[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.21 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk048-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk048-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk048.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.0 = CTCGAAACAATAGAGT-1

using 6406 reads

====================================================================================

graph has 3726 edges initially, 102 edges after simplification

total ucounts = 473
nonsolo ucounts = 281[2^52, 3^30, 4^41, 5^16, 6^17, 7^23, 8^20, 9^11, 10^7, 11^8, 12^14, 13^6, 14^3, 15^4, 16^4, 17^3, 18^2, 19, 20, 21^2, 24, 71, 121, 236, 259, 265, 268, 274, 298, 300, 329, 343, 348, 355, 369, 656]
surviving nonsolo ucounts = 14[16, 71, 121, 236, 259, 265, 268, 274, 300, 329, 343, 348, 355, 656]
ids = [265, 24, 455, 468, 108, 304, 202, 188, 245, 159, ...]

====================================================================================

UMI info for barcode CTCGAAACAATAGAGT-1 contig 1 = AGACCCACTC...
umi ACGATTTACC = 351 reads: +388 validated
umi AGCAAATGCC = 286 reads: +17 -1XX +33 -1XX +15 -1XX +6 -1XX +61 -1XX +3 -1XX +7 -1XX +1 -1XX +4 -1XX +2 -2XX +5 -3XX +44 -1XX +1 -1XX +8 -1XX +3 -2XX +3 -2XX +20 -1XX +2 -1XX +11 -1XX +8 -1XX +3 -1XX +29 -1XX +7 -1XX +10 -1XX +3 -2XX +2 -1XX +1 -1XX +3 -2XX +1 -14 +1 -2XX +6 -5XX +7 -1XX +4 invalidated
umi ATCCAGCCGG = 344 reads: +388 validated
umi CAGACTGTTC = 257 reads: +388 validated
umi CCCTCCTTTG = 333 reads: +388 validated
umi GACAATCAGT = 304 reads: +388 validated
umi GTCAATATAC = 268 reads: +388 validated

UMI info for barcode CTCGAAACAATAGAGT-1 contig 2 = GAGCTCTGGG...
umi ACCCTATTGG = 69 reads: +376 -1 +9 -1 +2 -23 non-validated
umi CATGCTACGC = 162 reads: +29 -1XX +6 -1XX +6 -1XX +13 -1XX +7 -3 +6 -1XX +2 -1XX +9 -1XX +1 -1XX +2 -1XX +9 -1XX +38 -1XX +5 -2XX +3 -3XX +9 -1XX +2 -1XX +5 -2XX +1 -30 +3 -6XX +6 -1XX +4 -2XX +1 -1XX +1 -2XX +3 -1XX +2 -1XX +38 -2XX +6 -1XX +24 -1XX +8 -1XX +25 -5XX +2 -1XX +1 -8XX +3 -2XX +1 -3XX +1 -1X +1 -2X +3 -1 +5 -1XX +2 -1XX +3 -2XX +5 -1XX +11 invalidated
umi CGGTGCTATT = 269 reads: +412 validated
umi GCGCCGCTGG = 17 reads: -2 +122 -57 +124 -12 +56 -39 non-validated
umi TCCAATAAGG = 659 reads: +182 -1XX +1 -2XX +1 -5XX +1 -12XX +1 -186XX +1 -2XX +4 -2XX +1 -4XX +1 -2XX +3 invalidated
umi TTCTGGGGCA = 122 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 9-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
20-371 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=3)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 303 reads
cdr3 = CLQDYNYPLTF at 347, score = 9 + 9
umis assigned: [30, 44, 70, 108, 159, 245, 304]
of which 6 are surviving nonsolos
reads assigned: 2100
start codons at 20, 26, 82, 95, 177, 231, 450
confident = true

TIG 2[bases=563]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=4)
446-492 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 25 reads
cdr3 = CGQGIAVGGIDYW at 422, score = 9 + 6
umis assigned: [24, 128, 202, 265, 371, 455]
of which 5 are surviving nonsolos
reads assigned: 1275
start codons at 80, 231, 236, 294, 297, 315, 383
confident = true

REJECT CONTIGS

TIG 1[bases=555]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=5)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [188, 272, 468]
of which 3 are surviving nonsolos
reads assigned: 846
start codons at 27, 33, 89, 102, 165, 238, 461
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGAGCTGAGGACACGGCTGTGTATTACTGTGGTCAGGGGATAGCAGTGGGTGGGATTGACTACTGGGGCCAGGGAACCCTGGTCATCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.3 = CTCGAAACACAAGTAA-1

using 467 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 4, 8, 168, 280]
surviving nonsolo ucounts = 2[168, 280]
ids = [3, 6]

====================================================================================

UMI info for barcode CTCGAAACACAAGTAA-1 contig 1 = AGGAATCAGT...
umi GTAATAGGAG = 170 reads: +388 validated
umi TTACTCGGTA = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 78 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 445
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.5 = CTCGAAACACAGATTC-1

using 222 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 2[5, 204]
surviving nonsolo ucounts = 1[204]
ids = [4]

====================================================================================

UMI info for barcode CTCGAAACACAGATTC-1 contig 1 = GCTCTGCTTC...
umi GACATCGGTC = 195 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=529]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-529 ==> 0-87 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.8 = CTCGAAACACCAGGTC-1

using 484 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 181, 293]
surviving nonsolo ucounts = 2[181, 293]
ids = [6, 1]

