[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.21 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk050-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk050-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk050.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.0 = CTCGAGGTCCATGAAC-1

using 577 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[6, 8, 11, 256, 292]
surviving nonsolo ucounts = 2[256, 292]
ids = [1, 4]

====================================================================================

UMI info for barcode CTCGAGGTCCATGAAC-1 contig 1 = GGAATCAGTC...
umi ACTCAGACAT = 236 reads: +388 validated
umi CATGCTTCTC = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-497 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 106 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 493
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.7 = CTCGAGGTCCTAGGGC-1

using 534 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 524]
surviving nonsolo ucounts = 1[524]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=395]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-110 ==> 0-70 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=0)
105-149 ==> 309-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=0) [SHIFT!]
146-184 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
184-395 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CAAWDDSLNGPVF at 117, score = 4 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 516
start codons at 40, 125, 130, 142
confident = false
not full
frameshifted full length stopped transcript of length 395
VJ delta = 266
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.20 = CTCGAGGTCGTTACGA-1

using 249 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode CTCGAGGTCGTTACGA-1 contig 1 = GAGAAGAGCT...
umi ATTCCTTTTG = 247 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=550]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYGSSRF at 359, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 35, 243, 369, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.31 = CTCGAGGTCTGGCGAC-1

using 117 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[111]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.33 = CTCGAGGTCTGTCAAG-1

using 376 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 365]
surviving nonsolo ucounts = 1[365]
ids = [0]

====================================================================================

UMI info for barcode CTCGAGGTCTGTCAAG-1 contig 1 = GGAACTGCTC...
umi AATACAACGC = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-503 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQRSNWPPGLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 31, 236, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.38 = CTCGAGGTCTTGTTTG-1

using 215 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode CTCGAGGTCTTGTTTG-1 contig 1 = ATCACATAAC...
umi AGATGGGTCC = 202 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=541]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-541 ==> 0-47 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.42 = CTCGGAGAGACACGAC-1

using 316 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 313]
surviving nonsolo ucounts = 1[313]
ids = [2]

====================================================================================

UMI info for barcode CTCGGAGAGACACGAC-1 contig 1 = GAGTCAGTCT...
umi TGCCGTTTCG = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
413-497 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPITF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.43 = CTCGGAGAGACATAAC-1

using 51 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^2, 4^2, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.45 = CTCGGAGAGACTCGGA-1

using 272 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3^3, 12, 248]
surviving nonsolo ucounts = 1[248]
ids = [5]

====================================================================================

UMI info for barcode CTCGGAGAGACTCGGA-1 contig 1 = GGGAATCAGT...
umi CAGGTATCAG = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-482 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.46 = CTCGGAGAGAGGGATA-1

using 208 reads

====================================================================================

graph has 126 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 36, 164]
surviving nonsolo ucounts = 2[36, 164]
ids = [2, 8]

====================================================================================

UMI info for barcode CTCGGAGAGAGGGATA-1 contig 1 = AGCTCTGAGA...
umi CGGTTTCTTG = 35 reads: +9 -1 +17 -2 +390 -1 +1 -1X +2 invalidated
umi TGATATAACT = 168 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-593 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 193
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.47 = CTCGGAGAGAGTAAGG-1

using 417 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 36
nonsolo ucounts = 18[2^6, 3, 5^2, 6^5, 8, 9, 10, 317]
surviving nonsolo ucounts = 1[317]
ids = [20]

====================================================================================

REJECT CONTIGS

TIG 1[bases=433]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
36-103 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
67-125 ==> 0-58 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
125-208 ==> 61-144 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
208-338 ==> 223-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=6) [SHIFT!]
363-414 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
414-433 ==> 0-19 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CETIIISGSGCGICFDPW at 329, score = 4 + 7
umis assigned: [20]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 67, 215, 288
confident = false
see deletion of 3 bases at pos 58 on |128|IGHV3-33|L-REGION+V-REGION|
frameshifted full length stopped transcript of length 433
VJ delta = 91
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.48 = CTCGGAGAGATCCCGC-1

using 121 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[119]
surviving nonsolo ucounts = 1[119]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=352]
30-226 ==> 155-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
231-281 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
281-352 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CVKEEDAFDIW at 217, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 90
start codons at 26, 31, 92, 178, 233, 262
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.51 = CTCGGAGAGCAGCCTC-1

using 209 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 201]
surviving nonsolo ucounts = 1[201]
ids = [4]

