[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.19 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk058-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk058-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk058.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.0 = GAAACTCCAGCCTATA-1

using 737 reads

====================================================================================

graph has 296 edges initially, 14 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 165, 210, 357]
surviving nonsolo ucounts = 3[165, 210, 357]
ids = [1, 3, 4]

====================================================================================

UMI info for barcode GAAACTCCAGCCTATA-1 contig 1 = AATGCCTGGG...
umi TCTCCTCGCC = 352 reads: +385 validated

UMI info for barcode GAAACTCCAGCCTATA-1 contig 2 = CTGAGCTACA...
umi GCAGCATCAG = 164 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=536]
0-56 ==> 41-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
56-401 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
403-441 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
441-536 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNNWPPITF at 377, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 1, 56, 125, 261, 483
confident = false

TIG 2[bases=527]
0-32 ==> 143-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
32-395 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-527 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CHQYLSTPLTF at 371, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 32, 101, 354, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.1 = GAAACTCCAGTATGCT-1

using 31 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 5^2, 11]
surviving nonsolo ucounts = 1[11]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.9 = GAAACTCCATCGATGT-1

using 359 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[359]
surviving nonsolo ucounts = 1[359]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.11 = GAAACTCCATGAACCT-1

using 650 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 3, 147, 495]
surviving nonsolo ucounts = 2[147, 495]
ids = [5, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=406]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
380-406 ==> 0-26 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 33, 241, 367
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.18 = GAAACTCGTACGCACC-1

using 292 reads

====================================================================================

graph has 129 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[11, 277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode GAAACTCGTACGCACC-1 contig 1 = GTCAGGACAC...
umi AAGGTCATGT = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
13-366 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
364-401 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
401-493 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTPLTF at 340, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 13, 19, 75, 88, 224, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.19 = GAAACTCGTAGCGTGA-1

using 376 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 366]
surviving nonsolo ucounts = 1[366]
ids = [1]

====================================================================================

UMI info for barcode GAAACTCGTAGCGTGA-1 contig 1 = GCTCAGTTAG...
umi CCACGATTCT = 365 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
25-373 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYGYSPRTF at 349, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 25, 233, 359, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.23 = GAAACTCGTCCGAGTC-1

using 226 reads

====================================================================================

graph has 107 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================

UMI info for barcode GAAACTCGTCCGAGTC-1 contig 1 = CTGGGCCTCA...
umi ATGTGCATTT = 203 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=539]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
416-539 ==> 0-123 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQAWDSTTDWVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.24 = GAAACTCGTCCGTCAG-1

using 223 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [2]

====================================================================================

UMI info for barcode GAAACTCGTCCGTCAG-1 contig 1 = GGAGTCAGAC...
umi CGCGCATGCG = 223 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYYSYTWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.26 = GAAACTCGTCGGCATC-1

using 248 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=543]
0-20 ==> 5-25 on |243|IGKV1D-13|5'UTR| [len=25] (mis=0)
0-20 ==> 11709-11729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=0)
0-20 ==> 5980-6000 on rc of segment after IGKV1-13 exon 1 [len=6000] (mis=0)
8-71 ==> 5677-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
20-371 ==> 0-351 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=3)
369-407 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 20, 26, 82, 231, 234, 449
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.29 = GAAACTCGTCTCATCC-1

using 24 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.30 = GAAACTCGTGATGTCT-1

using 394 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 391]
surviving nonsolo ucounts = 1[391]
ids = [1]

====================================================================================

UMI info for barcode GAAACTCGTGATGTCT-1 contig 1 = ATCAGTCCCA...
umi AGTTTGACAG = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 358
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.31 = GAAACTCGTGCAACGA-1

using 175 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 55
nonsolo ucounts = 32[2^9, 3^6, 4^4, 5^2, 6^2, 7^4, 8, 9, 10, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.37 = GAAACTCGTGTTCTTT-1

using 257 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [4]

====================================================================================

UMI info for barcode GAAACTCGTGTTCTTT-1 contig 1 = GAAGAGCTGC...
umi TTACTCCACA = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=478]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
424-478 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGSSPRIFTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 33, 241, 367, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.49 = GAAACTCTCACAACGT-1

using 257 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 252]
surviving nonsolo ucounts = 1[252]
ids = [1]

====================================================================================

UMI info for barcode GAAACTCTCACAACGT-1 contig 1 = AGCTTCAGCT...
umi ATTTCATTGC = 248 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-497 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.53 = GAAACTCTCAGCCTAA-1

using 331 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[15, 28, 280]
surviving nonsolo ucounts = 1[280]
ids = [2]

====================================================================================

UMI info for barcode GAAACTCTCAGCCTAA-1 contig 1 = GGGAGGAATC...
umi ATATCTTTCG = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-497 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.54 = GAAACTCTCATAACCG-1

using 233 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================

UMI info for barcode GAAACTCTCATAACCG-1 contig 1 = GAGAGAGGAG...
umi CAAAGTGTAG = 224 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=512]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.60 = GAAACTCTCCAGGGCT-1

using 272 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [2]

====================================================================================

