[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.19 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk059-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk059-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk059.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.0 = GAACATCCAGCTTCGG-1

using 24877 reads

====================================================================================

graph has 8770 edges initially, 60 edges after simplification

total ucounts = 1597
nonsolo ucounts = 699[2^255, 3^138, 4^89, 5^54, 6^24, 7^18, 8^8, 9^7, 10^7, 11^2, 12^3, 13, 14^3, 15^4, 16, 18, 44, 47, 89, 95, 97, 105, 108, 119, 124, 126, 128, 131, 132, 135, 136, 146, 148, 164, 177, 185, 199, 208, 210, 217, 221, 225^2, 230, 236, 241, 242, 243^2, 245, 247, 249, 252, 253^3, 254^2, 263, 268, 270, 277^2, 278, 283, 284^2, 288, 291, 293, 294, 295, 299^2, 300, 304, 314, 316, 319^2, 320, 323, 324, 326, 328, 329, 330, 331, 335, 343^2, 344, 352, 365, 371, 374, 376, 503, 673, 713]
surviving nonsolo ucounts = 81[4, 97, 105, 108, 119, 124, 126, 128, 131, 132, 135, 136, 146, 148, 164, 177, 185, 199, 208, 210, 217, 221, 225^2, 230, 236, 241, 242, 243^2, 245, 247, 249, 252, 253^3, 254^2, 263, 268, 270, 277^2, 278, 283, 284^2, 288, 291, 293, 294, 295, 299^2, 300, 304, 314, 316, 319^2, 320, 323, 324, 326, 328, 329, 330, 331, 335, 343^2, 344, 352, 365, 371, 374, 376, 503, 673, 713]
ids = [1429, 1360, 280, 8, 824, 1086, 857, 248, 1184, 41, ...]

====================================================================================

UMI info for barcode GAACATCCAGCTTCGG-1 contig 1 = TCTGAGAGTC...
umi ATCACATTAG = 106 reads: +432 -1 +10 -1 +1 non-validated
umi CAATCGGATA = 193 reads: -382 +63 non-validated
umi CGGTAGGGAC = 264 reads: +151 -1XX +293 invalidated
umi GATCCAGGGA = 126 reads: +445 validated
umi TTTCTGGTCT = 144 reads: +445 validated

UMI info for barcode GAACATCCAGCTTCGG-1 contig 2 = GGGAGGAGTC...
umi AAACGTGCTC = 114 reads: +388 validated
umi AAATCTCGCC = 300 reads: +388 validated
umi AAGAAATACT = 218 reads: +388 validated
umi AAGATACTGA = 209 reads: +388 validated
umi AAGTCAGGGT = 283 reads: +388 validated
umi AATAAGCTTG = 322 reads: +388 validated
umi ACCCGCTTCG = 176 reads: +388 validated
umi ACTGGTGGTC = 265 reads: +388 validated
umi AGCTCGCTGC = 254 reads: +388 validated
umi AGTATATCCG = 296 reads: +388 validated
umi AGTTCGCTTG = 315 reads: +388 validated
umi ATAAAGCAGC = 137 reads: +157 -1XX +230 invalidated
umi ATAATCAATC = 283 reads: +388 validated
umi ATACCGGCGT = 225 reads: +388 validated
umi ATCCACCGTC = 278 reads: +388 validated
umi ATGACCTTCT = 207 reads: +388 validated
umi ATGACGGGGT = 379 reads: +388 validated
umi ATTCCTTTAG = 677 reads: +388 validated
umi ATTCTCCTAT = 341 reads: +388 validated
umi ATTCTTTCCA = 282 reads: +388 validated
umi CACGATGTGC = 317 reads: +388 validated
umi CACTCCTGGC = 358 reads: +388 validated
umi CACTCTCGGC = 244 reads: +388 validated
umi CACTGTTCGC = 273 reads: +388 validated
umi CAGCTGGTGC = 327 reads: +388 validated
umi CATCCCCTGT = 502 reads: +388 validated
umi CATCTACCTT = 318 reads: +388 validated
umi CATTAACTCT = 263 reads: +388 validated
umi CCATCCGTAC = 238 reads: +388 validated
umi CCCCGCACGG = 302 reads: +388 validated
umi CCCGTTCTGC = 366 reads: +388 validated
umi CCGCAGTCAC = 148 reads: +388 validated
umi CCGGCATTTC = 344 reads: +388 validated
umi CCTACTCGCC = 241 reads: +388 validated
umi CCTTGACCCT = 292 reads: +388 validated
umi CGACAAACCG = 226 reads: +388 validated
umi CGCGAGACAG = 319 reads: +388 validated
umi CTAACATCCG = 136 reads: +388 validated
umi CTGTGGTTCC = 298 reads: +388 validated
umi GACCCCTGCG = 330 reads: +388 validated
umi GACGATCGCT = 119 reads: +388 validated
umi GACTCAGGCG = 256 reads: +388 validated
umi GCAAGAGGAA = 253 reads: +388 validated
umi GCACGTCGTA = 331 reads: +388 validated
umi GCCTTCCTAG = 252 reads: +388 validated
umi GCGTATCGTG = 331 reads: +388 validated
umi GTAACAAGCC = 257 reads: +388 validated
umi GTAATATTCG = 291 reads: +388 validated
umi GTATCATAGC = 226 reads: +388 validated
umi GTCCATATCC = 278 reads: +388 validated
umi GTGAGTTACG = 124 reads: +388 validated
umi GTTTAAACAC = 293 reads: +388 validated
umi TAAGTGTATC = 332 reads: +388 validated
umi TAATCTCCAT = 278 reads: +388 validated
umi TACGTTCGGT = 238 reads: +388 validated
umi TACTGCGTCT = 130 reads: +388 validated
umi TATATAGGGC = 356 reads: +123 -4XX +1 -1XX +1 -1XX +3 -4XX +3 -2XX +1 -13XX +231 invalidated
umi TATGCTCGGA = 224 reads: +388 validated
umi TCATTTTCGC = 361 reads: +388 validated
umi TCCAGATTAC = 238 reads: +388 validated
umi TCGAAGGACA = 348 reads: +388 validated
umi TCGGTGCGCA = 289 reads: +388 validated
umi TCGTCGCTAC = 306 reads: +388 validated
umi TCTACCATTC = 365 reads: +388 validated
umi TCTATATGGA = 186 reads: +388 validated
umi TCTCCGGAAA = 96 reads: +388 validated
umi TCTTATTTTG = 320 reads: +388 validated
umi TTAACCGTTG = 254 reads: +388 validated
umi TTAGCTTCTA = 716 reads: +388 validated
umi TTATAGATCG = 238 reads: +388 validated
umi TTCATATCAA = 134 reads: +388 validated
umi TTGCACCCGC = 324 reads: +388 validated
umi TTTTATTCTT = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=658]
0-31 ==> 70-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
31-387 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=15)
393-424 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=9)
425-476 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
476-658 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 53 reads
cdr3 = CARGQPFVDFSSGYYVPNWFDPW at 376, score = 9 + 7
umis assigned: [280, 399, 667, 857, 1581]
of which 5 are surviving nonsolos
reads assigned: 804
start codons at 31, 75
confident = true

TIG 2[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 73 umis using 3136 reads
cdr3 = CQQSYSTPWQF at 357, score = 8 + 7
umis assigned: [8, 19, 48, 53, 69, 77, 132, 164, 206, 224] and 63 others
of which 73 are surviving nonsolos
reads assigned: 20103
start codons at 30, 36, 92, 105, 241, 460
confident = true
now this is a cell
paired!

TGTGCGAGAGGACAGCCCTTCGTCGATTTTTCGAGTGGTTATTACGTCCCGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCACGAGTCTGCAACCTGAAGATTTTGCAATTTACTACTGTCAACAGAGTTACAGTACCCCGTGGCAGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.4 = GAACATCCAGGCTGAA-1

using 214 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 207]
surviving nonsolo ucounts = 1[207]
ids = [3]

====================================================================================

UMI info for barcode GAACATCCAGGCTGAA-1 contig 1 = GGCTTTCTGA...
umi CATCATATAC = 204 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=555]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=28)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
463-555 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CARRDYYGSERVDFDYW at 381, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 15, 24, 36, 80, 96, 184, 303, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.5 = GAACATCCAGGTCTCG-1

using 34 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 9, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.22 = GAACATCGTAGAGCTG-1

using 1905 reads

====================================================================================

graph has 496 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[583, 1317]
surviving nonsolo ucounts = 2[583, 1317]
ids = [3, 1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.23 = GAACATCGTAGAGGAA-1

using 222 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [0]

====================================================================================

UMI info for barcode GAACATCGTAGAGGAA-1 contig 1 = GGCTGGGGTC...
umi ACTGTAATGA = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-370 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-526 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSVAGSYSLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 42, 181, 199, 250, 253, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.25 = GAACATCGTCAATGTC-1

using 252 reads

====================================================================================

graph has 140 edges initially, 36 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 97, 146]
surviving nonsolo ucounts = 2[97, 146]
ids = [1, 3]

====================================================================================

UMI info for barcode GAACATCGTCAATGTC-1 contig 1 = CAGCGCTCTC...
umi CCCCAGCGCT = 94 reads: +388 validated

UMI info for barcode GAACATCGTCAATGTC-1 contig 2 = GCTGGGGTCA...
umi GATCGGAAGG = 143 reads: +40 -1XX +141 -1XX +1 -1XX +203 invalidated

GOOD CONTIGS

TIG 1[bases=527]
0-24 ==> 17-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
24-377 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
374-412 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
412-527 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYTSSSTLVF at 348, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 24, 181, 225, 232
confident = false

TIG 2[bases=544]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-544 ==> 0-115 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CCSYAGISTFAF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 41, 180, 242, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.29 = GAACATCGTCGCCATG-1

using 28 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 1[27]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.40 = GAACATCGTTCTCATT-1

using 652 reads

====================================================================================

graph has 976 edges initially, 2 edges after simplification

total ucounts = 326
nonsolo ucounts = 139[2^67, 3^30, 4^14, 5^11, 6^9, 7^3, 9^2, 11, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.41 = GAACATCGTTGGTAAA-1

using 453 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 6[2, 4, 7, 8, 10, 407]
surviving nonsolo ucounts = 1[407]
ids = [11]

====================================================================================

UMI info for barcode GAACATCGTTGGTAAA-1 contig 1 = GATCAGGACT...
umi TAACTTCTCC = 399 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=520]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-520 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.49 = GAACATCTCACGAAGG-1

using 391 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3^2, 4, 376]
surviving nonsolo ucounts = 1[376]
ids = [2]

====================================================================================

UMI info for barcode GAACATCTCACGAAGG-1 contig 1 = AGAGCCCTGG...
umi CGGCTCCTAG = 364 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-511 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQRSNWPPLFTF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 358
start codons at 44, 249, 252, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.59 = GAACATCTCCGAAGAG-1

using 197 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

UMI info for barcode GAACATCTCCGAAGAG-1 contig 1 = AGCTTCAGCT...
umi GGATGTAGCT = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-505 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.65 = GAACATCTCCTGCCAT-1

using 410 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[6, 397]
surviving nonsolo ucounts = 1[397]
ids = [6]

====================================================================================

UMI info for barcode GAACATCTCCTGCCAT-1 contig 1 = GTCAGTCTCA...
umi TGTCGGTCAC = 388 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.70 = GAACATCTCGTAGGTT-1

using 218 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 205]
surviving nonsolo ucounts = 1[205]
ids = [1]

====================================================================================

UMI info for barcode GAACATCTCGTAGGTT-1 contig 1 = GGGAGAGGAA...
umi CTCACCGTGT = 205 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=509]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=3)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=40)
458-494 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CATAPPSLIWFGLQSW at 415, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 73, 175, 229, 282, 290, 308, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.80 = GAACATCTCTGATACG-1

using 417 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 403]
surviving nonsolo ucounts = 1[403]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.82 = GAACATCTCTTCAACT-1

using 19 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.90 = GAACCTAAGAGACGAA-1

using 225 reads

====================================================================================

graph has 93 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode GAACCTAAGAGACGAA-1 contig 1 = CTGGGCCTCA...
umi CTCGAGCTAT = 217 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=501]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-375 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
416-501 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQAWDSSTLVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.96 = GAACCTAAGCAAATCA-1

using 1195 reads

====================================================================================

graph has 398 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 1183]
surviving nonsolo ucounts = 1[1183]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=400]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-189 ==> 0-151 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
189-400 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 1167
start codons at 38, 177
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.98 = GAACCTAAGCCCAGCT-1

using 112 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 26
nonsolo ucounts = 15[2^2, 3^3, 4^2, 5, 6, 8, 9, 12^3, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.99 = GAACCTAAGCGCTTAT-1

using 253 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 243]
surviving nonsolo ucounts = 1[243]
ids = [7]

====================================================================================

UMI info for barcode GAACCTAAGCGCTTAT-1 contig 1 = GATCAGGACT...
umi TCCTTTGGTC = 243 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
427-511 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTLFTF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.104 = GAACCTAAGCTCCTTC-1

using 1349 reads

====================================================================================

graph has 1794 edges initially, 28 edges after simplification

total ucounts = 633
nonsolo ucounts = 290[2^116, 3^64, 4^50, 5^27, 6^13, 7^6, 8^7, 9^4, 10, 11, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.118 = GAACCTAAGGTGACCA-1

using 255 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 246]
surviving nonsolo ucounts = 1[246]
ids = [3]

====================================================================================

UMI info for barcode GAACCTAAGGTGACCA-1 contig 1 = TGGGGACCCA...
umi GACCCTAGGC = 245 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=536]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=44)
437-486 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=8)
486-536 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDLFENAITSRWFDSW at 401, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 59, 146, 195, 279, 294, 365, 423, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.138 = GAACCTACAAGTTCTG-1

using 178 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 168]
surviving nonsolo ucounts = 1[168]
ids = [6]

====================================================================================

UMI info for barcode GAACCTACAAGTTCTG-1 contig 1 = AGTGCTTTCT...
umi GAAAGGACCT = 161 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=482]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=10)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
453-482 ==> 0-29 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARAHGDYYTLLDFW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.143 = GAACCTACACATTTCT-1

using 262 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[256]
surviving nonsolo ucounts = 1[256]
ids = [3]

====================================================================================

UMI info for barcode GAACCTACACATTTCT-1 contig 1 = AAGAACCTGC...
umi CAATGTGAGT = 244 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=558]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-382 ==> 0-330 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
428-558 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQAWDGSTAVF at 367, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 52, 57, 113, 200, 251, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.146 = GAACCTACACCCATTC-1

using 208 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode GAACCTACACCCATTC-1 contig 1 = GCTCTGCTTC...
umi ATAAGTTAGG = 207 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=518]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-518 ==> 0-73 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.149 = GAACCTACACCGGAAA-1

using 242 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [1]

====================================================================================

UMI info for barcode GAACCTACACCGGAAA-1 contig 1 = GCTGGGGTCT...
umi CTCATACTAG = 225 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=449]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CSSYTSSSTLVVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.153 = GAACCTACACGGTAAG-1

using 425 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 6[3^3, 4, 6, 389]
surviving nonsolo ucounts = 1[389]
ids = [14]

====================================================================================

UMI info for barcode GAACCTACACGGTAAG-1 contig 1 = GAGAAGAGCT...
umi TACTCTTAGT = 356 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
423-516 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSTPLFAF at 359, score = 9 + 6
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.155 = GAACCTACACTTCTGC-1

using 295 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 289]
surviving nonsolo ucounts = 1[289]
ids = [0]

====================================================================================

UMI info for barcode GAACCTACACTTCTGC-1 contig 1 = GTCAGACTCA...
umi ACGGAGTGTG = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=441]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-441 ==> 0-30 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 23, 29, 85, 98, 234, 237, 330, 360
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.156 = GAACCTACAGACAAAT-1

using 355 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3^2, 4, 7, 335]
surviving nonsolo ucounts = 1[335]
ids = [7]

====================================================================================

UMI info for barcode GAACCTACAGACAAAT-1 contig 1 = GAGCCCCAGC...
umi TTTACTTCTA = 311 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=505]
0-67 ==> 169-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
67-420 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=4)
441-476 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
476-505 ==> 0-29 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARGGFWSGYIW at 409, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 67, 223, 284, 370, 494
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.157 = GAACCTACAGACACTT-1

using 309 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 305]
surviving nonsolo ucounts = 1[305]
ids = [1]

====================================================================================

UMI info for barcode GAACCTACAGACACTT-1 contig 1 = ACCCAAAAAC...
umi TCTCACCATT = 298 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=541]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-541 ==> 0-78 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.158 = GAACCTACAGACAGGT-1

using 1179 reads

====================================================================================

graph has 1731 edges initially, 16 edges after simplification

total ucounts = 524
nonsolo ucounts = 227[2^87, 3^59, 4^23, 5^17, 6^17, 7^3, 8^9, 9^5, 12, 14, 15^2, 16, 17, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.159 = GAACCTACAGACGCCT-1

using 682 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 672]
surviving nonsolo ucounts = 1[672]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=305]
0-169 ==> 184-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
188-234 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
234-305 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARTPGGSGSQWDYW at 158, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 662
start codons at 14, 19, 51, 80, 113, 190
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.164 = GAACCTACATACTCTT-1

using 734 reads

====================================================================================

graph has 956 edges initially, 12 edges after simplification

total ucounts = 338
nonsolo ucounts = 148[2^50, 3^40, 4^25, 5^11, 6^8, 7^7, 8, 9^3, 10^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.165 = GAACCTACATAGTAAG-1

using 475 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[4^3, 10, 214, 236]
surviving nonsolo ucounts = 2[214, 236]
ids = [4, 6]

====================================================================================

UMI info for barcode GAACCTACATAGTAAG-1 contig 1 = AGCTCTCAGA...
umi CTCGGAGCGA = 213 reads: +406 validated

UMI info for barcode GAACCTACATAGTAAG-1 contig 2 = AGCTTCAGCT...
umi TCCCTAACGA = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 7 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 79, 235, 356, 382
confident = false

TIG 2[bases=495]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-495 ==> 0-61 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.167 = GAACCTACATCCGTGG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.168 = GAACCTACATCTACGA-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.169 = GAACCTACATGGGACA-1

using 324 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode GAACCTACATGGGACA-1 contig 1 = GAGAAGAGCT...
umi AAAAGGCTCT = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-467 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPPWTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 35, 243, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.187 = GAACCTAGTCCAGTAT-1

using 231 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [7]

====================================================================================

UMI info for barcode GAACCTAGTCCAGTAT-1 contig 1 = TGGGCCTCAG...
umi TTCAAAAGGT = 221 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=544]
0-36 ==> 16-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
36-370 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
377-415 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
415-544 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQAWDSTTDWVF at 351, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 36, 41, 97, 184, 330, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.188 = GAACCTAGTCCATCCT-1

using 1407 reads

====================================================================================

graph has 1842 edges initially, 32 edges after simplification

total ucounts = 683
nonsolo ucounts = 299[2^127, 3^68, 4^49, 5^29, 6^8, 7^5, 8^5, 9, 11, 12^2, 13^2, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.190 = GAACCTAGTCCGTTAA-1

using 338 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 5, 12, 311]
surviving nonsolo ucounts = 1[311]
ids = [8]

====================================================================================

UMI info for barcode GAACCTAGTCCGTTAA-1 contig 1 = AGTCTGGGCC...
umi TTAGCATCAG = 310 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=578]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-578 ==> 0-156 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.192 = GAACCTAGTCCTGCTT-1

using 343 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 7, 328]
surviving nonsolo ucounts = 1[328]
ids = [3]

====================================================================================

UMI info for barcode GAACCTAGTCCTGCTT-1 contig 1 = GAGAAGAGCT...
umi CTCTTTTGCC = 334 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CHQYGSSFMYTL at 359, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 35, 243, 369, 383, 416, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.195 = GAACCTAGTCTAACGT-1

using 214 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=467]
2-126 ==> 5876-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
126-467 ==> 0-341 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 31, 71, 126, 334, 460
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.196 = GAACCTAGTCTGATTG-1

using 12 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.200 = GAACCTAGTGCAGTAG-1

using 478 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 199, 273]
surviving nonsolo ucounts = 2[199, 273]
ids = [0, 4]

====================================================================================

UMI info for barcode GAACCTAGTGCAGTAG-1 contig 1 = AGGAATCAGT...
umi AATCACGTTC = 191 reads: +388 validated

UMI info for barcode GAACCTAGTGCAGTAG-1 contig 2 = TCTGCTTCAG...
umi TTAATCGGGC = 260 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=472]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-472 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=495]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-495 ==> 0-55 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDTSLSGSVF at 373, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 49, 203, 206, 257, 356, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.204 = GAACCTAGTTACGTCA-1

using 308 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode GAACCTAGTTACGTCA-1 contig 1 = ATACTTTCTG...
umi CCGGGTTACG = 279 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
37-240 ==> 0-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=10)
437-479 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
479-535 ==> 0-56 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARVQQIKRGAISTTFYYNALDVW at 376, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 37, 81, 431, 497
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.208 = GAACCTAGTTCCCTTG-1

using 314 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [0]

====================================================================================

UMI info for barcode GAACCTAGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi TACATGTTGA = 300 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=503]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-503 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.215 = GAACCTAGTTGTACAC-1

using 413 reads

====================================================================================

graph has 160 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 4, 142, 257]
surviving nonsolo ucounts = 2[142, 257]
ids = [5, 6]

====================================================================================

UMI info for barcode GAACCTAGTTGTACAC-1 contig 1 = ACCCAAAAAC...
umi GATCTGCCAC = 139 reads: +436 validated

UMI info for barcode GAACCTAGTTGTACAC-1 contig 2 = GAGGAATCAG...
umi TATTCTCGGC = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=449]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-449 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.216 = GAACCTAGTTTGTTTC-1

using 224 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode GAACCTAGTTTGTTTC-1 contig 1 = GGGGAAGCTC...
umi TGCTGCGGTA = 215 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=455]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
56-407 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=2)
409-447 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAAWDDSLSAHYVF at 377, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 56, 210, 360, 385, 390, 411
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.219 = GAACCTATCAAGAAGT-1

using 376 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[373]
surviving nonsolo ucounts = 1[373]
ids = [0]

====================================================================================

UMI info for barcode GAACCTATCAAGAAGT-1 contig 1 = GGAGAAGAGC...
umi AATAGCCTCT = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-486 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDTSPPWTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.222 = GAACCTATCACATAGC-1

using 23 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.240 = GAACCTATCCGCATCT-1

using 247 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 5, 229]
surviving nonsolo ucounts = 1[229]
ids = [8]

====================================================================================

UMI info for barcode GAACCTATCCGCATCT-1 contig 1 = AGAGCTGCTC...
umi GTAAGTGGGG = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-475 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPMYTF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 31, 80, 239, 338, 379, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.242 = GAACCTATCCGTCATC-1

using 311 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^3, 3^4, 4, 5, 7, 14, 260]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.247 = GAACCTATCGCACTCT-1

using 259 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 245]
surviving nonsolo ucounts = 1[245]
ids = [5]

====================================================================================

UMI info for barcode GAACCTATCGCACTCT-1 contig 1 = ACCCAAAAAC...
umi TAACGATTGG = 248 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=561]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-561 ==> 0-71 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.255 = GAACCTATCGTGGGAA-1

using 83 reads

====================================================================================

graph has 106 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^2, 3, 6, 7^2, 9, 10^2, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.260 = GAACCTATCTCTGCTG-1

using 305 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 295]
surviving nonsolo ucounts = 1[295]
ids = [1]

====================================================================================

UMI info for barcode GAACCTATCTCTGCTG-1 contig 1 = ACTGATCAGG...
umi ATTTGCCCGA = 294 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=563]
0-33 ==> 3-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
33-393 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=16)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQALTF at 369, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 33, 66, 102, 184, 190, 352, 372, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.264 = GAACCTATCTGCAGTA-1

using 10249 reads

====================================================================================

graph has 4623 edges initially, 80 edges after simplification

total ucounts = 763
nonsolo ucounts = 374[2^136, 3^67, 4^45, 5^31, 6^23, 7^12, 8^5, 9^5, 10^4, 11^2, 14, 15, 16, 17, 19, 22, 25, 33, 38, 60, 65^2, 90, 96, 102, 103, 162, 167, 176, 181, 187, 189, 194, 202, 207, 210^2, 216, 225, 241, 245, 276, 287, 305, 306, 308, 342, 348, 357, 368, 407, 446, 473, 668]
surviving nonsolo ucounts = 35[33, 38, 65, 90, 96, 102, 103, 162, 167, 176, 181, 187, 189, 194, 202, 207, 210^2, 216, 225, 241, 245, 276, 287, 305, 306, 308, 342, 348, 357, 368, 407, 446, 473, 668]
ids = [421, 132, 462, 354, 649, 225, 116, 92, 238, 88, ...]

====================================================================================

UMI info for barcode GAACCTATCTGCAGTA-1 contig 1 = AGCTTCAGCT...
umi AATTCCATTT = 191 reads: +388 validated
umi ACCTTCTCGT = 178 reads: +388 validated
umi ACTCTTGCCC = 56 reads: -7 +1 -8XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -7XX +1 -4XX +1 -1XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +5 -1XX +1 -1XX +4 -1XX +2 -1XX +4 -1XX +12 -1XX +2 -1XX +20 -1XX +2 -1XX +1 -1XX +4 -2XX +4 -2XX +24 -1XX +17 -1XX +3 -3XX +4 -1X +1 -1XX +4 -1XX +9 -1XX +1 -1XX +32 -1XX +6 -1XX +6 -1XX +5 -2XX +2 -1XX +6 -1X +2 -32X +2 -3X +1 -4X +1 -3X +1 -2X +1 -1X +25 -12 invalidated
umi ATAAAGCGTG = 210 reads: +388 validated
umi CATGGCGGTA = 66 reads: -16X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -7XX +1 -4XX +1 -1XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +5 -1XX +1 -1XX +4 -1XX +2 -1XX +4 -1XX +12 -1XX +2 -1XX +20 -1XX +2 -1XX +1 -1XX +4 -2XX +4 -2XX +24 -1XX +17 -1XX +3 -3XX +6 -1XX +4 -1XX +9 -1XX +1 -1XX +32 -1XX +6 -1XX +6 -1XX +5 -2XX +2 -1XX +3 -48X +1 -3X +1 -4X +37 invalidated
umi GAGGTTCCAG = 206 reads: +388 validated
umi GCGGTCTGCG = 62 reads: +381 -2X +5 invalidated
umi GCTTCCGCTA = 77 reads: -7 +1 -8XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -7XX +1 -4XX +1 -1XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +5 -1XX +1 -1XX +4 -1XX +2 -1XX +4 -1XX +12 -1XX +2 -1XX +20 -1XX +2 -1XX +1 -1XX +4 -2XX +4 -2XX +24 -1XX +17 -1XX +3 -3XX +6 -1XX +4 -1XX +9 -1XX +1 -1XX +32 -1XX +6 -1XX +6 -1XX +5 -2X +1 -43X +2 -3XX +1 -4XX +1 -3XX +1 -2XX +1 -1XX +37 invalidated
umi GGAACTTGGC = 199 reads: -9 +2 -2XX +1 -2XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -12XX +1 -1XX +345 invalidated
umi TCCTACAGTC = 228 reads: +388 validated
umi TGCCGGTCCA = 68 reads: -16X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -7XX +1 -4XX +1 -1XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +5 -1XX +1 -1XX +4 -1XX +2 -1XX +4 -1XX +12 -1XX +2 -1XX +20 -1XX +2 -1XX +1 -1XX +4 -2XX +4 -2XX +24 -1XX +17 -1XX +3 -3XX +6 -1XX +4 -1XX +9 -1XX +1 -1XX +32 -1XX +6 -1XX +6 -1XX +5 -2XX +2 -1X +1 -40X +2 -3XX +1 -4XX +1 -3XX +1 -2XX +1 -1XX +37 invalidated

UMI info for barcode GAACCTATCTGCAGTA-1 contig 2 = GGGAGAGGAG...
umi ACTCAACGCA = 176 reads: +400 -15 +23 -1 +3 -1 +16 -1 non-validated
umi AGGAGAGGTT = 98 reads: +401 -1 +6 -1 +51 non-validated
umi ATAGCGAGTA = 30 reads: -460 non-validated
umi CAGTATTAGA = 98 reads: +362 -1X +7 -90 invalidated
umi CGATGAGCCG = 368 reads: -428X +1 -1X +2 -7XX +1 -12XX +1 -5XX +2 invalidated
umi CTATATACGG = 403 reads: -427X +1 -4XX +1 -24XX +2 -1XX invalidated
umi GAATCCAGGT = 21 reads: -460 non-validated
umi TCCACCTTGA = 243 reads: +422 -38 non-validated
umi TCTAATAATC = 76 reads: -460 non-validated
umi TGCGTTTTCT = 327 reads: -431 +1 -7X +1 -12X +1 -5XX +2 invalidated
umi TGTTTATCCT = 197 reads: +401 -1 +17 -1 +2 -2 +1 -1 +11 -2 +21 non-validated
umi TTCAGAGTAT = 185 reads: +400 -28 +32 non-validated

GOOD CONTIGS

TIG 1[bases=583]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-583 ==> 0-148 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 163 reads
cdr3 = CAAWDDSLNGWVF at 368, score = 8 + 8
umis assigned: [44, 78, 92, 126, 238, 433, 462, 472, 475, 634] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1523
start codons at 47, 351, 376, 381, 393
confident = true

TIG 2[bases=605]
0-74 ==> 6-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
74-433 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=1)
471-534 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
534-605 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CTRDTPWGWGGGDWESSSHYYYYMDVW at 422, score = 8 + 7
umis assigned: [88, 116, 132, 225, 322, 369, 421, 623, 649, 676] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2205
start codons at 74, 127, 225, 230, 297, 354, 383, 445, 491
confident = true

REJECT CONTIGS

TIG 1[bases=563]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
17-69 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [81, 82, 207, 265, 361, 474, 564, 602, 624, 625] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3867
start codons at 44, 249, 252, 469
confident = false
did not find CDR3
now this is a cell
paired!

ACCCCCTGGGGATGGGGTGGTGGTGACTGGGAGTCCTCATCCCACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.266 = GAACCTATCTGGTTCC-1

using 11539 reads

====================================================================================

graph has 6222 edges initially, 62 edges after simplification

total ucounts = 1318
nonsolo ucounts = 671[2^271, 3^148, 4^89, 5^54, 6^28, 7^20, 8^9, 9^5, 10^4, 11^5, 12^2, 13, 14^2, 15, 40, 55, 57, 82, 113, 125, 146, 180, 185, 205, 208, 212, 223, 259, 287, 293, 295, 305, 318, 322, 324, 337, 338, 347, 354, 360, 362, 368, 379^2, 385, 836]
surviving nonsolo ucounts = 28[7, 82, 125, 146, 185, 205, 208, 212, 223, 259, 287, 293, 295, 305, 318, 322, 324, 337, 338, 347, 354, 360, 362, 368, 379^2, 385, 836]
ids = [834, 132, 77, 1133, 941, 512, 1065, 769, 694, 808, ...]