====================================================================================

UMI info for barcode CTCGGAGAGCAGCCTC-1 contig 1 = GCTTCAGCTG...
umi TCACTCGCGC = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=596]
0-46 ==> 68-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
46-399 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-596 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.57 = CTCGGAGAGCTTTGGT-1

using 199 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [2]

====================================================================================

UMI info for barcode CTCGGAGAGCTTTGGT-1 contig 1 = GGAGAAGAGC...
umi GTGAACCCGC = 183 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-481 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPWTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.67 = CTCGGAGAGTCATCCA-1

using 255 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [1]

====================================================================================

UMI info for barcode CTCGGAGAGTCATCCA-1 contig 1 = CACAAGAGGC...
umi GCGCGCCATT = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=3)
383-421 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
421-543 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CCSYAGSSTYVF at 357, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 33, 172, 234, 241, 367, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.70 = CTCGGAGAGTGGGTTG-1

using 114 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 109]
surviving nonsolo ucounts = 1[109]
ids = [1]

====================================================================================

UMI info for barcode CTCGGAGAGTGGGTTG-1 contig 1 = GCTCTGCTTC...
umi GCGGGAGGTC = 97 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-554 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.76 = CTCGGAGCAACACGCC-1

using 13694 reads

====================================================================================

graph has 3853 edges initially, 40 edges after simplification

total ucounts = 300
nonsolo ucounts = 106[2^35, 3^12, 4^11, 5^8, 6^8, 7, 8^3, 9, 10, 32, 51, 114, 187^2, 201, 202^2, 207, 224, 274, 297, 311, 314, 320, 322, 325, 553, 695, 789, 868, 890, 895, 1369, 1552, 1831]
surviving nonsolo ucounts = 23[114, 187^2, 201, 202^2, 207, 224, 274, 297, 311, 314, 320, 322, 553, 695, 789, 868, 890, 895, 1369, 1552, 1831]
ids = [40, 24, 186, 93, 124, 196, 119, 169, 57, 13, ...]

====================================================================================

UMI info for barcode CTCGGAGCAACACGCC-1 contig 1 = ACTTTCTGAG...
umi AACATCACGA = 116 reads: +8 -1XX +47 -1XX +9 -1XX +34 -3XX +19 -1XX +12 -81X +1 -1XX +1 -1XX +1 -2XX +1 -3XX +7 -1XX +15 -1XX +29 -1XX +4 -1XX +12 -1XX +11 -1XX +20 -1XX +26 -8XX +1 -3XX +2 -6XX +2 -1XX +2 -58XX invalidated
umi AACTTTAGCG = 298 reads: +442 validated
umi GGGCTCTGCA = 188 reads: +415 -1 +13 -13 non-validated
umi TCAGTCGCGC = 266 reads: +442 validated

UMI info for barcode CTCGGAGCAACACGCC-1 contig 2 = GTGGGTCCAG...
umi AACCAACCGC = 1559 reads: -334X +1 -7XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi AACCCCAACC = 694 reads: -334X +1 -1XX +1 -5XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi ACCATGACCA = 796 reads: -341 +1 -5X +3 -1XX +31 invalidated
umi AGAATCACTG = 1820 reads: -324X +1 -2X +2 -13XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi AGCCCAGAAC = 279 reads: +382 validated
umi CAACTCAGCG = 203 reads: +382 validated
umi CGACTCCGGG = 210 reads: +382 validated
umi CGCGTCCGAT = 198 reads: +382 validated
umi CTCGGGCCCT = 1369 reads: -344X +1 -2XX +3 -1XX +31 invalidated
umi GTAGTCGTAC = 204 reads: +382 validated
umi TCCAGTCTCC = 888 reads: -337 +1 -4XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi TGGTTTTTTC = 888 reads: -331X +1 -10XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi TTGACGGTAC = 872 reads: -342X +1 -1XX +1 -2XX +3 -1XX +31 invalidated