UMI info for barcode GAAACTCTCCAGGGCT-1 contig 1 = GATCAGGACT...
umi GTAGATCTAC = 265 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=504]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
427-504 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTPQTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.62 = GAAACTCTCCTACAGA-1

using 1574 reads

====================================================================================

graph has 1826 edges initially, 8 edges after simplification

total ucounts = 527
nonsolo ucounts = 244[2^99, 3^47, 4^37, 5^25, 6^11, 7^8, 8^5, 9^5, 10, 11, 12^3, 13, 401]
surviving nonsolo ucounts = 1[401]
ids = [403]

====================================================================================

UMI info for barcode GAAACTCTCCTACAGA-1 contig 1 = AGAGCTCTGG...
umi TCAGGGATTA = 384 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-524 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPPLVTF at 365, score = 9 + 8
umis assigned: [403]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 44, 113, 249, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.73 = GAAACTCTCTATGTGG-1

using 678 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[202, 473]
surviving nonsolo ucounts = 2[202, 473]
ids = [2, 0]

====================================================================================

UMI info for barcode GAAACTCTCTATGTGG-1 contig 1 = ATCACATAAC...
umi ATGCCTCCAA = 195 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=488]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=2)
58-195 ==> 0-137 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=2)
201-417 ==> 137-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=32)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 11 reads
cdr3 = CAAPHDDSDGYYQFDSW at 406, score = 10 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 58, 262, 419, 422, 431
confident = false
see insertion of CACCTA at pos 137 on |88|IGHV1-69D|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.78 = GAAACTCTCTCTAAGG-1

using 230 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=520]
0-74 ==> 6-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
0-74 ==> 6903-6977 on rc of segment before IGHVII-49-1 exon 1 [len=6977] (mis=0)
42-123 ==> 6506-6587 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=9)
74-381 ==> 0-307 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=22)
462-520 ==> 0-58 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
cdr3 = CTRDIPHRIWFGDVLVYYYYMDVW at 422, score = 10 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 74, 127, 230, 315, 354, 383, 448, 482
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.83 = GAAACTCTCTGCGGCA-1

using 525 reads

====================================================================================

graph has 111 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[524]
surviving nonsolo ucounts = 1[524]
ids = [1]

====================================================================================

UMI info for barcode GAAACTCTCTGCGGCA-1 contig 1 = AGGAGTCAGA...
umi TCACAAATGT = 506 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=470]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-470 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 86 reads
cdr3 = CQQAKSFSF at 354, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 500
start codons at 27, 33, 89, 102, 238, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.86 = GAAACTCTCTTGAGGT-1

using 25 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 21]
surviving nonsolo ucounts = 1[21]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.95 = GAAATGAAGACTACAA-1

using 417 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[415]
surviving nonsolo ucounts = 1[415]
ids = [1]

====================================================================================

UMI info for barcode GAAATGAAGACTACAA-1 contig 1 = ATCATCCAAC...
umi ACCGCACTCT = 368 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=533]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
482-533 ==> 0-51 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARVPMVRGVSYYFDYW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 58, 214, 256, 322, 355, 415, 500
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.100 = GAAATGAAGCTAACAA-1

using 664 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 659]
surviving nonsolo ucounts = 1[659]
ids = [2]

====================================================================================

UMI info for barcode GAAATGAAGCTAACAA-1 contig 1 = GGGGAGGAGT...
umi GGCACGCTTG = 652 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 104 reads
cdr3 = CQQYDDLPITF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 645
start codons at 31, 37, 93, 106, 368, 371, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.102 = GAAATGAAGGCATGGT-1

using 793 reads

====================================================================================

graph has 316 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 139, 245, 402]
surviving nonsolo ucounts = 3[139, 245, 402]
ids = [4, 2, 5]

====================================================================================

UMI info for barcode GAAATGAAGGCATGGT-1 contig 1 = GGAGGAATCA...
umi GGCTTGTCGC = 248 reads: +388 validated
umi TACTGTCGTG = 139 reads: +388 validated
umi TACTGTCGTT = 402 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 109 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2, 4, 5]
of which 3 are surviving nonsolos
reads assigned: 775
start codons at 29, 35, 104, 240, 459
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.108 = GAAATGAAGGTAGCTG-1

using 188 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 176]
surviving nonsolo ucounts = 1[176]
ids = [3]

====================================================================================

UMI info for barcode GAAATGAAGGTAGCTG-1 contig 1 = GAGCTACAAC...
umi GTCGTTGGGC = 166 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=475]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-475 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 30, 99, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.110 = GAAATGAAGGTGATTA-1

using 279 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 266]
surviving nonsolo ucounts = 1[266]
ids = [6]

====================================================================================

UMI info for barcode GAAATGAAGGTGATTA-1 contig 1 = TGAGTCTCCC...
umi TGTTGCTCGG = 261 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=494]
0-59 ==> 0-59 on |200|IGHV5-51|5'UTR| [len=59] (mis=0)
59-393 ==> 0-334 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=31)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=5)
junction support: 1 umis using 16 reads
cdr3 = CVTSGTSWYLYDAFDIW at 401, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 59, 233, 257, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.123 = GAAATGACAAGGACTG-1

using 281 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [4]