====================================================================================

UMI info for barcode GAACCTATCTGGTTCC-1 contig 1 = GGGGAGGAAC...
umi AATGGTATCG = 126 reads: +394 validated
umi ACCTTGGGGT = 82 reads: +394 validated
umi ACCTTTCGGC = 362 reads: +394 validated
umi ACGGACTTCT = 833 reads: +394 validated
umi ATATGCTGAT = 361 reads: +394 validated
umi ATCTTTTGTA = 341 reads: +394 validated
umi ATGAGCGTGT = 296 reads: +394 validated
umi CATCCGTGGC = 286 reads: +394 validated
umi CGGGATCTAT = 206 reads: +394 validated
umi CTCGAAGGAA = 339 reads: +394 validated
umi GGATGAGTTT = 214 reads: +394 validated
umi GGATTGTTTT = 388 reads: +394 validated
umi GTAACATACC = 260 reads: +394 validated
umi GTCACAGCTA = 326 reads: +394 validated
umi TAAGTTCCGC = 324 reads: +394 validated
umi TACTATGTTA = 185 reads: +394 validated
umi TAGATTCGCG = 380 reads: +394 validated
umi TATACCATAC = 353 reads: +394 validated
umi TCTCCCGCAA = 205 reads: +394 validated
umi TCTTTACATC = 367 reads: +394 validated
umi TGCCCCTTCA = 323 reads: +394 validated
umi TGCGTGACTT = 151 reads: +394 validated
umi TGGGTTGGAA = 376 reads: +394 validated
umi TTGGGATAGA = 286 reads: +394 validated

UMI info for barcode GAACCTATCTGGTTCC-1 contig 2 = AGAGAGGTGC...
umi ATCACCTCTA = 305 reads: +418 validated
umi CATTGCGACT = 70 reads: +8 -1XX +6 -1XX +13 -1XX +6 -1XX +5 -2XX +13 -2XX +28 -1XX +4 -1XX +8 -2XX +25 -1XX +16 -2XX +1 -2XX +2 -1XX +1 -2XX +3 -1XX +22 -1XX +17 -2XX +2 -3XX +2 -2XX +1 -7XX +2 -1XX +4 -2XX +1 -1XX +6 -1XX +8 -1XX +32 -2XX +8 -1XX +1 -1XX +1 -1XX +42 -1XX +16 -1X +1 -5X +1 -8X +1 -1XX +2 -9XX +1 -1XX +35 invalidated
umi CTCAGAGCAT = 313 reads: +418 validated
umi GCAGGTTGCC = 198 reads: +418 validated
umi GTCACCTCTG = 2 reads: -354X +2 -3X +2 -5X +1 -2X +1 -8X +2 -2X +2 -1X +1 -1X +1 -1X +20 -9 invalidated

GOOD CONTIGS

TIG 1[bases=566]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 1151 reads
cdr3 = CQQYNNWPPGFLYTF at 357, score = 9 + 8
umis assigned: [77, 132, 133, 146, 264, 287, 289, 396, 512, 570] and 14 others
of which 24 are surviving nonsolos
reads assigned: 7278
start codons at 36, 105, 241, 472
confident = true

TIG 2[bases=592]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
430-449 ==> 0-19 on |26|IGHD4-23|D-REGION| [len=19] (mis=0)
452-490 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-592 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 73 reads
cdr3 = CARAIMTTVVTPGYW at 414, score = 9 + 7
umis assigned: [268, 406, 564, 694, 834]
of which 4 are surviving nonsolos
reads assigned: 880
start codons at 72, 223, 228, 375, 429, 508, 569
confident = true
now this is a cell
paired!

GCCGAGGACACGGCTGTTTATTACTGTGCGAGAGCTATAATGACTACGGTGGTAACTCCTGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCGGGTTTCTTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.270 = GAACCTATCTTCCTTC-1

using 55 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.273 = GAACCTATCTTTCCTC-1

using 309 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 45, 257]
surviving nonsolo ucounts = 2[45, 257]
ids = [2, 3]

====================================================================================

UMI info for barcode GAACCTATCTTTCCTC-1 contig 1 = GGGAGTCAGT...
umi GCACTTACCC = 46 reads: +385 validated

UMI info for barcode GAACCTATCTTTCCTC-1 contig 2 = GGGGTCACAA...
umi GGAGCTTCAC = 257 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=417]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
380-412 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQQSYSTPLF at 354, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 27, 33, 89, 102, 238
confident = false

TIG 2[bases=534]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-534 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.275 = GAACGGAAGAAACCTA-1

using 169 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=554]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-79 ==> 0-43 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-51 exon 2 [len=109] (mis=1)
188-498 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3) [SHIFT!]
495-533 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
533-554 ==> 0-21 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGTWDSSLTAVVF at 466, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 36, 122, 299, 350, 474
confident = false
not full
frameshifted full length stopped transcript of length 554
VJ delta = -87
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.294 = GAACGGAAGCGTGAAC-1

using 111 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 20
nonsolo ucounts = 15[2^3, 3, 4^2, 5, 6, 9^2, 10^2, 11, 13, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.297 = GAACGGAAGGCCATAG-1

using 20 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.299 = GAACGGAAGGTACTCT-1

using 1119 reads

====================================================================================

graph has 1597 edges initially, 12 edges after simplification

total ucounts = 478
nonsolo ucounts = 217[2^83, 3^47, 4^32, 5^15, 6^10, 7^6, 8^9, 9^2, 10^3, 11^5, 13^2, 14, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.301 = GAACGGAAGTACTTGC-1

using 1200 reads

====================================================================================

graph has 396 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 3, 27, 426, 738]
surviving nonsolo ucounts = 2[426, 738]
ids = [1, 0]

====================================================================================

UMI info for barcode GAACGGAAGTACTTGC-1 contig 1 = GGGAGGAACT...
umi AAATCCCAGG = 744 reads: +388 validated
umi AATCTTTTAT = 446 reads: +191 -1XX +196 invalidated
umi TCTATATTTT = 21 reads: -33 +23 -1XX +7 -2XX +2 -2XX +4 -1XX +21 -1XX +5 -1XX +41 -1XX +25 -1XX +2 -1XX +12 -1XX +4 -1XX +11 -1XX +1 -16 +8 -3X +32 -1XX +4 -1XX +23 -2XX +2 -1X +12 -57 +7 -3X +11 invalidated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 201 reads
cdr3 = CQQRSNWPPVYTF at 356, score = 8 + 8
umis assigned: [0, 1, 6]
of which 2 are surviving nonsolos
reads assigned: 1168
start codons at 35, 240, 243, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.308 = GAACGGACAAAGAATC-1

using 42 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[4^2, 5, 7, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.309 = GAACGGACAAAGTCAA-1

using 343 reads

====================================================================================

graph has 143 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[8, 36, 297]
surviving nonsolo ucounts = 1[297]
ids = [3]

====================================================================================

UMI info for barcode GAACGGACAAAGTCAA-1 contig 1 = GGAGTCAGTC...
umi CCGATGTCAC = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQLNSYPLTF at 353, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 26, 32, 88, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.315 = GAACGGACAAGCGATG-1

using 2032 reads

====================================================================================

graph has 794 edges initially, 18 edges after simplification

total ucounts = 85
nonsolo ucounts = 20[2^8, 3^3, 5, 8, 57, 209, 259, 322, 340, 366, 376]
surviving nonsolo ucounts = 7[57, 209, 259, 322, 340, 366, 376]
ids = [32, 65, 0, 39, 1, 48, 27]

====================================================================================

UMI info for barcode GAACGGACAAGCGATG-1 contig 1 = AGGCTGATCA...
umi ATCTTATCCA = 373 reads: +388 validated
umi CCCATCTATT = 57 reads: +388 validated
umi CGACAATCTC = 319 reads: +388 validated

UMI info for barcode GAACGGACAAGCGATG-1 contig 2 = AGAGAGGTGC...
umi CTCCACAACC = 340 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 0-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
47-398 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 110 reads
cdr3 = CQQANSFPLTF at 374, score = 9 + 9
umis assigned: [27, 32, 39]
of which 3 are surviving nonsolos
reads assigned: 744
start codons at 47, 53, 109, 122, 258, 477
confident = true

TIG 2[bases=503]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=0)
425-456 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=9)
454-502 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 19 reads
cdr3 = CARDLEYDSSGYFVPFDYW at 414, score = 9 + 7
umis assigned: [48]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 72, 223, 228, 375, 433
confident = true

REJECT CONTIGS

TIG 1[bases=559]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0, 1, 65]
of which 3 are surviving nonsolos
reads assigned: 804
start codons at 34, 242, 368, 383, 465
confident = false
did not find CDR3
now this is a cell
paired!

GCTGTTTATTACTGTGCGAGAGACTTGGAGTATGATAGTAGTGGTTATTTCGTGCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.319 = GAACGGACACAGATTC-1

using 356 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[355]
surviving nonsolo ucounts = 1[355]
ids = [1]

====================================================================================

UMI info for barcode GAACGGACACAGATTC-1 contig 1 = GAATCAGTCC...
umi TGTAATTGGC = 356 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.331 = GAACGGACAGCATGAG-1

using 207 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 200]
surviving nonsolo ucounts = 1[200]
ids = [0]

====================================================================================

UMI info for barcode GAACGGACAGCATGAG-1 contig 1 = GGCTGGGGTC...
umi CAGTTATGTC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=531]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-370 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=14)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
430-531 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSEAGSYTLLF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 42, 193, 199, 250, 253, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.338 = GAACGGACAGTCTTCC-1

using 150 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 144]
surviving nonsolo ucounts = 2[2, 144]
ids = [0, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-45 ==> 14-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-45 ==> 11319-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
0-45 ==> 8652-8697 on rc of segment before IGHV3-57 exon 1 [len=8697] (mis=1)
0-45 ==> 5955-6000 on rc of segment after IGHV1OR15-2 exon 1 [len=6000] (mis=1)
31-63 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
45-398 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
447-475 ==> 12-40 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 387, score = 7 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 138
start codons at 45, 243, 248, 265, 309, 342
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.342 = GAACGGACATCACGAT-1

using 163 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 156]
surviving nonsolo ucounts = 1[156]
ids = [4]

====================================================================================

UMI info for barcode GAACGGACATCACGAT-1 contig 1 = AGTCTGGGCC...
umi TAGGGTTTGG = 153 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=527]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=8)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
422-527 ==> 0-105 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQVWDSSSDHPVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 40, 101, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.343 = GAACGGACATCCGTGG-1

using 285 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode GAACGGACATCCGTGG-1 contig 1 = AGAGCTGCTC...
umi TTTGGGGTCC = 264 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=511]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-363 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
416-511 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDVSPCSF at 355, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 31, 127, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.345 = GAACGGACATCTGGTA-1

using 20260 reads

====================================================================================

graph has 7884 edges initially, 118 edges after simplification

total ucounts = 996
nonsolo ucounts = 491[2^190, 3^89, 4^62, 5^32, 6^20, 7^10, 8^6, 9^4, 10^2, 11^2, 12, 16^2, 18, 19, 30, 36, 37, 52, 66, 70, 85, 90, 94, 95, 107, 126, 129, 139, 145, 155, 179, 206, 211, 219, 220, 221, 223^2, 233, 236, 239, 243, 247, 248, 254, 257, 259, 261, 266, 275, 286, 306, 307^2, 309, 310, 311, 317, 330^2, 337, 341, 342, 343, 347, 348, 361, 367, 373^2, 374, 378^3, 383, 414, 418, 428, 435, 450, 452, 463, 531]
surviving nonsolo ucounts = 64[4, 66, 70, 90, 94, 95, 107, 126, 129, 139, 145, 155, 179, 206, 211, 219, 220, 221, 223^2, 233, 236, 239, 243, 247, 248, 254, 257, 259, 261, 266, 275, 286, 306, 307^2, 309, 310, 311, 317, 330^2, 337, 341, 342, 343, 347, 348, 361, 367, 373^2, 374, 378^3, 383, 414, 418, 428, 435, 452, 463, 531]
ids = [469, 616, 598, 977, 200, 739, 816, 633, 161, 838, ...]

====================================================================================

UMI info for barcode GAACGGACATCTGGTA-1 contig 1 = AGCTCTGAGA...
umi AACTCAGCTG = 235 reads: +397 validated
umi AATACCCTCC = 270 reads: +397 validated
umi AATTTAGGCG = 272 reads: +397 validated
umi ACCACTGCTA = 247 reads: +397 validated
umi ATACTCAATC = 94 reads: +373 -24 non-validated
umi CAAGTGTATC = 208 reads: +397 validated
umi CACGTCCATG = 256 reads: +397 validated
umi CCAATTCGCT = 346 reads: -3XX +1 -3XX +390 invalidated
umi CCGCTATCTC = 160 reads: +397 validated
umi CGTCGCATTT = 282 reads: +397 validated
umi GCCTCTCCGG = 224 reads: +392 -1 +4 non-validated
umi GCTATGTAGG = 68 reads: +397 validated
umi GGGAGGTCAG = 114 reads: -336X +5 -11X +1 -2X +1 -1X +1 -1X +38 invalidated
umi GTTACTTAGT = 247 reads: +397 validated
umi TACACGCCTG = 203 reads: +397 validated
umi TCTTAGGACC = 138 reads: +393 -4 non-validated
umi TGCACACATC = 198 reads: +397 validated
umi TGGTGCTGCG = 130 reads: +397 validated
umi TTACGTCGCG = 235 reads: +381 -16 non-validated
umi TTTAATTTCG = 302 reads: +397 validated

UMI info for barcode GAACGGACATCTGGTA-1 contig 2 = AGAGCTCTGG...
umi AAACTCTATC = 414 reads: +385 validated
umi AACAAACTAG = 242 reads: +385 validated
umi AAGCGTGCTA = 367 reads: +385 validated
umi AATAAATCGG = 261 reads: +385 validated
umi AATACCGCGA = 351 reads: +385 validated
umi ACTATAACCC = 340 reads: -14 +35 -2XX +2 -4XX +1 -2XX +1 -1XX +1 -7XX +1 -288X +1 -12X +2 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi AGCCAAGTCT = 240 reads: +385 validated
umi AGCCCGTCGG = 128 reads: +385 validated
umi AGTAGGATCC = 334 reads: +385 validated
umi ATCTTTTCAT = 342 reads: +385 validated
umi CAAAATCATT = 312 reads: +385 validated
umi CACCCGGTGT = 374 reads: +385 validated
umi CCGAGAAGGC = 307 reads: +385 validated
umi CCGAGACTCT = 375 reads: +385 validated
umi CCGTACTCGC = 345 reads: +385 validated
umi CGCGGCGCAG = 375 reads: +385 validated
umi CGCTTCTGCA = 358 reads: +385 validated
umi CTGGTGGGTC = 312 reads: +385 validated
umi CTGTTTCTGT = 219 reads: +385 validated
umi CTTAATGCAG = 375 reads: +385 validated
umi GCCGCCTGGA = 8 reads: -238 +2 -3XX +8 -1XX +8 -1XX +5 -1XX +5 -1XX +20 -1XX +3 -1XX +12 -1XX +3 -71 invalidated
umi GTGGCTCACA = 373 reads: +385 validated
umi GTTTCCGCCT = 305 reads: +385 validated
umi TAGCTTGCCC = 94 reads: +385 validated
umi TATCCGTAGT = 181 reads: +385 validated
umi TATGGGGCTT = 307 reads: +385 validated
umi TATGTGCATT = 374 reads: +385 validated
umi TCCTGCTCCC = 434 reads: +385 validated
umi TGCTGTTCCT = 290 reads: +385 validated
umi TTACTGGCGC = 257 reads: +385 validated
umi TTATCATCGG = 224 reads: +385 validated
umi TTCAATTCTA = 257 reads: +385 validated
umi TTTCTGGGTT = 88 reads: +385 validated
umi TTTTCCGTTC = 434 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=2)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=15)
438-476 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 317 reads
cdr3 = CATRVVYW at 421, score = 8 + 7
umis assigned: [41, 61, 88, 110, 200, 282, 299, 342, 393, 465] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4160
start codons at 79, 230, 235, 382
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 32 umis using 1422 reads
cdr3 = CQQYGSSPNSF at 368, score = 9 + 7
umis assigned: [12, 25, 47, 60, 62, 133, 159, 161, 184, 233] and 24 others
of which 34 are surviving nonsolos
reads assigned: 9854
start codons at 44, 252, 378, 471
confident = true

REJECT CONTIGS

TIG 1[bases=456]
0-63 ==> 0-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=1)
63-321 ==> 0-258 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=5)
320-456 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [291, 402, 468, 567, 582, 668]
of which 6 are surviving nonsolos
reads assigned: 1863
start codons at 9, 63, 153, 211, 214, 217, 289, 362
confident = false
did not find CDR3
now this is a cell
paired!

CTGCAAATGAACAGCCTGAGAGTCGAGGACACGGCCGTATATTACTGTGCGACCAGAGTCGTCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTGTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTAATAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.348 = GAACGGAGTAATCGTC-1

using 430 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 189, 236]
surviving nonsolo ucounts = 2[189, 236]
ids = [3, 4]

====================================================================================

UMI info for barcode GAACGGAGTAATCGTC-1 contig 1 = GAGTGCTTTC...
umi GTTACGATGC = 235 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=593]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-593 ==> 0-139 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.350 = GAACGGAGTAGAAGGA-1

using 2085 reads

====================================================================================

graph has 3030 edges initially, 18 edges after simplification

total ucounts = 978
nonsolo ucounts = 401[2^156, 3^90, 4^49, 5^36, 6^29, 7^18, 8^6, 9^7, 10^3, 11, 14^2, 15, 16, 18, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.355 = GAACGGAGTATATCCG-1

using 294 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 285]
surviving nonsolo ucounts = 1[285]
ids = [7]

====================================================================================

UMI info for barcode GAACGGAGTATATCCG-1 contig 1 = AGCTGTGGGC...
umi TTGTTTACTA = 274 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=564]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-564 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CNSRDSSGNRVVF at 355, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.366 = GAACGGAGTGTGGCTC-1

using 5965 reads

====================================================================================

graph has 2421 edges initially, 34 edges after simplification

total ucounts = 221
nonsolo ucounts = 79[2^24, 3^11, 4^5, 5^9, 7^3, 8, 9^2, 53, 56, 78, 119, 122, 147, 166, 169, 181, 199^2, 217, 241^2, 254, 264, 265, 287^2, 337, 346, 358, 483, 561]
surviving nonsolo ucounts = 22[53, 56, 78, 119, 122, 166, 169, 181, 199^2, 217, 241^2, 254, 264, 265, 287^2, 337, 346, 358, 561]
ids = [24, 48, 131, 196, 101, 55, 139, 99, 27, 96, ...]

====================================================================================

UMI info for barcode GAACGGAGTGTGGCTC-1 contig 1 = ATCACATAAC...
umi ACTTGTGGTA = 52 reads: +422 -1 +10 non-validated
umi ATCGCACTCC = 358 reads: +433 validated
umi ATCTTGTGCA = 311 reads: +433 validated
umi CCACCAGGCG = 167 reads: +433 validated
umi CGCTAAATTC = 322 reads: +433 validated
umi GAGCACTCGG = 230 reads: +433 validated
umi GCCCGTGGCC = 230 reads: +433 validated
umi GTAGGCTCCT = 81 reads: +376 -3 +54 non-validated
umi GTCTCTGTCT = 201 reads: +433 validated
umi GTTCAGCGGC = 172 reads: +433 validated
umi TGTATCGTTG = 109 reads: +368 -65 non-validated

UMI info for barcode GAACGGAGTGTGGCTC-1 contig 2 = TGGGGGCTGG...
umi AGAGCGACGG = 197 reads: +391 validated
umi ATGCTGACGG = 241 reads: +391 validated
umi CAGACTTCTA = 57 reads: +3 -2 +2 -1 +1 -1 +11 -1 +369 non-validated
umi CCCATCTAAT = 264 reads: +391 validated
umi CGTTCACGCC = 265 reads: +391 validated
umi CTGTCACCAT = 119 reads: -359X +1 -2XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi CTGTGATCCG = 198 reads: +391 validated
umi GAAGTGGGTC = 181 reads: +391 validated
umi GACCAGGCTT = 126 reads: +391 validated
umi TACTCTCAAC = 289 reads: +391 validated
umi TGCTTTTTCT = 283 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=562]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
411-428 ==> 0-17 on |7|IGHD1-1|D-REGION| [len=17] (mis=0)
428-491 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 170 reads
cdr3 = CARSVQLERLHYYYYYMDVW at 400, score = 9 + 7
umis assigned: [24, 35, 36, 55, 70, 104, 110, 131, 133, 139] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2184
start codons at 58, 256, 355, 448
confident = true

TIG 2[bases=648]
46-400 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 325 reads
cdr3 = CSSYTSSSTLGVF at 370, score = 8 + 8
umis assigned: [27, 37, 48, 56, 80, 93, 96, 99, 101, 153] and 1 others
of which 10 are surviving nonsolos
reads assigned: 2188
start codons at 46, 203, 247, 254, 257
confident = true

REJECT CONTIGS

TIG 1[bases=315]
5-50 ==> 2527-2572 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=1)
60-129 ==> 2581-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
162-213 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
213-315 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [121]
of which 1 are surviving nonsolos
reads assigned: 557
start codons at 29, 231, 292
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGGTCGGTACAACTGGAACGACTGCACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.371 = GAACGGAGTTGGGACA-1

using 311 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[307]
surviving nonsolo ucounts = 1[307]
ids = [3]

====================================================================================

UMI info for barcode GAACGGAGTTGGGACA-1 contig 1 = GGGAGAGGAG...
umi TAATTTGGCT = 296 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=512]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=17)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 17 reads
cdr3 = CARELDGAAAVNGFDYW at 415, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 73, 224, 229, 287, 290, 308, 361, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.372 = GAACGGAGTTGTCGCG-1

using 480 reads

====================================================================================

graph has 160 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 215, 256]
surviving nonsolo ucounts = 2[215, 256]
ids = [3, 5]

====================================================================================

UMI info for barcode GAACGGAGTTGTCGCG-1 contig 1 = GGAATCAGTC...
umi TCCCGGCGTC = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 26, 32, 101, 237, 456
confident = false

REJECT CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-336 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 357, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 36, 241, 463
confident = false
not full
full length stopped transcript of length 557
frameshifted full length stopped transcript of length 557
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.373 = GAACGGAGTTGTTTGG-1

using 637 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[184, 449]
surviving nonsolo ucounts = 2[184, 449]
ids = [1, 4]

====================================================================================

UMI info for barcode GAACGGAGTTGTTTGG-1 contig 1 = AGCTTCAGCT...
umi TCGTCATGGA = 176 reads: +388 validated
umi TTCCTTTCGC = 444 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-544 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 108 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 608
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.376 = GAACGGATCAACACCA-1

using 1009 reads

====================================================================================

graph has 390 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 214, 786]
surviving nonsolo ucounts = 2[214, 786]
ids = [1, 5]

====================================================================================

UMI info for barcode GAACGGATCAACACCA-1 contig 1 = TGGGGAGGAA...
umi CATATCTACA = 193 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=480]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-480 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 37, 245, 461
confident = false

REJECT CONTIGS

TIG 1[bases=373]
1-259 ==> 1664-1922 on rc of segment before IGHD5-24 exon 1 [len=2346] (mis=2)
266-302 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
302-373 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 778
start codons at 111, 217
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.387 = GAACGGATCCACTGGG-1

using 114 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 108]
surviving nonsolo ucounts = 1[108]
ids = [0]

====================================================================================

UMI info for barcode GAACGGATCCACTGGG-1 contig 1 = TCTCAGGAGG...
umi AGTCCCTTGG = 104 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=527]
0-34 ==> 7-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
34-388 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
425-527 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CSSYTSSSTLVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 34, 191, 235, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.388 = GAACGGATCCAGATCA-1

using 278 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[22, 255]
surviving nonsolo ucounts = 1[255]
ids = [1]

====================================================================================

UMI info for barcode GAACGGATCCAGATCA-1 contig 1 = TGGGGAGGAA...
umi TCGCTGAGTG = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.389 = GAACGGATCCATGAAC-1

using 383 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 1[382]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.390 = GAACGGATCCCGGATG-1

using 394 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 16, 372]
surviving nonsolo ucounts = 1[372]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.392 = GAACGGATCCCTTGTG-1

using 245 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode GAACGGATCCCTTGTG-1 contig 1 = AAAACCACAC...
umi AACAAGCCTC = 235 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=549]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-549 ==> 0-64 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 49, 247, 252, 269, 313, 346, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.399 = GAACGGATCGCAAGCC-1

using 258 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.400 = GAACGGATCGCGGATC-1

using 319 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 314]
surviving nonsolo ucounts = 1[314]
ids = [1]

====================================================================================

UMI info for barcode GAACGGATCGCGGATC-1 contig 1 = GGGAGTCAGT...
umi GGGTCGTACG = 310 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYSTPSF at 354, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 27, 33, 89, 102, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.405 = GAACGGATCGTCTGCT-1

using 799 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[796]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.409 = GAACGGATCTCATTCA-1

using 236 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 224]
surviving nonsolo ucounts = 1[224]
ids = [1]

====================================================================================

UMI info for barcode GAACGGATCTCATTCA-1 contig 1 = GAGTCAGTCC...
umi CGGTCCTGGC = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-480 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYDNLPYTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.412 = GAACGGATCTGGGCCA-1

using 289 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [1]

====================================================================================

UMI info for barcode GAACGGATCTGGGCCA-1 contig 1 = GAATCAGTCC...
umi CTCGCTTGAT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-510 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.414 = GAACGGATCTTCCTTC-1

using 162 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.419 = GAAGCAGAGAGTACCG-1

using 477 reads

====================================================================================

graph has 198 edges initially, 8 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[14^2, 93, 350]
surviving nonsolo ucounts = 1[350]
ids = [1]

====================================================================================

UMI info for barcode GAAGCAGAGAGTACCG-1 contig 1 = GGAGTCAGAC...
umi ATCTTTTTTG = 322 reads: +388 validated
umi TCTCGTTAGG = 6 reads: +41 -1X +3 -43 +1 -3X +1 -1X +25 -1XX +20 -1XX +8 -1XX +5 -2XX +1 -4XX +3 -3XX +5 -215 invalidated

GOOD CONTIGS

TIG 1[bases=462]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-462 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [1, 7]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.420 = GAAGCAGAGATATGGT-1

using 284 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=522]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-522 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 30, 63, 99, 187, 250, 349, 369, 469
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.421 = GAAGCAGAGATGCCAG-1

using 283 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4, 7, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode GAAGCAGAGATGCCAG-1 contig 1 = GGAGTCAGTC...
umi GGCCGTCGCC = 270 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.432 = GAAGCAGAGGAGTCTG-1

using 267 reads

====================================================================================

graph has 146 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[8, 254]
surviving nonsolo ucounts = 1[254]
ids = [4]

====================================================================================

UMI info for barcode GAAGCAGAGGAGTCTG-1 contig 1 = TCAGCTTCAG...
umi GGCCCTAATC = 245 reads: +388 validated
umi TTGCGCCATT = 3 reads: -208X +1 -4X +1 -1X +1 -1X +1 -2X +3 -1 +8 -3X +2 -1XX +1 -1XX +2 -1XX +20 -8X +3 -1X +10 -2X +3 -75X +8 -3X +1 -1X +10 invalidated

GOOD CONTIGS

TIG 1[bases=585]
0-49 ==> 65-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
49-357 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-585 ==> 0-148 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CVAWDDSLYAWVF at 370, score = 8 + 7
umis assigned: [4, 6]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 49, 353, 383, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.433 = GAAGCAGAGGATGCGT-1

using 276 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [1]

====================================================================================

UMI info for barcode GAAGCAGAGGATGCGT-1 contig 1 = TGGGGGGGTC...
umi TCGCTATGGC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
42-393 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
430-539 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSSYTSSSTYVF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 42, 199, 243, 250, 253, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.437 = GAAGCAGAGGTCATCT-1

using 353 reads

====================================================================================

graph has 160 edges initially, 10 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[4^3, 28, 309]
surviving nonsolo ucounts = 2[4, 309]
ids = [3, 4]

====================================================================================

UMI info for barcode GAAGCAGAGGTCATCT-1 contig 1 = TGGGGAGGAA...
umi GAGAGACGTT = 4 reads: -94 +16 -1XX +13 -1XX +23 -1XX +8 -1XX +1 -1XX +11 -2X +8 -1X +22 -184 invalidated
umi GCATTATCTG = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-499 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 278
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.443 = GAAGCAGAGTCAAGCG-1

using 40 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 34]
surviving nonsolo ucounts = 1[34]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=374]
0-332 ==> 31-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
330-369 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
cdr3 = CQQYYGSPRTF at 308, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 28
start codons at 24, 38, 291, 321
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.450 = GAAGCAGCAAACGCGA-1

using 925 reads

====================================================================================

graph has 1374 edges initially, 4 edges after simplification

total ucounts = 482
nonsolo ucounts = 171[2^82, 3^31, 4^21, 5^11, 6^7, 7^6, 8^4, 9^2, 10^2, 11, 12, 13^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.454 = GAAGCAGCAAGGCTCC-1

using 203 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [0]

====================================================================================

UMI info for barcode GAAGCAGCAAGGCTCC-1 contig 1 = GAGTCAGTCC...
umi AATGTTCTCT = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
391-413 ==> 16-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYDALPPVF at 352, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.462 = GAAGCAGCACGGCCAT-1

using 303 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 296]
surviving nonsolo ucounts = 1[296]
ids = [1]

====================================================================================

UMI info for barcode GAAGCAGCACGGCCAT-1 contig 1 = GCCTGAGAAC...
umi ATTCTATACG = 290 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=546]
0-21 ==> 25-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
21-389 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=8)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-546 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CVLNMGSGISVF at 360, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 21, 36, 45, 48, 73, 343, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.467 = GAAGCAGCAGACACTT-1

using 1494 reads

====================================================================================

graph has 316 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[718, 774]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.470 = GAAGCAGCAGCCACCA-1

using 254 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[3, 4, 8, 239]
surviving nonsolo ucounts = 1[239]
ids = [1]

====================================================================================

UMI info for barcode GAAGCAGCAGCCACCA-1 contig 1 = GCCCCAGCCC...
umi CAGTGTTACC = 223 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=525]
0-65 ==> 171-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
65-396 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
437-474 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
474-525 ==> 0-51 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CTNLYHFGSEVW at 407, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 65, 221, 282
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.472 = GAAGCAGCAGCTTAAC-1

using 278 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 274]
surviving nonsolo ucounts = 1[274]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=469]
1-35 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=1)
1-35 ==> 3176-3210 on rc of segment before IGHV7-56 exon 2 [len=3210] (mis=1)
14-385 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=23)
cdr3 = CARGAAQSGTLSLDSW at 374, score = 7 + 5
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 14, 35, 79, 109, 165, 344
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.485 = GAAGCAGCATGCAACT-1

using 292 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 287]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.491 = GAAGCAGGTAATCACC-1

using 785 reads

====================================================================================

graph has 256 edges initially, 52 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[184, 261, 338]
surviving nonsolo ucounts = 3[184, 261, 338]
ids = [1, 4, 2]

====================================================================================

UMI info for barcode GAAGCAGGTAATCACC-1 contig 1 = GATCAGGACT...
umi CCCACTCTCT = 183 reads: +397 validated

UMI info for barcode GAAGCAGGTAATCACC-1 contig 2 = GGAGTCAGAC...
umi CCCATGTGAG = 335 reads: +388 validated

UMI info for barcode GAAGCAGGTAATCACC-1 contig 3 = AGTCCCAACC...
umi TGTTGTACAG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CMQALQTPWTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false

TIG 3[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLMYTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 20, 26, 82, 95, 234, 357, 368, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.494 = GAAGCAGGTATAAACG-1

using 283 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 273]
surviving nonsolo ucounts = 1[273]
ids = [2]

====================================================================================

UMI info for barcode GAAGCAGGTATAAACG-1 contig 1 = AGGAGTCAGA...
umi GACGCTATCG = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.497 = GAAGCAGGTCGTCTTC-1

using 33 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.499 = GAAGCAGGTCTCTCTG-1

using 337 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 329]
surviving nonsolo ucounts = 1[329]
ids = [4]

====================================================================================

UMI info for barcode GAAGCAGGTCTCTCTG-1 contig 1 = AGGAGTCAGA...
umi GACTTGTTTC = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNTYIWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 27, 33, 102, 240, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.508 = GAAGCAGGTGGTCTCG-1

using 13416 reads

====================================================================================

graph has 4866 edges initially, 76 edges after simplification

total ucounts = 478
nonsolo ucounts = 230[2^78, 3^47, 4^22, 5^11, 6^4, 7^6, 8^3, 9^5, 10^3, 11^3, 12^3, 16, 17, 26, 34, 35, 41, 57, 123, 139, 161, 168, 231^2, 237, 239, 241, 246, 266, 267, 271, 274, 277, 278, 284, 294, 300, 307, 315, 317, 319, 322, 328, 332, 362, 373, 376, 377, 385, 386, 399, 420, 477, 507, 719, 720]
surviving nonsolo ucounts = 40[26, 34, 123, 139, 161, 168, 231^2, 237, 239, 241, 246, 266, 267, 271, 274, 277, 278, 284, 294, 300, 307, 315, 317, 319, 322, 328, 332, 362, 373, 376, 377, 385, 386, 399, 420, 477, 507, 719, 720]
ids = [234, 313, 17, 216, 117, 311, 55, 245, 331, 416, ...]