GOOD CONTIGS

TIG 1[bases=548]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-257 ==> 0-222 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=11)
263-397 ==> 222-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=3)
429-477 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=8)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 41 reads
cdr3 = CAREMSGVRGVRGVRHLDCW at 386, score = 9 + 7
umis assigned: [5, 13, 186, 232]
of which 3 are surviving nonsolos
reads assigned: 848
start codons at 35, 79, 398
confident = true
see insertion of ACTGGG at pos 222 on |196|IGHV4-61|L-REGION+V-REGION|

TIG 2[bases=628]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=5)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 187 reads
cdr3 = CQSADSSGTYMVF at 350, score = 8 + 8
umis assigned: [7, 10, 30, 50, 57, 93, 119, 124, 140, 196] and 3 others
of which 13 are surviving nonsolos
reads assigned: 9825
start codons at 35, 96, 165, 183, 380
confident = true

REJECT CONTIGS

TIG 1[bases=589]
31-108 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
61-421 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=6)
414-453 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
453-589 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [40, 169]
of which 2 are surviving nonsolos
reads assigned: 332
start codons at 24, 61, 94, 122, 130, 218, 380, 400, 495
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGAAATGTCAGGGGTTCGCGGGGTTCGGGGAGTTAGACATCTTGACTGCTGGGGCCCGGGAACCCTGCTCACCGTCTCCTCAG <==> GGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATATGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.82 = CTCGGAGCAATGAAAC-1

using 40 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[39]
surviving nonsolo ucounts = 1[39]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.83 = CTCGGAGCAATGGTCT-1

using 55 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[3, 43]
surviving nonsolo ucounts = 1[43]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.94 = CTCGGAGCACGTCTCT-1

using 844 reads

====================================================================================

graph has 290 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 143, 171, 187, 336]
surviving nonsolo ucounts = 4[143, 171, 187, 336]
ids = [6, 0, 4, 3]

====================================================================================

UMI info for barcode CTCGGAGCACGTCTCT-1 contig 1 = GCCTATCCAC...
umi GCTCCGGGCC = 133 reads: +424 validated

UMI info for barcode CTCGGAGCACGTCTCT-1 contig 2 = AGCTTCAGCT...
umi ACCATTCCGC = 161 reads: +388 validated
umi CTCGCATCAT = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-43 ==> 36-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
43-396 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
420-467 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
467-575 ==> 0-108 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDRAATARLGGMDVW at 385, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 43, 194, 199, 346, 424
confident = true

TIG 2[bases=601]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-601 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 62 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 340
start codons at 47, 201, 351, 376, 381
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.97 = CTCGGAGCAGCCTATA-1

using 5960 reads

====================================================================================

graph has 2442 edges initially, 36 edges after simplification

total ucounts = 357
nonsolo ucounts = 129[2^47, 3^19, 4^14, 5^7, 6^5, 7^6, 8^2, 9, 11, 13, 16, 27, 55, 67, 105, 121, 161, 164, 168, 169^2, 190, 201, 206, 221, 241, 270, 271, 272, 291, 307, 312, 322, 326, 347, 370]
surviving nonsolo ucounts = 24[55, 67, 105, 121, 161, 164, 168, 169^2, 190, 201, 206, 221, 241, 270, 271, 272, 291, 307, 312, 322, 326, 347, 370]
ids = [170, 329, 49, 135, 117, 39, 179, 79, 82, 87, ...]