====================================================================================

UMI info for barcode GAAATGACAAGGACTG-1 contig 1 = CAGTCTCAGT...
umi TATTTACCGG = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-21 ==> 2-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
21-374 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
371-409 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
409-487 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTVFTF at 348, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 21, 27, 83, 96, 232, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.127 = GAAATGACACAGACAG-1

using 2628 reads

====================================================================================

graph has 1585 edges initially, 16 edges after simplification

total ucounts = 266
nonsolo ucounts = 90[2^36, 3^15, 4^10, 5^8, 6^2, 7^6, 8^3, 9, 10, 24, 211, 224, 274, 302, 344, 381, 398]
surviving nonsolo ucounts = 8[24, 211, 224, 274, 302, 344, 381, 398]
ids = [91, 116, 173, 261, 167, 32, 35, 221]

====================================================================================

UMI info for barcode GAAATGACACAGACAG-1 contig 1 = GGGCCTCAGG...
umi AGACTCCCTC = 343 reads: +376 validated
umi AGGTCATGTG = 384 reads: +376 validated
umi CGAGCCCTTC = 24 reads: -17 +240 -42 +77 non-validated
umi CTGGCAACCG = 212 reads: +376 validated
umi TTTTACATGA = 265 reads: +376 validated

UMI info for barcode GAAATGACACAGACAG-1 contig 2 = AGCTCTGGGA...
umi GTCTTGGATT = 236 reads: -400 +1 -3X +1 -1X +1 -2X +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TAAGTGCTTA = 223 reads: +433 validated
umi TGCCAGACCT = 312 reads: -400X +1 -3XX +1 -1XX +1 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=622]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=8)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
411-622 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 221 reads
cdr3 = CQAWDSSTVVF at 350, score = 6 + 8
umis assigned: [32, 35, 91, 116, 261]
of which 5 are surviving nonsolos
reads assigned: 1204
start codons at 35, 40, 96, 181, 329, 333
confident = true

TIG 2[bases=695]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=14)
450-513 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
513-695 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=2)
junction support: 1 umis using 19 reads
cdr3 = CARDSGDYVFNYYYYGMDVW at 422, score = 8 + 7
umis assigned: [167, 173, 221]
of which 3 are surviving nonsolos
reads assigned: 759
start codons at 80, 236, 383, 470
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATTCCGGTGACTACGTCTTCAACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGTAGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.132 = GAAATGACACCGAAAG-1

using 526 reads

====================================================================================

graph has 280 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[173, 350]
surviving nonsolo ucounts = 2[173, 350]
ids = [2, 3]

====================================================================================

UMI info for barcode GAAATGACACCGAAAG-1 contig 1 = TGGGGGCTGG...
umi TACAAGAGGA = 349 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=568]
46-407 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
440-568 ==> 0-128 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CSSYTSSSTLFYVF at 370, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 46, 203, 247, 254, 257, 404
confident = false

REJECT CONTIGS

TIG 1[bases=365]
1-18 ==> 545-562 on rc of segment before IGF2 exon 2 [len=2847] (mis=0)
22-269 ==> 106-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=20)
289-337 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
337-365 ==> 0-28 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CATDRVEGSSEVFDYW at 258, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 72, 133, 219
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.139 = GAAATGACAGACTCGC-1

using 272 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 268]
surviving nonsolo ucounts = 1[268]
ids = [1]

====================================================================================

UMI info for barcode GAAATGACAGACTCGC-1 contig 1 = GAATCAGTCC...
umi GTGCTTCTGA = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.143 = GAAATGACAGGCTGAA-1

using 410 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[7, 127, 276]
surviving nonsolo ucounts = 2[127, 276]
ids = [2, 0]

====================================================================================

UMI info for barcode GAAATGACAGGCTGAA-1 contig 1 = ACTTTCTGAG...
umi CTAGATTCCT = 119 reads: +415 validated

UMI info for barcode GAAATGACAGGCTGAA-1 contig 2 = GCTGGGGTCA...
umi CATTAAGTCC = 270 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=530]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-530 ==> 0-80 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 35, 79, 159, 229, 431
confident = false

TIG 2[bases=589]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
398-426 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-589 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CFSYGTSGRTF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 41, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.150 = GAAATGACATCGGAAG-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.151 = GAAATGACATCGTCGG-1

using 454 reads

====================================================================================

graph has 272 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[4^3, 5, 6, 7^3, 8, 11, 12, 17, 360]
surviving nonsolo ucounts = 1[360]
ids = [14]

====================================================================================

UMI info for barcode GAAATGACATCGTCGG-1 contig 1 = GGAATCAGAC...
umi TTGCGATATC = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
382-414 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYNSYPPTF at 353, score = 9 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.153 = GAAATGACATTAGGCT-1

using 250 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[250]
surviving nonsolo ucounts = 1[250]
ids = [0]

====================================================================================

