7]
of which 4 are surviving nonsolos
reads assigned: 398
start codons at 39, 175, 247, 562
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.347 = GCGAGAACATCACGAT-1

using 316 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[315]
surviving nonsolo ucounts = 1[315]
ids = [1]

====================================================================================

UMI info for barcode GCGAGAACATCACGAT-1 contig 1 = GACTGATCAG...
umi TAACACACTA = 319 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=567]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTPCSF at 370, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.348 = GCGAGAACATCACGTA-1

using 883 reads

====================================================================================

graph has 346 edges initially, 22 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[10, 260, 266, 343]
surviving nonsolo ucounts = 3[260, 266, 343]
ids = [6, 2, 1]

====================================================================================

UMI info for barcode GCGAGAACATCACGTA-1 contig 1 = GAGTCAGACT...
umi ATTATTCGAC = 237 reads: +71 -1XX +74 -1XX +6 -1XX +4 -1XX +13 -1XX +8 -35X +2 -1XX +2 -1XX +5 -3XX +14 -1XX +5 -2XX +77 -1XX +5 -1XX +3 -1XX +3 -1XX +2 -1XX +3 -4XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +1 -1XX +2 -1XX +7 invalidated
umi CCCGACAGAA = 11 reads: +48 -1X +7 -27 +2 -1 +1 -1 +1 -1X +2 -2X +1 -2X +37 -1XX +5 -1X +6 -2X +6 -1X +2 -1X +3 -10 +6 -1X +22 -1X +9 -1X +6 -1X +4 -2X +3 -9 +38 -1XX +11 -1XX +20 -1XX +14 -1X +5 -1X +6 -2X +1 -1X +1 -1X +1 -45 invalidated
umi TCCAAGGGAC = 261 reads: +388 validated

UMI info for barcode GCGAGAACATCACGTA-1 contig 2 = GGGGAGGAAC...
umi ATTTCAGTTG = 252 reads: +297 -1XX +4 -1XX +8 -3XX +9 -2XX +1 -5XX +1 -5XX +2 -7XX +36 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [1, 4, 6]
of which 2 are surviving nonsolos
reads assigned: 492
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-333 ==> 0-297 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNTYSHTF at 357, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 36, 105, 241, 337, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.352 = GCGAGAACATGTTGAC-1

using 1237 reads

====================================================================================

graph has 488 edges initially, 26 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 31, 248, 258, 697]
surviving nonsolo ucounts = 4[31, 248, 258, 697]
ids = [3, 4, 5, 2]

====================================================================================

UMI info for barcode GCGAGAACATGTTGAC-1 contig 1 = AGCTTCAGCT...
umi TCAGTTTCTC = 234 reads: +388 validated

UMI info for barcode GCGAGAACATGTTGAC-1 contig 2 = TGGGGGCTTT...
umi TAACGCTCGG = 238 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=577]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-577 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 47, 201, 351, 376, 381
confident = true

TIG 2[bases=506]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
455-506 ==> 0-51 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARYFAFVNYYFDKW at 379, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 19, 40, 84
confident = true

REJECT CONTIGS

TIG 1[bases=399]
2-209 ==> 144-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
218-235 ==> 0-17 on |7|IGHD1-1|D-REGION| [len=17] (mis=2)
234-297 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
297-399 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CAKVLGSTTGTIKYYYYGMDVW at 200, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 685
start codons at 9, 14, 72, 75, 93, 161, 254, 315, 376
confident = false
VJ delta = 21
not full
not full

TIG 2[bases=418]
0-279 ==> 74-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=20)
286-303 ==> 0-17 on |7|IGHD1-1|D-REGION| [len=17] (mis=2)
302-365 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
365-418 ==> 0-53 on |43|IGHG2|C-REGION| [len=977] (mis=0)
cdr3 = CAKVLGSTTGTIKYYYYGMDVW at 268, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 20
start codons at 77, 82, 229, 322
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.353 = GCGAGAAGTAAATACG-1

using 322 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [3]

====================================================================================

UMI info for barcode GCGAGAAGTAAATACG-1 contig 1 = AGTCTGGGCC...
umi CTTCACACTA = 323 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.358 = GCGAGAAGTACGCTGC-1

using 292 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAGTACGCTGC-1 contig 1 = ACCCAAAAAC...
umi AAACTATCTC = 259 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=605]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-605 ==> 0-115 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.359 = GCGAGAAGTACTCAAC-1

using 175 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAGTACTCAAC-1 contig 1 = AGCTCTCAGA...
umi CGGGGGTGTG = 170 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=517]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
485-517 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.361 = GCGAGAAGTCAGAAGC-1

using 1834 reads

====================================================================================

graph has 1449 edges initially, 24 edges after simplification

total ucounts = 400
nonsolo ucounts = 287[2^55, 3^46, 4^30, 5^28, 6^23, 7^22, 8^13, 9^15, 10^9, 11^15, 12^13, 13^5, 14^4, 15^4, 16^3, 20, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.366 = GCGAGAAGTCTCATCC-1

using 420 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 145, 267]
surviving nonsolo ucounts = 2[145, 267]
ids = [6, 5]