====================================================================================

UMI info for barcode CTCGGAGCAGCCTATA-1 contig 1 = GGTTCAGGAC...
umi AACTAGCCAT = 218 reads: -15X +2 -3X +1 -2XX +1 -7XX +1 -3XX +1 -5XX +1 -1XX +2 -1XX +369 invalidated
umi ACGCATCAAT = 162 reads: +415 validated
umi AGATATTCGT = 85 reads: +391 -24 non-validated
umi AGCGTATTGA = 192 reads: +415 validated
umi ATACTTTTAC = 144 reads: +411 -4 non-validated
umi ATCATTGCCA = 169 reads: +245 -24 +89 -4 +2 -51 non-validated
umi ATTTCCGGTG = 221 reads: +415 validated
umi CCGCTTCTCC = 115 reads: +390 -25 non-validated
umi CTAATCTCGC = 53 reads: -369X +1 -5X +1 -1X +1 -2X +9 -1X +2 -1X +3 -2X +17 invalidated
umi CTCAGTGTGT = 163 reads: +369 -1 +1 -44 non-validated
umi GAATTCATGC = 329 reads: -363X +1 -5XX +1 -5XX +1 -1XX +1 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GCACGTGCTT = 307 reads: -375X +1 -1XX +1 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GTAGGGCGGG = 306 reads: -369X +1 -5X +1 -1X +1 -2X +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GTCACGCCCG = 225 reads: +415 validated
umi TGCAGGGACT = 364 reads: -363X +1 -5X +1 -5XX +1 -1XX +1 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated

UMI info for barcode CTCGGAGCAGCCTATA-1 contig 2 = GAGCTACAAC...
umi ACCATATTCA = 269 reads: +400 validated
umi ACCCTACTCA = 101 reads: +357 -1 +7 -2 +7 -1 +1 -1 +5 -1 +2 -1 +14 non-validated
umi ATGACCAGGA = 194 reads: +400 validated
umi CGCCTATCGT = 310 reads: +400 validated
umi GAGAACTTGC = 317 reads: +400 validated
umi GGATATTCGG = 217 reads: +400 validated
umi GTTCTCTCCT = 289 reads: +400 validated
umi TGTGTTTGCA = 68 reads: +398 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=762]
245-598 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
622-660 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
660-762 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 101 reads
cdr3 = CARGYVSHLAAGYW at 587, score = 9 + 7
umis assigned: [5, 39, 49, 58, 79, 82, 97, 135, 170, 179] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3002
start codons at 69, 89, 147, 158, 180, 195, 245, 396, 443, 448, 452, 480, 509, 542, 678, 739
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 212 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [31, 32, 87, 155, 210, 241, 280, 329]
of which 8 are surviving nonsolos
reads assigned: 1737
start codons at 30, 99, 352, 472
confident = true
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGCTACGTCTCACACTTAGCAGCAGGCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.101 = CTCGGAGCAGGTCGTC-1

using 48 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 7, 15, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.102 = CTCGGAGCAGTTCATG-1

using 186 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[186]
surviving nonsolo ucounts = 1[186]
ids = [0]

====================================================================================

UMI info for barcode CTCGGAGCAGTTCATG-1 contig 1 = TGATCAGGAC...
umi GCAACATTAA = 177 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=518]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
428-518 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQTPVTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.103 = CTCGGAGCATAACCTG-1

using 221 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 11, 201]
surviving nonsolo ucounts = 2[4, 201]
ids = [5, 3]

====================================================================================

UMI info for barcode CTCGGAGCATAACCTG-1 contig 1 = GGCACAAGAG...
umi GTTCTCTGCA = 192 reads: +391 validated
umi TCGCTTCAGT = 4 reads: -119 +129 -143 non-validated