UMI info for barcode GAAATGACATTAGGCT-1 contig 1 = GGCTGGGGTC...
umi GCTCAATGTT = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-480 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 42, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.155 = GAAATGAGTAAACACA-1

using 527 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[106, 418]
surviving nonsolo ucounts = 2[106, 418]
ids = [4, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=486]
16-237 ==> 135-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
237-275 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
275-486 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 205, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 410
start codons at 35, 38, 89, 188, 215, 239, 407
confident = false
not full
VJ delta = 22
not full

TIG 2[bases=493]
0-320 ==> 28-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
320-357 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
357-493 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQHATSPFTF at 296, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 180, 306, 399
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.163 = GAAATGAGTAGCTGCC-1

using 23 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.164 = GAAATGAGTAGTACCT-1

using 1898 reads

====================================================================================

graph has 2342 edges initially, 42 edges after simplification

total ucounts = 562
nonsolo ucounts = 309[2^104, 3^63, 4^47, 5^23, 6^22, 7^22, 8^10, 9^5, 10, 11^3, 12, 13, 14, 15, 16, 17^2, 33, 354]
surviving nonsolo ucounts = 1[354]
ids = [302]

====================================================================================

UMI info for barcode GAAATGAGTAGTACCT-1 contig 1 = GATCAGGACT...
umi GGTTATCGGT = 338 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [302]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.170 = GAAATGAGTCCTGCTT-1

using 128 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 35
nonsolo ucounts = 23[2^5, 3^5, 4^2, 5^2, 7^4, 8^3, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.188 = GAAATGAGTTGGAGGT-1

using 227 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 216]
surviving nonsolo ucounts = 1[216]
ids = [4]

====================================================================================

UMI info for barcode GAAATGAGTTGGAGGT-1 contig 1 = GGGGGGGGTC...
umi GCGTTATGGC = 220 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=644]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-400 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=5)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CCSYAGSYTSVVF at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.190 = GAAATGAGTTGTCGCG-1

using 240 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[237]
surviving nonsolo ucounts = 1[237]
ids = [1]

====================================================================================

UMI info for barcode GAAATGAGTTGTCGCG-1 contig 1 = GAGGAATCAG...
umi GCACTGTGAT = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.192 = GAAATGAGTTTGACTG-1

using 137 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[133]
surviving nonsolo ucounts = 1[133]
ids = [4]

====================================================================================

UMI info for barcode GAAATGAGTTTGACTG-1 contig 1 = GAGAAGAGCT...
umi TAAACTGCCT = 124 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-486 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYGSSPYTF at 359, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.195 = GAAATGATCAAGAAGT-1

using 202 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.203 = GAAATGATCAGCGATT-1

using 16798 reads

====================================================================================

graph has 7931 edges initially, 58 edges after simplification

total ucounts = 1159
nonsolo ucounts = 577[2^181, 3^94, 4^86, 5^47, 6^31, 7^26, 8^19, 9^6, 10^4, 11^6, 12^4, 13^2, 14, 16^2, 17^4, 18, 19, 20^3, 28, 37, 43, 63, 75, 103, 110, 117, 121^2, 123, 126^2, 140, 142, 148, 159, 173, 177, 186, 206, 209, 225^2, 231^2, 233, 241, 255, 256, 266, 267, 273, 274, 278^2, 280, 281, 283, 290, 293, 296, 300^2, 302, 327, 335^2, 343^2, 347, 355^2, 364, 365, 370, 389, 426, 483]
surviving nonsolo ucounts = 54[37, 43, 103, 110, 117, 121^2, 126^2, 140, 142, 148, 173, 177, 186, 206, 209, 225^2, 231^2, 233, 241, 255, 256, 266, 267, 273, 274, 278^2, 280, 281, 283, 290, 293, 296, 300^2, 302, 327, 335^2, 343^2, 347, 355^2, 364, 365, 370, 389, 426, 483]
ids = [129, 54, 352, 704, 1004, 177, 801, 230, 677, 504, ...]

====================================================================================

UMI info for barcode GAAATGATCAGCGATT-1 contig 1 = AGGAGTCAGA...
umi AATTCCGGCC = 229 reads: +388 validated
umi ACCATAGCTC = 280 reads: +388 validated
umi AGCCAGGTTC = 260 reads: +388 validated
umi AGCCTTAGTT = 172 reads: +388 validated
umi AGTCGGCTTC = 291 reads: +388 validated
umi ATGATCCGCC = 278 reads: +388 validated
umi ATGTCTTGGG = 356 reads: +388 validated
umi CAGCATCGGA = 106 reads: +344 -1 +1 -2X +2 -1X +1 -5XX +31 invalidated
umi CATATGTCTG = 268 reads: +388 validated
umi CCACCTTCTC = 297 reads: +388 validated
umi CCACGTAGGG = 331 reads: +388 validated
umi CCTAAGGCCC = 288 reads: +388 validated
umi CTACCATGCA = 366 reads: +388 validated
umi CTCAGTGCTG = 360 reads: +388 validated
umi CTGCTCGTAC = 193 reads: +388 validated
umi CTGGGACCGA = 275 reads: +388 validated
umi CTGGTTTGCA = 344 reads: +388 validated
umi CTGTGACTCC = 348 reads: +388 validated
umi GAATGTATTC = 205 reads: +388 validated
umi GCAACAATGG = 340 reads: +388 validated
umi GCAATTCCCT = 300 reads: +388 validated
umi GCAATTGCGG = 369 reads: +388 validated
umi GCTGCTGCTT = 278 reads: +388 validated
umi GGCCAGTAGT = 170 reads: +388 validated
umi GGTACTTCCG = 271 reads: +388 validated
umi GTTCAATGGC = 282 reads: +388 validated
umi GTTTGAGTGC = 265 reads: +388 validated
umi TAGTATAAGG = 335 reads: +388 validated
umi TATGCCCGAT = 232 reads: +388 validated
umi TATTATAGGC = 257 reads: +388 validated
umi TCAGCGTGAC = 338 reads: +388 validated
umi TCCGTCCCTT = 245 reads: +388 validated
umi TCGGATGCTG = 281 reads: +388 validated
umi TCGTCATATC = 377 reads: +388 validated
umi TTATTGGGAA = 385 reads: +388 validated
umi TTCATAATCT = 299 reads: +388 validated
umi TTTGCTCTAC = 309 reads: +177 -1XX +210 invalidated