====================================================================================

UMI info for barcode GCGAGAAGTCTCATCC-1 contig 1 = AGCTCTGAGA...
umi TTACACGGGT = 143 reads: +424 validated

UMI info for barcode GCGAGAAGTCTCATCC-1 contig 2 = TGATCAGGAC...
umi GCGAACTGCA = 244 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=536]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-536 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=511]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
428-511 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTRETF at 367, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.367 = GCGAGAAGTCTCCATC-1

using 68 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 63]
surviving nonsolo ucounts = 1[63]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAAGTCTCCATC-1 contig 1 = ATGGACATGA...
umi CAAATCTGAG = 60 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=438]
0-351 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
349-388 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
388-438 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQQYNTYSYTF at 327, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 58
start codons at 0, 6, 62, 75, 211, 214, 307, 430
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.380 = GCGAGAAGTTCCACGG-1

using 25 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 1[24]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.389 = GCGAGAATCAGTGCAT-1

using 8479 reads

====================================================================================

graph has 4148 edges initially, 58 edges after simplification

total ucounts = 614
nonsolo ucounts = 238[2^93, 3^49, 4^19, 5^19, 6^11, 7^4, 8^3, 9^4, 10, 11^3, 12, 21, 24, 25, 63, 81, 96, 106, 116, 145, 154, 159, 193, 196^2, 205, 210^2, 238, 239, 246, 249, 250, 268^2, 280, 285, 310, 312, 452, 493, 1300]
surviving nonsolo ucounts = 27[63, 81, 96, 106, 116, 145, 154, 159, 193, 196^2, 205, 210^2, 238, 239, 246, 249, 250, 268^2, 280, 285, 310, 452, 493, 1300]
ids = [12, 80, 249, 429, 227, 1, 36, 357, 603, 183, ...]

====================================================================================

UMI info for barcode GCGAGAATCAGTGCAT-1 contig 1 = ATACTTTCTG...
umi AACATCCCTC = 281 reads: +427 validated
umi CCTCAAGGGA = 314 reads: +427 validated
umi CGAACACGGT = 113 reads: +408 -3 +8 -1 +7 non-validated
umi CTCTAAGCAC = 355 reads: +427 validated
umi TTTCAGAATC = 210 reads: +427 validated

UMI info for barcode GCGAGAATCAGTGCAT-1 contig 2 = GGCTGGGGTC...
umi AAAACCGGAA = 144 reads: +388 validated
umi ACACCTATCT = 109 reads: +41 -2X +345 invalidated
umi GAAGTTGCTT = 241 reads: +388 validated
umi GACAACTCCC = 270 reads: +388 validated
umi GCTACTAGCC = 251 reads: +388 validated
umi GGCGCAACAT = 156 reads: +388 validated
umi TACAATCTAG = 209 reads: +388 validated
umi TACTCGTGTG = 247 reads: +388 validated
umi TAGTTCCTAC = 197 reads: +388 validated
umi TATAGGGCAA = 266 reads: +388 validated
umi TCACATGCTA = 251 reads: +388 validated
umi TCTCACTACT = 284 reads: +388 validated
umi TTTCCATCTC = 144 reads: +33 -1 +1 -1XX +1 -6XX +345 invalidated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=16)
413-464 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 139 reads
cdr3 = CARGGPPGIAARSNWFDPW at 376, score = 9 + 7
umis assigned: [10, 217, 227, 275, 601]
of which 5 are surviving nonsolos
reads assigned: 1255
start codons at 37, 81, 298
confident = true

TIG 2[bases=641]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-379 ==> 0-337 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 459 reads
cdr3 = CSSYVASYNVLF at 366, score = 7 + 8
umis assigned: [1, 36, 306, 309, 348, 357, 425, 437, 445, 448] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2729
start codons at 42, 181, 250, 253, 349, 376
confident = true