GOOD CONTIGS

TIG 1[bases=520]
0-34 ==> 17-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
34-374 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
425-520 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSYDKSLRGAVF at 358, score = 7 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 193
start codons at 34, 118, 191, 341, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.105 = CTCGGAGCATCCGTGG-1

using 57 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[57]
surviving nonsolo ucounts = 1[57]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.110 = CTCGGAGGTAAATGAC-1

using 290 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 8, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=534]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-367 ==> 0-337 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=13)
359-398 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 30, 63, 99, 187, 250, 349, 440
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.115 = CTCGGAGGTACACCGC-1

using 199 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [2]

====================================================================================

UMI info for barcode CTCGGAGGTACACCGC-1 contig 1 = AGACTCAGTC...
umi GCATTGTCCT = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
408-491 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYNGQSRAF at 347, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 20, 26, 95, 231, 234, 327, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.116 = CTCGGAGGTACAGCAG-1

using 186 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 177]
surviving nonsolo ucounts = 1[177]
ids = [2]

====================================================================================

UMI info for barcode CTCGGAGGTACAGCAG-1 contig 1 = GCTGGGGTCT...
umi CGGGTCTCCC = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=14)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-564 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CSSHAGSTRVLF at 365, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.126 = CTCGGAGGTCAACTGT-1

using 4021 reads

====================================================================================

graph has 2760 edges initially, 34 edges after simplification

total ucounts = 544
nonsolo ucounts = 376[2^86, 3^53, 4^44, 5^30, 6^35, 7^27, 8^13, 9^20, 10^17, 11^9, 12^6, 13^6, 14^6, 15^2, 16^5, 17^3, 18^3, 20^2, 22, 25, 36, 127, 182, 278, 325, 362, 398]
surviving nonsolo ucounts = 6[127, 182, 278, 325, 362, 398]
ids = [289, 152, 147, 80, 387, 338]

====================================================================================

UMI info for barcode CTCGGAGGTCAACTGT-1 contig 1 = AGCTCTGAGA...
umi CAAATCCGAT = 278 reads: +418 validated
umi CAATATCGGG = 181 reads: +418 validated
umi CTTTGCTTTA = 124 reads: +418 validated
umi GTCCAACATG = 363 reads: +418 validated

UMI info for barcode CTCGGAGGTCAACTGT-1 contig 2 = AGAGCTCTGG...
umi AGAGATTACC = 323 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=568]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=9)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 63 reads
cdr3 = CAKDRLPTRTAFDYW at 421, score = 9 + 7
umis assigned: [147, 152, 289, 387]
of which 4 are surviving nonsolos
reads assigned: 923
start codons at 79, 230, 235, 382
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQCGSFPRTF at 368, score = 9 + 7
umis assigned: [80]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 44, 252, 471
confident = true

REJECT CONTIGS

TIG 1[bases=463]
1-310 ==> 2412-2721 on rc of segment before IGHD1OR15-1B exon 1 [len=2721] (mis=31)
342-392 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
392-463 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [338]
of which 1 are surviving nonsolos
reads assigned: 390
start codons at 86, 211, 344, 373
confident = false
did not find CDR3
now this is a cell
paired!

GCCGAGGACACGGCCATATATTACTGTGCGAAAGATCGTCTACCAACTCGTACCGCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTGTGGTAGCTTTCCTAGAACGTTCGGCCAAGGGACCAAGGTGGAACTCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.127 = CTCGGAGGTCACACGC-1

using 3596 reads

====================================================================================

graph has 2023 edges initially, 42 edges after simplification

total ucounts = 420
nonsolo ucounts = 181[2^77, 3^32, 4^14, 5^8, 6^6, 7^2, 8^3, 9^7, 10, 11, 12, 14, 15^2, 23, 28^2, 31, 36, 37, 39, 40^2, 43, 44, 48^2, 49, 50, 51, 56^2, 57, 58, 66, 129, 210, 313, 480, 737]
surviving nonsolo ucounts = 26[23, 28^2, 31, 36, 37, 39, 40^2, 43, 44, 48^2, 49, 50, 51, 56^2, 57, 58, 66, 129, 210, 313, 480, 737]
ids = [58, 30, 168, 186, 293, 56, 363, 224, 276, 89, ...]