UMI info for barcode GAAATGATCAGCGATT-1 contig 2 = GAGCTCTGGG...
umi AAGAGACGGC = 41 reads: +278 -22 +84 -8 +41 non-validated
umi ACGTGTTTCA = 37 reads: -10 +395 -28 non-validated
umi AGCTCCGAAG = 87 reads: -404X +1 -1XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi ATATAGGCCA = 126 reads: +10 -6X +1 -7XX +1 -7XX +1 -13XX +387 invalidated
umi ATGCCGGGAT = 5 reads: -366X +1 -1X +1 -2X +1 -5X +1 -5XX +1 -7XX +1 -1XX +1 -1XX +38 invalidated
umi CAGCTATCTT = 225 reads: +433 validated
umi CCGATGGTTG = 145 reads: +433 validated
umi CGTCCAGCGC = 6 reads: -366X +1 -1XX +1 -2XX +1 -5XX +1 -5XX +1 -7XX +1 -1XX +1 -1XX +38 invalidated
umi GCATACTCGA = 3 reads: -383X +1 -9X +1 -1X +38 invalidated
umi GCCCGTATAA = 206 reads: +433 validated
umi GCGTACGCAC = 112 reads: +433 validated
umi GTGGATTAGG = 3 reads: -366 +1 -1X +1 -2X +1 -5X +1 -5X +1 -7X +1 -1XX +1 -1XX +38 invalidated
umi TATGACCACG = 478 reads: -185X +1 -3XX +244 invalidated
umi TCTGACTGGC = 146 reads: +433 validated
umi TGATACTCCG = 1 reads: -366X +1 -1X +1 -2X +1 -5X +1 -5X +1 -7X +1 -1X +1 -1X +22 -16 invalidated
umi TGTCTAGCCG = 424 reads: +433 validated
umi TGTGGTCTTC = 233 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 37 umis using 1716 reads
cdr3 = CQQYNSYPCTF at 354, score = 8 + 8
umis assigned: [80, 110, 170, 175, 206, 262, 275, 352, 367, 402] and 27 others
of which 37 are surviving nonsolos
reads assigned: 10380
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true

TIG 2[bases=695]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=6)
436-457 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
465-513 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
513-695 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 9 umis using 321 reads
cdr3 = CAKDWKIAVAGTPISYFDYW at 422, score = 9 + 7
umis assigned: [54, 129, 177, 230, 268, 355, 426, 504, 677, 688] and 7 others
of which 17 are surviving nonsolos
reads assigned: 2235
start codons at 80, 231, 236, 294, 297, 315, 383
confident = true
now this is a cell
paired!

GTGTATTATTGTGCGAAAGATTGGAAGATAGCAGTGGCTGGTACGCCGATCTCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAATATAATAGTTACCCTTGCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.212 = GAAATGATCCAGATCA-1

using 524 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 516]
surviving nonsolo ucounts = 1[516]
ids = [4]

====================================================================================

UMI info for barcode GAAATGATCCAGATCA-1 contig 1 = AGCTTCAGCT...
umi TAATGTGCAC = 514 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 509
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.219 = GAAATGATCGCGATCG-1

using 325 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [3]

====================================================================================