====================================================================================

UMI info for barcode GAAGCAGGTGGTCTCG-1 contig 1 = ACTTTCTGAG...
umi ACATGCCATT = 253 reads: +424 validated
umi AGCACTCGCT = 535 reads: -371X +2 -6XX +3 -1XX +1 -1XX +1 -3XX +1 -2XX +1 -1XX +2 -2XX +3 -1XX +22 invalidated
umi ATTAGTCTCA = 144 reads: +157 -1XX +5 -1XX +1 -1XX +3 -9XX +2 -4XX +1 -1XX +1 -3XX +1 -5XX +228 invalidated
umi CAGCGTAGGG = 235 reads: -371X +2 -6XX +3 -1XX +1 -1XX +1 -3XX +1 -2XX +1 -1XX +2 -2XX +3 -1XX +22 invalidated
umi CATTGCAGTG = 246 reads: +424 validated
umi CTATCTTTTA = 146 reads: +190 -1XX +233 invalidated
umi CTCAGTTGTC = 275 reads: -371X +2 -6XX +3 -1XX +1 -1XX +1 -3XX +1 -2XX +1 -1XX +2 -2XX +3 -1XX +22 invalidated
umi CTTAAACGTA = 17 reads: -424 non-validated
umi GCTAACTCCT = 471 reads: -107X +2 -1XX +1 -8XX +1 -2XX +2 -2XX +1 -1XX +2 -1XX +293 invalidated
umi GTCAACCTGG = 31 reads: +37 -10 +80 -1XX +296 invalidated
umi TATGTGGGCT = 399 reads: +424 validated

UMI info for barcode GAAGCAGGTGGTCTCG-1 contig 2 = GGGGAGGAGT...
umi AAGGGCCTTG = 122 reads: +385 validated
umi AAGTCGTGGG = 275 reads: +385 validated
umi AATTGGGTTT = 331 reads: +385 validated
umi ACTCAACACC = 229 reads: +385 validated
umi AGAGCCGCCG = 544 reads: +139 -1XX +1 -3XX +2 -2XX +1 -3XX +1 -7XX +1 -2XX +1 -43XX +1 -6XX +1 -6XX +1 -1XX +2 -7XX +153 invalidated
umi AGGCGGAACG = 281 reads: +385 validated
umi AGGGGTCAAA = 376 reads: +385 validated
umi ATCGAAACGT = 1181 reads: +243 -1XX +3 -1XX +2 -1XX +9 -2XX +1 -6XX +1 -115XX invalidated
umi CAAATCTTGG = 313 reads: +385 validated
umi CAGTGCCGTG = 299 reads: +385 validated
umi CATCGGATAT = 244 reads: +385 validated
umi CCGTTAACAT = 291 reads: +385 validated
umi CGCTGGTTGC = 380 reads: +385 validated
umi CTCCTAGTCC = 320 reads: +385 validated
umi CTTTATTCCA = 227 reads: +385 validated
umi GCTTGGGCGA = 365 reads: +385 validated
umi TAAATTGGGT = 235 reads: +385 validated
umi TACATGAATC = 283 reads: +385 validated
umi TCCCCTTTGC = 281 reads: +385 validated
umi TGCCTTGGGT = 237 reads: +385 validated
umi TTAACCCCTA = 270 reads: +385 validated
umi TTTCCCTCGG = 386 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=530]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
407-459 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=3)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 155 reads
cdr3 = CARVPLRSTSSYYFQHW at 377, score = 9 + 7
umis assigned: [38, 70, 117, 143, 158, 216, 219, 234, 282, 313] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2702
start codons at 14, 35, 79
confident = true

TIG 2[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 1015 reads
cdr3 = CQQYDNLPLF at 358, score = 9 + 7
umis assigned: [17, 18, 30, 55, 63, 80, 82, 104, 127, 148] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6867
start codons at 31, 37, 93, 106, 245, 368, 458
confident = true

REJECT CONTIGS

TIG 1[bases=423]
1-265 ==> 846-1110 on rc of segment before IGHD3-16 exon 1 [len=1110] (mis=2)
295-321 ==> 20-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
321-423 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [417]
of which 1 are surviving nonsolos
reads assigned: 415
start codons at 116, 175, 282, 339, 400
confident = false
did not find CDR3

TIG 2[bases=305]
8-33 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
56-94 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
92-140 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
94-305 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [278, 300, 311, 346, 351, 432]
of which 6 are surviving nonsolos
reads assigned: 348
start codons at 58, 226
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCGAGAGTTCCTCTTCGTAGTACCAGCTCTTACTACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCCCTCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.514 = GAAGCAGGTTATTCTC-1

using 268 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 257]
surviving nonsolo ucounts = 1[257]
ids = [7]

====================================================================================

UMI info for barcode GAAGCAGGTTATTCTC-1 contig 1 = ATACTTTCTG...
umi GTCTCGAGAT = 255 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=574]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=21)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=7)
452-574 ==> 0-122 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARDFPGKYFTFDIW at 376, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 37, 81, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.519 = GAAGCAGGTTGAACTC-1

using 249 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 3, 234]
surviving nonsolo ucounts = 1[234]
ids = [10]

====================================================================================

UMI info for barcode GAAGCAGGTTGAACTC-1 contig 1 = GGACTCCTGT...
umi TGCGGAACAC = 229 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=557]
18-369 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
436-557 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CAVSSRADGYFDSW at 363, score = 7 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 18, 62, 244, 324, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.521 = GAAGCAGGTTGTGGAG-1

using 119 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 75
nonsolo ucounts = 18[2^8, 3^6, 4^2, 5, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.525 = GAAGCAGTCACATAGC-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.528 = GAAGCAGTCACTATTC-1

using 283 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 4, 9^2, 254]
surviving nonsolo ucounts = 2[9, 254]
ids = [3, 1]

====================================================================================

UMI info for barcode GAAGCAGTCACTATTC-1 contig 1 = TCTGCTTCAG...
umi CAACCTCGTC = 246 reads: +391 validated
umi GCTCGCTCTA = 9 reads: -1X +118 -14 +122 -136 invalidated

GOOD CONTIGS

TIG 1[bases=555]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-555 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDTSLSGSVF at 373, score = 8 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 253
start codons at 49, 203, 206, 257, 356, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.529 = GAAGCAGTCACTGGGC-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.533 = GAAGCAGTCAGTTGAC-1

using 134 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[133]
surviving nonsolo ucounts = 1[133]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.542 = GAAGCAGTCCTATGTT-1

using 297 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 289]
surviving nonsolo ucounts = 1[289]
ids = [0]

====================================================================================

UMI info for barcode GAAGCAGTCCTATGTT-1 contig 1 = GGGGAGGAGT...
umi ATTCTAATGT = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDNLPQTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 31, 37, 93, 106, 245, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.548 = GAAGCAGTCGCTTAGA-1

using 85 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 14[2^4, 4^3, 5^4, 7, 10, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.551 = GAAGCAGTCGTCTGAA-1

using 306 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 297]
surviving nonsolo ucounts = 1[297]
ids = [5]

====================================================================================

UMI info for barcode GAAGCAGTCGTCTGAA-1 contig 1 = CGGAGAGCCC...
umi TGACCGTGGC = 282 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=3)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
432-527 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSNWRGVTF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 47, 252, 255, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.554 = GAAGCAGTCTAACCGA-1

using 813 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 290, 515]
surviving nonsolo ucounts = 2[290, 515]
ids = [0, 6]

====================================================================================

UMI info for barcode GAAGCAGTCTAACCGA-1 contig 1 = GGTGGTAGCT...
umi ACAGTGTGTG = 288 reads: +388 validated
umi TAGTCTGGAC = 498 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
39-376 ==> 0-337 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-589 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 160 reads
cdr3 = CQSFGSNTRVF at 366, score = 6 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 772
start codons at 39, 102, 193, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.556 = GAAGCAGTCTCAAACG-1

using 544 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 12, 524]
surviving nonsolo ucounts = 2[12, 524]
ids = [6, 5]

====================================================================================

UMI info for barcode GAAGCAGTCTCAAACG-1 contig 1 = GGAGGAACTG...
umi TTGGTTAAGA = 524 reads: +388 validated
umi TTGTAAGCTA = 12 reads: +75 -13 +69 -6 +87 -57 +33 -1 +47 non-validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CQQRSNWPPGVTF at 355, score = 9 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 526
start codons at 34, 239, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.558 = GAAGCAGTCTGGCGAC-1

using 263 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [1]

====================================================================================

UMI info for barcode GAAGCAGTCTGGCGAC-1 contig 1 = GGGTGGGGTC...
umi CATTTATCTT = 254 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=522]
42-392 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-522 ==> 0-89 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CGSYTSSSTPYVF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 42, 243, 250, 253, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.562 = GAATAAGAGAGTGACC-1

using 372 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGAGAGTGACC-1 contig 1 = GAGGAACTGC...
umi AGGTCTGCAT = 334 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=517]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=21)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-517 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSNWSPLMYTF at 354, score = 10 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 33, 102, 175, 384, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.568 = GAATAAGAGCATGGCA-1

using 415 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 14, 391]
surviving nonsolo ucounts = 1[391]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGAGCATGGCA-1 contig 1 = GGAGTCAGAC...
umi AGTTCATGCC = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-502 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.572 = GAATAAGAGCTACCGC-1

using 1215 reads

====================================================================================

graph has 1402 edges initially, 10 edges after simplification

total ucounts = 373
nonsolo ucounts = 156[2^70, 3^28, 4^24, 5^12, 6^3, 7^3, 8^4, 9^5, 10^3, 11, 12, 13, 436]
surviving nonsolo ucounts = 2[11, 436]
ids = [120, 7]

====================================================================================

UMI info for barcode GAATAAGAGCTACCGC-1 contig 1 = GGAACTGCTC...
umi AACTTAGGTT = 439 reads: +385 validated
umi CATAATTTCT = 12 reads: -10 +5 -1 +47 -3XX +69 -44 +29 -1X +4 -3X +63 -2XX +29 -1XX +8 -66 invalidated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNKWPPSSF at 352, score = 9 + 6
umis assigned: [7, 120]
of which 2 are surviving nonsolos
reads assigned: 443
start codons at 31, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.576 = GAATAAGAGCTGCAAG-1

using 1523 reads

====================================================================================

graph has 2197 edges initially, 20 edges after simplification

total ucounts = 695
nonsolo ucounts = 284[2^109, 3^60, 4^33, 5^26, 6^18, 7^14, 8^7, 9^7, 10^4, 11^2, 12, 13, 15, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.579 = GAATAAGAGGAGTTTA-1

using 330 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGAGGAGTTTA-1 contig 1 = AGTCCCAGTC...
umi GAGGCCTGAC = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=454]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=13)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-454 ==> 0-46 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQFSAYPLTF at 347, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.588 = GAATAAGAGTGTTGAA-1

using 293 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 283]
surviving nonsolo ucounts = 1[283]
ids = [6]

====================================================================================

UMI info for barcode GAATAAGAGTGTTGAA-1 contig 1 = GTCAGACTCA...
umi TGTTGGAGTT = 283 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CHQYNSYSTF at 350, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 23, 29, 85, 98, 234, 237, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.591 = GAATAAGCAAAGTGCG-1

using 225 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode GAATAAGCAAAGTGCG-1 contig 1 = GGGGGCTTTC...
umi GTGAGATGGA = 214 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=505]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=14)
416-466 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
466-505 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CGRQGVSVGGFDAFDIW at 384, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 18, 27, 39, 83, 418, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.597 = GAATAAGCAAGACGTG-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.599 = GAATAAGCACACTGCG-1

using 10515 reads

====================================================================================

graph has 6781 edges initially, 146 edges after simplification

total ucounts = 1006
nonsolo ucounts = 709[2^115, 3^77, 4^73, 5^60, 6^63, 7^43, 8^38, 9^40, 10^30, 11^30, 12^27, 13^19, 14^16, 15^14, 16^10, 17^9, 18^3, 19^5, 20^3, 21^4, 22^2, 23^3, 28, 33, 36, 37, 54, 55, 92, 128^2, 152, 155, 169^2, 176, 202, 209, 240, 284, 295, 296, 301, 317, 342, 593, 977]
surviving nonsolo ucounts = 19[37, 92, 128, 152, 155, 169^2, 176, 202, 209, 240, 284, 295, 296, 301, 317, 342, 593, 977]
ids = [511, 670, 396, 607, 339, 42, 606, 862, 33, 782, ...]

====================================================================================

UMI info for barcode GAATAAGCACACTGCG-1 contig 1 = GAGCTCTGGG...
umi AAGTTATTTT = 8 reads: -338 +1 -1X +1 -4X +1 -3X +1 -1XX +1 -2XX +1 -8XX +1 -5XX +2 -1XX +37 invalidated
umi CGAGATAACA = 128 reads: +409 validated
umi GCCTAAGTGT = 169 reads: +409 validated
umi GCCTTACGGG = 150 reads: +409 validated

UMI info for barcode GAATAAGCACACTGCG-1 contig 2 = GCTGGGGTCT...
umi AATCGCCTTT = 170 reads: +388 validated
umi CCAAATCATA = 315 reads: +388 validated
umi CCCTTAATGA = 158 reads: +388 validated
umi CTGCGTAGCG = 296 reads: +388 validated
umi CTTATATCGT = 38 reads: +27 -1 +240 -1 +119 non-validated
umi CTTTTATGTA = 296 reads: +388 validated
umi GATATTTGCT = 240 reads: +388 validated
umi GGCTAGGCAC = 91 reads: +376 -1 +1 -2 +8 non-validated
umi GTGCCTAGTT = 302 reads: +388 validated
umi GTTACACAGT = 297 reads: +127 -1XX +1 -1XX +258 invalidated
umi TACTAAGCCT = 218 reads: +388 validated
umi TCCGCACAAT = 176 reads: +388 validated
umi TGGGCGACCT = 355 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=25)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
489-579 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 3 umis using 50 reads
cdr3 = CASAMAFYFEDW at 422, score = 7 + 7
umis assigned: [33, 396, 606, 607]
of which 4 are surviving nonsolos
reads assigned: 445
start codons at 80, 231, 236, 294, 297, 306, 315, 383, 434
confident = true

TIG 2[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=19)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-640 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 471 reads
cdr3 = CTSFAGSNNFIF at 365, score = 8 + 9
umis assigned: [42, 315, 339, 491, 511, 533, 569, 670, 718, 726] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2881
start codons at 41, 198, 249, 348, 561
confident = true

REJECT CONTIGS

TIG 1[bases=362]
0-77 ==> 3084-3161 on segment before IGLJ5 exon 1 [len=3161] (mis=12)
78-150 ==> 0-72 on |315|IGLJ5|J-REGION| [len=72] (mis=9)
151-362 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [439, 944]
of which 2 are surviving nonsolos
reads assigned: 1549
start codons at 0, 8, 94
confident = false
did not find CDR3
now this is a cell
paired!

AACCTGAGGGGCGACGACACGGCTGTTTATTACTGTGCGAGTGCCATGGCCTTCTACTTTGAAGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGACTATTACTGCACCTCATTTGCAGGCAGCAACAATTTCATCTTCGGAACTGGGACCAAGCTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.600 = GAATAAGCACATTAGC-1

using 491 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 11, 472]
surviving nonsolo ucounts = 1[472]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=579]
3-323 ==> 17-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
330-368 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
368-579 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSADSSGTYVVF at 301, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 467
start codons at 47, 116, 134, 329
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.602 = GAATAAGCACCGAAAG-1

using 233 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [3]

====================================================================================

UMI info for barcode GAATAAGCACCGAAAG-1 contig 1 = GGGAGTCTCA...
umi CGTAAGGGGT = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-475 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPPTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.608 = GAATAAGCAGACGTAG-1

using 392 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[391]
surviving nonsolo ucounts = 1[391]
ids = [0]

====================================================================================

UMI info for barcode GAATAAGCAGACGTAG-1 contig 1 = AGGAGTCAGA...
umi TTCAACAACA = 389 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.609 = GAATAAGCAGCATGAG-1

using 346 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 5, 329]
surviving nonsolo ucounts = 1[329]
ids = [8]

====================================================================================

UMI info for barcode GAATAAGCAGCATGAG-1 contig 1 = AGCTCTCAGA...
umi TAGTTAACAG = 318 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=523]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
485-523 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.611 = GAATAAGCAGCGTCCA-1

using 366 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[11, 353]
surviving nonsolo ucounts = 1[353]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=583]
0-49 ==> 0-49 on |208|IGHV7-4-1|5'UTR| [len=49] (mis=0)
0-49 ==> 5951-6000 on rc of segment after IGHV7-4-1 exon 1 [len=6000] (mis=0)
35-67 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
49-402 ==> 0-353 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=12)
462-512 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 49, 123, 205, 247, 284, 455, 464, 493
confident = false
full length stopped transcript of length 583
frameshifted full length stopped transcript of length 583
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.612 = GAATAAGCAGCTGGCT-1

using 723 reads

====================================================================================

graph has 280 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[327, 393]
surviving nonsolo ucounts = 2[327, 393]
ids = [3, 4]

====================================================================================

UMI info for barcode GAATAAGCAGCTGGCT-1 contig 1 = GCTCTGCTTC...
umi TAACATGGTG = 331 reads: +391 validated

UMI info for barcode GAATAAGCAGCTGGCT-1 contig 2 = GGAGAAGAGC...
umi TTTTATATTA = 347 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 60 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 51, 205, 208, 259, 358, 385
confident = false

TIG 2[bases=511]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-511 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPVTF at 360, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 36, 244, 247, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.619 = GAATAAGCATCCAACA-1

using 309 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGCATCCAACA-1 contig 1 = GGGACTGATC...
umi TGCGCGCCAT = 307 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
398-436 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPPWTF at 372, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.625 = GAATAAGGTACTTAGC-1

using 365 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 355]
surviving nonsolo ucounts = 1[355]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
0-68 ==> 5924-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=4)
41-259 ==> 0-218 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
254-465 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 41, 198, 242, 249, 386
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.630 = GAATAAGGTCATATGC-1

using 313 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode GAATAAGGTCATATGC-1 contig 1 = ACACAGCATG...
umi CGCAGTAGCC = 304 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=534]
7-358 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=16)
360-398 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQLHSYPSIVF at 334, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 7, 13, 69, 221, 440
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.634 = GAATAAGGTCGTTGTA-1

using 360 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[12, 346]
surviving nonsolo ucounts = 1[346]
ids = [3]

====================================================================================

UMI info for barcode GAATAAGGTCGTTGTA-1 contig 1 = CCCAGCCCTG...
umi TATTTCTATG = 335 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=567]
0-63 ==> 173-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
63-416 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=23)
425-472 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
472-567 ==> 0-95 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CATLYHFGMEVW at 405, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 63, 219, 280, 429, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.636 = GAATAAGGTGAGGCTA-1

using 365 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4^2, 355]
surviving nonsolo ucounts = 1[355]
ids = [4]

====================================================================================

UMI info for barcode GAATAAGGTGAGGCTA-1 contig 1 = GAGTCAGACC...
umi TGTGCGGCAG = 334 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDTYPWTF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 25, 31, 87, 100, 151, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.641 = GAATAAGGTGTTTGGT-1

using 343 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^2, 7, 324]
surviving nonsolo ucounts = 1[324]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=548]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-26 ==> 6796-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
15-78 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=12)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 26, 32, 88, 101, 244, 363, 454
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.646 = GAATAAGGTTGTGGAG-1

using 88 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2, 3^4, 4^3, 7^2, 8, 10, 11, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.654 = GAATAAGTCAGCCTAA-1

using 333 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGTCAGCCTAA-1 contig 1 = GGGAGTCTCA...
umi AGCTCGCTTT = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYSTPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.656 = GAATAAGTCAGTACGT-1

using 756 reads

====================================================================================

graph has 316 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 4^2, 13, 258, 469]
surviving nonsolo ucounts = 2[258, 469]
ids = [10, 0]

====================================================================================

UMI info for barcode GAATAAGTCAGTACGT-1 contig 1 = AGGAGTCAGT...
umi AATTTATGTT = 478 reads: +388 validated

UMI info for barcode GAATAAGTCAGTACGT-1 contig 2 = AGCTTCAGCT...
umi TCGTACTATA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CQQSYGVPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 466
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-548 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.661 = GAATAAGTCCGAGCCA-1

using 565 reads

====================================================================================

graph has 262 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[10, 208, 339]
surviving nonsolo ucounts = 2[208, 339]
ids = [8, 6]

====================================================================================

UMI info for barcode GAATAAGTCCGAGCCA-1 contig 1 = GTCAGTCTCA...
umi CCGTCCGCTG = 340 reads: +385 validated

UMI info for barcode GAATAAGTCCGAGCCA-1 contig 2 = GTGGGCTCAG...
umi GGACATAACG = 208 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 23, 29, 85, 98, 234, 450
confident = false

TIG 2[bases=631]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.662 = GAATAAGTCCGCATCT-1

using 644 reads

====================================================================================

graph has 311 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[6, 285, 345]
surviving nonsolo ucounts = 2[285, 345]
ids = [6, 0]

====================================================================================

UMI info for barcode GAATAAGTCCGCATCT-1 contig 1 = GATGCTTTCT...
umi AAACGGTGTC = 333 reads: +454 validated

UMI info for barcode GAATAAGTCCGCATCT-1 contig 2 = GGGACTGATC...
umi GACTTCTGCT = 282 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=552]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=8)
398-419 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=2)
420-471 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
471-552 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 49 reads
cdr3 = CARLGGDSSGWYNNYFDPW at 383, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 1, 17, 26, 38, 82
confident = false

TIG 2[bases=566]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=15)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQVLQRPTF at 372, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 36, 69, 187, 355, 375, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.667 = GAATAAGTCCTAGAAC-1

using 352 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[349]
surviving nonsolo ucounts = 1[349]
ids = [1]

====================================================================================

UMI info for barcode GAATAAGTCCTAGAAC-1 contig 1 = AGGAGTCAGA...
umi CAATCACCTC = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQHYNSYLITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.669 = GAATAAGTCCTTGGTC-1

using 1670 reads

====================================================================================

graph has 1874 edges initially, 10 edges after simplification

total ucounts = 411
nonsolo ucounts = 224[2^85, 3^54, 4^29, 5^20, 6^18, 7^4, 8^5, 9^2, 10^3, 15, 53, 247, 396]
surviving nonsolo ucounts = 3[53, 247, 396]
ids = [48, 329, 55]

====================================================================================

UMI info for barcode GAATAAGTCCTTGGTC-1 contig 1 = GGTGATCAGG...
umi TCCCTTGCGC = 249 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=538]
0-31 ==> 48-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
31-384 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
390-406 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
404-467 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
467-538 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CAKDLRDYGDYPYYYYGMDVW at 373, score = 9 + 7
umis assigned: [329]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 31, 182, 187, 334, 424
confident = false

REJECT CONTIGS

TIG 1[bases=514]
3-21 ==> 7308-7326 on segment before IGLV3-15 exon 1 [len=7632] (mis=0)
22-45 ==> 294-317 on segment before IGLV3-24 exon 2 [len=317] (mis=0)
34-168 ==> 55-189 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=19)
202-318 ==> 0-116 on segment before IGLV2-23 exon 1 [len=2836] (mis=1)
315-353 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
353-514 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [55]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 84, 134, 178, 294, 316
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.673 = GAATAAGTCGCACTCT-1

using 132 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 127]
surviving nonsolo ucounts = 1[127]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.681 = GAATAAGTCTACTATC-1

using 235 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 4, 5, 10, 22, 185]
surviving nonsolo ucounts = 2[22, 185]
ids = [2, 1]

====================================================================================

UMI info for barcode GAATAAGTCTACTATC-1 contig 1 = GATCAGGACT...
umi AATACACACT = 166 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=487]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-487 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CMQALQTPPTF at 366, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.682 = GAATAAGTCTCGCATC-1

using 366 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [0]

====================================================================================

UMI info for barcode GAATAAGTCTCGCATC-1 contig 1 = TTATGGGGGA...
umi TTCGAAAGTG = 356 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=547]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
458-547 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 370, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 2, 25, 69, 248, 251, 254, 340, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.685 = GAATAAGTCTGGTATG-1

using 447 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[443]
surviving nonsolo ucounts = 1[443]
ids = [3]

====================================================================================

UMI info for barcode GAATAAGTCTGGTATG-1 contig 1 = GGAGTCAGTC...
umi TGGAATATGC = 394 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=479]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
417-479 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYDNLPMYTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 26, 32, 88, 101, 240, 363, 377, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.687 = GAATAAGTCTTCTGGC-1

using 300 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode GAATAAGTCTTCTGGC-1 contig 1 = GAGTCAGTCT...
umi GTCTTACAGT = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPFTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.689 = GAATGAAAGAATAGGG-1

using 421 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 13, 405]
surviving nonsolo ucounts = 1[405]
ids = [0]

====================================================================================

UMI info for barcode GAATGAAAGAATAGGG-1 contig 1 = GGGAGGAATC...
umi AAACGTTGCA = 407 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 401
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.695 = GAATGAAAGATGAGAG-1

using 522 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 249, 267]
surviving nonsolo ucounts = 2[249, 267]
ids = [2, 1]

====================================================================================

UMI info for barcode GAATGAAAGATGAGAG-1 contig 1 = GGAGTCAGAC...
umi GCTTTATTGT = 263 reads: +388 validated
umi GTCTACATAT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 87 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 506
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.696 = GAATGAAAGCATCATC-1

using 42 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 33]
surviving nonsolo ucounts = 1[33]
ids = [3]

====================================================================================

UMI info for barcode GAATGAAAGCATCATC-1 contig 1 = CGTCTCCACC...
umi CCCCTGTTGA = 32 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=420]
10-350 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=25)
367-395 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
395-420 ==> 0-25 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 6 reads
cdr3 = CFSYGTSGRTF at 334, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 32
start codons at 10, 218, 344
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.700 = GAATGAAAGCGATAGC-1

using 575 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[281, 290]
surviving nonsolo ucounts = 2[281, 290]
ids = [3, 2]

====================================================================================

UMI info for barcode GAATGAAAGCGATAGC-1 contig 1 = GAATCAGTCC...
umi ACTAGACGGC = 291 reads: +388 validated
umi AGACGATGCA = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 562
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.715 = GAATGAAAGGTTACCT-1

using 474 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 138, 329]
surviving nonsolo ucounts = 2[138, 329]
ids = [4, 5]

====================================================================================

UMI info for barcode GAATGAAAGGTTACCT-1 contig 1 = GGGCTGCCTC...
umi TTCCTAGTGT = 329 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=3)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

REJECT CONTIGS

TIG 1[bases=553]
2-220 ==> 5782-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
220-553 ==> 0-333 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 48, 125, 165, 220, 428
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.723 = GAATGAAAGTTAGCGG-1

using 304 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 294]
surviving nonsolo ucounts = 1[294]
ids = [5]

====================================================================================

UMI info for barcode GAATGAAAGTTAGCGG-1 contig 1 = GGAGTCAGAC...
umi TTGAGCCCTA = 291 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
382-414 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYSYPQTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.725 = GAATGAACAAGAGGCT-1

using 32009 reads

====================================================================================

graph has 11152 edges initially, 142 edges after simplification

total ucounts = 936
nonsolo ucounts = 462[2^124, 3^81, 4^53, 5^34, 6^20, 7^10, 8^13, 9^7, 10^6, 11, 12, 13, 14^2, 15^3, 17, 18, 19, 23, 24^2, 33, 37, 39, 43, 44^2, 51^2, 58, 70, 79, 81, 86, 90, 91, 97, 102, 109, 116, 128, 142, 146, 147, 164^2, 165, 168, 175, 179, 187^2, 191^2, 201, 203, 206^2, 215, 218, 219, 220, 221, 222, 225^2, 226, 228, 229, 238, 246, 252, 254, 261, 262, 264, 265^2, 266, 267, 270, 276, 279, 280, 282, 283^2, 285, 288, 290, 291, 300, 301, 304, 313, 321, 340, 346, 353, 358, 361, 366, 385, 388, 391, 404, 442, 444, 478, 627, 628, 633, 776, 855, 857, 883, 888, 911, 978, 1008, 1506]
surviving nonsolo ucounts = 90[39, 43, 51^2, 58, 70, 79, 81, 90, 91, 97, 109, 116, 128, 142, 147, 164^2, 165, 168, 175, 179, 187, 191^2, 201, 203, 206^2, 215, 218, 219, 220, 221, 222, 225^2, 226, 228, 229, 238, 246, 252, 254, 261, 262, 264, 265^2, 266, 267, 270, 276, 279, 280, 282, 283^2, 285, 288, 290, 291, 300, 301, 304, 313, 321, 340, 346, 353, 358, 361, 366, 385, 388, 391, 404, 442, 478, 628, 633, 776, 855, 857, 883, 888, 911, 978, 1008, 1506]
ids = [306, 682, 76, 654, 653, 175, 138, 270, 660, 907, ...]

====================================================================================

UMI info for barcode GAATGAACAAGAGGCT-1 contig 1 = AGCTCTGAGA...
umi AAACTTTCAT = 230 reads: +430 -9 non-validated
umi ACAGCTAAGT = 354 reads: +439 validated
umi ACATACTCGA = 49 reads: +430 -1 +2 -6 non-validated
umi ACATCAAACA = 251 reads: +439 validated
umi ACCATAGCAT = 224 reads: +439 validated
umi AGAGGGATCG = 225 reads: +439 validated
umi AGCCCCAGGG = 79 reads: +405 -34 non-validated
umi ATAGTCACCC = 69 reads: +431 -8 non-validated
umi ATCGTCTCAG = 205 reads: +439 validated
umi CACTCACGGA = 397 reads: +439 validated
umi CCATCCACAT = 302 reads: +427 -1XX +8 -2X +1 invalidated
umi CGCTCGCTCC = 227 reads: +439 validated
umi GAATGATGCT = 261 reads: +439 validated
umi GATGATATGG = 391 reads: +439 validated
umi GCCCTATCTT = 218 reads: +127 -1XX +311 invalidated
umi GTTGTGTCGG = 177 reads: +433 -6 non-validated
umi GTTTCGCCGT = 60 reads: +405 -34 non-validated
umi GTTTCGCTGT = 53 reads: +381 -1 +2 -55 non-validated
umi TAAACAGGCA = 91 reads: +439 validated
umi TAGGCTTCAT = 168 reads: -392X +1 -4XX +1 -1XX +1 -4XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TTGTTTGGCG = 89 reads: +313 -8 +98 -20 non-validated

UMI info for barcode GAATGAACAAGAGGCT-1 contig 2 = GCTGTGGGTC...
umi AAAGTGATAC = 285 reads: +382 validated
umi AACCCTTCCA = 143 reads: +382 validated
umi AAGAGCTTAA = 253 reads: +382 validated
umi AATTGTTGGA = 1523 reads: -316X +1 -4XX +1 -5XX +2 -14XX +1 -2XX +36 invalidated
umi ACAGTCATCC = 636 reads: +382 validated
umi AGATAATTCC = 251 reads: +382 validated
umi AGATATTCTA = 164 reads: +382 validated
umi AGCAATAACG = 354 reads: +382 validated
umi AGCATAATGT = 443 reads: +382 validated
umi AGTGTTCCGT = 278 reads: +382 validated
umi ATAAAAGCGT = 220 reads: +382 validated
umi ATAGCTACTG = 263 reads: +382 validated
umi ATATCCTCCT = 316 reads: +382 validated
umi ATCTAACTAC = 67 reads: -7 +4 -5X +1 -4XX +1 -1XX +3 -1XX +3 -1XX +1 -5XX +2 -4XX +339 invalidated
umi ATTAAGGAAG = 74 reads: -7 +2 -1X +1 -5X +1 -4XX +1 -1XX +3 -1XX +3 -1XX +1 -5XX +2 -4XX +217 -1 +20 -101 invalidated
umi CAACGGGTTT = 292 reads: +382 validated
umi CAGGTACGCT = 929 reads: -343X +1 -2XX +36 invalidated
umi CCATTCGTAT = 314 reads: +382 validated
umi CCCTGTTCGG = 224 reads: +382 validated
umi CCTGCATCTC = 216 reads: +382 validated
umi CGCTCTTTCT = 275 reads: +382 validated
umi CGGCGGGACA = 266 reads: +382 validated
umi CGGCGTTGGG = 285 reads: +382 validated
umi CGGGGGTCTT = 223 reads: +382 validated
umi CGTGGTACTT = 280 reads: +382 validated
umi CTATCCGATA = 480 reads: -354 +28 non-validated
umi CTATGTAGTG = 863 reads: -343X +1 -2XX +36 invalidated
umi CTCAATCACT = 849 reads: -310 +1 -5XX +1 -4XX +1 -5XX +2 -14XX +1 -2XX +36 invalidated
umi CTCTAATCCG = 878 reads: -334X +1 -8XX +1 -2XX +36 invalidated
umi CTGCGTTGCA = 1031 reads: -335 +1 -7X +1 -2XX +36 invalidated
umi CTGCTAATCG = 168 reads: +382 validated
umi CTGGCATCCC = 146 reads: +382 validated
umi GACTACCGAT = 192 reads: +382 validated
umi GCTCGCGGAT = 292 reads: +382 validated
umi GTAAATGCGG = 263 reads: +382 validated
umi GTGAAATCGA = 286 reads: +382 validated
umi GTGACTACCT = 283 reads: +382 validated
umi GTTACTAGCA = 200 reads: +382 validated
umi GTTCGCTTCT = 340 reads: +382 validated
umi TAAGGTTGCG = 200 reads: -16X +1 -4XX +1 -1XX +3 -1XX +3 -1XX +1 -5XX +2 -4XX +339 invalidated
umi TACTCGATCG = 973 reads: +382 validated
umi TATCTTGGAT = 189 reads: +382 validated
umi TCACTGGTGT = 362 reads: +382 validated
umi TCAGGTTGCG = 210 reads: +45 -1XX +336 invalidated
umi TCAGTGTCAT = 285 reads: +382 validated
umi TCATGTTCTG = 305 reads: +382 validated
umi TCCTTTGCGC = 221 reads: +382 validated
umi TCGATTTCTT = 274 reads: +382 validated
umi TCGGGTCCTA = 190 reads: +382 validated
umi TTACACCGGA = 226 reads: +382 validated
umi TTCCCACTGA = 395 reads: -343X +1 -2X +36 invalidated
umi TTTACGGAAT = 235 reads: +382 validated
umi TTTCTGTTTT = 256 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=589]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=2)
438-469 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=5)
469-518 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
518-589 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 207 reads
cdr3 = CARDLWGYCSGGSCSLYGMDVW at 421, score = 9 + 7
umis assigned: [5, 71, 76, 77, 84, 126, 138, 175, 189, 255] and 11 others
of which 20 are surviving nonsolos
reads assigned: 4006
start codons at 79, 235, 382, 435, 475
confident = true

TIG 2[bases=631]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=2)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 44 umis using 1977 reads
cdr3 = CQSADSSGTRRVF at 353, score = 8 + 8
umis assigned: [7, 18, 29, 59, 74, 128, 129, 133, 136, 155] and 43 others
of which 53 are surviving nonsolos
reads assigned: 18730
start codons at 38, 99, 168, 186
confident = true
now this is a cell
paired!