====================================================================================

UMI info for barcode CTCGGAGGTCACACGC-1 contig 1 = GATCAGGACT...
umi AACTAACCAC = 56 reads: +397 validated
umi AATTCCACTA = 28 reads: +117 -1 +235 -1 +4 -2 +1 -1 +1 -1 +14 -3 +16 non-validated
umi ACTCTGCACC = 40 reads: +60 -1XX +336 invalidated
umi AGAAGGGGTA = 24 reads: -1 +3 -1 +291 -1 +1 -1 +5 -1 +2 -2 +1 -1 +1 -2 +5 -2 +3 -1 +1 -1 +1 -1 +1 -1 +15 -51 non-validated
umi ATCTCATCGC = 41 reads: -38 +322 -13 +24 non-validated
umi CATCGGTCCT = 309 reads: -369 +3 -3XX +7 -3XX +12 invalidated
umi CCTTAAGTAT = 52 reads: +49 -3XX +1 -4XX +3 -1XX +2 -1XX +1 -5XX +323 -1 +2 -1 invalidated
umi CGGAGGATCC = 28 reads: +397 validated
umi CTAGATTATT = 30 reads: +336 -61 non-validated
umi CTATCGCATT = 54 reads: +397 validated
umi CTCCTACCGA = 51 reads: +297 -3 +97 non-validated
umi CTTTCCTGTG = 40 reads: -27 +339 -1 +3 -1X +4 -2 +5 -2 +13 invalidated
umi GACCACTCCT = 51 reads: -16 +3 -1 +340 -1 +36 non-validated
umi GCCCGCTACC = 51 reads: +395 -1 +1 non-validated
umi GTAAATTTTG = 42 reads: +397 validated
umi GTCCGGGTCA = 36 reads: +397 validated
umi TAAGTTTCAT = 62 reads: +213 -1XX +183 invalidated
umi TACCTCTGGC = 42 reads: +397 validated
umi TCCTATGGGT = 64 reads: +397 validated
umi TCTATTCAGG = 40 reads: +372 -25 non-validated
umi TGAAACCAGC = 45 reads: +397 validated
umi TTTACAATCG = 58 reads: +14 -1XX +382 invalidated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=14)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 96 reads
cdr3 = CMQALETPFTF at 366, score = 8 + 7
umis assigned: [17, 30, 56, 58, 89, 127, 157, 168, 186, 190] and 12 others
of which 22 are surviving nonsolos
reads assigned: 1203
start codons at 30, 63, 99, 187, 211, 369, 469
confident = true

REJECT CONTIGS

TIG 1[bases=312]
87-130 ==> 20-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
130-312 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [65, 260]
of which 2 are surviving nonsolos
reads assigned: 681
start codons at 87
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.136 = CTCGGAGGTCGCTTTC-1

using 4878 reads

====================================================================================

graph has 3351 edges initially, 52 edges after simplification

total ucounts = 739
nonsolo ucounts = 293[2^134, 3^62, 4^35, 5^23, 6^4, 7^4, 8^6, 9, 10^2, 12, 14, 17, 41, 80, 107, 112, 122, 123, 179, 180, 182, 193, 198, 202, 214, 222, 233, 241, 247, 251, 424]
surviving nonsolo ucounts = 18[41, 107, 112, 122, 123, 179, 180, 182, 193, 198, 202, 214, 222, 233, 241, 247, 251, 424]
ids = [431, 48, 621, 115, 108, 204, 31, 249, 329, 16, ...]