UMI info for barcode GAAATGATCGCGATCG-1 contig 1 = GAATCAGTCC...
umi TATTAAGCGG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-474 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.224 = GAAATGATCGGTTCGG-1

using 23941 reads

====================================================================================

graph has 8772 edges initially, 90 edges after simplification

total ucounts = 1245
nonsolo ucounts = 566[2^200, 3^99, 4^71, 5^41, 6^22, 7^18, 8^13, 9^5, 10^4, 11^5, 12^2, 13^3, 15^2, 16^2, 17^4, 18, 22, 36, 55, 67, 76, 83, 84, 109, 116, 137, 141, 143, 148, 149, 154, 155, 159, 167, 173, 179, 185, 193, 195, 198, 208, 212, 217, 224, 225, 228, 229^2, 232, 235, 244, 268^2, 277, 281, 283, 300, 314, 325, 329, 340, 342, 345^3, 349, 350^2, 351, 352, 357, 365, 370, 371, 378, 380, 389, 392, 395, 399, 400, 410, 416^2, 430, 465, 701, 709, 934, 965]
surviving nonsolo ucounts = 66[67, 76, 84, 109, 116, 137, 143, 148, 154, 155, 159, 173, 185, 193, 195, 198, 208, 212, 217, 224, 225, 228, 229^2, 232, 235, 244, 268^2, 277, 281, 283, 300, 314, 325, 329, 340, 342, 345^3, 349, 350^2, 351, 352, 357, 365, 370, 371, 378, 380, 389, 392, 395, 399, 400, 410, 416^2, 430, 465, 701, 709, 934, 965]
ids = [1011, 502, 564, 804, 251, 811, 295, 832, 419, 660, ...]

====================================================================================

UMI info for barcode GAAATGATCGGTTCGG-1 contig 1 = ACCCAAAAAC...
umi AAAAAACTTC = 227 reads: +430 validated
umi ACTTTCCAAC = 642 reads: -397X +1 -3XX +1 -1XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi ATCAGCACGG = 117 reads: +430 validated
umi ATGTCGCCTG = 183 reads: +430 validated
umi ATTCATTCGG = 7 reads: -424X +1 -2X +3 invalidated
umi CAACAACAGG = 311 reads: +430 validated
umi CAACTTCGCG = 279 reads: +430 validated
umi CACTTCCGTC = 223 reads: +430 validated
umi CATTCCATCG = 174 reads: +430 validated
umi CCCTATCTGC = 152 reads: +413 -2 +9 -1 +3 -2X invalidated
umi CGCATCCTCC = 195 reads: +430 validated
umi CGCGATGTTA = 261 reads: +430 validated
umi CTCAAATGCA = 91 reads: +215 -1X +1 -3XX +6 -1 +2 -1 +200 invalidated
umi GAATCGCATC = 228 reads: +430 validated
umi GAGGCACTTC = 156 reads: +430 validated
umi GTATATGTAC = 110 reads: -21X +409 invalidated
umi GTCATGGCAT = 17 reads: -397 +2 -2X +1 -9X +1 -2XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi GTGTCCCTCA = 146 reads: +430 validated
umi TATACTAATC = 181 reads: -401X +1 -1X +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TCGTACCCCT = 65 reads: +383 -1 +3 -1 +3 -39 non-validated
umi TTTGACGGTC = 194 reads: +430 validated

UMI info for barcode GAAATGATCGGTTCGG-1 contig 2 = AGAGCTCTGG...
umi AACGTTAGCC = 379 reads: +388 validated
umi ACATGAGCTA = 365 reads: +388 validated
umi ACGTATCGAA = 210 reads: +388 validated
umi ACTGCTCGAA = 369 reads: +388 validated
umi AGATGCCTGT = 400 reads: +388 validated
umi ATAGTATCAC = 199 reads: +388 validated
umi ATCCTGTTAC = 336 reads: +388 validated
umi ATCGCACTAC = 365 reads: +388 validated
umi ATTCTTCTTG = 228 reads: +388 validated
umi CACATAACTG = 428 reads: +388 validated
umi CAGACTGCTT = 354 reads: +388 validated
umi CATGCACCCT = 353 reads: +388 validated
umi CATTCCTTTT = 395 reads: +388 validated
umi CCGGATCAGG = 422 reads: +388 validated
umi CCTTCGGAAC = 216 reads: +388 validated
umi CGAGATCCCG = 232 reads: +388 validated
umi CTACATCCAC = 352 reads: +388 validated
umi CTGTCCTTTC = 278 reads: +388 validated
umi CTTTACATTG = 710 reads: -144X +1 -2X +241 invalidated
umi CTTTGTAGGG = 328 reads: +388 validated
umi GAATACCGTT = 244 reads: +388 validated
umi GACTCAAAAC = 227 reads: +388 validated
umi GAGCATCTGC = 374 reads: +388 validated
umi GAGGATCGGC = 342 reads: +388 validated
umi GAGTGAATGA = 281 reads: +388 validated
umi GCTGGACACT = 349 reads: +388 validated
umi GGAATCCCTT = 401 reads: +388 validated
umi GGGCTTCGGG = 266 reads: +388 validated
umi GTAGCCACTC = 395 reads: +388 validated
umi GTCAGTAGTA = 346 reads: +388 validated
umi GTTCCAACCT = 351 reads: +388 validated
umi TAAAACCCGT = 411 reads: +388 validated
umi TATCAGACTG = 399 reads: +388 validated
umi TCATTAATTA = 467 reads: +388 validated
umi TCATTGTGGG = 354 reads: +388 validated
umi TGAATGGTTT = 744 reads: -345 +1 -3XX +1 -1XX +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi TGCGAGTATC = 156 reads: +388 validated
umi TGTTCTACCA = 366 reads: +388 validated
umi TTAGCGGCCC = 330 reads: +388 validated
umi TTCTACGGTA = 208 reads: +388 validated
umi TTGGTCTCTA = 410 reads: +388 validated
umi TTTTGCTTTA = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=666]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=13)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
484-666 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 15 umis using 334 reads
cdr3 = CAKDGISGYYNRGYYFDSW at 396, score = 8 + 7
umis assigned: [0, 146, 251, 283, 295, 319, 326, 353, 388, 419] and 11 others
of which 21 are surviving nonsolos
reads assigned: 3877
start codons at 54, 205, 252, 257, 274, 289, 351, 406
confident = true