REJECT CONTIGS

TIG 1[bases=913]
1-581 ==> 1727-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
577-739 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
739-777 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
777-913 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [183, 249, 280, 323]
of which 3 are surviving nonsolos
reads assigned: 828
start codons at 60, 109, 116, 176, 261, 326, 358, 393, 417, 494, 547, 602, 607, 720, 819
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGAGGAGGGCCCCCCGGTATAGCAGCCCGTAGTAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTTTTACTGCTCCTCATATGTAGCCAGTTACAACGTCCTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.394 = GCGAGAATCCAGATCA-1

using 307 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode GCGAGAATCCAGATCA-1 contig 1 = AGGAATCAGT...
umi CCTCTAACGA = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.402 = GCGAGAATCCTGTAGA-1

using 559 reads

====================================================================================

graph has 934 edges initially, 6 edges after simplification

total ucounts = 298
nonsolo ucounts = 108[2^53, 3^28, 4^9, 5^5, 6^4, 7^3, 8, 10^2, 14^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.406 = GCGAGAATCGTCCAGG-1

using 290 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode GCGAGAATCGTCCAGG-1 contig 1 = ATCACATAAC...
umi ATGCACTTCG = 269 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=580]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=29)
443-479 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
479-580 ==> 0-101 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CVRGTLKFGEVLSDSW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 58, 355, 533
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.411 = GCGAGAATCTCGCTTG-1

using 291 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode GCGAGAATCTCGCTTG-1 contig 1 = GCTCTGCTTC...
umi CGCAGTGGGA = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=544]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-544 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.412 = GCGAGAATCTCGGACG-1

using 702 reads

====================================================================================

graph has 316 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 6, 686]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.413 = GCGAGAATCTGACCTC-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.420 = GCGCAACAGAATAGGG-1

using 336 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2^4, 3^2, 6, 314]
surviving nonsolo ucounts = 1[314]
ids = [8]

====================================================================================

UMI info for barcode GCGCAACAGAATAGGG-1 contig 1 = TGATCAGGAC...
umi TGTGATCCAG = 303 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=509]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
428-509 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQALQTPYTF at 367, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.421 = GCGCAACAGAATTCCC-1

using 168 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 162]
surviving nonsolo ucounts = 1[162]
ids = [4]

====================================================================================

UMI info for barcode GCGCAACAGAATTCCC-1 contig 1 = ATCACACAAC...
umi TGCACGACGC = 159 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=564]
0-57 ==> 3-60 on |68|IGHV1-24|5'UTR| [len=60] (mis=0)
57-408 ==> 0-351 on |69|IGHV1-24|L-REGION+V-REGION| [len=351] (mis=44)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
475-564 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CATAAGINKWAFDSW at 399, score = 10 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 57, 202, 213, 255, 277, 321, 354, 425
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.422 = GCGCAACAGACTCGGA-1

using 309 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[307]
surviving nonsolo ucounts = 1[307]
ids = [2]

====================================================================================

UMI info for barcode GCGCAACAGACTCGGA-1 contig 1 = AGCCCTGGGA...
umi TTCCAATTGG = 312 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=558]
0-60 ==> 19-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
60-413 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=10)
436-487 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
487-558 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAKLYDSGSFPLDWFDPW at 402, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 60, 211, 216, 363, 415
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.425 = GCGCAACAGAGTACAT-1

using 213 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 203]
surviving nonsolo ucounts = 1[203]
ids = [7]

====================================================================================

UMI info for barcode GCGCAACAGAGTACAT-1 contig 1 = GAGTCTCCCT...
umi TAGGGTGCCA = 179 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=508]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
426-476 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
476-508 ==> 0-32 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARLSSGWYNAFDIW at 400, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 58, 232, 256, 391, 428, 457, 494
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.428 = GCGCAACAGCAGATCG-1

using 1033 reads

====================================================================================

graph has 300 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[170, 347, 515]
surviving nonsolo ucounts = 3[170, 347, 515]
ids = [3, 1, 0]

====================================================================================

UMI info for barcode GCGCAACAGCAGATCG-1 contig 1 = GGAGGAACTG...
umi AACACGTGTC = 1 reads: -385 non-validated
umi TTGGCGCAGT = 170 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNDWPPLTF at 355, score = 9 + 9
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 167
start codons at 34, 103, 130, 239, 242, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 67.429 = GCGCAACAGCCAGAAC-1

using 14823 reads

====================================================================================

graph has 7142 edges initially, 66 edges after simplification

total ucounts = 1126
nonsolo ucounts = 447[2^179, 3^92, 4^40, 5^25, 6^18, 7^9, 8^8, 9^12, 10^3, 11, 12, 14^2, 15^3, 16, 19, 25, 29, 44, 78, 85, 106, 120, 129, 132, 138, 149, 160, 211, 213, 214, 219, 221, 227^2, 236, 238^2, 239, 242, 244, 245, 248, 252, 260, 263, 264, 265, 266, 270, 271, 287, 291, 297, 301, 302, 313, 314, 318, 326, 327, 331, 361, 362, 372, 396, 484, 571]
surviving nonsolo ucounts = 48[29, 44, 85, 106, 120, 129, 132, 138, 149, 211, 214, 219, 221, 227^2, 236, 238^2, 239, 242, 244, 245, 248, 252, 260, 263, 264, 265, 266, 270, 271, 287, 291, 297, 301, 302, 313, 314, 318, 326, 327, 331, 361, 362, 372, 396, 484, 571]
ids = [626, 344, 648, 729, 1107, 1054, 1049, 1032, 361, 31, ...]