====================================================================================

UMI info for barcode CTCGGAGGTCGCTTTC-1 contig 1 = AAGAACCTGC...
umi AACCTTGGCG = 197 reads: +376 validated
umi AATACAGTGG = 181 reads: +376 validated
umi AATGGTTAAC = 202 reads: +376 validated
umi ACGAAGGTAC = 247 reads: +376 validated
umi AGTACTCCTC = 122 reads: +376 validated
umi CACCGCTCAA = 184 reads: +376 validated
umi GGAATGGGTT = 41 reads: +213 -2 +161 non-validated
umi TAGGACGCCG = 226 reads: +376 validated
umi TTCGATGATG = 215 reads: +376 validated

UMI info for barcode CTCGGAGGTCGCTTTC-1 contig 2 = GGGATCACAC...
umi ACATTTCTAT = 96 reads: +405 -28 non-validated
umi ACTTATGAGT = 21 reads: +8 -1XX +36 -1XX +1 -2XX +5 -1XX +7 -1XX +5 -1XX +2 -1XX +2 -1XX +6 -1XX +45 -2XX +2 -1XX +7 -3XX +4 -4XX +1 -5XX +2 -2X +2 -271X invalidated
umi AGGCTCACAT = 112 reads: +374 -5 +6 -1 +2 -1 +8 -1 +2 -1 +17 -1 +2 -1 +11 non-validated
umi TGAGTAGCTC = 107 reads: +431 -2 non-validated
umi TTATTTCTGT = 224 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=639]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-398 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
428-639 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 228 reads
cdr3 = CQAWDSSTASF at 367, score = 6 + 8
umis assigned: [16, 31, 38, 62, 115, 204, 431, 535, 685]
of which 9 are surviving nonsolos
reads assigned: 1580
start codons at 52, 57, 113, 200, 346, 350
confident = true

TIG 2[bases=495]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=4)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=0)
436-493 ==> 6-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CATEVRFLEPSDYYYGMDVW at 402, score = 9 + 7
umis assigned: [48, 76, 108, 621, 676]
of which 4 are surviving nonsolos
reads assigned: 550
start codons at 60, 216, 258, 280, 324, 357, 450
confident = true

REJECT CONTIGS

TIG 1[bases=646]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=4)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [32, 183, 249, 295, 329]
of which 5 are surviving nonsolos
reads assigned: 1248
start codons at 46, 200, 350, 375, 380
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCAACAGAGGTACGATTTTTGGAGCCAAGTGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCATCGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.138 = CTCGGAGGTCTGGAGA-1

using 307 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 9, 291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

UMI info for barcode CTCGGAGGTCTGGAGA-1 contig 1 = AGCTCTCAGA...
umi GCTCTCGTTT = 277 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=557]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=0)
449-512 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
512-557 ==> 0-45 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDYIDYGVFYYYYGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 79, 230, 235, 382, 469, 530
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.144 = CTCGGAGGTGCAGTAG-1

using 476 reads

====================================================================================

graph has 246 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[71, 120, 280]
surviving nonsolo ucounts = 3[71, 120, 280]
ids = [5, 3, 1]

====================================================================================

UMI info for barcode CTCGGAGGTGCAGTAG-1 contig 1 = GCTCTGCTTC...
umi ATCGCTCGGA = 278 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.154 = CTCGGAGGTTCAGACT-1

using 768 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 231, 530]
surviving nonsolo ucounts = 2[231, 530]
ids = [3, 1]

====================================================================================

UMI info for barcode CTCGGAGGTTCAGACT-1 contig 1 = TGGGGGGGTC...
umi ACGAACCGTT = 531 reads: +388 validated
umi CAAGGCTGGG = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=641]
42-376 ==> 0-334 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 153 reads
cdr3 = CNSFTSSYTLVF at 366, score = 8 + 9
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 749
start codons at 42, 243, 250, 253, 562
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.157 = CTCGGAGGTTGAGTTC-1

using 36 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.159 = CTCGGAGGTTTGGCGC-1

using 267 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode CTCGGAGGTTTGGCGC-1 contig 1 = GAAGAGCTGC...
umi CGCCGGAGAG = 240 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQHATSPFTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.163 = CTCGGAGTCACATAGC-1

using 7112 reads

====================================================================================