TIG 2[bases=568]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=4)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 41 umis using 2337 reads
cdr3 = CQQYNNWPPRFTF at 365, score = 9 + 8
umis assigned: [31, 87, 117, 135, 165, 239, 259, 260, 299, 336] and 32 others
of which 42 are surviving nonsolos
reads assigned: 14451
start codons at 44, 113, 249, 474
confident = true

REJECT CONTIGS

TIG 1[bases=537]
0-404 ==> 81-485 on rc of segment before IGHD6-25 exon 1 [len=485] (mis=0)
420-466 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [220, 502, 1029]
of which 3 are surviving nonsolos
reads assigned: 1305
start codons at 29, 110, 218
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGTGCGAAAGATGGTATATCCGGGTACTATAATAGGGGGTACTACTTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCCCGATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.233 = GAAATGATCTTGACGA-1

using 472 reads

====================================================================================

graph has 242 edges initially, 8 edges after simplification

total ucounts = 116
nonsolo ucounts = 42[2^25, 3^5, 4^8, 5, 12, 79, 205]
surviving nonsolo ucounts = 2[79, 205]
ids = [27, 77]

====================================================================================

UMI info for barcode GAAATGATCTTGACGA-1 contig 1 = GAATCAGTCC...
umi GTTCCAGGTC = 189 reads: +388 validated
umi TTACCAGGTC = 1 reads: -70 +11 -1X +3 -4 +1 -6X +4 -1 +2 -2X +1 -3 +12 -3 +1 -263X invalidated

GOOD CONTIGS

TIG 1[bases=460]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-460 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [77, 103]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.237 = GAACATCAGACAGAGA-1

using 10206 reads

====================================================================================

graph has 4650 edges initially, 40 edges after simplification

total ucounts = 743
nonsolo ucounts = 367[2^123, 3^67, 4^50, 5^27, 6^20, 7^14, 8^8, 9^11, 10^3, 11^4, 12^2, 13^3, 16, 18^2, 19, 22, 25, 64, 98^2, 136, 145, 182, 190, 196, 208, 214, 227, 244, 256, 269, 271, 292, 334, 340, 351, 363, 370, 373, 376, 390^2, 393, 398, 515, 729]
surviving nonsolo ucounts = 29[64, 98^2, 136, 145, 182, 190, 196, 208, 214, 227, 244, 256, 269, 271, 292, 334, 340, 351, 363, 370, 373, 376, 390^2, 393, 398, 515, 729]
ids = [345, 141, 278, 97, 225, 231, 269, 376, 495, 290, ...]

====================================================================================

UMI info for barcode GAACATCAGACAGAGA-1 contig 1 = TGGGGGAGTC...
umi ACTACTGGAA = 273 reads: +388 validated
umi ACTCCATCAG = 385 reads: +388 validated
umi ACTCTCAATA = 244 reads: +388 validated
umi ACTTTAGGAC = 269 reads: +388 validated
umi AGCTAAAATC = 336 reads: +388 validated
umi AGTCTAATAT = 364 reads: +388 validated
umi ATTAAAGCCA = 380 reads: +388 validated
umi CAAGTTACTC = 390 reads: +388 validated
umi CATCACTCAC = 233 reads: +188 -1XX +199 invalidated
umi CCATACTGCT = 183 reads: +388 validated
umi CCGTCGTCAG = 191 reads: +388 validated
umi CGTTTAATCT = 289 reads: +388 validated
umi CTGAGATCCA = 390 reads: +388 validated
umi CTGGCCAACG = 517 reads: +388 validated
umi GAGCTAGCCC = 731 reads: +388 validated
umi GTCCACTATA = 399 reads: +388 validated
umi TAATATTTTT = 369 reads: +388 validated
umi TCAATACCCG = 335 reads: +388 validated
umi TGTATTAGAA = 354 reads: +388 validated
umi TTTGCAAAGG = 254 reads: +388 validated

UMI info for barcode GAACATCAGACAGAGA-1 contig 2 = GGGAGAGGAG...
umi ATAATCCGCT = 136 reads: +412 -15 non-validated
umi ATTTGATAGC = 96 reads: +427 validated
umi CCAGCTCCTT = 145 reads: +427 validated
umi CCTCGTTCGA = 98 reads: +423 -4 non-validated
umi CTACTATGGG = 63 reads: +427 validated
umi CTGTCTCCGT = 198 reads: +427 validated
umi GTATGGCGCT = 202 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 1158 reads
cdr3 = CQQGFSIPLTF at 357, score = 9 + 9
umis assigned: [57, 62, 65, 72, 80, 93, 132, 157, 201, 231] and 10 others
of which 20 are surviving nonsolos
reads assigned: 6783
start codons at 30, 36, 92, 105, 460
confident = true