TACTGTGCGAGAGATTTATGGGGGTATTGTAGTGGTGGTAGCTGCTCCTTATACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACCCGAAGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.730 = GAATGAACAAGGTTTC-1

using 10709 reads

====================================================================================

graph has 6017 edges initially, 42 edges after simplification

total ucounts = 1014
nonsolo ucounts = 450[2^158, 3^80, 4^71, 5^40, 6^18, 7^14, 8^12, 9^6, 10, 11^3, 12^3, 13, 17, 18^2, 21, 22, 29, 32, 44, 53, 68, 69, 121, 149, 170, 183, 185, 187, 194, 203, 218, 219, 233, 235, 246, 250, 267, 276, 278, 283, 286, 290^2, 294, 295, 298, 304, 308, 309, 311, 329, 337, 338, 380]
surviving nonsolo ucounts = 35[21, 29, 68, 69, 121, 149, 183, 185, 187, 194, 203, 218, 219, 233, 235, 246, 250, 267, 276, 278, 283, 286, 290^2, 294, 295, 298, 304, 308, 309, 311, 329, 337, 338, 380]
ids = [224, 223, 741, 99, 206, 157, 765, 828, 245, 780, ...]

====================================================================================

UMI info for barcode GAATGAACAAGGTTTC-1 contig 1 = TTACTTATTT...
umi AAACCGAGTA = 291 reads: +388 validated
umi AATCAGTCGC = 332 reads: +388 validated
umi AATTGATGAC = 304 reads: +388 validated
umi ACCCAGTACG = 233 reads: +388 validated
umi ACTAAGGTTA = 315 reads: +388 validated
umi ACTCCTCCGC = 204 reads: +388 validated
umi ACTTTTCCGG = 148 reads: +388 validated
umi AGTTTTAGGG = 119 reads: +388 validated
umi ATCAGTCACG = 238 reads: +388 validated
umi ATTTTGTGCT = 341 reads: +388 validated
umi CATATGTCAA = 293 reads: +388 validated
umi CCAGCTTCTA = 281 reads: +388 validated
umi CCTGTTCGAT = 333 reads: +388 validated
umi CGGCGAGGTA = 223 reads: +388 validated
umi CTTATATGCT = 278 reads: +388 validated
umi GAAGTCCATA = 276 reads: +32 -1XX +355 invalidated
umi GCGTGGTCCC = 298 reads: +388 validated
umi GCTTAGTATA = 303 reads: +388 validated
umi GTAATTTATG = 293 reads: +388 validated
umi TATGAGGTGT = 190 reads: +388 validated
umi TCCTTACATT = 182 reads: +388 validated
umi TTCCACCTTC = 313 reads: +388 validated
umi TTGCGATTTG = 278 reads: +388 validated

UMI info for barcode GAATGAACAAGGTTTC-1 contig 2 = GGCTTTCTGA...
umi ACCAGAGGTG = 71 reads: -18 +433 non-validated
umi ACCGCTAGCT = 248 reads: +451 validated
umi ATAGCGTCAG = 29 reads: +131 -1 +124 -3 +86 -2X +1 -1 +1 -5 +3 -72 +21 invalidated
umi ATAGCGTCGG = 21 reads: +35 -1 +330 -29 +56 non-validated
umi ATCGCATGCA = 187 reads: +451 validated
umi ATTCATTCAT = 286 reads: +451 validated
umi CCTATGCCAC = 251 reads: +451 validated
umi TAGTGCTTTA = 179 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=651]
52-405 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
402-440 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
440-651 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 23 umis using 966 reads
cdr3 = CSSYTSSSTLVF at 376, score = 8 + 9
umis assigned: [8, 54, 67, 104, 140, 146, 157, 206, 237, 297] and 13 others
of which 23 are surviving nonsolos
reads assigned: 5943
start codons at 52, 209, 253, 260, 263
confident = true

TIG 2[bases=648]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
403-466 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
466-648 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 6 umis using 169 reads
cdr3 = CARLPMVRYYYYYGMGVW at 381, score = 9 + 7
umis assigned: [99, 112, 223, 224, 245, 272, 419, 765]
of which 8 are surviving nonsolos
reads assigned: 1251
start codons at 15, 24, 36, 80, 396, 423
confident = true
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGACTCCCTATGGTTCGGTACTACTACTACTACGGTATGGGCGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.734 = GAATGAACAATGACCT-1

using 245 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [1]

====================================================================================

UMI info for barcode GAATGAACAATGACCT-1 contig 1 = AGAGCTCTGG...
umi CGACTAAGCA = 227 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=529]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=12)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-529 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQTWGAGIYWVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 22, 223, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.738 = GAATGAACACAACTGT-1

using 340 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 327]
surviving nonsolo ucounts = 1[327]
ids = [5]

====================================================================================

UMI info for barcode GAATGAACACAACTGT-1 contig 1 = GAGGAACTGC...
umi TCAAGCCTTC = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQRSNWPPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 33, 238, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.740 = GAATGAACACACGCTG-1

using 340 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 9, 320]
surviving nonsolo ucounts = 1[320]
ids = [4]

====================================================================================

UMI info for barcode GAATGAACACACGCTG-1 contig 1 = GGAGTCAGTC...
umi CTGGCTTTCT = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPGTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.746 = GAATGAACACTGTGTA-1

using 523 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[171, 348]
surviving nonsolo ucounts = 1[348]
ids = [5]

====================================================================================

UMI info for barcode GAATGAACACTGTGTA-1 contig 1 = GGAGGAACTG...
umi TACAAAGGCA = 313 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=472]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-472 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPGYTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.748 = GAATGAACAGACGCAA-1

using 280 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[5, 11, 12, 13, 235]
surviving nonsolo ucounts = 1[235]
ids = [6]

====================================================================================

UMI info for barcode GAATGAACAGACGCAA-1 contig 1 = GCTCTGCTTC...
umi GCTTAAGGTC = 226 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=538]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-538 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.750 = GAATGAACAGATAATG-1

using 413 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[413]
surviving nonsolo ucounts = 1[413]
ids = [0]

====================================================================================

UMI info for barcode GAATGAACAGATAATG-1 contig 1 = TGGGGAGGAA...
umi CCTGCCTCTA = 408 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSDWPRTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 405
start codons at 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.756 = GAATGAACAGTAACGG-1

using 373 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[370]
surviving nonsolo ucounts = 1[370]
ids = [2]

====================================================================================

UMI info for barcode GAATGAACAGTAACGG-1 contig 1 = GAGGAATCAG...
umi GTTCCGGTAG = 372 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.759 = GAATGAACATACTACG-1

using 282 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [2]

====================================================================================

UMI info for barcode GAATGAACATACTACG-1 contig 1 = GAGGAACTGC...
umi GTTCTGCAAC = 281 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSDWPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.760 = GAATGAACATAGTAAG-1

using 55 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^4, 3, 5, 6, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.767 = GAATGAAGTACTTCTT-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.768 = GAATGAAGTCAAAGAT-1

using 325 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode GAATGAAGTCAAAGAT-1 contig 1 = GAGGAATCAG...
umi TTGGAGGACT = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.770 = GAATGAAGTCATCGGC-1

using 1432 reads

====================================================================================

graph has 620 edges initially, 8 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 4^2, 306, 410, 699]
surviving nonsolo ucounts = 3[306, 410, 699]
ids = [0, 11, 6]

====================================================================================

UMI info for barcode GAATGAAGTCATCGGC-1 contig 1 = GTCAGACCCA...
umi GAACTATCTA = 699 reads: -267X +124 invalidated
umi TTTTTATACT = 407 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=37)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=9)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 147 reads
cdr3 = CQQYNPYAGYTF at 350, score = 8 + 7
umis assigned: [6, 11]
of which 2 are surviving nonsolos
reads assigned: 1089
start codons at 23, 29, 85, 234, 330, 369, 456
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.773 = GAATGAAGTCGAACAG-1

using 728 reads

====================================================================================

graph has 287 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[336, 389]
surviving nonsolo ucounts = 2[336, 389]
ids = [0, 4]

====================================================================================

UMI info for barcode GAATGAAGTCGAACAG-1 contig 1 = AGCACTGAAC...
umi TTTTGCGTCC = 396 reads: +12 -1X +393 invalidated

GOOD CONTIGS

TIG 1[bases=501]
0-24 ==> 56-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
24-375 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=23)
380-430 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
430-501 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CVKEEDAFNIW at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 383
start codons at 24, 175, 180, 241, 259, 327, 382, 411
confident = false

REJECT CONTIGS

TIG 1[bases=536]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-188 ==> 0-161 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=5)
188-379 ==> 162-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=12) [SHIFT!]
363-400 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=16)
400-536 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 27, 33, 89, 102, 165, 237, 442
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.775 = GAATGAAGTCGTGGCT-1

using 686 reads

====================================================================================

graph has 246 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[4^2, 9, 12, 657]
surviving nonsolo ucounts = 1[657]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=416]
7-173 ==> 187-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=14)
222-256 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
256-416 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 162, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 650
start codons at 18, 23, 40, 84, 117, 310
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.778 = GAATGAAGTGATAAGT-1

using 440 reads

====================================================================================

graph has 435 edges initially, 6 edges after simplification

total ucounts = 95
nonsolo ucounts = 37[2^17, 3^6, 4^2, 5^3, 6, 7, 8^3, 9^3, 243]
surviving nonsolo ucounts = 1[243]
ids = [91]

====================================================================================

UMI info for barcode GAATGAAGTGATAAGT-1 contig 1 = GGTAGCTCAG...
umi TTGCGGACAC = 231 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=12)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-588 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDNNNLWVF at 363, score = 6 + 8
umis assigned: [91]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 36, 99, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.792 = GAATGAATCACAACGT-1

using 22424 reads

====================================================================================

graph has 8956 edges initially, 50 edges after simplification

total ucounts = 1045
nonsolo ucounts = 534[2^173, 3^97, 4^63, 5^48, 6^30, 7^16, 8^12, 9^6, 10^3, 12, 13^2, 15, 16^2, 17, 26, 28, 54, 62, 65, 68, 82, 125, 139, 146, 161, 164, 172, 177, 184, 195, 202, 208, 210, 213, 218, 219, 220, 225, 226, 228, 233, 236, 239, 241, 244, 247^2, 248, 252, 256, 258, 264, 268^2, 273, 275, 277, 278, 279^4, 284, 286^2, 290, 293^2, 297, 299^2, 304, 306, 309, 312, 315, 316, 319, 320, 324^2, 326^2, 329, 330^2, 331, 333, 344, 359, 410, 629, 650]
surviving nonsolo ucounts = 72[125, 139, 146, 161, 164, 172, 177, 184, 195, 202, 208, 210, 213, 218, 219, 220, 225, 226, 228, 233, 236, 239, 241, 244, 247^2, 248, 252, 256, 258, 264, 268^2, 273, 275, 277, 278, 279^4, 284, 286^2, 290, 293^2, 297, 299^2, 304, 306, 309, 312, 315, 316, 319, 320, 324^2, 326^2, 329, 330^2, 331, 333, 344, 359, 410, 629, 650]
ids = [919, 445, 389, 977, 655, 727, 1016, 868, 433, 990, ...]

====================================================================================

UMI info for barcode GAATGAATCACAACGT-1 contig 1 = TGGGGGCTGG...
umi AAAACCGGTA = 330 reads: +388 validated
umi AAAACTTTCA = 329 reads: +388 validated
umi AAACGGACCT = 321 reads: +388 validated
umi AAATTACCGT = 320 reads: +388 validated
umi AACACATCCG = 329 reads: +388 validated
umi ACAACTCGCA = 274 reads: +388 validated
umi ACATCTCCGG = 291 reads: +388 validated
umi ACCAATTCCT = 233 reads: +388 validated
umi ACCTTTTACC = 274 reads: +388 validated
umi ACTCCGTGAA = 321 reads: +388 validated
umi AGCTTTAGTC = 302 reads: +388 validated
umi AGTACGGATT = 229 reads: +388 validated
umi ATCCCACAGA = 211 reads: +388 validated
umi ATTGCGTCAG = 303 reads: +388 validated
umi ATTTACGGCC = 282 reads: +388 validated
umi CAACATCCAC = 301 reads: +388 validated
umi CAACATGCCT = 285 reads: +388 validated
umi CACGTACTCA = 327 reads: +388 validated
umi CACTTTTATC = 342 reads: +388 validated
umi CAGTATACAT = 311 reads: +388 validated
umi CCAGGCGTTA = 241 reads: +388 validated
umi CCCTTCCGGT = 314 reads: +388 validated
umi CCCTTCTCAC = 150 reads: +388 validated
umi CGAAATGCCA = 257 reads: +388 validated
umi CGCAAGGGGC = 193 reads: +388 validated
umi CGCTTCCTGT = 145 reads: +388 validated
umi CGGGAGTCGC = 225 reads: +388 validated
umi CTATCTGCAC = 355 reads: +388 validated
umi CTCCTCACCG = 435 reads: +146 -4XX +1 -1XX +1 -7XX +4 -2XX +1 -1XX +1 -1XX +1 -1XX +1 -34X +1 -4XX +2 -2XX +1 -2XX +1 -3XX +1 -3XX +1 -3XX +157 invalidated
umi CTCTTAGCTA = 229 reads: +388 validated
umi CTGTTTTCTG = 280 reads: +388 validated
umi CTTTAATCCT = 238 reads: +388 validated
umi GAAATCATTA = 244 reads: +388 validated
umi GCATAGGCAA = 284 reads: +388 validated
umi GCCGGGATTG = 279 reads: +388 validated
umi GCGATACCCG = 250 reads: +388 validated
umi GTCTGCCGTG = 221 reads: +388 validated
umi GTCTTTTACC = 225 reads: +388 validated
umi GTTCGTATCG = 630 reads: +388 validated
umi GTTTTTGCTT = 171 reads: +388 validated
umi TAAAGCTGTA = 316 reads: +388 validated
umi TAAGTCCTAG = 296 reads: +388 validated
umi TAATCCACTA = 280 reads: +388 validated
umi TAGAATCCTA = 318 reads: +388 validated
umi TCACACATCA = 270 reads: +388 validated
umi TCCTCACAGC = 303 reads: +388 validated
umi TCGGGTGCTC = 256 reads: +388 validated
umi TCTCCGGCTG = 308 reads: +194 -1XX +193 invalidated
umi TTACACATCC = 291 reads: +388 validated
umi TTCAATTTTC = 168 reads: +384 -1XX +3 invalidated
umi TTGATTCGAA = 326 reads: +388 validated
umi TTGGAATAAA = 271 reads: +388 validated
umi TTGTATGGTC = 178 reads: +388 validated
umi TTTAGCCACC = 282 reads: +388 validated
umi TTTATGCCGA = 245 reads: +388 validated

UMI info for barcode GAATGAATCACAACGT-1 contig 2 = AGCTCTGAGA...
umi ACATAATTCA = 248 reads: +421 validated
umi AGGGAAAGGC = 205 reads: +421 validated
umi AGGTACCCCC = 326 reads: +421 validated
umi AGTGTCTCTC = 217 reads: +421 validated
umi ATATGAGATG = 651 reads: -282X +139 invalidated
umi CACACTGGCC = 339 reads: +421 validated
umi CATTGCACTC = 254 reads: +421 validated
umi CGAGTCATAA = 303 reads: +421 validated
umi CTCTTCTGGG = 285 reads: +421 validated
umi GGATCTCTAA = 245 reads: +421 validated
umi GGCCGCCTTT = 166 reads: +421 validated
umi TATAAACATT = 264 reads: +421 validated
umi TATCCCTATG = 210 reads: +421 validated
umi TCGTGTTTTA = 185 reads: +421 validated
umi TGCTAGCGTA = 126 reads: +421 validated
umi TTCGGCCTTT = 206 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=645]
46-386 ==> 0-340 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 54 umis using 2538 reads
cdr3 = CCSYTTRSTWVF at 370, score = 8 + 8
umis assigned: [1, 2, 7, 26, 30, 87, 105, 112, 129, 146] and 45 others
of which 55 are surviving nonsolos
reads assigned: 15086
start codons at 46, 203, 254, 257
confident = true

TIG 2[bases=660]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=13)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
500-660 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 15 umis using 434 reads
cdr3 = CAKDIHGGNSVYFDYW at 421, score = 9 + 7
umis assigned: [101, 188, 192, 206, 220, 293, 350, 429, 522, 653] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4136
start codons at 79, 230, 235, 314, 325, 382, 554
confident = true
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAAGATATACACGGTGGTAACTCGGTATACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATACAACCCGCAGCACTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.795 = GAATGAATCACGCATA-1

using 566 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 255, 306]
surviving nonsolo ucounts = 2[255, 306]
ids = [3, 2]

====================================================================================

UMI info for barcode GAATGAATCACGCATA-1 contig 1 = GAGAGAGGAG...
umi TTACCAATAA = 259 reads: +424 validated

UMI info for barcode GAATGAATCACGCATA-1 contig 2 = AGCTCAGCTT...
umi CTGCGTTCTT = 288 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=679]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-679 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 73, 224, 229, 376, 454
confident = false

TIG 2[bases=584]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=9)
405-443 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
443-584 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CATWDDSLNGHVVF at 373, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 52, 191, 356, 381, 386, 398, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.797 = GAATGAATCAGCACAT-1

using 396 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 5, 164, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode GAATGAATCAGCACAT-1 contig 1 = GGCTGGGGTC...
umi CCAGAGCCAG = 213 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=594]
42-396 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-594 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYTSSSTLVVF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.802 = GAATGAATCATCGGAT-1

using 6092 reads

====================================================================================

graph has 3906 edges initially, 36 edges after simplification

total ucounts = 749
nonsolo ucounts = 334[2^114, 3^71, 4^34, 5^31, 6^22, 7^12, 8^14, 9^7, 10^2, 11^2, 12^3, 13, 14^2, 15, 21, 73, 106, 110, 214, 218, 229^2, 235, 245, 256, 268, 269, 282, 303, 386, 486, 490]
surviving nonsolo ucounts = 17[14, 21, 73, 106, 218, 229^2, 235, 245, 256, 268, 269, 282, 303, 386, 486, 490]
ids = [249, 57, 477, 30, 116, 71, 378, 275, 94, 237, ...]

====================================================================================

UMI info for barcode GAATGAATCATCGGAT-1 contig 1 = AGCTTCAGCT...
umi ACAGCTCATC = 230 reads: +388 validated
umi ACCTTGCTCC = 247 reads: +388 validated
umi AGAAGAGTGC = 491 reads: +388 validated
umi CAGATTGTCA = 257 reads: +388 validated
umi CCCGTGCCAA = 235 reads: +388 validated
umi CCGCCTCCTA = 278 reads: +388 validated
umi CGAGGAGCAA = 269 reads: +388 validated
umi CGGGTTTCTC = 265 reads: +388 validated
umi CGTGCCAGCT = 118 reads: +6 -1XX +1 -1XX +1 -2XX +14 -1XX +6 -1XX +7 -2XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +12 -1X +3 -50 +1 -2XX +3 -4XX +11 -1XX +2 -1XX +7 -2XX +21 -4XX +1 -1XX +1 -3XX +1 -1XX +23 -1XX +2 -1XX +40 -1XX +8 -1XX +1 -1XX +1 -1XX +8 -2XX +3 -1XX +5 -57XX +1 -1X +9 -1XX invalidated
umi CTGTACCCCT = 232 reads: +388 validated

UMI info for barcode GAATGAATCATCGGAT-1 contig 2 = ACTTTCTGAG...
umi AAGCCCCTTT = 106 reads: +412 validated
umi ACAGGGATCG = 300 reads: +412 validated
umi AGACAAGGCA = 217 reads: +412 validated
umi CGGACGCTAG = 414 reads: +58 -1XX +353 invalidated

GOOD CONTIGS

TIG 1[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=15)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 411 reads
cdr3 = CAAWDDSLSGVVF at 367, score = 7 + 8
umis assigned: [71, 94, 111, 237, 275, 286, 308, 331, 340, 378]
of which 9 are surviving nonsolos
reads assigned: 2564
start codons at 46, 253, 260, 350, 375, 380
confident = true

TIG 2[bases=607]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
382-413 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=9)
409-447 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=2)
447-607 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 4 umis using 137 reads
cdr3 = CARGDDFWSGYSYW at 374, score = 9 + 6
umis assigned: [30, 72, 116, 323]
of which 4 are surviving nonsolos
reads assigned: 997
start codons at 35, 79, 240, 501
confident = true

REJECT CONTIGS

TIG 1[bases=495]
3-67 ==> 5672-5736 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
5-77 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=8)
5-77 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=8)
5-77 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=8)
20-158 ==> 0-138 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
322-359 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
359-495 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [630]
of which 1 are surviving nonsolos
reads assigned: 486
start codons at 20, 26, 82, 95, 401
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTGTATTATTGTGCGAGAGGGGACGATTTTTGGAGTGGTTATTCCTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCCG <==> GGGCTCCGGTCCGAGGATGAAACTGTTTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTGTGGTATTTGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.813 = GAATGAATCCGCGCAA-1

using 249 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=484]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-199 ==> 0-152 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
199-399 ==> 153-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14) [SHIFT!]
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-484 ==> 0-50 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 47, 200, 350, 375, 380
confident = false
not full
frameshifted full length stopped transcript of length 484
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.819 = GAATGAATCCTGCTTG-1

using 398 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^3, 4, 5, 6, 7, 8, 13, 344]
surviving nonsolo ucounts = 1[344]
ids = [9]

====================================================================================

UMI info for barcode GAATGAATCCTGCTTG-1 contig 1 = GGAGGAACTG...
umi GGCAACAGGA = 346 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQRSNWPRWTF at 355, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 34, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.820 = GAATGAATCGAATCCA-1

using 13514 reads

====================================================================================

graph has 5408 edges initially, 44 edges after simplification

total ucounts = 583
nonsolo ucounts = 281[2^83, 3^59, 4^28, 5^25, 6^13, 7^10, 8^6, 9^4, 10^2, 11^2, 12^2, 13^2, 14, 15^2, 18, 53, 123, 146, 154, 157, 162, 167, 169, 210, 220, 238, 245, 248, 266, 268, 277, 282, 295, 296, 298, 313, 316, 318^2, 334, 335, 336, 337^2, 350, 362, 365, 378, 383, 388^2, 396, 409, 414, 431, 764]
surviving nonsolo ucounts = 40[53, 123, 146, 154, 157, 162, 167, 169, 210, 238, 245, 248, 266, 268, 277, 282, 295, 296, 298, 313, 316, 318^2, 334, 335, 336, 337^2, 350, 362, 365, 378, 383, 388^2, 396, 409, 414, 431, 764]
ids = [570, 516, 167, 492, 419, 292, 108, 6, 400, 450, ...]

====================================================================================

UMI info for barcode GAATGAATCGAATCCA-1 contig 1 = ACCCAAAAAC...
umi AAAGCATCCG = 142 reads: +421 validated
umi AGCTCACAAA = 429 reads: +421 validated
umi CTTGTCCTTT = 294 reads: +421 validated
umi GCACTAGGGG = 251 reads: +421 validated
umi GCATTAATTC = 361 reads: +421 validated
umi GCGGACCGCG = 296 reads: +421 validated
umi GCGGCGCGCC = 159 reads: +421 validated
umi GGATACATCA = 348 reads: +421 validated
umi GTCACTACAC = 238 reads: +421 validated
umi GTGGCACCGT = 269 reads: +421 validated
umi TCAGCTCCGT = 156 reads: +421 validated
umi TCGACGCTCG = 121 reads: +369 -52 non-validated
umi TTCCCGCGTC = 44 reads: +400 -21 non-validated

UMI info for barcode GAATGAATCGAATCCA-1 contig 2 = GGGGAGAAGT...
umi AAGCTTCTAC = 242 reads: +391 validated
umi AATTTTGTCA = 394 reads: +391 validated
umi AGTATCCAAA = 167 reads: +79 -1 +311 non-validated
umi AGTGTGCGCT = 339 reads: +391 validated
umi CAATAATGTA = 383 reads: +391 validated
umi CAATCAAGCA = 145 reads: +391 validated
umi CACTCTAGGG = 297 reads: +391 validated
umi CAGAATCCGG = 757 reads: +391 validated
umi CCCTTATATC = 405 reads: +391 validated
umi CCTAACGGCT = 351 reads: +391 validated
umi CGCATAACAT = 165 reads: +391 validated
umi CGCTTTTGGG = 337 reads: +391 validated
umi CTACCTTCGC = 378 reads: +391 validated
umi CTGGCGGTAA = 334 reads: +391 validated
umi GACATCGAGG = 275 reads: +391 validated
umi GCAGTAACCG = 212 reads: +391 validated
umi GCATTATCAG = 338 reads: +391 validated
umi GGTATGGGGC = 316 reads: +391 validated
umi GTTAAACTCC = 337 reads: +391 validated
umi TCCGCCCCCC = 266 reads: +391 validated
umi TCGCGTCTGT = 393 reads: +391 validated
umi TCTAGTCATC = 319 reads: +391 validated
umi TGTATTAATC = 324 reads: +391 validated
umi TGTTCTCCGT = 283 reads: +391 validated
umi TTCACACGCA = 390 reads: +391 validated
umi TTCCTAAATC = 370 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=546]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=13)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
475-546 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 246 reads
cdr3 = CARSEWEIPYYYFDYW at 396, score = 9 + 6
umis assigned: [6, 97, 362, 398, 403, 418, 419, 429, 450, 458] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3059
start codons at 54, 205, 252, 257, 274, 289, 318, 351
confident = true

TIG 2[bases=558]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=3)
390-422 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 1363 reads
cdr3 = CQKYNRAPNPEF at 358, score = 9 + 7
umis assigned: [26, 43, 108, 110, 166, 167, 193, 196, 246, 258] and 16 others
of which 26 are surviving nonsolos
reads assigned: 8376
start codons at 31, 37, 93, 106, 242, 341, 464
confident = true
now this is a cell
paired!

GACGACACGGCCGTGTATTACTGTGCGAGGTCCGAGTGGGAGATACCTTATTATTACTTTGACTACTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATGTTGGAACTTATTACTGTCAAAAGTATAACCGTGCCCCTAACCCAGAGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.821 = GAATGAATCGAGAACG-1

using 377 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [3]

====================================================================================

UMI info for barcode GAATGAATCGAGAACG-1 contig 1 = GAAGAGCTGC...
umi CCCCCTTCGG = 373 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-369 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYRNSITF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 33, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.825 = GAATGAATCGGATGGA-1

using 411 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[408]
surviving nonsolo ucounts = 1[408]
ids = [1]

====================================================================================

UMI info for barcode GAATGAATCGGATGGA-1 contig 1 = GAGAAGAGCT...
umi CCTCAATCGT = 356 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=485]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=23)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
417-485 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGGSITF at 359, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 35, 243, 369, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.829 = GAATGAATCTACTTAC-1

using 632 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[630]
surviving nonsolo ucounts = 1[630]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=421]
4-242 ==> 122-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
248-285 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
285-421 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQSPRGLTF at 218, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 609
start codons at 39, 201, 221, 327
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.831 = GAATGAATCTCCAACC-1

using 453 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[451]
surviving nonsolo ucounts = 1[451]
ids = [2]

====================================================================================

UMI info for barcode GAATGAATCTCCAACC-1 contig 1 = AGGAGTCAGA...
umi TCTCGTGGGC = 447 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 442
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.832 = GAATGAATCTCGATGA-1

using 100 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 14[2^4, 4^2, 5, 7^2, 9^2, 10, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.836 = GAATGAATCTGTACGA-1

using 87 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 4, 9, 67]
surviving nonsolo ucounts = 1[67]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=360]
0-274 ==> 76-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
289-339 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
339-360 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARDFPGNYFTFDIW at 263, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 47
start codons at 48, 118, 320
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.839 = GAATGAATCTTGTATC-1

using 337 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 4, 318]
surviving nonsolo ucounts = 1[318]
ids = [6]

====================================================================================

UMI info for barcode GAATGAATCTTGTATC-1 contig 1 = GAGAAGAGCT...
umi CTCTACTACT = 284 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=506]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-506 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSPYTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.846 = GACACGCAGACAAAGG-1

using 238 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode GACACGCAGACAAAGG-1 contig 1 = GGGGTCACAA...
umi AGTGGCAACG = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-508 ==> 0-82 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CCSYADSSTFVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 38, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.850 = GACACGCAGACTAGGC-1

using 233 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode GACACGCAGACTAGGC-1 contig 1 = GTCAGTCCCA...
umi CCTTTGCATG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYDNLPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.851 = GACACGCAGACTTTCG-1

using 84 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 11[2, 3, 4^2, 5^2, 6, 8, 11, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.861 = GACACGCAGCGTGAAC-1

using 174 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.862 = GACACGCAGCGTTCCG-1

using 314 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 309]
surviving nonsolo ucounts = 1[309]
ids = [0]

====================================================================================

UMI info for barcode GACACGCAGCGTTCCG-1 contig 1 = TGGGAGGAAT...
umi GATATATCCT = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-491 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.869 = GACACGCAGGTCATCT-1

using 569 reads

====================================================================================

graph has 256 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[22, 216, 327]
surviving nonsolo ucounts = 3[22, 216, 327]
ids = [0, 6, 4]

====================================================================================

UMI info for barcode GACACGCAGGTCATCT-1 contig 1 = CTGTTTCTGC...
umi TGTTTTATGA = 216 reads: +409 validated

UMI info for barcode GACACGCAGGTCATCT-1 contig 2 = AGGAGTCAGA...
umi AAACTAATAG = 2 reads: -235 +8 -4X +1 -1XX +5 -1XX +1 -1XX +3 -1XX +6 -1XX +1 -1XX +22 -1X +2 -1X +4 -88 invalidated
umi GCGACAACGG = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
0-43 ==> 193-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
43-374 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
415-452 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
452-518 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CTNLYHFGSEVW at 385, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 43, 199, 260, 506
confident = false

TIG 2[bases=509]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-509 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 299
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.883 = GACACGCCAAACTGTC-1

using 980 reads

====================================================================================

graph has 804 edges initially, 8 edges after simplification

total ucounts = 158
nonsolo ucounts = 64[2^23, 3^17, 4^6, 5^4, 6^2, 7^2, 8^2, 9^3, 10, 13, 21, 261, 371]
surviving nonsolo ucounts = 2[261, 371]
ids = [110, 39]

====================================================================================

UMI info for barcode GACACGCCAAACTGTC-1 contig 1 = GAGGAACTGC...
umi ATTTAAGCAT = 374 reads: +385 validated
umi TACAAGCTTA = 259 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CQQRSNWPTITF at 354, score = 9 + 8
umis assigned: [39, 110]
of which 2 are surviving nonsolos
reads assigned: 624
start codons at 33, 238, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.904 = GACACGCCACCGTTGG-1

using 10085 reads

====================================================================================

graph has 4012 edges initially, 48 edges after simplification

total ucounts = 587
nonsolo ucounts = 210[2^80, 3^36, 4^20, 5^14, 6^8, 7^6, 8^4, 9^2, 10^2, 11, 12^2, 13^3, 14, 25, 37, 54, 80, 115, 150, 181, 184, 193, 199, 232^2, 259, 260, 276, 282, 325, 332, 340, 343^2, 355, 361, 371, 385, 391, 397, 408, 454, 696, 782]
surviving nonsolo ucounts = 28[25, 37, 54, 150, 181, 184, 193, 199, 232, 259, 260, 276, 282, 325, 332, 340, 343^2, 355, 361, 371, 385, 391, 397, 408, 454, 696, 782]
ids = [457, 157, 124, 188, 404, 573, 170, 406, 427, 547, ...]