graph has 4737 edges initially, 98 edges after simplification

total ucounts = 918
nonsolo ucounts = 400[2^160, 3^89, 4^46, 5^25, 6^21, 7^15, 8^6, 9, 10^2, 11^6, 12, 13, 21, 30, 31, 35, 126, 136, 150, 160, 171, 176, 194, 208, 210, 211, 223, 234, 235, 237^2, 239, 248, 254, 257, 277, 292, 330, 377]
surviving nonsolo ucounts = 24[35, 126, 136, 150, 160, 171, 176, 194, 208, 210, 211, 223, 234, 235, 237^2, 239, 248, 254, 257, 277, 292, 330, 377]
ids = [744, 879, 913, 659, 485, 876, 112, 446, 105, 564, ...]

====================================================================================

UMI info for barcode CTCGGAGTCACATAGC-1 contig 1 = ACCCAAAAAC...
umi AATGTTTAAC = 14 reads: -397 +7 -1XX +2 -1XX +3 -2XX +17 invalidated
umi ACACCCGTCC = 251 reads: +430 validated
umi TACAAGCAAG = 145 reads: +430 validated
umi TTGCCTCTGG = 101 reads: +428 -1 +1 non-validated
umi TTTTTCATGC = 136 reads: +430 validated

UMI info for barcode CTCGGAGTCACATAGC-1 contig 2 = GTGGGCTCAG...
umi ACCTTTAGTC = 215 reads: +385 validated
umi ACTTCTTTCG = 258 reads: +385 validated
umi GGCATAGGAG = 212 reads: +385 validated
umi GGTATGGGGA = 243 reads: +385 validated
umi TCCTTTTGCA = 34 reads: +385 validated
umi TGCTGAGTCA = 226 reads: +385 validated
umi TTGATGGTTC = 172 reads: +385 validated

UMI info for barcode CTCGGAGTCACATAGC-1 contig 3 = GTGGGTCCAG...
umi ACGGGGTCGA = 172 reads: +376 validated
umi AGTCCGTCGA = 251 reads: +376 validated
umi CTCTGCGAGT = 196 reads: +376 validated
umi GAAGTCTTTA = 163 reads: +376 validated
umi GGCCTAACTA = 234 reads: +376 validated
umi TATTCTCAGA = 242 reads: +376 validated
umi TCGTGAACTT = 274 reads: +376 validated
umi TGAATCCCCA = 235 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=600]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=12)
429-484 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
484-600 ==> 0-116 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 4 umis using 63 reads
cdr3 = CARSPQEGMWGYYYGMDVW at 396, score = 8 + 7
umis assigned: [65, 75, 659, 879, 913]
of which 5 are surviving nonsolos
reads assigned: 631
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 420, 436, 441
confident = true

TIG 2[bases=631]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=3)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 257 reads
cdr3 = CYSTDSSGNHRGVF at 350, score = 7 + 8
umis assigned: [105, 139, 564, 579, 744, 799, 876]
of which 7 are surviving nonsolos
reads assigned: 1320
start codons at 35, 96, 165, 234, 296, 333
confident = true

TIG 3[bases=622]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=17)
373-411 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
411-622 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 292 reads
cdr3 = CQSADSSGTLF at 350, score = 8 + 8
umis assigned: [112, 181, 446, 485, 567, 704, 750, 780]
of which 8 are surviving nonsolos
reads assigned: 1736
start codons at 35, 96, 165, 183, 221
confident = true

REJECT CONTIGS

TIG 1[bases=568]
0-81 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=3)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [49, 475, 514, 897]
of which 4 are surviving nonsolos
reads assigned: 1055
start codons at 34, 67, 95, 103, 191, 353, 373, 474
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 50.165 = CTCGGAGTCACCATAG-1

using 348 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 340]
surviving nonsolo ucounts = 1[340]
ids = [3]

====================================================================================

UMI info for barcode CTCGGAGTCACCATAG-1 contig 1 = GGAATCAGTC...
umi GACTCTCAAT = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk050-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk050-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

9.595 seconds used processing barcodes, peak mem = 0.23