TIG 2[bases=567]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=1)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=17)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
500-567 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 56 reads
cdr3 = CARSRSRYGSGNYEFFDYW at 412, score = 7 + 7
umis assigned: [97, 141, 225, 278, 345, 376, 495]
of which 7 are surviving nonsolos
reads assigned: 922
start codons at 73, 229, 373, 403, 434, 449
confident = true

REJECT CONTIGS

TIG 1[bases=520]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=14)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-520 ==> 0-91 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CWSYADSRHYWVF at 362, score = 7 + 7
umis assigned: [290]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 38, 177, 239, 246, 361, 372
confident = false
not full
full length stopped transcript of length 520
frameshifted full length stopped transcript of length 520
VJ delta = 6
not full
now this is a cell
paired!

GCCATGTATTACTGTGCGAGAAGTCGTTCACGCTATGGTTCGGGGAATTATGAGTTCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGGGTTTCAGTATCCCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.242 = GAACATCAGAGTGAGA-1

using 1293 reads

====================================================================================

graph has 1304 edges initially, 28 edges after simplification

total ucounts = 419
nonsolo ucounts = 170[2^58, 3^42, 4^16, 5^19, 6^6, 7^5, 8^4, 9^3, 10^6, 11, 12^3, 13^2, 14, 15, 17, 22, 312]
surviving nonsolo ucounts = 1[312]
ids = [363]

====================================================================================

UMI info for barcode GAACATCAGAGTGAGA-1 contig 1 = AGGAGTCAGA...
umi TGCCTAGCTG = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-495 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [363]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.252 = GAACATCAGCGTTCCG-1

using 311 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 304]
surviving nonsolo ucounts = 1[304]
ids = [3]

====================================================================================

UMI info for barcode GAACATCAGCGTTCCG-1 contig 1 = GCTCTGCTTC...
umi TATTGCTCCG = 297 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=592]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-592 ==> 0-150 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.255 = GAACATCAGCTTCGCG-1

using 227 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2^2, 5, 6, 212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode GAACATCAGCTTCGCG-1 contig 1 = AGCTCTCAGA...
umi ACTATAATGC = 212 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=500]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 18 reads
cdr3 = CARVGPLFDYW at 421, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.257 = GAACATCAGGACTGGT-1

using 209 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode GAACATCAGGACTGGT-1 contig 1 = AGTGCTTTCT...
umi TATAATTTCC = 210 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=553]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-553 ==> 0-85 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_58.257_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.260 = GAACATCAGGCAAAGA-1

using 115 reads

====================================================================================

graph has 86 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 15, 91]
surviving nonsolo ucounts = 1[91]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.262 = GAACATCAGGCTAGAC-1

using 1909 reads

====================================================================================

graph has 2354 edges initially, 14 edges after simplification

total ucounts = 647
nonsolo ucounts = 277[2^98, 3^52, 4^41, 5^22, 6^18, 7^16, 8^6, 9^5, 10^5, 11^5, 13, 14^3, 15^3, 16, 379]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.266 = GAACATCAGTCAAGGC-1

using 53 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[3^4, 9, 10, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.276 = GAACATCAGTTATCGC-1

using 100 reads

====================================================================================

graph has 96 edges initially, 6 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[2^3, 4^3, 5^2, 6, 8, 10^2, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.279 = GAACATCAGTTGTAGA-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.280 = GAACATCCAAACTGCT-1

using 281 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [3]

====================================================================================

UMI info for barcode GAACATCCAAACTGCT-1 contig 1 = GGAGGAACTG...
umi ATCGCTTAAT = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNLWPPMCSF at 355, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 34, 103, 176, 239, 382, 415, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.282 = GAACATCCAAGGACTG-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.291 = GAACATCCACCAGATT-1

using 282 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 270]
surviving nonsolo ucounts = 1[270]
ids = [6]

====================================================================================

UMI info for barcode GAACATCCACCAGATT-1 contig 1 = GAGTCAGTCT...
umi TGTTAACGGG = 255 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=450]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-450 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 25, 31, 87, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.300 = GAACATCCAGATAATG-1

using 422 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[420]
surviving nonsolo ucounts = 1[420]
ids = [2]

====================================================================================

UMI info for barcode GAACATCCAGATAATG-1 contig 1 = GGAACTGCTC...
umi ATTCACCCCT = 408 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=506]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-506 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CLQYSDWPRTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 58.302 = GAACATCCAGCGTAAG-1

using 250 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^4, 236]
surviving nonsolo ucounts = 1[236]
ids = [10]

====================================================================================

UMI info for barcode GAACATCCAGCGTAAG-1 contig 1 = GAAACAGAGC...
umi TTGTTTGGTA = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=23)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
426-549 ==> 0-123 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSAWDSSLNVWVF at 359, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 38, 177, 367, 384
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk058-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk058-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

15.660 seconds used processing barcodes, peak mem = 0.23