====================================================================================

UMI info for barcode GACACGCCACCGTTGG-1 contig 1 = ATACTTTCTG...
umi AAGGGCTTCC = 347 reads: +406 validated
umi CACCTTATAT = 55 reads: +320 -21 +2 -1 +2 -1 +17 -1 +26 -1 +5 -9 non-validated
umi CATTACCGGC = 24 reads: -406 non-validated
umi CGCGCTACCG = 387 reads: +406 validated
umi CGTTTTATTA = 455 reads: +406 validated
umi CTCAACATCG = 388 reads: +406 validated
umi GTATCTTAGC = 195 reads: +406 validated
umi TAGCATAACC = 25 reads: -22 +159 -9 +149 -67 non-validated

UMI info for barcode GACACGCCACCGTTGG-1 contig 2 = GGAGAAGAGC...
umi ATAAGCATCA = 345 reads: +385 validated
umi ATATAATGAC = 775 reads: -154X +231 invalidated
umi ATGCAATTGA = 262 reads: +385 validated
umi CAGGATCTAT = 680 reads: -315X +2 -2XX +1 -2XX +1 -5XX +1 -5XX +1 -2XX +1 -9XX +23 -1XX +14 invalidated
umi CATGTATCTT = 285 reads: +385 validated
umi CATTAACCCG = 401 reads: -328X +1 -5XX +1 -2XX +1 -9XX +23 -1XX +14 invalidated
umi CCCGCGTATG = 193 reads: -354X +2 -1XX +5 -1XX +7 -1XX +1 -1XX +4 -1XX +7 invalidated
umi CCTAAAATCT = 329 reads: +385 validated
umi CGAAAACATT = 149 reads: +385 validated
umi CGATTTCATG = 376 reads: +385 validated
umi CTCTATCTTC = 336 reads: +385 validated
umi GCCCCGGCCT = 359 reads: +385 validated
umi GTAGCGCCAG = 178 reads: +385 validated
umi GTTCCGTCGG = 234 reads: +385 validated
umi TAGTAACAAT = 343 reads: +385 validated
umi TCCCAACCAT = 365 reads: +385 validated
umi TCTCTTAGTC = 273 reads: +385 validated
umi TGTGGTCTCA = 395 reads: +385 validated
umi TTATCTCTGT = 262 reads: +385 validated
umi TTTAGGTTTA = 186 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=514]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=11)
392-412 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=3)
412-443 ==> 15-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
443-514 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 129 reads
cdr3 = CARGASGYTYGF at 376, score = 9 + 7
umis assigned: [8, 124, 157, 213, 243, 263, 406, 457]
of which 8 are surviving nonsolos
reads assigned: 1847
start codons at 37, 81, 298, 404
confident = true

TIG 2[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 924 reads
cdr3 = CQQYVSSPWTF at 360, score = 9 + 8
umis assigned: [79, 85, 93, 134, 153, 156, 170, 178, 188, 202] and 10 others
of which 20 are surviving nonsolos
reads assigned: 6612
start codons at 36, 370, 463
confident = true
now this is a cell
paired!

TCTGTGACCGCTGCGGACACGGCCGTATATTACTGTGCGAGGGGCGCTAGTGGATACACCTATGGCTTCGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGTTAGCTCTCCGTGGACGTTCGGCCAAGGGACCAGGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.907 = GACACGCCACGACTCG-1

using 705 reads

====================================================================================

graph has 260 edges initially, 14 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[197, 237, 270]
surviving nonsolo ucounts = 3[197, 237, 270]
ids = [3, 2, 0]

====================================================================================

UMI info for barcode GACACGCCACGACTCG-1 contig 1 = AGGAGGCAGC...
umi CATTTATGGT = 229 reads: +388 validated

UMI info for barcode GACACGCCACGACTCG-1 contig 2 = AGCTTCAGCT...
umi AGATAGGGCG = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
30-370 ==> 0-340 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=14)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
418-519 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CTSYTMSSTLVF at 354, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 30, 187, 238, 241, 369
confident = false

TIG 2[bases=536]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-536 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.910 = GACACGCCACGGATAG-1

using 868 reads

====================================================================================

graph has 278 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 863]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.915 = GACACGCCAGACTCGC-1

using 403 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 397]
surviving nonsolo ucounts = 1[397]
ids = [0]

====================================================================================

UMI info for barcode GACACGCCAGACTCGC-1 contig 1 = GCAGGAGTCA...
umi CAAACACTTC = 397 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 2-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CHQYESVPYTF at 356, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 392
start codons at 29, 35, 91, 104, 243, 339, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.917 = GACACGCCAGCGAACA-1

using 476 reads

====================================================================================

graph has 716 edges initially, 2 edges after simplification

total ucounts = 250
nonsolo ucounts = 88[2^41, 3^21, 4^6, 5^8, 6^2, 7, 8^3, 9^3, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.922 = GACACGCCAGGTCTCG-1

using 859 reads

====================================================================================

graph has 1270 edges initially, 14 edges after simplification

total ucounts = 410
nonsolo ucounts = 158[2^77, 3^35, 4^11, 5^7, 6^5, 7^5, 8^5, 9^3, 10^3, 11, 12, 13^2, 17, 18, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.925 = GACACGCCATAAAGGT-1

using 229 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode GACACGCCATAAAGGT-1 contig 1 = GGGAAACAGA...
umi CTAATATCCA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=21)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-589 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSAWDSSLNVWVF at 361, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 40, 179, 369, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.926 = GACACGCCATAACCTG-1

using 1347 reads

====================================================================================

graph has 1607 edges initially, 12 edges after simplification

total ucounts = 529
nonsolo ucounts = 191[2^82, 3^37, 4^27, 5^12, 6^12, 7^6, 8^2, 9^3, 10^3, 11, 13^2, 14, 16, 17, 295]
surviving nonsolo ucounts = 1[295]
ids = [413]

====================================================================================

UMI info for barcode GACACGCCATAACCTG-1 contig 1 = AGGAATCAGA...
umi TATAGCGCTA = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYPLTF at 354, score = 9 + 9
umis assigned: [413]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.935 = GACACGCCATGTAGTC-1

using 120 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[38, 80]
surviving nonsolo ucounts = 2[38, 80]
ids = [1, 3]

====================================================================================

UMI info for barcode GACACGCCATGTAGTC-1 contig 1 = AGGAGTCAGA...
umi GTTAGCCACC = 34 reads: +279 -21 +67 -21 non-validated
umi TTGTCCGCTT = 80 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-456 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 111
start codons at 27, 33, 89, 102, 241, 259
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.937 = GACACGCCATTAGGCT-1

using 246 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 244]
surviving nonsolo ucounts = 1[244]
ids = [1]

====================================================================================

UMI info for barcode GACACGCCATTAGGCT-1 contig 1 = GGGGTCTCAG...
umi CGTGAACCGG = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=3)
38-382 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-496 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSYISSTTLGF at 362, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 38, 246, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.940 = GACACGCCATTCTTAC-1

using 310 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=492]
3-68 ==> 5672-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
20-371 ==> 0-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=0)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-492 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 20, 26, 82, 95, 234, 451
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.947 = GACACGCTCAACGCTA-1

using 318 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 5, 7, 299]
surviving nonsolo ucounts = 1[299]
ids = [3]

====================================================================================

UMI info for barcode GACACGCTCAACGCTA-1 contig 1 = AGTCTGGGCC...
umi CCTCAGGGGC = 284 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-553 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.950 = GACACGCTCAAGGCTT-1

using 384 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2, 3^2, 6, 360]
surviving nonsolo ucounts = 1[360]
ids = [5]

====================================================================================

UMI info for barcode GACACGCTCAAGGCTT-1 contig 1 = GGAGTCAGTC...
umi CATATTATCT = 364 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.965 = GACACGCTCCGTTGCT-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.967 = GACACGCTCCTCAACC-1

using 451 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 207, 239]
surviving nonsolo ucounts = 2[207, 239]
ids = [3, 0]

====================================================================================

UMI info for barcode GACACGCTCCTCAACC-1 contig 1 = CCACATCCCT...
umi GAAATGACCT = 208 reads: +430 validated

UMI info for barcode GACACGCTCCTCAACC-1 contig 2 = GCTCTGCCTC...
umi AGCTTTCGGG = 233 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=475]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=3)
421-472 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 25 reads
cdr3 = CARPYYSIAAAGGEWFDPW at 384, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 42, 193, 198, 240, 245, 262, 339
confident = false

TIG 2[bases=566]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-566 ==> 0-121 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.971 = GACACGCTCCTTCAAT-1

using 5298 reads

====================================================================================

graph has 2350 edges initially, 44 edges after simplification

total ucounts = 395
nonsolo ucounts = 172[2^78, 3^28, 4^18, 5^12, 6^8, 7^2, 9^2, 10, 11^2, 30, 31, 89, 127, 135, 164, 172, 180^2, 184, 189, 202, 205, 220, 223, 236, 242, 244, 316, 461, 761]
surviving nonsolo ucounts = 20[31, 89, 127, 135, 164, 172, 180^2, 184, 189, 202, 205, 220, 223, 236, 242, 244, 316, 461, 761]
ids = [282, 108, 302, 70, 92, 334, 241, 347, 351, 132, ...]

====================================================================================

UMI info for barcode GACACGCTCCTTCAAT-1 contig 1 = AGCTTCAGCT...
umi AAAGGCTTGA = 228 reads: +388 validated
umi AACGAGTACA = 239 reads: +388 validated
umi AGCTGTTTCG = 119 reads: +341 -8 +39 non-validated
umi CAACGGTCAT = 88 reads: +388 validated
umi CATCTCCTCC = 461 reads: +388 validated
umi CATTAGGATA = 189 reads: +388 validated
umi CGTTTCCTCT = 248 reads: +388 validated
umi GCTTGTTCGC = 188 reads: -10 +1 -2XX +1 -2XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -12XX +1 -1XX +345 invalidated
umi TAACCCTCCG = 127 reads: +388 validated
umi TCAAACCGTC = 763 reads: -331X +1 -2XX +3 -3XX +1 -4XX +2 -3XX +38 invalidated
umi TCACCTACCC = 199 reads: +388 validated
umi TCGAACGAGA = 198 reads: +388 validated
umi TCGGTTCACA = 179 reads: +388 validated
umi TCTCTACTCA = 183 reads: +388 validated

UMI info for barcode GACACGCTCCTTCAAT-1 contig 2 = GGGGGACTCC...
umi ATGCCTTCCT = 149 reads: +430 -24 non-validated
umi CATTGCCTCG = 315 reads: +454 validated
umi GATACCGATT = 145 reads: +39 -1X +1 -2X +1 -2XX +384 -24 invalidated
umi GTATGTCAGG = 31 reads: +75 -12 +278 -2 +5 -1 +8 -73 non-validated
umi TTCTCCGTAG = 247 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 310 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [4, 10, 70, 108, 129, 132, 197, 267, 302, 319] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3356
start codons at 46, 200, 350, 375, 380
confident = true

TIG 2[bases=577]
21-379 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=0)
412-475 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
475-577 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 43 reads
cdr3 = CARIHGSSSWWGAIHSSYYYYGMDVW at 366, score = 7 + 7
umis assigned: [92, 136, 241, 282, 385]
of which 5 are surviving nonsolos
reads assigned: 878
start codons at 21, 169, 177, 244, 327, 336, 432, 493, 554
confident = true
now this is a cell
paired!

ATACACGGGAGCAGCAGCTGGTGGGGGGCGATACACTCCTCCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.972 = GACACGCTCGACCAGC-1

using 309 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 5, 296]
surviving nonsolo ucounts = 1[296]
ids = [5]

====================================================================================

UMI info for barcode GACACGCTCGACCAGC-1 contig 1 = GAGCTACAAC...
umi TAATGCGCAT = 296 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYYNTPLTF at 369, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.976 = GACACGCTCTAACCGA-1

using 5351 reads

====================================================================================

graph has 4906 edges initially, 132 edges after simplification

total ucounts = 881
nonsolo ucounts = 673[2^102, 3^85, 4^60, 5^56, 6^58, 7^47, 8^44, 9^34, 10^42, 11^33, 12^24, 13^19, 14^16, 15^18, 16^11, 17^10, 18^3, 19^3, 20^3, 23, 26, 40, 45, 366]
surviving nonsolo ucounts = 1[366]
ids = [329]

====================================================================================

UMI info for barcode GACACGCTCTAACCGA-1 contig 1 = GAGAAGAGCT...
umi CCCTTACTGA = 351 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=446]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
388-426 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
426-446 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGRSPRGFTF at 359, score = 9 + 8
umis assigned: [329]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 35, 243, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.978 = GACACGCTCTAACTGG-1

using 22 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.980 = GACACGCTCTACTTAC-1

using 478 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 228, 241]
surviving nonsolo ucounts = 2[228, 241]
ids = [6, 1]

====================================================================================

UMI info for barcode GACACGCTCTACTTAC-1 contig 1 = GGGAGGAACT...
umi ATGCCCTACT = 238 reads: +382 validated
umi GTGTTTAGCA = 235 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 75 reads
cdr3 = CQQYNNWLGTF at 356, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 462
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.984 = GACACGCTCTGATACG-1

using 54 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 3, 4, 6, 7, 10, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.988 = GACACGCTCTTGTCAT-1

using 604 reads

====================================================================================

graph has 940 edges initially, 42 edges after simplification

total ucounts = 288
nonsolo ucounts = 123[2^58, 3^25, 4^12, 5^9, 6^7, 7^2, 8^4, 9^2, 10, 12, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.998 = GACAGAGAGACTAGAT-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1004 = GACAGAGAGCCACGTC-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1008 = GACAGAGAGCGTTTAC-1

using 347 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^3, 3, 4^2, 5^2, 9, 11, 19, 277]
surviving nonsolo ucounts = 1[277]
ids = [4]

====================================================================================

UMI info for barcode GACAGAGAGCGTTTAC-1 contig 1 = GAGAGGAGCC...
umi ATATTTAGAC = 282 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=578]
0-71 ==> 8-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
71-424 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
444-507 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
507-578 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDLRSGQWLVYYYYGMDVW at 413, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 71, 227, 288, 306, 374, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1015 = GACAGAGAGGCATGTG-1

using 278 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================

UMI info for barcode GACAGAGAGGCATGTG-1 contig 1 = GGGACTGATC...
umi TCTAATCCTT = 270 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=523]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-523 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPLTF at 372, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1025 = GACAGAGAGTATGACA-1

using 795 reads

====================================================================================

graph has 274 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 7, 337, 441]
surviving nonsolo ucounts = 2[337, 441]
ids = [2, 10]

====================================================================================

UMI info for barcode GACAGAGAGTATGACA-1 contig 1 = AGAGCATCAC...
umi AGATTTGAGG = 308 reads: +430 validated

UMI info for barcode GACAGAGAGTATGACA-1 contig 2 = GAGTCAGTCT...
umi TGGCTTCACC = 438 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
63-416 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=1)
438-493 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
493-514 ==> 0-21 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDGYSSGWTYYYGMDVW at 405, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 63, 214, 261, 266, 270, 298, 327, 360, 450
confident = false

TIG 2[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CQQSYSTPRTF at 352, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 436
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1029 = GACAGAGAGTGAAGAG-1

using 6642 reads

====================================================================================

graph has 4374 edges initially, 86 edges after simplification

total ucounts = 817
nonsolo ucounts = 606[2^91, 3^83, 4^62, 5^59, 6^49, 7^54, 8^46, 9^33, 10^33, 11^24, 12^12, 13^14, 14^12, 15^4, 16^4, 17^5, 18^3, 19^2, 20, 22^2, 23, 25, 168, 177, 186, 191, 206, 217, 223, 273, 288, 295, 395]
surviving nonsolo ucounts = 11[168, 177, 186, 191, 206, 217, 223, 273, 288, 295, 395]
ids = [628, 452, 169, 578, 734, 187, 141, 535, 542, 166, ...]

====================================================================================

UMI info for barcode GACAGAGAGTGAAGAG-1 contig 1 = TCTGAGGATA...
umi CAAACAATAC = 214 reads: +391 validated
umi CACCGTAAGT = 177 reads: +384 -1 +5 -1 non-validated
umi GTCTACTGTC = 261 reads: +391 validated

UMI info for barcode GACAGAGAGTGAAGAG-1 contig 2 = GGGGGACTCC...
umi CACCATCGCC = 297 reads: +424 validated
umi CAGGTATACG = 223 reads: +424 validated
umi GCCCGTTACA = 178 reads: +424 validated
umi GTGATGGTTA = 291 reads: +424 validated
umi TACCGGACCC = 188 reads: +424 validated
umi TCAAGCTGGC = 167 reads: +424 validated
umi TGGAACCGCT = 210 reads: +424 validated

UMI info for barcode GACAGAGAGTGAAGAG-1 contig 3 = AGGAGTCAGA...
umi TTCGGATGCT = 393 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=579]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
86-439 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=8)
439-477 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
477-579 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 92 reads
cdr3 = CQSHDSSTPWVF at 413, score = 6 + 8
umis assigned: [141, 169, 535]
of which 3 are surviving nonsolos
reads assigned: 642
start codons at 86, 149, 240, 291, 423
confident = true

TIG 2[bases=605]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=5)
399-445 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
445-605 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 7 umis using 204 reads
cdr3 = CAHRRVSSSWPRIDNW at 366, score = 7 + 7
umis assigned: [166, 187, 452, 542, 578, 628, 734]
of which 7 are surviving nonsolos
reads assigned: 1528
start codons at 21, 65, 172, 244, 247, 327, 336, 499
confident = true

TIG 3[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [784]
of which 1 are surviving nonsolos
reads assigned: 388
start codons at 27, 33, 89, 102, 238, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1031 = GACAGAGAGTGTGGCA-1

using 2108 reads

====================================================================================

graph has 1172 edges initially, 30 edges after simplification

total ucounts = 186
nonsolo ucounts = 69[2^26, 3^10, 4^9, 5^4, 6^8, 7, 8, 10^2, 11^2, 12, 16, 143, 393, 565, 619]
surviving nonsolo ucounts = 4[143, 393, 565, 619]
ids = [89, 96, 13, 23]

====================================================================================

UMI info for barcode GACAGAGAGTGTGGCA-1 contig 1 = ATACTTTCTG...
umi CTCGCAATGG = 362 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=2)
402-433 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=7)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
491-535 ==> 0-44 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASQMPNIHCSGGSCYAGTSYYFDYW at 382, score = 9 + 7
umis assigned: [96]
of which 1 are surviving nonsolos
reads assigned: 358
start codons at 37, 81, 394, 509
confident = true

REJECT CONTIGS

TIG 1[bases=364]
3-234 ==> 890-1121 on rc of segment before IGHD3-3 exon 1 [len=1121] (mis=0)
245-293 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
293-364 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [13, 89]
of which 2 are surviving nonsolos
reads assigned: 688
start codons at 85, 144
confident = false
did not find CDR3

TIG 2[bases=448]
5-59 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
43-75 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
59-84 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
100-117 ==> 27-44 on rc of segment before IGSF6 exon 2 [len=1989] (mis=0)
175-200 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
228-266 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
266-448 ==> 0-182 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [23]
of which 1 are surviving nonsolos
reads assigned: 604
start codons at 59, 205
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1032 = GACAGAGAGTTTGCGT-1

using 292 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 8, 277]
surviving nonsolo ucounts = 1[277]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=511]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
0-79 ==> 5921-6000 on rc of segment after IGHV3-48 exon 1 [len=6000] (mis=0)
39-90 ==> 3150-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=9)
47-118 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=8)
433-451 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
449-508 ==> 0-59 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
cdr3 = CAREEYTRSSDYYYYGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 79, 235, 382, 469
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1037 = GACAGAGCAAGGTGTG-1

using 356 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 13, 339]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1042 = GACAGAGCAATCTACG-1

using 320 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[317]
surviving nonsolo ucounts = 1[317]
ids = [2]

====================================================================================

UMI info for barcode GACAGAGCAATCTACG-1 contig 1 = GAGTCAGACT...
umi TAATATGGGT = 317 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSNSYWTF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 25, 31, 85, 100, 236, 239, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1047 = GACAGAGCACATAACC-1

using 319 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode GACAGAGCACATAACC-1 contig 1 = GATCAGGACT...
umi GGTTGTTTCC = 285 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=488]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
430-488 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQGTHWPPWTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 63, 91, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1048 = GACAGAGCACATTAGC-1

using 1005 reads

====================================================================================

graph has 400 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2^3, 4^3, 6^2, 225, 744]
surviving nonsolo ucounts = 2[225, 744]
ids = [0, 7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=543]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-339 ==> 0-312 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
339-370 ==> 320-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3) [SHIFT!]
368-407 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPYTF at 346, score = 3 + 8
umis assigned: [0, 7]
of which 2 are surviving nonsolos
reads assigned: 959
start codons at 27, 33, 89, 102, 334, 449
confident = false
not full
frameshifted full length stopped transcript of length 543
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1050 = GACAGAGCACCATGTA-1

using 229 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode GACAGAGCACCATGTA-1 contig 1 = GCTCTGCTTC...
umi ATTCTCAGGA = 205 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=544]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-544 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLRDVVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 51, 205, 208, 259, 358, 385, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1054 = GACAGAGCACGTAAGG-1

using 413 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 406]
surviving nonsolo ucounts = 1[406]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1059 = GACAGAGCAGCCAATT-1

using 365 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3^2, 357]
surviving nonsolo ucounts = 1[357]
ids = [0]

====================================================================================

UMI info for barcode GACAGAGCAGCCAATT-1 contig 1 = GGGAGCATAG...
umi GAATTTGCCA = 354 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=530]
12-357 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
356-394 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
394-530 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYYSYTWTF at 333, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 12, 68, 81, 217, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1060 = GACAGAGCAGCCTTTC-1

using 221 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [1]

====================================================================================

UMI info for barcode GACAGAGCAGCCTTTC-1 contig 1 = AGCTCTGAGA...
umi CGACTGCGGC = 211 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=528]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=28)
457-503 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
503-528 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAKQGYCGGNSCALDYW at 421, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 79, 230, 235, 367, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1062 = GACAGAGCAGCGTTCG-1

using 1906 reads

====================================================================================

graph has 954 edges initially, 4 edges after simplification

total ucounts = 155
nonsolo ucounts = 55[2^18, 3^12, 4, 5^4, 6^4, 7, 8, 9^3, 10^2, 12, 19, 176, 191, 210, 237, 244, 263, 271]
surviving nonsolo ucounts = 7[176, 191, 210, 237, 244, 263, 271]
ids = [129, 113, 7, 147, 97, 135, 10]

====================================================================================

UMI info for barcode GACAGAGCAGCGTTCG-1 contig 1 = GCTGGGGTCA...
umi AATTGCCGCA = 204 reads: +394 validated

UMI info for barcode GACAGAGCAGCGTTCG-1 contig 2 = TGGGGACCCA...
umi ACGACTAACA = 268 reads: +424 validated
umi GTCATTCTTC = 248 reads: +424 validated
umi TACTTGCCGC = 192 reads: +424 validated
umi TCCTCCCCGG = 157 reads: +384 -40 non-validated
umi TGCCCCCGCT = 263 reads: +424 validated
umi TGTTAATCGA = 238 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=602]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-602 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSYAGSSTLGVVF at 365, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 41, 180, 242, 249, 375
confident = true

TIG 2[bases=554]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 80 reads
cdr3 = CARDRNWNYEGIAFDIW at 401, score = 8 + 8
umis assigned: [10, 97, 113, 129, 135, 147]
of which 6 are surviving nonsolos
reads assigned: 1350
start codons at 59, 210, 257, 262, 279, 294, 323, 356, 464
confident = true
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCGAGAGATCGTAACTGGAACTACGAGGGCATCGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTAGGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1068 = GACAGAGCATCCGGGT-1

using 450 reads

====================================================================================

graph has 258 edges initially, 16 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[211, 234]
surviving nonsolo ucounts = 2[211, 234]
ids = [0, 5]

====================================================================================

UMI info for barcode GACAGAGCATCCGGGT-1 contig 1 = GCTGCGGGTA...
umi AAACGCACGC = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-562 ==> 0-134 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false

REJECT CONTIGS

TIG 1[bases=331]
17-238 ==> 135-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
238-276 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
276-331 ==> 0-55 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 206, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 36, 39, 90, 189, 216, 240
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1072 = GACAGAGCATGTTGAC-1

using 317 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode GACAGAGCATGTTGAC-1 contig 1 = GAGTCAGACT...
umi ATGATGGGGC = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSNSYWTF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 25, 31, 85, 100, 236, 239, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1075 = GACAGAGGTAACGCGA-1

using 505 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[3^2, 4, 7, 9, 474]
surviving nonsolo ucounts = 1[474]
ids = [6]

====================================================================================

UMI info for barcode GACAGAGGTAACGCGA-1 contig 1 = AATCAGTCCC...
umi GGAGAGCCGG = 476 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 469
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1083 = GACAGAGGTCCCGACA-1

using 389 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 7, 373]
surviving nonsolo ucounts = 1[373]
ids = [4]

====================================================================================

UMI info for barcode GACAGAGGTCCCGACA-1 contig 1 = AAGAACCTGC...
umi CCTCAAGTCT = 350 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=548]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-392 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-548 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQAWDSSTVVF at 367, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 52, 57, 113, 200, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1091 = GACAGAGGTGTATGGG-1

using 229 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[8, 217]
surviving nonsolo ucounts = 1[217]
ids = [4]

====================================================================================

UMI info for barcode GACAGAGGTGTATGGG-1 contig 1 = AAAACCACAC...
umi TTCGACGCAC = 209 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-542 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1092 = GACAGAGGTTATCACG-1

using 40 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1094 = GACAGAGGTTCCACGG-1

using 1077 reads

====================================================================================

graph has 683 edges initially, 12 edges after simplification

total ucounts = 161
nonsolo ucounts = 69[2^26, 3^16, 4^4, 5^7, 6^5, 7^2, 8^2, 9^4, 20, 350, 368]
surviving nonsolo ucounts = 2[350, 368]
ids = [99, 24]

====================================================================================

UMI info for barcode GACAGAGGTTCCACGG-1 contig 1 = AAGAGCTGCT...
umi GGCCTTCCCT = 349 reads: +385 validated

UMI info for barcode GACAGAGGTTCCACGG-1 contig 2 = TGGGGTCACA...
umi AGTATTCACC = 346 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-380 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYVSPPWTF at 356, score = 9 + 8
umis assigned: [99]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 32, 240, 243, 459
confident = false

TIG 2[bases=571]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-332 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
430-571 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CSSYAGRTTFDVF at 363, score = 7 + 8
umis assigned: [24]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 39, 175, 178, 193, 196, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1095 = GACAGAGGTTCCCTTG-1

using 229 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode GACAGAGGTTCCCTTG-1 contig 1 = GCTACAACAG...
umi ATCTGTTCCC = 230 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1103 = GACAGAGTCACGGTTA-1

using 565 reads

====================================================================================

graph has 232 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[9, 13, 229, 310]
surviving nonsolo ucounts = 2[13, 310]
ids = [5, 3]

====================================================================================

UMI info for barcode GACAGAGTCACGGTTA-1 contig 1 = GGGGGGGGTC...
umi CGATCGCCAT = 307 reads: +388 validated
umi TCTAAGATAT = 3 reads: -30 +5 -1 +2 -2X +1 -2X +21 -2X +11 -2X +4 -1X +1 -303X invalidated

GOOD CONTIGS

TIG 1[bases=521]
42-393 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
430-521 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYTSSSTKVF at 366, score = 8 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 307
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1107 = GACAGAGTCAGCTCTC-1

using 220 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[219]
surviving nonsolo ucounts = 1[219]
ids = [0]

====================================================================================

UMI info for barcode GACAGAGTCAGCTCTC-1 contig 1 = AGGAGTCAGT...
umi TCAATCGCCG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYDNLPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1114 = GACAGAGTCCCACTTG-1

using 289 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode GACAGAGTCCCACTTG-1 contig 1 = GATCAGGACT...
umi TATACGAAAG = 272 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=502]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-502 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTLWTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1115 = GACAGAGTCCTATTCA-1

using 71 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2, 4, 6, 7, 15, 28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1121 = GACAGAGTCGGCATCG-1

using 39 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^2, 3, 4^2, 5, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1131 = GACAGAGTCTTGGGTA-1

using 343 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [4]

====================================================================================

UMI info for barcode GACAGAGTCTTGGGTA-1 contig 1 = GGGAATCAGT...
umi GCGGTTTCTA = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1132 = GACAGAGTCTTTCCTC-1

using 390 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 378]
surviving nonsolo ucounts = 1[378]
ids = [0]

====================================================================================

UMI info for barcode GACAGAGTCTTTCCTC-1 contig 1 = GCTGCTCAGT...
umi ACCACCTTCG = 379 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-376 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSPVTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 28, 236, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1134 = GACCAATAGACATAAC-1

using 7334 reads

====================================================================================

graph has 3743 edges initially, 48 edges after simplification

total ucounts = 567
nonsolo ucounts = 279[2^91, 3^54, 4^41, 5^24, 6^15, 7^13, 8^3, 9^4, 10^2, 11^4, 13, 14, 17, 18, 22, 90, 105, 109, 124, 157, 164, 175, 225, 226, 235, 244, 252, 270, 280, 306, 314, 338, 343, 354, 363, 373, 382, 600]
surviving nonsolo ucounts = 24[22, 90, 105, 109, 124, 157, 164, 175, 225, 226, 235, 244, 252, 270, 280, 306, 314, 338, 343, 354, 363, 373, 382, 600]
ids = [293, 168, 558, 44, 235, 339, 392, 415, 179, 226, ...]