====================================================================================

UMI info for barcode GCGCAACAGCCAGAAC-1 contig 1 = CGAGCCCAGC...
umi AGGTCTTGTA = 227 reads: +424 validated
umi CATAAGGACT = 38 reads: +364 -14 +25 -1X +20 invalidated
umi GACCAGCTAC = 270 reads: +424 validated
umi GATCTTGGTT = 23 reads: +313 -16X +6 -2X +3 -23X +55 -6 invalidated
umi GCACAGACGA = 81 reads: +424 validated
umi GTCGTATTCC = 263 reads: +424 validated
umi TAACTTCCAC = 216 reads: +424 validated
umi TGCTCTTCCA = 227 reads: +123 -1XX +300 invalidated
umi TTAATACAAA = 113 reads: +424 validated
umi TTCAACTATG = 123 reads: -396 +1 -3XX +1 -2XX +2 -7XX +1 -5XX +1 -2XX +3 invalidated
umi TTCCCCACCC = 129 reads: +424 validated
umi TTTACCACCC = 302 reads: +424 validated
umi TTTTTTTTTC = 357 reads: +424 validated

UMI info for barcode GCGCAACAGCCAGAAC-1 contig 2 = CTGGGCCTCA...
umi AACCTTTCGC = 327 reads: +379 validated
umi AAGCGCGCAT = 236 reads: +379 validated
umi ACCAGAGGCA = 235 reads: +379 validated
umi ATCACTTTCT = 370 reads: +379 validated
umi CATTCAGAAT = 151 reads: +379 validated
umi CCGCACTCTC = 261 reads: +379 validated
umi CGGTTTTGTT = 268 reads: +379 validated
umi CTCAAGTGGG = 242 reads: +379 validated
umi CTGACGACAT = 317 reads: +379 validated
umi CTTTTCGCAA = 290 reads: +379 validated
umi GACCCATAGG = 314 reads: +379 validated
umi GCCCCGTCAT = 287 reads: +379 validated
umi GGTATGTAGA = 107 reads: +379 validated
umi GTGTGGTCGC = 304 reads: +379 validated
umi TCAGCACCTC = 325 reads: +379 validated
umi TGATTATCTT = 358 reads: +379 validated
umi TGCTGCTGCA = 335 reads: +379 validated
umi TGTACAAGAG = 261 reads: +379 validated
umi TTATCAACCT = 490 reads: +379 validated
umi TTCGAATCGT = 584 reads: +379 validated
umi TTCGTACGAG = 226 reads: +379 validated
umi TTTCGAGTGT = 122 reads: +379 validated

UMI info for barcode GCGCAACAGCCAGAAC-1 contig 3 = GTGGGCTCAG...
umi AACTCAATGA = 225 reads: +136 -1XX +245 invalidated
umi AAGTACTTAC = 236 reads: +382 validated
umi CTCCAATCGC = 274 reads: +382 validated
umi GAAATGACGG = 248 reads: +382 validated
umi GCGACACCTC = 245 reads: +382 validated
umi GCTAATGGGT = 220 reads: +382 validated
umi GGAGACTACT = 222 reads: +382 validated
umi GGGAAACAGC = 216 reads: +382 validated
umi GGGTTTACGG = 265 reads: +382 validated
umi GTAGTCAGAT = 241 reads: +382 validated
umi TACGAGGACA = 318 reads: +382 validated
umi TATCGCTGGG = 298 reads: +382 validated
umi TCGCTGCCAG = 391 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=593]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=1)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
491-593 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 10 umis using 168 reads
cdr3 = CARGIVGATGDYYFDYW at 409, score = 9 + 7
umis assigned: [183, 344, 603, 626, 648, 771, 805, 991, 1032, 1049] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2318
start codons at 67, 218, 223, 281, 284, 370, 509, 570
confident = true

TIG 2[bases=627]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 22 umis using 1100 reads
cdr3 = CQAWDSSTGVVF at 352, score = 6 + 8
umis assigned: [21, 40, 101, 240, 361, 407, 470, 516, 547, 587] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6291
start codons at 37, 42, 98, 185, 331, 335
confident = true

TIG 3[bases=628]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=4)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 630 reads
cdr3 = CYSTDSSGNPVVF at 350, score = 7 + 8
umis assigned: [31, 43, 523, 590, 676, 684, 697, 710, 726, 753] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3332
start codons at 35, 96, 165, 183, 234, 296, 333
confident = true
now this is a cell
NOT paired!
sorting bam, mem = 0.07
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk067-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk067-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

19.407 seconds used processing barcodes, peak mem = 0.23