====================================================================================

UMI info for barcode GACCAATAGACATAAC-1 contig 1 = CCTGGGTCAG...
umi AAGGAGCCCT = 254 reads: -319X +1 -2XX +1 -5XX +1 -5XX +1 -12XX +1 -1XX +36 invalidated
umi ACCCGTTTCG = 358 reads: +385 validated
umi ACCTGCCCCC = 282 reads: +385 validated
umi AGGCGCTATA = 370 reads: +385 validated
umi AGTCTTCGCT = 374 reads: +385 validated
umi CACAAGCCCC = 270 reads: +385 validated
umi CACAGCAATA = 84 reads: -364 +21 non-validated
umi CACCATGGTG = 236 reads: +385 validated
umi GCGTTACTAG = 381 reads: +385 validated
umi GGTAAACTCC = 152 reads: +385 validated
umi TCGATATCTT = 303 reads: +385 validated
umi TGTAGGCAGG = 254 reads: +385 validated

UMI info for barcode GACCAATAGACATAAC-1 contig 2 = GGGAGAGGAG...
umi CAGAGATATA = 229 reads: +397 -15 non-validated
umi CGACACCTCA = 226 reads: +412 validated
umi CTTTTTGCAT = 23 reads: +183 -1 +77 -1 +34 -1 +53 -62 non-validated
umi GAACTTCGTC = 348 reads: +117 -1XX +294 invalidated
umi TAGCACCCCT = 174 reads: +412 validated
umi TATCGGGCGA = 316 reads: +408 -4 non-validated
umi TATTCTCGCT = 304 reads: +412 validated
umi TTTCAAGTCG = 107 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=573]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
399-437 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 443 reads
cdr3 = CQQYGSSPGTF at 376, score = 9 + 8
umis assigned: [23, 52, 57, 94, 108, 166, 168, 170, 319, 339] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3268
start codons at 52, 260, 386, 479
confident = true

TIG 2[bases=556]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=3)
447-485 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 95 reads
cdr3 = CARAQWLVEGLSYW at 412, score = 9 + 7
umis assigned: [179, 226, 293, 297, 415, 421, 429, 558]
of which 8 are surviving nonsolos
reads assigned: 1684
start codons at 73, 229, 373
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGCTCAGTGGCTGGTAGAGGGGCTTAGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGGGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1140 = GACCAATAGATCTGCT-1

using 389 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[381]
surviving nonsolo ucounts = 1[381]
ids = [3]

====================================================================================

UMI info for barcode GACCAATAGATCTGCT-1 contig 1 = GTCAGACCCA...
umi CTGCAACTGT = 385 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=15)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQYSNDFPYVF at 350, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 23, 29, 85, 98, 288, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1143 = GACCAATAGCATCATC-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1144 = GACCAATAGCCACCTG-1

using 343 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[339]
surviving nonsolo ucounts = 1[339]
ids = [1]

====================================================================================

UMI info for barcode GACCAATAGCCACCTG-1 contig 1 = AGGAGTCAGA...
umi CGTATAGACT = 340 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQSNSYWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 27, 33, 87, 102, 238, 241, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1146 = GACCAATAGCCAGTAG-1

using 1029 reads

====================================================================================

graph has 704 edges initially, 6 edges after simplification

total ucounts = 193
nonsolo ucounts = 64[2^31, 3^7, 4^11, 5^5, 6^2, 7^2, 8^3, 10, 316, 372]
surviving nonsolo ucounts = 2[316, 372]
ids = [6, 89]

====================================================================================

UMI info for barcode GACCAATAGCCAGTAG-1 contig 1 = GGGGAGGAAC...
umi ACAATGTGGG = 315 reads: +382 validated
umi CTTTGGTTCC = 377 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 108 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [6, 89]
of which 2 are surviving nonsolos
reads assigned: 678
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1150 = GACCAATAGGACAGCT-1

using 20 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1153 = GACCAATAGGACTGGT-1

using 264 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode GACCAATAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi GCTGCTGGCA = 256 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=571]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-571 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 35 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1160 = GACCAATAGGTGTGGT-1

using 308 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 4^2, 6, 290]
surviving nonsolo ucounts = 1[290]
ids = [2]

====================================================================================

UMI info for barcode GACCAATAGGTGTGGT-1 contig 1 = AGGAATCAGA...
umi CAGCTGACAT = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-495 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1162 = GACCAATAGTAGCCGA-1

using 251 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[249]
surviving nonsolo ucounts = 1[249]
ids = [0]

====================================================================================

UMI info for barcode GACCAATAGTAGCCGA-1 contig 1 = TGAGCGCAGA...
umi ATGATGCTAA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=11)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
424-549 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CETWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 36, 190, 241, 247, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1163 = GACCAATAGTAGGCCA-1

using 221 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 213]
surviving nonsolo ucounts = 1[213]
ids = [7]

====================================================================================

UMI info for barcode GACCAATAGTAGGCCA-1 contig 1 = GCTCTGCTTC...
umi TTTTAAGACA = 209 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=506]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-506 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1168 = GACCAATAGTGATCGG-1

using 671 reads

====================================================================================

graph has 924 edges initially, 6 edges after simplification

total ucounts = 294
nonsolo ucounts = 122[2^45, 3^24, 4^19, 5^8, 6^12, 7^4, 8, 9^3, 10, 11, 13, 16^2, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1173 = GACCAATAGTGGGTTG-1

using 19979 reads

====================================================================================

graph has 6898 edges initially, 77 edges after simplification

total ucounts = 1095
nonsolo ucounts = 500[2^178, 3^93, 4^68, 5^25, 6^22, 7^13, 8^5, 9^11, 10^8, 11, 12, 13^3, 14, 20, 28, 38, 75, 81, 85, 89, 92, 93, 98, 101, 109, 110^2, 123, 134, 138, 152, 155, 169, 172, 175, 178, 189, 191, 194, 195^2, 216, 218, 221^2, 226, 234^2, 235, 236, 239, 247, 251, 254, 256, 257, 264^2, 267, 268, 272^2, 275, 277^2, 278, 280, 282, 285, 294, 296, 298, 300^2, 304, 313, 318, 326, 480, 732, 741, 817, 833, 887]
surviving nonsolo ucounts = 66[75, 85, 89, 92, 93, 98, 101, 109, 110^2, 123, 134, 138, 152, 155, 169, 175, 178, 189, 191, 194, 195^2, 216, 218, 221^2, 226, 234^2, 235, 236, 239, 247, 251, 254, 256, 257, 264^2, 267, 268, 272^2, 275, 277^2, 278, 280, 282, 285, 294, 296, 298, 300^2, 304, 313, 318, 326, 480, 732, 741, 817, 833, 887]
ids = [93, 222, 963, 150, 602, 110, 1037, 237, 68, 697, ...]

====================================================================================

UMI info for barcode GACCAATAGTGGGTTG-1 contig 1 = AGCTCTGGGA...
umi ACCTAACAGA = 74 reads: +341 -89 non-validated
umi AGATGTTGGT = 86 reads: +420 -10 non-validated
umi CATGTGCTGT = 136 reads: +421 -9 non-validated
umi CGTTGTTAAG = 256 reads: +426 -4 non-validated
umi CTGGAGTACT = 233 reads: +411 -19 non-validated
umi GCACCGAGCG = 227 reads: +430 validated
umi GGGGTACCAA = 112 reads: +423 -7 non-validated
umi GTCATTGATA = 194 reads: +421 -9 non-validated
umi TATCGAAGAT = 216 reads: +430 validated
umi TGGCATGGCC = 91 reads: +396 -34 non-validated
umi TTTATAGTCT = 217 reads: +430 validated

UMI info for barcode GACCAATAGTGGGTTG-1 contig 2 = GCTCTGCTTC...
umi ACAAGTCCAA = 109 reads: +391 validated
umi ACCGAGCGCG = 222 reads: +391 validated
umi ACCTACGCTA = 279 reads: +391 validated
umi ACGTTTAGTG = 97 reads: +391 validated
umi ACTTAGGATG = 483 reads: +391 validated
umi AGCAGCTCTT = 253 reads: +391 validated
umi ATACAGTCTT = 331 reads: +391 validated
umi ATATTTATAT = 192 reads: +391 validated
umi ATCTCTAGTG = 279 reads: +391 validated
umi ATGCTCGGGA = 111 reads: +391 validated
umi ATGGACCTTC = 198 reads: +391 validated
umi ATGTGTGCCG = 754 reads: -340 +1 -11X +26 -1XX +12 invalidated
umi ATTGTCGCCT = 272 reads: +391 validated
umi CAAACAATGG = 170 reads: +391 validated
umi CAATGTATGG = 235 reads: +391 validated
umi CATACGCTTC = 276 reads: +391 validated
umi CATCTAACAT = 269 reads: +391 validated
umi CATCTCCAGC = 191 reads: +391 validated
umi CCAACGTTCC = 175 reads: +391 validated
umi CCCATACCCA = 278 reads: +391 validated
umi CCGATAGCGG = 228 reads: +391 validated
umi CGGCAAAGAG = 299 reads: +391 validated
umi CGTAAGCTTG = 253 reads: +391 validated
umi CTAGACATCG = 254 reads: +391 validated
umi CTCTTTCGGA = 224 reads: +391 validated
umi GAACCAGCAT = 172 reads: +391 validated
umi GAATCCAGGG = 825 reads: -352X +26 -1XX +12 invalidated
umi GATCTCGCTT = 317 reads: +391 validated
umi GCACTATCCA = 91 reads: +391 validated
umi GCGACGGTTC = 837 reads: -347 +1 -4XX +26 -1XX +12 invalidated
umi GCGTCCAATA = 738 reads: -347X +1 -4XX +26 -1XX +12 invalidated
umi GCTCATGGCA = 306 reads: +391 validated
umi GCTCCATTCG = 313 reads: +391 validated
umi GGCCCGAACA = 297 reads: +391 validated
umi GGCTCGTCCT = 266 reads: +391 validated
umi GTACTTTATC = 301 reads: +391 validated
umi GTCAGAGGAA = 271 reads: +391 validated
umi GTGTATTGGC = 124 reads: +391 validated
umi GTGTCACTCT = 276 reads: +391 validated
umi GTTTCAATAC = 213 reads: +391 validated
umi TACTCCCTCA = 264 reads: +391 validated
umi TCAAACGCCA = 277 reads: +391 validated
umi TCACAAACGC = 269 reads: +391 validated
umi TCATTTGTTC = 297 reads: +391 validated
umi TCCCATGTTC = 246 reads: +391 validated
umi TCCGGATCAG = 194 reads: +391 validated
umi TCGACACGGC = 890 reads: -352X +26 -1XX +12 invalidated
umi TGTATGAAAA = 152 reads: +391 validated
umi TTAGTTTCAG = 238 reads: +391 validated
umi TTATAAGCTG = 139 reads: +391 validated
umi TTCGAGTCAT = 99 reads: +359 -1XX +1 -2XX +1 -2X +1 -2X +2 -2X +1 -1 +16 invalidated
umi TTCTCTCGAA = 291 reads: +391 validated
umi TTTAACTTGG = 155 reads: +391 validated
umi TTTCCATCAC = 283 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=580]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=8)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
509-580 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 48 reads
cdr3 = CASDASPSWYGSGRYYLDYW at 418, score = 9 + 7
umis assigned: [93, 150, 324, 474, 524, 601, 697, 734, 840, 963] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1800
start codons at 79, 235, 296, 379, 428, 446
confident = true

TIG 2[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 47 umis using 1718 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [68, 89, 94, 110, 132, 156, 192, 208, 227, 237] and 44 others
of which 54 are surviving nonsolos
reads assigned: 15345
start codons at 51, 205, 208, 259, 358, 385
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGCGATGCGTCCCCTTCCTGGTATGGTTCGGGAAGGTATTATCTAGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTGGGTGTTCGGCGGAGGGACCAAGGTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1183 = GACCAATCAATAGAGT-1

using 331 reads

====================================================================================

graph has 135 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

UMI info for barcode GACCAATCAATAGAGT-1 contig 1 = GAGCTACAAC...
umi AAACCATCAA = 336 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1190 = GACCAATCACACATGT-1

using 341 reads

====================================================================================

graph has 98 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 331]
surviving nonsolo ucounts = 1[331]
ids = [6]

====================================================================================

UMI info for barcode GACCAATCACACATGT-1 contig 1 = GGGGGAGTCA...
umi AATTACCCGT = 2 reads: -388 non-validated
umi TAATTAAGTG = 327 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=2)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [0, 6]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1197 = GACCAATCAGACACTT-1

using 258 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 5[2^2, 3^2, 236]
surviving nonsolo ucounts = 1[236]
ids = [14]

====================================================================================

UMI info for barcode GACCAATCAGACACTT-1 contig 1 = ATCACATAAC...
umi TGAAGAGCCG = 212 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=491]
0-58 ==> 3-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
58-411 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=3)
415-439 ==> 7-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
442-491 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 15 reads
cdr3 = CASLGCSGGSCYPTYGMDVW at 400, score = 9 + 7
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 58, 209, 256, 355, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1200 = GACCAATCAGCGTAAG-1

using 50 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 47]
surviving nonsolo ucounts = 1[47]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1202 = GACCAATCAGTCCTTC-1

using 407 reads

====================================================================================

graph has 108 edges initially, 6 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[407]
surviving nonsolo ucounts = 1[407]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1205 = GACCAATCATATACCG-1

using 572 reads

====================================================================================

graph has 234 edges initially, 36 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[280, 290]
surviving nonsolo ucounts = 2[280, 290]
ids = [3, 0]

====================================================================================

UMI info for barcode GACCAATCATATACCG-1 contig 1 = GAATCAGTCC...
umi AGATTTTTGC = 312 reads: +22 -1XX +235 -2XX +128 invalidated

UMI info for barcode GACCAATCATATACCG-1 contig 2 = AGGAGTCAGA...
umi TCGTTAGATA = 283 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYSLWTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1211 = GACCAATCATGTAAGA-1

using 300 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 5, 285]
surviving nonsolo ucounts = 1[285]
ids = [6]

====================================================================================

UMI info for barcode GACCAATCATGTAAGA-1 contig 1 = GAGTCAGTCT...
umi CTTCGGCACT = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYTTPYTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 25, 31, 87, 100, 257, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1212 = GACCAATCATGTCCTC-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1214 = GACCAATGTAAAGTCA-1

using 49 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 5, 6, 12, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1216 = GACCAATGTAAGTGGC-1

using 989 reads

====================================================================================

graph has 1346 edges initially, 14 edges after simplification

total ucounts = 447
nonsolo ucounts = 184[2^69, 3^36, 4^27, 5^13, 6^16, 7^8, 8^6, 9^3, 10, 11, 12, 14^2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1222 = GACCAATGTCACCTAA-1

using 2232 reads

====================================================================================

graph has 418 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 12, 153, 2057]
surviving nonsolo ucounts = 2[153, 2057]
ids = [9, 0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1240 = GACCAATGTTTCGCTC-1

using 134 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3^2, 4^2, 116]
surviving nonsolo ucounts = 1[116]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1250 = GACCAATTCATGTAGC-1

using 7 reads

====================================================================================

graph has 2 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1262 = GACCAATTCGAATCCA-1

using 36 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 26]
surviving nonsolo ucounts = 1[26]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1265 = GACCAATTCGGCATCG-1

using 120 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 5, 112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================

UMI info for barcode GACCAATTCGGCATCG-1 contig 1 = GAAGAGCTGC...
umi CACTACGGGT = 109 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=466]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-466 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CHQYGTSPRTF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1270 = GACCAATTCTCCTATA-1

using 441 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[6, 9, 421]
surviving nonsolo ucounts = 1[421]
ids = [4]

====================================================================================

UMI info for barcode GACCAATTCTCCTATA-1 contig 1 = ATCAGTCCCA...
umi CAGTCAGGGT = 410 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-485 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 402
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1271 = GACCAATTCTCTGCTG-1

using 469 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 457]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=480]
4-101 ==> 1609-1706 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
99-234 ==> 1965-2100 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
231-269 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
269-480 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
umis assigned: [6]
of which 0 are surviving nonsolos
reads assigned: 451
start codons at 46, 162, 190
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1288 = GACCTGGAGATAGCAT-1

using 95 reads

====================================================================================

graph has 119 edges initially, 4 edges after simplification

total ucounts = 22
nonsolo ucounts = 15[2^6, 3, 4, 6, 7^2, 11, 12, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1294 = GACCTGGAGCAACGGT-1

using 161 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[3, 4^3, 5, 137]
surviving nonsolo ucounts = 1[137]
ids = [9]

====================================================================================

UMI info for barcode GACCTGGAGCAACGGT-1 contig 1 = GGCTTTCTGA...
umi TGGCGGTGGT = 133 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=509]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
424-475 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
475-509 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 375, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 15, 36, 80, 166
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1305 = GACCTGGAGGAATCGC-1

using 13 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1316 = GACCTGGAGGTGTGGT-1

using 63 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^3, 49]
surviving nonsolo ucounts = 1[49]
ids = [1]

====================================================================================

UMI info for barcode GACCTGGAGGTGTGGT-1 contig 1 = AGCTCTGGAG...
umi CCAGACAGAA = 45 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=457]
0-42 ==> 10-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
42-390 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-457 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQQYGSSPPITF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 42, 250, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1327 = GACCTGGAGTGGGATC-1

using 370 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[364]
surviving nonsolo ucounts = 1[364]
ids = [5]

====================================================================================

UMI info for barcode GACCTGGAGTGGGATC-1 contig 1 = AATCAGTCCC...
umi TCGCCATGCA = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-505 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1332 = GACCTGGAGTTACGGG-1

using 185 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 175]
surviving nonsolo ucounts = 1[175]
ids = [1]

====================================================================================

UMI info for barcode GACCTGGAGTTACGGG-1 contig 1 = GGGCTCAGAA...
umi ATTATGTTGG = 162 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=442]
0-34 ==> 6-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
34-371 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-442 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CNSRDSSGNHLKVF at 349, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 34, 153, 182, 233, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1339 = GACCTGGCAAATACAG-1

using 290 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 6, 271]
surviving nonsolo ucounts = 1[271]
ids = [7]

====================================================================================

UMI info for barcode GACCTGGCAAATACAG-1 contig 1 = GAGAGAGGAG...
umi TACTAAATAT = 271 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=568]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-568 ==> 0-71 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1341 = GACCTGGCAACACCCG-1

using 130 reads

====================================================================================

graph has 140 edges initially, 6 edges after simplification

total ucounts = 20
nonsolo ucounts = 13[3, 4^2, 6, 7, 8, 10^2, 12^2, 14, 15, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1353 = GACCTGGCACCCTATC-1

using 380 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 373]
surviving nonsolo ucounts = 1[373]
ids = [1]

====================================================================================

UMI info for barcode GACCTGGCACCCTATC-1 contig 1 = GAGTGTGCTT...
umi ATTCAAGTCT = 371 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=530]
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=14)
429-459 ==> 16-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGAERSTTLIIDSW at 380, score = 8 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 20, 41, 85, 171, 424
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1357 = GACCTGGCACTTCTGC-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1367 = GACCTGGCAGCTGTTA-1

using 13012 reads

====================================================================================

graph has 5833 edges initially, 150 edges after simplification

total ucounts = 1094
nonsolo ucounts = 499[2^175, 3^116, 4^67, 5^28, 6^28, 7^12, 8^13, 9^7, 10^3, 11^7, 12, 13^2, 14^3, 15^2, 39, 50, 81, 117, 123, 128, 134^2, 145, 155, 169, 177, 190, 207, 212, 219, 222, 229, 230, 233, 235, 239, 244, 253, 255, 264, 288, 310, 383, 431, 590, 652, 720, 1044, 1573]
surviving nonsolo ucounts = 33[50, 81, 117, 123, 128, 134^2, 145, 155, 169, 177, 207, 212, 219, 222, 229, 230, 233, 235, 239, 244, 253, 255, 264, 288, 310, 383, 431, 590, 652, 720, 1044, 1573]
ids = [110, 680, 494, 685, 158, 633, 675, 643, 724, 951, ...]

====================================================================================

UMI info for barcode GACCTGGCAGCTGTTA-1 contig 1 = TGGGGACTGT...
umi ACGGGAGCAT = 52 reads: -387 +2 -1X +13 invalidated
umi CAAGGCCCGT = 214 reads: +403 validated
umi CACTCTGCTT = 257 reads: +403 validated
umi CAGACCCTCT = 227 reads: +403 validated
umi CCCCAGAACA = 212 reads: +403 validated
umi CGCTCAGTGT = 120 reads: +403 validated
umi CTAACTCCAT = 1591 reads: -358 +1 -6XX +6 -1XX +17 -1XX +13 invalidated
umi CTTTGACGCT = 236 reads: +403 validated
umi GCCGAAGTGC = 138 reads: +403 validated
umi GCCTTAACTA = 122 reads: +403 validated
umi TGAGACCGTC = 169 reads: +403 validated
umi TTTTACACCT = 254 reads: +403 validated
umi TTTTATGAAC = 220 reads: +403 validated

UMI info for barcode GACCTGGCAGCTGTTA-1 contig 2 = AGAGAGGAGC...
umi AGGCCATAGG = 114 reads: -341X +1 -4X +1 -8X +1 -2XX +20 -1XX +21 invalidated
umi AGGGGTTTTG = 188 reads: -362X +2 -7XX +2 -9XX +2 -2XX +1 -2XX +2 -2XX +7 invalidated
umi ATTACGCACC = 230 reads: +400 validated
umi ATTTGTCTTG = 229 reads: -324 +1 -7X +2 -2XX +2 -2XX +1 -1XX +1 -1XX +2 -1XX +1 -1XX +2 -4XX +1 -2XX +20 -1XX +21 invalidated
umi CCCCACGTCT = 158 reads: +400 validated
umi GAGAAAAATG = 135 reads: +382 -18 non-validated
umi GATCGACCGG = 142 reads: +400 validated
umi GCCTCATTGG = 82 reads: +372 -1 +4 -23 non-validated
umi GCTACCGACC = 309 reads: +400 validated
umi GGTCAACCCC = 162 reads: +27 -1XX +328 -2 +42 invalidated
umi GTATATCCTC = 238 reads: +400 validated
umi TAGGCACCCT = 225 reads: +400 validated
umi TTGGAAGCCA = 519 reads: -363 +1 -1XX +1 -2XX +1 -1XX +1 -4XX +1 -5XX +2 -5XX +1 -7XX +4 invalidated

GOOD CONTIGS

TIG 1[bases=646]
32-401 ==> 0-369 on |377|IGLV5-39|L-REGION+V-REGION| [len=369] (mis=9)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 324 reads
cdr3 = CAIWYSSTWVF at 374, score = 8 + 8
umis assigned: [110, 289, 322, 327, 403, 494, 523, 609, 675, 685] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3733
start codons at 32, 174, 306, 318, 357
confident = true

TIG 2[bases=543]
0-72 ==> 7-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=11)
424-472 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
472-543 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 112 reads
cdr3 = CARDGIDYW at 414, score = 8 + 6
umis assigned: [158, 162, 245, 271, 402, 633, 643, 680, 688, 724] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2676
start codons at 72, 228, 307, 375, 424
confident = true
now this is a cell
paired!

CAAATGAACAGCCTGAGAGTCGAGGACACGGCTGTGTATTACTGTGCGAGGGATGGTATTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGGCTCCAGTCTGAAGATGAGGCTGACTATTACTGTGCCATTTGGTACAGCAGCACTTGGGTATTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1369 = GACCTGGCAGGAACGT-1

using 182 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 171]
surviving nonsolo ucounts = 1[171]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
0-56 ==> 4272-4328 on rc of segment before IGHVIII-51-1 exon 1 [len=4328] (mis=0)
13-103 ==> 5828-5918 on rc of segment after IGHV5-78 exon 1 [len=6000] (mis=10)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
413-434 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=0)
432-475 ==> 0-43 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
cdr3 = CARFPGYSSSWYPFDYW at 398, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 56, 230, 254, 389
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1371 = GACCTGGCAGGTCGTC-1

using 160 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 151]
surviving nonsolo ucounts = 1[151]
ids = [1]

====================================================================================

UMI info for barcode GACCTGGCAGGTCGTC-1 contig 1 = GTCTCACCAT...
umi CGTAGTCGTT = 138 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=525]
8-345 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=11)
352-390 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
390-525 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CQSADSSGSYYVF at 323, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 8, 69, 138, 156, 200, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1376 = GACCTGGCATACGCTA-1

using 16538 reads

====================================================================================

graph has 6129 edges initially, 80 edges after simplification

total ucounts = 946
nonsolo ucounts = 482[2^181, 3^86, 4^56, 5^42, 6^24, 7^16, 8^12, 9^4, 10^3, 11^5, 12^2, 13, 14, 17, 23, 39^2, 47, 120, 145, 147, 158, 159, 205, 217, 219, 220, 230, 232, 240, 247, 251, 252, 271, 286, 294, 303, 304, 313^2, 314, 319, 321, 326, 330, 335, 350, 353, 364^2, 369, 370, 372, 379, 388, 400, 414, 432, 588, 628, 728, 761]
surviving nonsolo ucounts = 51[2^5, 3, 4, 39, 145, 147, 158, 159, 205, 217, 219, 220, 230, 232, 240, 247, 251, 252, 271, 286, 294, 303, 304, 313^2, 314, 319, 321, 326, 330, 335, 350, 353, 364^2, 369, 370, 372, 379, 388, 400, 414, 432, 588, 628, 728, 761]
ids = [217, 224, 391, 535, 702, 25, 666, 790, 791, 679, ...]

====================================================================================

UMI info for barcode GACCTGGCATACGCTA-1 contig 1 = GGGGAGGAAC...
umi AAGCATCCAA = 380 reads: +382 validated
umi AATTCTGGTC = 309 reads: -320 +62 non-validated
umi ACACTATACA = 764 reads: +382 validated
umi ACAGAACGAT = 311 reads: +382 validated
umi ACCACGTCCA = 355 reads: +382 validated
umi ACGAATCGAG = 218 reads: +382 validated
umi ACGTTATAGG = 398 reads: +382 validated
umi ACTTAGTTCT = 286 reads: +382 validated
umi ATACTTATTA = 728 reads: +382 validated
umi ATCCTTCAAT = 251 reads: +382 validated
umi CAACTGTGTG = 271 reads: +382 validated
umi CAATGCTACC = 340 reads: +382 validated
umi CACAGATGTC = 318 reads: +382 validated
umi CCATTGAGTG = 365 reads: +382 validated
umi CCCCCGTGCT = 372 reads: +382 validated
umi CCTCGGACGT = 327 reads: +382 validated
umi CGGCGGCCGT = 244 reads: -334X +48 invalidated
umi CGTGTCGCTC = 349 reads: +335 -3X +1 -1 +42 invalidated
umi CTAACGTCCT = 229 reads: +382 validated
umi CTCCCTCGGT = 325 reads: +382 validated
umi CTGACTGGTT = 372 reads: +382 validated
umi GAAACGGTTC = 320 reads: +382 validated
umi GAATAGTCTC = 387 reads: +382 validated
umi GATGTCAGGT = 430 reads: +382 validated
umi GCATCCCACA = 630 reads: +382 validated
umi GCCAGGAGTG = 412 reads: +382 validated
umi GGATCTGGGC = 360 reads: +382 validated
umi GGGGTACAAG = 158 reads: +382 validated
umi GGGTCAAGGG = 350 reads: +382 validated
umi GTAAATCCTG = 301 reads: +382 validated
umi TAAATTACCC = 319 reads: +382 validated
umi TATTGCGGCA = 220 reads: +382 validated
umi TCCGACAATC = 143 reads: +377 -2 +2 -1 non-validated
umi TCTATGGGGT = 584 reads: -200 +182 non-validated
umi TTGATTTTGG = 421 reads: +49 -2XX +95 -1XX +57 -1XX +3 -1XX +21 -1XX +107 -1XX +7 -1X +35 invalidated
umi TTTAGTTGCC = 296 reads: +382 validated

UMI info for barcode GACCTGGCATACGCTA-1 contig 2 = AGCTCTGGGA...
umi AATTTTATGG = 251 reads: +11 -8XX +2 -1XX +417 invalidated
umi CACGCGCCTT = 220 reads: +439 validated
umi CGCACCTTTA = 265 reads: +37 -1XX +2 -1 +3 -1 +343 -1XX +1 -3XX +1 -4X +1 -7X +33 invalidated
umi TCCCTTGGCA = 36 reads: +365 -47 +27 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 33 umis using 1857 reads
cdr3 = CQQYNKWPRTF at 357, score = 9 + 8
umis assigned: [57, 79, 95, 99, 105, 131, 140, 158, 207, 235] and 26 others
of which 36 are surviving nonsolos
reads assigned: 12543
start codons at 36, 105, 241, 244, 460
confident = true

TIG 2[bases=621]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=13)
470-519 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
519-621 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 27 reads
cdr3 = CARELVATRRVGAYYYYGMDVW at 422, score = 9 + 7
umis assigned: [84, 310, 452, 790]
of which 4 are surviving nonsolos
reads assigned: 733
start codons at 80, 236, 383, 476, 537, 598
confident = true
now this is a cell
paired!

TACTGTGCGAGAGAACTTGTAGCGACTCGCCGGGTTGGGGCATACTATTATTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAAGTGGCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1378 = GACCTGGCATCACCCT-1

using 5904 reads

====================================================================================

graph has 3221 edges initially, 70 edges after simplification

total ucounts = 899
nonsolo ucounts = 413[2^167, 3^109, 4^49, 5^26, 6^12, 7^10, 8^10, 9^4, 10^3, 11^2, 12^2, 13^2, 14^2, 16, 17, 24, 143, 241, 305, 318, 329, 332, 350, 356, 359, 400, 408, 445]
surviving nonsolo ucounts = 14[10, 14, 143, 241, 305, 318, 329, 332, 350, 356, 359, 400, 408, 445]
ids = [117, 109, 250, 785, 867, 300, 677, 195, 891, 184, ...]

====================================================================================

UMI info for barcode GACCTGGCATCACCCT-1 contig 1 = GCTCTGCTTC...
umi ACTGTATCGT = 8 reads: +37 -6X +60 -4 +2 -1 +47 -34 +101 -30 +9 -1 +45 -17 invalidated
umi AGATTGCGGG = 10 reads: +98 -2 +143 -151 non-validated
umi TGCACTCCGA = 233 reads: +394 validated

UMI info for barcode GACCTGGCATCACCCT-1 contig 2 = GGAGTCTCCC...
umi CCACACCCTC = 139 reads: +421 validated
umi TTGTAGTCCT = 302 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=575]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-575 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGYYVF at 375, score = 8 + 8
umis assigned: [109, 117, 785]
of which 3 are surviving nonsolos
reads assigned: 249
start codons at 51, 205, 208, 259, 358, 385, 409
confident = true

TIG 2[bases=551]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
427-480 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARQRGLGTYYGMDVW at 401, score = 8 + 7
umis assigned: [250, 867]
of which 2 are surviving nonsolos
reads assigned: 437
start codons at 59, 233, 257, 392, 437
confident = true

REJECT CONTIGS

TIG 1[bases=509]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
36-374 ==> 0-338 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
373-509 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGTVAAPSVFIFPPSDEQLKS at 360, score = 9 + 4
umis assigned: [58, 69, 184, 195, 300, 677, 761, 827, 891]
of which 9 are surviving nonsolos
reads assigned: 3229
start codons at 36, 244, 370, 415
confident = false
not full
not full
now this is a cell
paired!

TCGGACACCGCCATGTATTACTGTGCGAGACAGAGGGGGCTGGGGACCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGCTATTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1414 = GACCTGGGTCGCGGTT-1

using 1295 reads

====================================================================================

graph has 1369 edges initially, 46 edges after simplification

total ucounts = 514
nonsolo ucounts = 198[2^84, 3^48, 4^23, 5^20, 6^8, 7^4, 8^6, 9^4, 315]
surviving nonsolo ucounts = 1[315]
ids = [38]

====================================================================================

REJECT CONTIGS

TIG 1[bases=530]
3-73 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
357-394 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=17)
394-530 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [38]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 25, 31, 100, 182, 236, 436
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1420 = GACCTGGGTCTGCGGT-1

using 455 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 199, 246]
surviving nonsolo ucounts = 2[199, 246]
ids = [7, 1]

====================================================================================

UMI info for barcode GACCTGGGTCTGCGGT-1 contig 1 = TGAGCGCAGA...
umi ATTACATGTC = 240 reads: +388 validated

UMI info for barcode GACCTGGGTCTGCGGT-1 contig 2 = AGTCCCACTC...
umi TCATGCCCCG = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=1)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=11)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
424-509 ==> 0-85 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CGTWDRSLSAEVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 36, 190, 241, 365
confident = false

TIG 2[bases=495]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-495 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1437 = GACCTGGGTTAGGGTG-1

using 246 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 5, 229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================

UMI info for barcode GACCTGGGTTAGGGTG-1 contig 1 = AGCTTCAGCT...
umi AGGCTTCGTG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-530 ==> 0-95 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1438 = GACCTGGGTTATGCGT-1

using 461 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^3, 12, 434]
surviving nonsolo ucounts = 2[12, 434]
ids = [10, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1448 = GACCTGGTCAACGAAA-1

using 203 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================

UMI info for barcode GACCTGGTCAACGAAA-1 contig 1 = GCTGGGGTCT...
umi GGCAGGGCAC = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
429-480 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTVVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1451 = GACCTGGTCACATACG-1

using 288 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [0]

====================================================================================

UMI info for barcode GACCTGGTCACATACG-1 contig 1 = GGAACTGCTC...
umi TTTTATCAGT = 258 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=439]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-360 ==> 0-329 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-439 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQRRLWYTF at 352, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 31, 236, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1463 = GACCTGGTCATTGCGA-1

using 863 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 9[2^6, 3, 267, 571]
surviving nonsolo ucounts = 2[267, 571]
ids = [1, 2]

====================================================================================

UMI info for barcode GACCTGGTCATTGCGA-1 contig 1 = TGGGGAGGAA...
umi ACTCAAATTG = 269 reads: +388 validated
umi ACTGTGAACT = 574 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 153 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 831
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1470 = GACCTGGTCCACGCAG-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1476 = GACCTGGTCCGAAGAG-1

using 371 reads

====================================================================================

graph has 146 edges initially, 26 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 155, 208]
surviving nonsolo ucounts = 2[155, 208]
ids = [7, 1]

====================================================================================

UMI info for barcode GACCTGGTCCGAAGAG-1 contig 1 = GGGAGGAATC...
umi GGCCTTCTCT = 143 reads: +386 -1 +1 non-validated

UMI info for barcode GACCTGGTCCGAAGAG-1 contig 2 = GGGAGGAATC...
umi AGTTAATGTG = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-471 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 30, 36, 92, 105, 241, 460
confident = false

TIG 2[bases=471]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-471 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1477 = GACCTGGTCCTAGGGC-1

using 47549 reads

====================================================================================

graph has 13937 edges initially, 194 edges after simplification

total ucounts = 1432
nonsolo ucounts = 747[2^258, 3^125, 4^76, 5^48, 6^31, 7^19, 8^19, 9^6, 10^4, 11^4, 12^4, 13^3, 14^2, 15^2, 19, 20, 21, 26^2, 27, 28, 33, 34, 35^2, 36, 37, 42, 46, 51, 56^2, 67^2, 69, 76^3, 79, 81, 82, 91, 96, 114, 115, 119, 120, 121, 147, 150^2, 151, 156, 157, 158, 163, 164, 168, 175, 177, 179, 180, 193, 196, 208, 210, 213, 216^2, 217, 218, 221, 225, 230, 233^3, 243, 244^2, 246, 247, 250, 251^2, 254^2, 255, 258, 264^2, 269, 270, 271, 272, 273^3, 277, 284, 288, 289, 290, 293, 303, 305, 306, 309, 310, 313, 318, 320^2, 324, 329, 332, 338, 340, 341^2, 345^2, 347, 349, 364, 365, 373, 394, 438, 450, 461, 466, 475, 477, 492, 493, 508, 523, 524, 546, 568, 576, 586, 601, 615, 627, 631, 636, 682, 696, 705, 723^2, 764, 769, 780, 1184, 1280, 1353, 1531]
surviving nonsolo ucounts = 129[12, 19, 36, 51, 56, 67, 69, 76^2, 79, 81, 82, 91, 96, 115, 120, 121, 147, 150^2, 151, 156, 157, 158, 163, 164, 168, 175, 177, 179, 180, 193, 196, 208, 210, 213, 216^2, 217, 218, 221, 225, 230, 233^3, 243, 244^2, 246, 247, 250, 251^2, 254^2, 255, 258, 264^2, 269, 270, 271, 272, 273^3, 277, 284, 288, 289, 290, 293, 303, 305, 306, 309, 310, 313, 318, 320^2, 324, 329, 332, 338, 340, 341^2, 345^2, 347, 349, 364, 365, 373, 394, 438, 450, 461, 466, 475, 477, 492, 493, 508, 523, 524, 546, 568, 576, 586, 601, 615, 627, 631, 636, 682, 696, 705, 723^2, 764, 769, 780, 1184, 1280, 1353, 1531]
ids = [1189, 326, 1252, 909, 1366, 280, 566, 684, 960, 603, ...]

====================================================================================

UMI info for barcode GACCTGGTCCTAGGGC-1 contig 1 = TGAGCGCAGA...
umi ACGGTCCGGC = 228 reads: +388 validated
umi ACTTGTCACG = 161 reads: +388 validated
umi AGCGCCTCTT = 250 reads: +388 validated
umi AGGACCTTGT = 46 reads: +47 -2X +167 -10 +162 invalidated
umi AGGTCATGGT = 310 reads: +388 validated
umi AGGTGCCGTT = 251 reads: +388 validated
umi AGGTTTTTGT = 238 reads: +388 validated
umi ATACTTTATG = 439 reads: +388 validated
umi ATCTCCGCCA = 166 reads: +388 validated
umi ATCTCCGCCT = 264 reads: +388 validated
umi CAAGTACGCC = 214 reads: +388 validated
umi CAGGCACGTC = 347 reads: +388 validated
umi CATTCCTCAA = 319 reads: +388 validated
umi CCCGTTAATA = 79 reads: +388 validated
umi CGACACCTTC = 268 reads: +388 validated
umi CGGCGACCGC = 146 reads: +388 validated
umi CTAGATCCCT = 215 reads: +388 validated
umi GCACTACAAG = 245 reads: +388 validated
umi GCATATCTAT = 146 reads: +356 -1 +8 -23 non-validated
umi GGTGGGAATC = 72 reads: +388 validated
umi GTAGGGTCCT = 695 reads: -340X +1 -9XX +1 -2XX +3 -1XX +16 -1XX +14 invalidated
umi GTCAACGAGC = 162 reads: +388 validated
umi GTCTATGTGT = 162 reads: +388 validated
umi GTTTATCACG = 285 reads: +388 validated
umi GTTTTTTGGA = 156 reads: +388 validated
umi TAACTTTCGG = 1199 reads: -363X +25 invalidated
umi TACAATCCTT = 264 reads: +388 validated
umi TACTTTGCTT = 215 reads: +388 validated
umi TATAACGCCT = 192 reads: +388 validated
umi TTATGTTACA = 248 reads: +388 validated
umi TTCATTTCAG = 178 reads: +388 validated
umi TTCCCTGCAG = 57 reads: +388 validated
umi TTGAACTGTA = 300 reads: +388 validated
umi TTGGACCCGG = 271 reads: +388 validated
umi TTTTGTCGGG = 229 reads: +388 validated

UMI info for barcode GACCTGGTCCTAGGGC-1 contig 2 = GGGAGAGGAG...
umi AGCCTGTATA = 160 reads: +424 validated
umi AGCGCCAGTG = 158 reads: +120 -1XX +303 invalidated
umi AGGCACACTT = 201 reads: +424 validated
umi AGTATATCTA = 251 reads: +424 validated
umi AGTGCACACT = 18 reads: -7 +196 -221 non-validated
umi ATGGCATTCG = 274 reads: +424 validated
umi CACACTGTTA = 112 reads: +424 validated
umi CAGGCACGGT = 66 reads: -371X +1 -1 +1 -3XX +2 -1X +1 -5XX +1 -2X +1 -5XX +2 -1X +26 invalidated
umi CATTAGGTTT = 72 reads: +371 -1 +52 non-validated
umi CGGTCTCTTA = 77 reads: +424 validated
umi CTCCGGTCTA = 324 reads: +424 validated
umi CTTCACTCCA = 181 reads: +414 -10 non-validated
umi CTTGAACCCT = 218 reads: +388 -36 non-validated
umi GAACAAACGT = 91 reads: +424 validated
umi GAAGGGCCAT = 247 reads: +424 validated
umi GATAATCCCG = 216 reads: +424 validated
umi GGACCTTAGT = 43 reads: -395X +2 -2 +25 invalidated
umi GGCGTAGCAC = 270 reads: -156X +268 invalidated
umi GTATGTTGCC = 80 reads: +379 -9 +36 non-validated
umi TACGACTCCA = 86 reads: -382 +1 -1X +3 -2X +9 -1X +2 -1X +3 -2X +17 invalidated
umi TCGGATCGTT = 12 reads: -35 +163 -9 +2 -2 +5 -1 +6 -1 +8 -1 +26 -1 +3 -10 +56 -24 +53 -1 +2 -15 non-validated
umi TCTGCGTCGT = 321 reads: -379X +1 -2X +1 -2X +1 -3X +5 -2 +2 -1X +2 -1XX +3 -2XX +17 invalidated
umi TGATTGATCG = 36 reads: +393 -5 +26 non-validated
umi TTCTTCCTCA = 301 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 32 umis using 1023 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [195, 226, 271, 280, 290, 295, 300, 357, 389, 390] and 25 others
of which 35 are surviving nonsolos
reads assigned: 8886
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=569]
0-74 ==> 6-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=1)
74-433 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=13)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 204 reads
cdr3 = CTICGGRCPPRFDYW at 422, score = 9 + 7
umis assigned: [267, 270, 283, 311, 326, 407, 487, 523, 566, 684] and 14 others
of which 24 are surviving nonsolos
reads assigned: 3756
start codons at 74, 127, 225, 230, 297, 354, 383
confident = true

REJECT CONTIGS

TIG 1[bases=589]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=13)
378-589 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2, 40, 118, 172, 197, 324, 399, 428, 468, 534] and 23 others
of which 33 are surviving nonsolos
reads assigned: 19417
start codons at 38, 177, 239, 246, 372
confident = false
did not find CDR3

TIG 2[bases=543]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-27 ==> 5973-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-27 ==> 5269-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-27 ==> 782-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-27 ==> 9983-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-27 ==> 786-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
27-187 ==> 0-160 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
190-366 ==> 160-336 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5, 29, 66, 106, 256, 287, 317, 588, 1090, 1129] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3760
start codons at 27, 33, 89, 102, 241, 244, 337, 449
confident = false
see insertion of GAA at pos 160 on |233|IGKV1-5|L-REGION+V-REGION|
did not find CDR3

TIG 3[bases=561]
0-77 ==> 5776-5853 on rc of segment after IGKV1OR9-1 exon 1 [len=6000] (mis=8)
25-86 ==> 5676-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
38-389 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=7)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [93, 127, 185, 354, 387, 422, 558, 564, 749, 764] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5890
start codons at 38, 44, 100, 113, 148, 249, 467
confident = false
did not find CDR3
now this is a cell
paired!

ACCGAGGACACAGCCGTGTATTACTGTACTATCTGTGGTGGTCGCTGCCCGCCCCGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGACTCCAGATTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTGGTATTCGGCGGAGGGACCAGGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1487 = GACCTGGTCGGCATCG-1

using 500 reads

====================================================================================

graph has 190 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 9, 193, 290]
surviving nonsolo ucounts = 2[193, 290]
ids = [2, 6]

====================================================================================

UMI info for barcode GACCTGGTCGGCATCG-1 contig 1 = GATCAGGACT...
umi CTACGTGAGC = 178 reads: +397 validated
umi GTGCTGTCTT = 24 reads: -327X +1 -1X +10 -3XX +3 -2XX +1 -6XX +1 -3XX +1 -1XX +26 -1XX +10 invalidated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-508 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 197
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1489 = GACCTGGTCGGTTAAC-1

using 328 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode GACCTGGTCGGTTAAC-1 contig 1 = GATCAGGACT...
umi CCCTTCAGTA = 311 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
427-495 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CMQALQTPCSF at 366, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1498 = GACCTGGTCTGACCTC-1

using 52 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 6, 9, 32]
surviving nonsolo ucounts = 1[32]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1502 = GACCTGGTCTGCTTGC-1

using 713 reads

====================================================================================

graph has 222 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 4, 108, 223, 373]
surviving nonsolo ucounts = 3[108, 223, 373]
ids = [7, 6, 0]

====================================================================================

UMI info for barcode GACCTGGTCTGCTTGC-1 contig 1 = GGAGTCAGAC...
umi AACCAGTGGC = 373 reads: +382 validated
umi TAGGCTTTCC = 220 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 96 reads
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 587
start codons at 26, 32, 88, 101, 237, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1510 = GACCTGGTCTTTAGTC-1

using 470 reads

====================================================================================

graph has 212 edges initially, 34 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3, 4^2, 207, 244]
surviving nonsolo ucounts = 2[207, 244]
ids = [7, 2]

====================================================================================

UMI info for barcode GACCTGGTCTTTAGTC-1 contig 1 = GCTCTGCTTC...
umi AGGTTCATCT = 247 reads: +394 validated

UMI info for barcode GACCTGGTCTTTAGTC-1 contig 2 = CAGCTGTGGG...
umi CCAGCTCGCA = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-507 ==> 0-62 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=462]
0-42 ==> 72-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
42-395 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-462 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAAWDDSLNGVVF at 363, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 42, 346, 371, 376, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1511 = GACGCGTAGACCTTTG-1

using 91 reads

====================================================================================

graph has 42 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[39, 49]
surviving nonsolo ucounts = 2[39, 49]
ids = [4, 3]

====================================================================================

UMI info for barcode GACGCGTAGACCTTTG-1 contig 1 = AATCTCCAGC...
umi TAGTGTCCCT = 50 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=451]
10-318 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
360-398 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
398-451 ==> 0-53 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CVAWDDSLYAWVF at 331, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 10, 314, 344, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1512 = GACGCGTAGACTACAA-1

using 93 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[93]
surviving nonsolo ucounts = 1[93]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=309]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-309 ==> 0-276 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 33, 241
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1518 = GACGCGTAGCACAGGT-1

using 137 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[134]
surviving nonsolo ucounts = 1[134]
ids = [3]

====================================================================================

UMI info for barcode GACGCGTAGCACAGGT-1 contig 1 = GGAGGAACTG...
umi TTCGGTTCGG = 137 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYNNWPPPYTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 34, 103, 239, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1523 = GACGCGTAGCTTCGCG-1

using 130 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[128]
surviving nonsolo ucounts = 1[128]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTAGCTTCGCG-1 contig 1 = GTCAGGACAC...
umi AGCGTATGCC = 128 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
13-366 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
363-401 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQSYSTPLTF at 340, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 13, 19, 75, 88, 224, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1532 = GACGCGTAGTTAACGA-1

using 112 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[110]
surviving nonsolo ucounts = 1[110]
ids = [2]

====================================================================================

UMI info for barcode GACGCGTAGTTAACGA-1 contig 1 = GGAATCAGTC...
umi TCCTCCTAGT = 102 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-508 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1534 = GACGCGTAGTTCCACA-1

using 62 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 1[62]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1539 = GACGCGTCAAGTCTAC-1

using 135 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 1[135]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTCAAGTCTAC-1 contig 1 = GAGGAACTGC...
umi CGCCAAGGCT = 114 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=498]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-498 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQRSNGLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 33, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1540 = GACGCGTCAATAAGCA-1

using 172 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 158]
surviving nonsolo ucounts = 2[2, 158]
ids = [6, 7]

====================================================================================

UMI info for barcode GACGCGTCAATAAGCA-1 contig 1 = GAGTCAGACT...
umi TTTTATTTGT = 1 reads: -162 +3 -3 +1 -1 +4 -1 +8 -1 +3 -1 +4 -1 +1 -2 +7 -2 +1 -1 +6 -2X +1 -172X invalidated
umi TTTTTTTGGT = 2 reads: -163 +56 -33 +56 -80 non-validated
umi TTTTTTTTGG = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [5, 6, 7]
of which 2 are surviving nonsolos
reads assigned: 157
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1543 = GACGCGTCACCAGCAC-1

using 54 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 47]
surviving nonsolo ucounts = 1[47]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1554 = GACGCGTCAGCGAACA-1

using 305 reads

====================================================================================

graph has 104 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 123, 175]
surviving nonsolo ucounts = 2[123, 175]
ids = [3, 5]

====================================================================================

UMI info for barcode GACGCGTCAGCGAACA-1 contig 1 = AGAGCTCTGG...
umi TAGGAAATCG = 170 reads: +382 validated

UMI info for barcode GACGCGTCAGCGAACA-1 contig 2 = GGGACTGATC...
umi ATTTTGCAGT = 124 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNNWPYTF at 365, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 44, 113, 249, 468
confident = false

TIG 2[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=4)
397-436 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CMRAPQTPPYTF at 372, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1565 = GACGCGTCATTAGCCA-1

using 256 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[101, 154]
surviving nonsolo ucounts = 2[101, 154]
ids = [1, 2]

====================================================================================

UMI info for barcode GACGCGTCATTAGCCA-1 contig 1 = GCTTTTCTGA...
umi CCCTTTTCCG = 96 reads: +445 validated

UMI info for barcode GACGCGTCATTAGCCA-1 contig 2 = GGGGAGGAAC...
umi TTCCACGGAC = 139 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=6)
397-417 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
414-460 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
460-513 ==> 0-53 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARRFGGYSYGPHDYW at 381, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 15, 24, 36, 80, 409, 418
confident = false

TIG 2[bases=484]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-484 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYINWPPGDTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 36, 105, 241, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1569 = GACGCGTCATTTGCCC-1

using 381 reads

====================================================================================

graph has 422 edges initially, 8 edges after simplification

total ucounts = 183
nonsolo ucounts = 54[2^30, 3^9, 4^6, 5^2, 6^2, 7^2, 9, 13, 83]
surviving nonsolo ucounts = 1[83]
ids = [66]

====================================================================================

UMI info for barcode GACGCGTCATTTGCCC-1 contig 1 = AGGAGTCAGT...
umi CCTGCGCTCT = 78 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-475 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYTTPWTF at 354, score = 9 + 8
umis assigned: [66]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1573 = GACGCGTGTATAATGG-1

using 295 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[24, 264]
surviving nonsolo ucounts = 2[24, 264]
ids = [1, 3]

====================================================================================

UMI info for barcode GACGCGTGTATAATGG-1 contig 1 = GCTCCAAACA...
umi CGTTGCCAGT = 22 reads: +83 -30 +275 non-validated
umi CTTAGAACTT = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=591]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-591 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 265
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1574 = GACGCGTGTATATGGA-1

using 272 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTGTATATGGA-1 contig 1 = AGCTCAGGAA...
umi TCCACTAAGC = 247 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-33 ==> 53-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
33-386 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=1)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
424-583 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDSSNRWVF at 360, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 33, 96, 187, 238, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1577 = GACGCGTGTATTCTCT-1

using 205 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 197]
surviving nonsolo ucounts = 1[197]
ids = [3]

====================================================================================

UMI info for barcode GACGCGTGTATTCTCT-1 contig 1 = AGGAATCAGT...
umi CGTTGGGTCT = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1578 = GACGCGTGTCAAACTC-1

using 23023 reads

====================================================================================

graph has 6462 edges initially, 120 edges after simplification

total ucounts = 475
nonsolo ucounts = 217[2^57, 3^19, 4^20, 5^9, 6^7, 7^4, 8^4, 9^2, 10^3, 13, 15, 16, 17, 24, 41, 45, 46, 72, 95, 108, 113, 125, 132, 137, 158, 164, 170, 178, 179, 205, 206, 212, 214, 218, 219^2, 225^2, 228, 229, 232, 235^2, 238^2, 239, 244, 245, 247, 249, 254, 256, 257, 259, 260, 261, 262, 263, 265, 267^2, 270, 272, 274, 275, 279, 280, 282^2, 284^2, 285, 286^2, 287, 288, 290, 291, 293, 294, 295, 301, 310^2, 311, 313, 324, 325^2, 326, 337, 348, 355, 357, 368, 370, 386, 390, 410, 456, 499]
surviving nonsolo ucounts = 81[41, 95, 113, 125, 132, 137, 164, 170, 178, 179, 205, 206, 212, 214, 218, 219, 225^2, 228, 229, 232, 235^2, 238^2, 239, 244, 245, 247, 249, 254, 256, 257, 259, 260, 261, 262, 263, 265, 267^2, 270, 272, 274, 275, 279, 280, 282^2, 284^2, 285, 286^2, 287, 288, 290, 291, 293, 294, 295, 301, 310^2, 311, 313, 324, 325^2, 326, 337, 348, 355, 357, 368, 370, 386, 390, 410, 456, 499]
ids = [301, 378, 219, 277, 194, 163, 161, 233, 124, 372, ...]

====================================================================================

UMI info for barcode GACGCGTGTCAAACTC-1 contig 1 = GGGGAGAAGT...
umi AAAATAGGAC = 207 reads: +388 validated
umi AAATACCCGA = 409 reads: +388 validated
umi AAATTAGTGG = 332 reads: +388 validated
umi AACCGTTCCG = 179 reads: +17 -1XX +14 -1XX +8 -1XX +10 -1XX +2 -1XX +1 -1XX +82 -1XX +6 -1XX +9 -2XX +6 -3XX +25 -2XX +28 -1XX +7 -3XX +11 -2XX +49 -1XX +5 -1XX +9 -1XX +10 -1XX +5 -18 +3 -2XX +11 -3XX +8 -1XX +5 -1XX +7 invalidated
umi AACGTTGCTT = 374 reads: +388 validated
umi AACTGCACAC = 263 reads: +388 validated
umi AATCGATGGC = 456 reads: +388 validated
umi ACAAACAGCA = 225 reads: +118 -1XX +269 invalidated
umi ACATAATAGC = 240 reads: +388 validated
umi ACCCGACTGC = 312 reads: +388 validated
umi ACGCCACGTT = 326 reads: +388 validated
umi ACTGCGTCAC = 292 reads: +388 validated
umi ACTTCTTGGA = 287 reads: +388 validated
umi ATTACACGTG = 229 reads: +388 validated
umi ATTACATCGA = 313 reads: +388 validated
umi ATTCCAAGGA = 287 reads: +388 validated
umi ATTTAGCTCG = 237 reads: +388 validated
umi CAACTTCCCT = 243 reads: +388 validated
umi CAGATGGGCA = 165 reads: +388 validated
umi CAGCCCACAG = 256 reads: +388 validated
umi CATTCCGCTC = 229 reads: +388 validated
umi CCAACTACTA = 352 reads: +388 validated
umi CCCTTTGGTC = 290 reads: +388 validated
umi CCTAGCCCTT = 131 reads: +388 validated
umi CGAAAGTATT = 248 reads: +388 validated
umi CGAGAAAGCC = 285 reads: +388 validated
umi CGGCTCCGGA = 232 reads: +388 validated
umi CGTTCCTATA = 350 reads: +388 validated
umi CTACGCCGTT = 285 reads: +388 validated
umi GACGGCGTAC = 263 reads: +388 validated
umi GATAACCACA = 230 reads: +388 validated
umi GCAGCCGTGC = 125 reads: +388 validated
umi GCGCAACTGT = 294 reads: +388 validated
umi GCTGCAGACC = 332 reads: +388 validated
umi GGAGCCGCTT = 240 reads: +388 validated
umi GGCGCTGTGT = 218 reads: +388 validated
umi GGTCATTGCT = 287 reads: +388 validated
umi TCCGTACTCT = 272 reads: +388 validated
umi TCGAAGTCGT = 254 reads: +388 validated
umi TCGCAATGCA = 322 reads: +388 validated
umi TGAATTGTGT = 324 reads: +388 validated
umi TGGACTATGG = 257 reads: +388 validated
umi TTTAAATGCG = 277 reads: +388 validated
umi TTTCGTTGCT = 313 reads: +388 validated

UMI info for barcode GACGCGTGTCAAACTC-1 contig 2 = AGCTCTGGGA...
umi AAAGCCGCTT = 265 reads: +433 validated
umi ATGCGGGTTC = 251 reads: +433 validated
umi CGTAAAGCAT = 101 reads: +424 -9 non-validated
umi CTCCTCTGCA = 169 reads: +397 -1 +3 -6 +26 non-validated
umi GCTTAATTCT = 42 reads: +384 -45 +4 non-validated
umi GTGTTTGTCT = 248 reads: +433 validated
umi TAGTTCCTCT = 164 reads: +433 validated
umi TATGCCCGGT = 93 reads: +370 -63 non-validated
umi TGAATCTTCT = 207 reads: +433 validated
umi TTTTGCTTTA = 283 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 43 umis using 1799 reads
cdr3 = CQKYNSAPLTF at 358, score = 9 + 9
umis assigned: [6, 12, 16, 22, 26, 29, 47, 53, 59, 67] and 34 others
of which 43 are surviving nonsolos
reads assigned: 11845
start codons at 31, 37, 93, 106, 242, 341, 461
confident = true

TIG 2[bases=584]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=9)
433-464 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=3)
460-513 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 90 reads
cdr3 = CAGGYYYDSSGYLYYGMDVW at 422, score = 9 + 7
umis assigned: [9, 122, 219, 233, 301, 346, 372, 378, 423, 473]
of which 10 are surviving nonsolos
reads assigned: 1796
start codons at 80, 236, 383, 441, 470
confident = true

REJECT CONTIGS

TIG 1[bases=546]
3-98 ==> 5645-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
47-369 ==> 0-322 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CNFQGTF at 361, score = 3 + 8
umis assigned: [0, 49, 78, 103, 110, 123, 124, 144, 155, 209] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7202
start codons at 47, 53, 109, 122, 354, 452
confident = false
not full
frameshifted full length transcript of length 546
VJ delta = 26
not full
now this is a cell
paired!

GTGTATTACTGTGCGGGAGGATATTACTATGATAGTAGTGGTTATCTCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1588 = GACGCGTGTCGGGTCT-1

using 5668 reads

====================================================================================

graph has 2314 edges initially, 38 edges after simplification

total ucounts = 313
nonsolo ucounts = 143[2^50, 3^22, 4^14, 5^8, 6^6, 7^7, 8^4, 9^5, 10^2, 11^2, 13^2, 16, 35, 71, 134, 163, 183, 197, 199, 203, 208, 211, 214, 215, 223, 245, 253, 295, 328, 429, 532, 652]
surviving nonsolo ucounts = 18[35, 71, 163, 183, 197, 199, 203, 208, 211, 214, 223, 245, 253, 295, 328, 429, 532, 652]
ids = [273, 306, 80, 37, 209, 293, 189, 246, 42, 109, ...]

====================================================================================

UMI info for barcode GACGCGTGTCGGGTCT-1 contig 1 = TATACGGGGG...
umi ACGGATTAGC = 183 reads: +394 validated
umi ACTAAGGCGT = 213 reads: +394 validated
umi ATTCGCTCCT = 164 reads: +394 validated
umi CCCACGCCAT = 217 reads: +394 validated
umi CGTCTGCTGC = 293 reads: +394 validated
umi GCATCAATCA = 209 reads: +394 validated
umi GGGCACGCTT = 202 reads: +394 validated
umi TAACCAACCT = 54 reads: -4 +5 -1XX +3 -2XX +2 -2XX +7 -1XX +6 -1XX +4 -2XX +24 -3XX +4 -1XX +5 -2XX +4 -1XX +9 -1XX +1 -1XX +2 -1XX +1 -110 +1 -1XX +2 -1XX +3 -1XX +17 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +5 -1XX +12 -1 +1 -91 invalidated
umi TACTTTATGG = 212 reads: +394 validated
umi TCGTTCACGT = 226 reads: +394 validated
umi TCTGGTTTAC = 35 reads: +15 -21 +248 -18 +92 non-validated
umi TTCACCCCTT = 204 reads: +394 validated
umi TTTCCCTGGA = 71 reads: +394 validated

UMI info for barcode GACGCGTGTCGGGTCT-1 contig 2 = GGGGGCAAGA...
umi CGGCTAGCTT = 68 reads: -292X +150 invalidated
umi GGCCCCACTT = 324 reads: -20X +1 -3XX +2 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +396 invalidated
umi TGTACTTTCT = 429 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=652]
47-400 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
403-441 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
441-652 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 316 reads
cdr3 = CSSYTSSSTLNVVF at 371, score = 8 + 8
umis assigned: [37, 42, 80, 109, 141, 189, 209, 240, 246, 270] and 3 others
of which 12 are surviving nonsolos
reads assigned: 2238
start codons at 47, 204, 248, 255, 258, 402
confident = true

TIG 2[bases=525]
12-368 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
371-402 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=3)
403-454 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
454-525 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 129 reads
cdr3 = CAREGRYCSSTSCYSPNWFDPW at 357, score = 9 + 7
umis assigned: [137, 206, 285]
of which 3 are surviving nonsolos
reads assigned: 814
start codons at 12, 56
confident = true

REJECT CONTIGS

TIG 1[bases=642]
0-26 ==> 20-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
26-394 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=3)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-642 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [149, 157, 309]
of which 3 are surviving nonsolos
reads assigned: 1142
start codons at 26, 41, 50, 53, 78, 345, 348, 377
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCGAGAGAGGGTCGATATTGTAGTAGTACCAGCTGCTATTCCCCGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTAAATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1601 = GACGCGTGTTGCTCCT-1

using 342 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[341]
surviving nonsolo ucounts = 1[341]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTGTTGCTCCT-1 contig 1 = GAGCTGCTCA...
umi ACATTCCGCC = 343 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-366 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYRNSITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 30, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1604 = GACGCGTTCAAACCGT-1

using 195 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTTCAAACCGT-1 contig 1 = AGCCCTGGGA...
umi CCAGTTCTCT = 179 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=535]
0-60 ==> 19-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
60-413 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=32)
446-484 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
484-535 ==> 0-51 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARFRGAVGRDGIGVYW at 402, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 60, 211, 216, 277, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1606 = GACGCGTTCAACACGT-1

using 303 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 4, 293]
surviving nonsolo ucounts = 1[293]
ids = [2]

====================================================================================

UMI info for barcode GACGCGTTCAACACGT-1 contig 1 = GACTCCTGTG...
umi CAGATAGGGC = 272 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=527]
17-375 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-527 ==> 0-77 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 17, 61, 240, 243, 246, 332, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1609 = GACGCGTTCACATGCA-1

using 9911 reads

====================================================================================

graph has 9149 edges initially, 177 edges after simplification

total ucounts = 2140
nonsolo ucounts = 1526[2^315, 3^242, 4^165, 5^150, 6^106, 7^86, 8^95, 9^82, 10^54, 11^62, 12^40, 13^26, 14^22, 15^23, 16^15, 17^9, 18^10, 19^6, 20^6, 21^2, 22^4, 23^2, 24^2, 25, 46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1610 = GACGCGTTCACGATGT-1

using 397 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 386]
surviving nonsolo ucounts = 1[386]
ids = [2]

====================================================================================

UMI info for barcode GACGCGTTCACGATGT-1 contig 1 = AGAGCTCTGG...
umi CGCTCTACCG = 385 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQCTNWPCTF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 44, 110, 113, 249, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1615 = GACGCGTTCATAGCAC-1

using 312 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1623 = GACGCGTTCCCTAACC-1

using 8532 reads

====================================================================================

graph has 4326 edges initially, 86 edges after simplification

total ucounts = 834
nonsolo ucounts = 296[2^116, 3^70, 4^34, 5^14, 6^12, 7^8, 8^3, 9, 10^3, 11, 15, 17, 36, 79^2, 94, 113, 124, 130, 135, 145, 160, 182, 195, 198, 206, 218, 236^2, 242, 243, 245, 246, 260, 276, 287, 288, 308, 309, 311, 372, 376^2, 406]
surviving nonsolo ucounts = 29[36, 79^2, 94, 113, 135, 145, 182, 195, 198, 206, 218, 236^2, 242, 243, 245, 246, 260, 276, 287, 288, 308, 309, 311, 372, 376^2, 406]
ids = [492, 138, 583, 156, 807, 817, 443, 322, 502, 603, ...]

====================================================================================

UMI info for barcode GACGCGTTCCCTAACC-1 contig 1 = AGCTCTCAGA...
umi AAATGTCCCT = 207 reads: +415 validated
umi ACATCTTGCT = 216 reads: +415 validated
umi ATACTACGCC = 83 reads: +415 validated
umi ATGCATGATT = 312 reads: +415 validated
umi ATGTACTCTT = 210 reads: +415 validated
umi CGATAGTGCT = 204 reads: +415 validated
umi GCATAATACG = 397 reads: +415 validated
umi GCCCGAGTCA = 147 reads: +394 -1 +5 -2 +8 -1 +1 -1 +2 non-validated
umi GGCATTTGTC = 218 reads: +415 validated
umi GGCTCGAACG = 247 reads: +415 validated
umi TAAGTGAACC = 77 reads: +408 -1 +6 non-validated
umi TACTCGCTCT = 232 reads: +415 validated
umi TAGCATGTTG = 201 reads: +400 -15 non-validated
umi TATTTAACGC = 303 reads: +415 validated
umi TGCCTCCCGT = 233 reads: -345X +1 -5X +1 -3XX +1 -2XX +1 -3XX +1 -15XX +1 -1XX +35 invalidated
umi TTAGTGCCAC = 332 reads: +415 validated
umi TTTACTCTTC = 114 reads: +415 validated
umi TTTCTCAGTC = 135 reads: +415 validated
umi TTTTACTGAC = 275 reads: +415 validated

UMI info for barcode GACGCGTTCCCTAACC-1 contig 2 = AGGAGTCAGA...
umi AGTAGATCGT = 79 reads: -320X +1 -2X +1 -1X +1 -5X +1 -2X +1 -5X +1 -4X +1 -7X +38 invalidated
umi ATGACTCTCC = 258 reads: +391 validated
umi CGGAACAATC = 177 reads: -353X +38 invalidated
umi GATAAATCTG = 236 reads: +391 validated
umi GGAATGCGCT = 312 reads: +391 validated
umi GGCGATTCCT = 312 reads: +391 validated
umi GGGCTCTTAA = 35 reads: +2 -1 +8 -22 +193 -11 +154 non-validated
umi GTAACACTCC = 373 reads: +391 validated
umi GTGCAACATC = 244 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=565]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
448-494 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 17 umis using 371 reads
cdr3 = CARAHLSGWPHDYW at 421, score = 9 + 7
umis assigned: [8, 59, 156, 185, 191, 312, 434, 443, 481, 488] and 9 others
of which 19 are surviving nonsolos
reads assigned: 4040
start codons at 79, 235, 356, 382, 452
confident = true

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 256 reads
cdr3 = CQQYNSYSPWTF at 354, score = 8 + 8
umis assigned: [138, 180, 322, 416, 476, 483, 492, 509, 549]
of which 9 are surviving nonsolos
reads assigned: 2002
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGCCCATCTTAGTGGCTGGCCCCATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1625 = GACGCGTTCCCTCTTT-1

using 247 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 5, 12, 19, 204]
surviving nonsolo ucounts = 1[204]
ids = [7]

====================================================================================

UMI info for barcode GACGCGTTCCCTCTTT-1 contig 1 = CAGCACTAGA...
umi TGGCCCTCCG = 200 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=510]
0-61 ==> 19-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
61-350 ==> 0-289 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=22)
431-467 ==> 13-49 on |52|IGHJ3|J-REGION| [len=49] (mis=1)
467-510 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CVSGPTMEYVW at 403, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 61, 212, 217, 270, 278, 287, 296, 364, 421, 428, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1627 = GACGCGTTCCGCATCT-1

using 9163 reads

====================================================================================

graph has 3520 edges initially, 38 edges after simplification

total ucounts = 541
nonsolo ucounts = 226[2^99, 3^45, 4^15, 5^15, 6^7, 7^4, 8^2, 9^2, 12^3, 14^2, 17, 27, 65, 106, 133, 159, 161, 171, 173, 185, 203, 217, 219, 230, 244^2, 285, 286, 301, 309, 323, 324, 327, 334^2, 335, 336, 340, 349, 353, 403, 718]
surviving nonsolo ucounts = 28[106, 133, 159, 161, 173, 185, 203, 217, 219, 230, 244^2, 285, 286, 301, 309, 323, 324, 327, 334^2, 335, 336, 340, 349, 353, 403, 718]
ids = [441, 40, 273, 509, 399, 210, 472, 5, 479, 365, ...]

====================================================================================

UMI info for barcode GACGCGTTCCGCATCT-1 contig 1 = GGGGGAGTCA...
umi AAATAGTGAT = 218 reads: +385 validated
umi ACATGGCTCC = 134 reads: +385 validated
umi AGCTTGAACA = 347 reads: +385 validated
umi AGGAACCCTT = 288 reads: +385 validated
umi ATATACCTTA = 309 reads: +385 validated
umi ATCAAATACT = 327 reads: +385 validated
umi ATTTAATATG = 330 reads: +385 validated
umi CACAATCTCC = 332 reads: +385 validated
umi CGAAGTTCTA = 184 reads: +385 validated
umi CTCCGCCGGG = 338 reads: +385 validated
umi CTCGTTCGGG = 357 reads: +385 validated
umi CTCTTACTCG = 304 reads: +385 validated
umi CTGCTACTAT = 158 reads: +385 validated
umi GATACCCAGT = 240 reads: +385 validated
umi GATCCTCCTG = 401 reads: +385 validated
umi GGTTTTGGCG = 284 reads: +385 validated
umi GTAATAATCA = 227 reads: +385 validated
umi TATGCACCTC = 337 reads: +252 -1X +132 invalidated
umi TATTTAAGGT = 332 reads: +385 validated
umi TGAATAACTC = 206 reads: +385 validated
umi TGGCGTTGGA = 589 reads: -350 +2 -1XX +1 -1XX +1 -2XX +1 -2XX +3 -2XX +1 -1XX +4 -1XX +1 -2XX +2 -7XX invalidated
umi TGTTCTGTTC = 336 reads: +385 validated
umi TTGTATAGTA = 342 reads: +385 validated

UMI info for barcode GACGCGTTCCGCATCT-1 contig 2 = GGGAGAGGAG...
umi ACTTCATAGA = 239 reads: +421 validated
umi TACAATCAGA = 173 reads: +421 validated
umi TCAGAGGCCT = 103 reads: +249 -1 +171 non-validated
umi TGGCCCTCTA = 217 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=550]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 998 reads
cdr3 = CQQSYSIPSF at 356, score = 7 + 7
umis assigned: [5, 40, 80, 83, 100, 103, 128, 136, 210, 256] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6814
start codons at 29, 35, 91, 104, 240, 456
confident = true

TIG 2[bases=596]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=23)
445-494 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
494-596 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 51 reads
cdr3 = CARSRSTVTMNYGMDVW at 412, score = 9 + 7
umis assigned: [68, 399, 441, 479]
of which 4 are surviving nonsolos
reads assigned: 722
start codons at 73, 163, 229, 267, 373, 439, 451, 512, 573
confident = true
now this is a cell
paired!

GACACGGCCGTATATTACTGTGCGAGAAGTAGGTCAACGGTGACTATGAATTACGGAATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ACCATCAGCAATCTGGAAACTGAAGATTTTGCAAGTTACTACTGTCAACAGAGTTACAGTATCCCTTCTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1628 = GACGCGTTCCGTAGTA-1

using 263 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 255]
surviving nonsolo ucounts = 1[255]
ids = [5]

====================================================================================

UMI info for barcode GACGCGTTCCGTAGTA-1 contig 1 = CTCAGTTAGG...
umi TCACAGCAAG = 260 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=542]
0-24 ==> 28-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
24-372 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
368-406 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
406-542 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSFTF at 348, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 24, 232, 358, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1634 = GACGCGTTCGGCTACG-1

using 286 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode GACGCGTTCGGCTACG-1 contig 1 = GTCAGTCTCA...
umi AGGTAATATG = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1637 = GACGCGTTCGTCCAGG-1

using 7266 reads

====================================================================================

graph has 3144 edges initially, 62 edges after simplification

total ucounts = 352
nonsolo ucounts = 182[2^69, 3^40, 4^13, 5^6, 6^4, 7^2, 8^3, 11, 12^2, 15, 19, 26, 39, 60, 70, 83, 90, 95, 96, 100, 102, 107, 110, 116, 120, 132, 141, 144, 156, 164, 170, 171, 172, 178, 179, 185, 190, 202, 210, 213, 215, 218, 219, 221, 225, 233, 245^2, 270, 279, 434]
surviving nonsolo ucounts = 38[26, 39, 60, 70, 83, 90, 95, 100, 102, 110, 116, 120, 132, 141, 144, 156, 164, 170, 171, 172, 178, 179, 185, 190, 202, 210, 213, 215, 218, 219, 221, 225, 233, 245^2, 270, 279, 434]
ids = [182, 63, 64, 306, 144, 197, 73, 250, 61, 168, ...]

====================================================================================

UMI info for barcode GACGCGTTCGTCCAGG-1 contig 1 = CCTGGGTCAG...
umi ACTGTAACCT = 143 reads: +347 -1XX +1 -1XX +1 -1XX +1 -7XX +1 -4XX +1 -7XX +7 -1XX +4 invalidated
umi ATACATCCTT = 252 reads: +385 validated
umi ATACCTCCTA = 215 reads: +385 validated
umi ATCTATTGCT = 220 reads: +385 validated
umi CACCTTCCTT = 154 reads: +385 validated
umi CATCTGATGC = 189 reads: +385 validated
umi GCCTCCTCAA = 91 reads: +346 -1 +5 -10 +23 non-validated
umi GTTTCATTCT = 421 reads: +347 -1XX +1 -1XX +1 -1XX +1 -7XX +1 -4XX +1 -7XX +7 -1XX +4 invalidated
umi TATAGTCCGG = 212 reads: +347 -1XX +1 -1XX +1 -1XX +1 -9XX +3 -2 +1 -5X +7 -1XX +4 invalidated
umi TGAAGCTTAC = 174 reads: +385 validated
umi TGACGATCGC = 268 reads: +385 validated
umi TGGTGATATA = 229 reads: +385 validated
umi TTGACACCAA = 175 reads: +385 validated

UMI info for barcode GACGCGTTCGTCCAGG-1 contig 2 = GAGAGAGGAG...
umi AAGCTAATCG = 133 reads: +418 -1 +8 non-validated
umi AGAATCACAC = 121 reads: +384 -43 non-validated
umi AGGGGTTATT = 170 reads: +427 validated
umi AGTCGACTGA = 95 reads: +419 -8 non-validated
umi AGTCGTGGTT = 39 reads: +319 -61 +4 -1 +42 non-validated
umi AGTCGTGTTT = 61 reads: +352 -2 +15 -1 +1 -1 +7 -1 +10 -37 non-validated
umi ATAGCTTCGG = 97 reads: +403 -24 non-validated
umi ATATTGATAA = 187 reads: +149 -3X +275 invalidated
umi ATCTTTCGGC = 186 reads: +412 -1 +14 non-validated
umi CGGACTGGGC = 124 reads: +427 validated
umi CGGTCGTATG = 84 reads: +427 validated
umi GAATCCTCCC = 1 reads: -401 +16 -1 +3 -1 +5 non-validated
umi GATTAACGTC = 23 reads: +244 -1 +139 -1 +22 -20 non-validated
umi GCAACGTTTG = 222 reads: +427 validated
umi GCGTTCACTC = 235 reads: +14 -1 +1 -4X +2 -1XX +404 invalidated
umi GTTGGTCCTC = 103 reads: +354 -1 +3 -1 +4 -1 +10 -1 +52 non-validated
umi TCGTTTAGTG = 153 reads: +427 validated
umi TGCAAATTGG = 71 reads: +269 -5 +153 non-validated
umi TGGAAATGAC = 184 reads: +427 validated
umi TTACTCACGC = 223 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=573]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
400-437 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 273 reads
cdr3 = CQQYGSSPLTF at 376, score = 9 + 9
umis assigned: [46, 69, 70, 80, 100, 114, 197, 251, 273, 301] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2703
start codons at 52, 260, 386, 479
confident = true

TIG 2[bases=571]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
451-500 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 183 reads
cdr3 = CARGSRIAAAGGGRFDPW at 415, score = 9 + 7
umis assigned: [17, 48, 56, 61, 63, 64, 73, 74, 81, 141] and 10 others
of which 20 are surviving nonsolos
reads assigned: 2442
start codons at 73, 229, 376
confident = true
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGAGGGAGCCGTATAGCAGCAGCTGGTGGTGGGAGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1641 = GACGCGTTCTATCGCC-1

using 1175 reads

====================================================================================

graph has 466 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[6, 259, 903]
surviving nonsolo ucounts = 2[259, 903]
ids = [9, 8]

====================================================================================

UMI info for barcode GACGCGTTCTATCGCC-1 contig 1 = CACAGCATGG...
umi TATCGACCGC = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
6-357 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
356-394 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
394-483 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 333, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 6, 12, 81, 217, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1648 = GACGCGTTCTTCCTTC-1

using 31 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3, 4^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1652 = GACGGCTAGAATTCCC-1

using 182 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 8, 11, 157]
surviving nonsolo ucounts = 1[157]
ids = [1]

====================================================================================

UMI info for barcode GACGGCTAGAATTCCC-1 contig 1 = GTGGGCTCAG...
umi CACTAGCGTA = 142 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=533]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-533 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1659 = GACGGCTAGCACACAG-1

using 145 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[140]
surviving nonsolo ucounts = 1[140]
ids = [1]

====================================================================================

UMI info for barcode GACGGCTAGCACACAG-1 contig 1 = GATCAGGACT...
umi GCCATGTCAC = 116 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=447]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-447 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1662 = GACGGCTAGCCAGTAG-1

using 86 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 82]
surviving nonsolo ucounts = 1[82]
ids = [3]

====================================================================================

UMI info for barcode GACGGCTAGCCAGTAG-1 contig 1 = TCCCCTGAGA...
umi GTATCTTTTG = 62 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=465]
0-25 ==> 39-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
25-378 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
401-449 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
junction support: 1 umis using 10 reads
cdr3 = CARSLVSYSSSWIFDYW at 367, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 25, 223, 228, 260, 289, 322
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1682 = GACGGCTAGTCCTCCT-1

using 255 reads

====================================================================================

graph has 310 edges initially, 4 edges after simplification

total ucounts = 47
nonsolo ucounts = 34[2^7, 3^5, 4, 5^2, 6^5, 7^2, 8^3, 9, 10, 11, 12^2, 13^2, 22, 29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1683 = GACGGCTAGTCGATAA-1

using 506 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 499]
surviving nonsolo ucounts = 1[499]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1688 = GACGGCTAGTGTCTCA-1

using 379 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 6[2, 3, 4, 5^2, 345]
surviving nonsolo ucounts = 1[345]
ids = [1]

====================================================================================

UMI info for barcode GACGGCTAGTGTCTCA-1 contig 1 = CCACTCAGGA...
umi AACGTCTTGG = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
16-367 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
404-540 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 343, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 16, 22, 91, 227, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1689 = GACGGCTAGTGTGGCA-1

using 162 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 38
nonsolo ucounts = 29[2^7, 3, 4^7, 5^2, 6^2, 7^5, 8^2, 11^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1706 = GACGGCTCACATTCGA-1

using 103 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 97]
surviving nonsolo ucounts = 1[97]
ids = [3]

====================================================================================

UMI info for barcode GACGGCTCACATTCGA-1 contig 1 = ATCACATAAC...
umi CTTTCTACAT = 95 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=557]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-557 ==> 0-63 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 400, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1715 = GACGGCTCACTTCTGC-1

using 92 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 85]
surviving nonsolo ucounts = 1[85]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1717 = GACGGCTCAGCAGTTT-1

using 342 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[11, 325]
surviving nonsolo ucounts = 1[325]
ids = [2]

====================================================================================

UMI info for barcode GACGGCTCAGCAGTTT-1 contig 1 = AGGAGTCAGA...
umi CTTTTAGGGC = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-504 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNSYSYTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1718 = GACGGCTCAGCCAGAA-1

using 2703 reads

====================================================================================

graph has 3476 edges initially, 18 edges after simplification

total ucounts = 1188
nonsolo ucounts = 443[2^194, 3^100, 4^64, 5^40, 6^17, 7^8, 8^4, 9^3, 10^3, 11^3, 12^2, 14, 20, 21, 147, 308]
surviving nonsolo ucounts = 2[147, 308]
ids = [988, 822]

====================================================================================

UMI info for barcode GACGGCTCAGCCAGAA-1 contig 1 = GAGCTCTGAG...
umi TAAGATTTCC = 287 reads: +415 validated

UMI info for barcode GACGGCTCAGCCAGAA-1 contig 2 = GAGCTACAAC...
umi TCTATCATCG = 136 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=607]
80-431 ==> 0-351 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=52)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
495-607 ==> 0-112 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CARYAEAFSFFDSW at 422, score = 8 + 7
umis assigned: [822]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 80, 236, 383
confident = false

TIG 2[bases=488]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=18)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
433-488 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQYYSNPPHTF at 369, score = 9 + 8
umis assigned: [988]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 30, 99, 352, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1726 = GACGGCTCATACGCTA-1

using 278 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 269]
surviving nonsolo ucounts = 1[269]
ids = [6]

====================================================================================

UMI info for barcode GACGGCTCATACGCTA-1 contig 1 = GCTGGGGTCT...
umi GATCAGTCGT = 2 reads: -239 +4 -1 +1 -1 +1 -1 +2 -1 +3 -1 +5 -1 +1 -1 +1 -1 +4 -1X +8 -1 +2 -1 +1 -2 +1 -1 +2 -3X +3 -93 invalidated
umi GCTCCGTCGT = 270 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1732 = GACGGCTCATCCAACA-1

using 19 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1735 = GACGGCTCATCTCCCA-1

using 399 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[397]
surviving nonsolo ucounts = 1[397]
ids = [0]

====================================================================================

UMI info for barcode GACGGCTCATCTCCCA-1 contig 1 = AGCTTCAGCT...
umi AAGTCTTTCG = 387 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-589 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1737 = GACGGCTCATGAACCT-1

using 173 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 165]
surviving nonsolo ucounts = 1[165]
ids = [2]

====================================================================================

UMI info for barcode GACGGCTCATGAACCT-1 contig 1 = GGGATGCTTT...
umi CCACCTAACA = 153 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=538]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=37)
423-476 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=6)
476-538 ==> 0-62 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARPILARAGGMPAYFFDLW at 385, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 3, 19, 28, 40, 84, 164, 181, 418
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1748 = GACGGCTGTAGCCTCG-1

using 298 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 292]
surviving nonsolo ucounts = 1[292]
ids = [0]

====================================================================================

UMI info for barcode GACGGCTGTAGCCTCG-1 contig 1 = ATCAGTCCCA...
umi ACTAATGATG = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1749 = GACGGCTGTAGCGCTC-1

using 1017 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[296, 719]
surviving nonsolo ucounts = 2[296, 719]
ids = [1, 2]

====================================================================================

UMI info for barcode GACGGCTGTAGCGCTC-1 contig 1 = GGAGTCAGAC...
umi ATAGCCTCTT = 294 reads: +388 validated
umi GACTAGTGCA = 726 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 144 reads
cdr3 = CQQYDSYSCSF at 353, score = 8 + 7
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 1007
start codons at 26, 32, 88, 101, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1751 = GACGGCTGTCACCCAG-1

using 454 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 7, 12^2, 416]
surviving nonsolo ucounts = 1[416]
ids = [5]

====================================================================================

UMI info for barcode GACGGCTGTCACCCAG-1 contig 1 = GAGGAACTGC...
umi CGAAGCCTTG = 413 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNNWPPYTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 405
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1755 = GACGGCTGTCCATCCT-1

using 375 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[4, 5, 6, 7, 9, 339]
surviving nonsolo ucounts = 2[7, 339]
ids = [6, 2]

====================================================================================

UMI info for barcode GACGGCTGTCCATCCT-1 contig 1 = GAGCTGCTCA...
umi ATACCCCGGG = 341 reads: +382 validated
umi CCTGCCGCTC = 7 reads: -22 +56 -42 +60 -9 +11 -1 +11 -1 +9 -1 +15 -1 +6 -137 non-validated

GOOD CONTIGS

TIG 1[bases=548]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-367 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDRSWTF at 354, score = 9 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 342
start codons at 30, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1765 = GACGGCTGTGGTACAG-1

using 229 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 219]
surviving nonsolo ucounts = 1[219]
ids = [4]

====================================================================================

UMI info for barcode GACGGCTGTGGTACAG-1 contig 1 = GCTGCGGGTA...
umi TTGTATGGAT = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=639]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=2)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-639 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAAWDDSLNGVVF at 361, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 40, 191, 248, 251, 344, 369, 374, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1785 = GACGGCTTCAGCTGGC-1

using 170 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[170]
surviving nonsolo ucounts = 1[170]
ids = [0]

====================================================================================

UMI info for barcode GACGGCTTCAGCTGGC-1 contig 1 = GAGCTCTGGG...
umi GGTCGGTGAG = 164 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=583]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=3)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
459-510 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
510-583 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGAGYDFLSGHHWFDPW at 422, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 80, 236, 287, 294, 297, 315, 383, 564
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1788 = GACGGCTTCAGTTGAC-1

using 1924 reads

====================================================================================

graph has 2170 edges initially, 50 edges after simplification

total ucounts = 795
nonsolo ucounts = 304[2^152, 3^67, 4^30, 5^16, 6^14, 7^9, 8^8, 9^2, 10, 12, 17, 18, 180, 262]
surviving nonsolo ucounts = 2[180, 262]
ids = [644, 622]

====================================================================================

UMI info for barcode GACGGCTTCAGTTGAC-1 contig 1 = AGCTTCAGCT...
umi TCGTCATGCG = 169 reads: +388 validated

UMI info for barcode GACGGCTTCAGTTGAC-1 contig 2 = GAGAGAGGAG...
umi TCATGTACGT = 259 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [644]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=582]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-582 ==> 0-85 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [622]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1790 = GACGGCTTCATGTCCC-1

using 596 reads

====================================================================================

graph has 234 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 3^2, 274, 306]
surviving nonsolo ucounts = 2[274, 306]
ids = [1, 6]

====================================================================================

UMI info for barcode GACGGCTTCATGTCCC-1 contig 1 = GAGTCAGTCT...
umi TACACTTACG = 307 reads: +385 validated

UMI info for barcode GACGGCTTCATGTCCC-1 contig 2 = GCTTCAGCTG...
umi CGACCTATCC = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 25, 31, 87, 100, 236, 452
confident = false

TIG 2[bases=533]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-379 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
437-533 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSNANNLDGFVF at 370, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 46, 170, 200, 203, 353, 380, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1793 = GACGGCTTCCAAGTAC-1

using 313 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 307]
surviving nonsolo ucounts = 1[307]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=501]
0-36 ==> 5964-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=1)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=1)
0-36 ==> 5964-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=1)
9-50 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
28-82 ==> 0-54 on |294|IGKV3D-7|L-REGION+V-REGION| [len=359] (mis=0)
82-330 ==> 111-359 on |294|IGKV3D-7|L-REGION+V-REGION| [len=359] (mis=5)
326-365 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
365-501 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQDYNYPYTF at 304, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 28, 36, 188, 407
confident = false
not full
full length transcript of length 501
VJ delta = 74
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1796 = GACGGCTTCCCACTTG-1

using 1092 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[2, 1081]
surviving nonsolo ucounts = 1[1081]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1818 = GACGGCTTCTCTTGAT-1

using 191 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1824 = GACGTGCAGACAAAGG-1

using 204 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 9, 192]
surviving nonsolo ucounts = 1[192]
ids = [1]

====================================================================================

UMI info for barcode GACGTGCAGACAAAGG-1 contig 1 = GGGAATCAGT...
umi ATTGCCCTGC = 181 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=458]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=2)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-458 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLHHNSYPATWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 27, 33, 102, 184, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1830 = GACGTGCAGACTTTCG-1

using 103 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4^2, 93]
surviving nonsolo ucounts = 1[93]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1831 = GACGTGCAGAGAGCTC-1

using 168 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1837 = GACGTGCAGCCGGTAA-1

using 208 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[8, 36, 163]
surviving nonsolo ucounts = 2[36, 163]
ids = [0, 2]

====================================================================================

UMI info for barcode GACGTGCAGCCGGTAA-1 contig 1 = GTCAGTCCCA...
umi AGCCCACTCG = 1 reads: -35 +1 -2X +3 -1 +6 -2 +2 -2 +8 -2 +2 -1 +6 -1 +2 -1 +12 -1 +1 -291 invalidated
umi AGCCCCCTCT = 133 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=466]
29-277 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-466 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CLHYDNRRRTF at 350, score = 9 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1846 = GACGTGCAGGTTACCT-1

using 407 reads

====================================================================================

graph has 144 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[63, 148, 191]
surviving nonsolo ucounts = 3[63, 148, 191]
ids = [7, 4, 0]

====================================================================================

UMI info for barcode GACGTGCAGGTTACCT-1 contig 1 = GAAGAGCTGC...
umi AAAGGTACAG = 176 reads: +388 validated

UMI info for barcode GACGTGCAGGTTACCT-1 contig 2 = TCAGTGATCA...
umi TAAGTAGCAG = 147 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=465]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-465 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 33, 82, 241, 340, 381
confident = false

TIG 2[bases=528]
33-388 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=37)
423-457 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=3)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CAKDVSYTSSFYGIDHW at 375, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 33, 178, 184, 261, 268, 336, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1847 = GACGTGCAGTAAGTAC-1

using 192 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 185]
surviving nonsolo ucounts = 1[185]
ids = [0]

====================================================================================

UMI info for barcode GACGTGCAGTAAGTAC-1 contig 1 = AGCCTGGGCC...
umi ATCAGCCCAG = 174 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=543]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-386 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-543 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQAWDSSTAVVF at 355, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 40, 45, 101, 188, 334, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1850 = GACGTGCAGTGAATTG-1

using 207 reads

====================================================================================

graph has 80 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 5, 194]
surviving nonsolo ucounts = 2[5, 194]
ids = [1, 3]

====================================================================================

UMI info for barcode GACGTGCAGTGAATTG-1 contig 1 = AGGAGTCAGA...
umi ACCTTAATCT = 2 reads: -169 +10 -1XX +8 -2XX +20 -1XX +1 -3XX +5 -1XX +2 -1XX +1 -163 invalidated
umi GATAACCCGC = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQTDSFPRTF at 354, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 186
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1851 = GACGTGCAGTGCGTGA-1

using 174 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[174]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1852 = GACGTGCAGTGGAGTC-1

using 29 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1863 = GACGTGCCAATCCAAC-1

using 760 reads

====================================================================================

graph has 328 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 198, 267, 287]
surviving nonsolo ucounts = 3[198, 267, 287]
ids = [6, 7, 3]

====================================================================================

UMI info for barcode GACGTGCCAATCCAAC-1 contig 1 = ACCCAAAAAC...
umi CAGGGCTTCC = 286 reads: +436 validated

UMI info for barcode GACGTGCCAATCCAAC-1 contig 2 = AGTGCTTTCT...
umi GACGTGGTCA = 187 reads: +460 validated

UMI info for barcode GACGTGCCAATCCAAC-1 contig 3 = GGGCTGCTTC...
umi TATGGGTCCT = 254 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=526]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-526 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=490]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 23 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 17, 38, 82, 168
confident = false

TIG 3[bases=514]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=2)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-514 ==> 0-69 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGSYVF at 375, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1865 = GACGTGCCACAACGTT-1

using 284 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 5, 267]
surviving nonsolo ucounts = 1[267]
ids = [6]

====================================================================================

UMI info for barcode GACGTGCCACAACGTT-1 contig 1 = GAGACTCAGT...
umi GGTTGCAGCT = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
409-495 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNSYPLTF at 348, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 21, 27, 83, 96, 232, 235, 328, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1872 = GACGTGCCACCCTATC-1

using 156 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[156]
surviving nonsolo ucounts = 1[156]
ids = [0]

====================================================================================

UMI info for barcode GACGTGCCACCCTATC-1 contig 1 = GCTCTGCTTC...
umi GTCATGTATA = 148 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
445-556 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDSSLSGPWVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1874 = GACGTGCCACGTAAGG-1

using 352 reads

====================================================================================

graph has 134 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 92, 255]
surviving nonsolo ucounts = 2[92, 255]
ids = [4, 5]

====================================================================================

UMI info for barcode GACGTGCCACGTAAGG-1 contig 1 = GGGAATCAGT...
umi TCAGTAATCG = 93 reads: +3 -7XX +378 invalidated
umi TGCTCGTTCG = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 343
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1875 = GACGTGCCACTGTGTA-1

using 754 reads

====================================================================================

graph has 226 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[166, 269, 318]
surviving nonsolo ucounts = 3[166, 269, 318]
ids = [3, 0, 1]

====================================================================================

UMI info for barcode GACGTGCCACTGTGTA-1 contig 1 = GGGGAGGAAT...
umi ATCGTAGGAC = 269 reads: +388 validated
umi CTCGTAACTA = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 578
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1887 = GACGTGCCAGGGAGAG-1

using 112 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[107]
surviving nonsolo ucounts = 1[107]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1888 = GACGTGCCAGGGCATA-1

using 6503 reads

====================================================================================

graph has 3126 edges initially, 38 edges after simplification

total ucounts = 241
nonsolo ucounts = 121[2^44, 3^18, 4^15, 5^8, 6^3, 7^2, 9^2, 10, 13, 14^2, 17, 22, 51, 63, 121, 170, 209, 219, 234, 238, 240, 247, 258^2, 264, 267, 284, 292, 310, 313, 316, 329, 404, 418, 496]
surviving nonsolo ucounts = 21[63, 170, 209, 219, 234, 238, 240, 247, 258^2, 264, 267, 284, 292, 310, 313, 316, 329, 404, 418, 496]
ids = [118, 44, 54, 197, 137, 210, 47, 13, 19, 204, ...]

====================================================================================

UMI info for barcode GACGTGCCAGGGCATA-1 contig 1 = GGGATCACAC...
umi ACACCTGGAT = 246 reads: +424 validated
umi ACCGTATGCA = 262 reads: +424 validated
umi AGACTTCGCT = 282 reads: +424 validated
umi ATAAGTCTGG = 150 reads: +342 -1XX +81 invalidated
umi ATACCGCACT = 200 reads: +415 -9 non-validated
umi CGTTGTCTTT = 281 reads: +424 validated
umi CTAAGCCTCT = 315 reads: +424 validated
umi CTGTGGCGGT = 62 reads: +300 -1 +110 -1 +12 non-validated
umi GATCACATCC = 232 reads: +424 validated
umi GTGCTATGTT = 286 reads: +424 validated
umi TACAATGGGT = 267 reads: +413 -2 +9 non-validated

UMI info for barcode GACGTGCCAGGGCATA-1 contig 2 = GGAGGAACTG...
umi CGTTTCTTTT = 420 reads: +382 validated
umi CTTTACTCCT = 501 reads: +382 validated
umi TCCGCACCAA = 223 reads: +382 validated
umi TGCGGTTGCT = 236 reads: +382 validated
umi TTACTTTATA = 288 reads: +382 validated
umi TTTAGGGCGG = 264 reads: +382 validated

UMI info for barcode GACGTGCCAGGGCATA-1 contig 3 = GATCAGGACT...
umi ATTCGTAACC = 206 reads: +397 validated
umi GGTTTCCTCT = 319 reads: +397 validated
umi TTGAATTCCA = 404 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=555]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=1)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 185 reads
cdr3 = CATVAPMTTVTHDWVYW at 402, score = 9 + 7
umis assigned: [13, 19, 29, 44, 47, 100, 104, 118, 137, 166] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2530
start codons at 60, 216, 258, 280, 324, 357, 420
confident = true

TIG 2[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 289 reads
cdr3 = CQQRSNWPITF at 355, score = 9 + 8
umis assigned: [102, 128, 197, 210, 221, 235]
of which 6 are surviving nonsolos
reads assigned: 1896
start codons at 34, 239, 242, 458
confident = true

TIG 3[bases=563]
0-30 ==> 0-30 on |270|IGKV2D-26|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 132 reads
cdr3 = CMQDAQDPITF at 366, score = 9 + 8
umis assigned: [54, 154, 228]
of which 3 are surviving nonsolos
reads assigned: 913
start codons at 30, 63, 99, 150, 187, 250, 369, 376, 469
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1896 = GACGTGCCATGTCTCC-1

using 230 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 5, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

UMI info for barcode GACGTGCCATGTCTCC-1 contig 1 = GGAGTCAGAC...
umi ACTTCTATTC = 215 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=487]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
417-487 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYNSYSVYTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 26, 32, 88, 101, 333, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1902 = GACGTGCGTACGACCC-1

using 4015 reads

====================================================================================

graph has 1814 edges initially, 40 edges after simplification

total ucounts = 274
nonsolo ucounts = 118[2^45, 3^16, 4^13, 5^9, 6^4, 7^3, 8^2, 9^3, 10, 13, 16, 21, 22, 23, 32, 107, 132, 138, 174, 178, 189, 207, 210, 229, 235, 238, 253, 255, 259, 262, 333]
surviving nonsolo ucounts = 16[107, 132, 138, 174, 178, 189, 207, 210, 229, 235, 238, 253, 255, 259, 262, 333]
ids = [249, 192, 153, 86, 18, 70, 58, 178, 246, 107, ...]

====================================================================================

UMI info for barcode GACGTGCGTACGACCC-1 contig 1 = GCTCTGCTTC...
umi AACAGGACGA = 255 reads: +391 validated
umi AATGCACCAC = 179 reads: +391 validated
umi ATGCTTATGC = 204 reads: +391 validated
umi CCCTGTCGTG = 176 reads: +391 validated
umi CTAGCCTCTG = 237 reads: +391 validated
umi GTTGTATCCT = 133 reads: +391 validated
umi TACAGTAAGC = 251 reads: +391 validated
umi TGTTGTGACT = 229 reads: +391 validated

UMI info for barcode GACGTGCGTACGACCC-1 contig 2 = GTAGGCTCAG...
umi AGTCCCCCGT = 264 reads: +376 validated
umi CACGATTCAT = 340 reads: -373 +3 non-validated
umi CACGCATCTT = 187 reads: +376 validated
umi CGTCCTATAC = 232 reads: +376 validated
umi GCGTGAAAGC = 146 reads: +147 -2X +227 invalidated
umi GTACACATAA = 223 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 257 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [5, 18, 58, 86, 111, 192, 200, 246]
of which 8 are surviving nonsolos
reads assigned: 1648
start codons at 51, 205, 208, 259, 358, 385
confident = true

TIG 2[bases=622]
0-35 ==> 3-38 on |364|IGLV3-27|5'UTR| [len=38] (mis=0)
35-374 ==> 0-339 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=0)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
411-622 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 171 reads
cdr3 = CYSAADNNVVF at 350, score = 7 + 8
umis assigned: [49, 69, 70, 107, 153, 178]
of which 6 are surviving nonsolos
reads assigned: 1352
start codons at 25, 35, 96, 165, 183, 333, 372
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1905 = GACGTGCGTCAAAGCG-1

using 374 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[373]
surviving nonsolo ucounts = 1[373]
ids = [1]

====================================================================================

UMI info for barcode GACGTGCGTCAAAGCG-1 contig 1 = GGAGTCAGAC...
umi TGCACACCTT = 372 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1909 = GACGTGCGTCGAACAG-1

using 20 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 59.1913 = GACGTGCGTCTGGAGA-1

using 84 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 11[2^2, 3, 4, 6^2, 7, 8, 13^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.12
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk059-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk059-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

106.226 seconds used processing barcodes, peak mem = 0.26