====================================================================================

UMI info for barcode CTCGAAACACCAGGTC-1 contig 1 = AAATACTTTC...
umi TCCGGCTTCT = 179 reads: +415 validated

UMI info for barcode CTCGAAACACCAGGTC-1 contig 2 = GGGGGCTGGG...
umi ATGAATCTAA = 289 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=521]
0-39 ==> 106-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
39-389 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=18)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-521 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDFPGNYFTFDIW at 378, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 39, 83, 163, 233, 435
confident = false

TIG 2[bases=565]
45-388 ==> 0-343 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=19)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
436-565 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSSYSSIYTLVVF at 369, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 45, 159, 196, 202, 249, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.9 = CTCGAAACACCAGTTA-1

using 10586 reads

====================================================================================

graph has 4987 edges initially, 65 edges after simplification

total ucounts = 784
nonsolo ucounts = 396[2^153, 3^73, 4^55, 5^37, 6^13, 7^12, 8^12, 10^3, 11^2, 12, 14, 15, 16, 30, 54, 118, 122, 162, 167, 184, 205, 238, 241, 252, 258, 260, 263, 265, 271, 280, 284, 287, 302, 313, 315, 322, 334, 338, 347, 350, 358, 359, 459, 567, 596]
surviving nonsolo ucounts = 32[30, 54, 118, 122, 162, 167, 184, 205, 238, 241, 252, 258, 260, 263, 265, 271, 280, 284, 287, 302, 313, 315, 322, 334, 338, 347, 350, 358, 359, 459, 567, 596]
ids = [538, 26, 432, 18, 308, 752, 364, 295, 644, 749, ...]

====================================================================================

UMI info for barcode CTCGAAACACCAGTTA-1 contig 1 = ACTTTCTGAG...
umi AACCAGGGCT = 122 reads: +422 -12 +5 non-validated
umi AACGTATCGT = 55 reads: +439 validated
umi AATTCGATCT = 265 reads: +439 validated
umi ATCGGTTGGC = 272 reads: +439 validated
umi CCAGGCAAAT = 260 reads: +439 validated
umi CCCGTCAACA = 569 reads: +439 validated
umi CCTGACCTCT = 209 reads: +439 validated
umi CTCTAGTACA = 276 reads: +439 validated
umi CTTCTGGACC = 311 reads: +439 validated
umi GTAGCACCAC = 355 reads: +439 validated
umi TCGTCGTTTC = 237 reads: +439 validated
umi TTGCGTTCTC = 164 reads: +439 validated

UMI info for barcode CTCGAAACACCAGTTA-1 contig 2 = TGGGGGATCA...
umi AAATTCCGGC = 344 reads: +397 validated
umi AACCTACTTC = 286 reads: +397 validated
umi CAGTTACTCT = 347 reads: +397 validated
umi CCACTTCATG = 315 reads: +397 validated
umi CCATGTCCGC = 295 reads: +397 validated
umi CGAGATCAAC = 162 reads: +397 validated
umi CGGAGCTCAA = 321 reads: +397 validated
umi CTCACACCCT = 185 reads: +397 validated
umi CTCATATTCC = 334 reads: +397 validated
umi CTCGAACCAA = 250 reads: +397 validated
umi GCAGGACACC = 120 reads: +397 validated
umi GGTTCGGTCC = 332 reads: +397 validated
umi GTGTGCGTGC = 304 reads: +397 validated
umi TAACACCCTT = 283 reads: +397 validated
umi TAGAGCTATC = 259 reads: +397 validated
umi TTGATTTCGT = 237 reads: +397 validated
umi TTTCGAGCGT = 266 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=545]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=20)
423-474 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 269 reads
cdr3 = CARSALRGFGELLTRFWFDPW at 380, score = 9 + 7
umis assigned: [18, 26, 45, 120, 249, 265, 295, 381, 401, 502] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3044
start codons at 35, 79, 225
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 696 reads
cdr3 = CMQALQTPVTF at 371, score = 9 + 8
umis assigned: [13, 23, 213, 248, 253, 308, 331, 364, 366, 378] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4568
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true
now this is a cell
paired!

TATTACTGTGCGAGATCAGCTCTTAGGGGGTTCGGGGAGTTATTAACCAGATTCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCAGTCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.13 = CTCGAAACACGACTCG-1

using 8321 reads

====================================================================================

graph has 3076 edges initially, 40 edges after simplification

total ucounts = 365
nonsolo ucounts = 154[2^56, 3^23, 4^17, 5^10, 6^7, 7^2, 8^6, 10^2, 17, 29, 81, 90, 121, 127, 129, 137, 157, 172, 188, 191, 207, 220, 234, 235, 251, 259, 264, 270, 286, 288, 301, 329, 352, 356, 367, 398, 425, 503, 703]
surviving nonsolo ucounts = 28[29, 81, 90, 121, 127, 137, 172, 188, 191, 207, 220, 234, 235, 251, 259, 264, 270, 286, 288, 301, 329, 352, 356, 367, 398, 425, 503, 703]
ids = [55, 354, 291, 197, 225, 34, 332, 255, 347, 302, ...]

====================================================================================

UMI info for barcode CTCGAAACACGACTCG-1 contig 1 = GGAGTCAGAC...
umi ACGTTGTACC = 136 reads: -372X +8 -1XX +5 -2XX +6 invalidated
umi ACTTATGAGT = 422 reads: +32 -1XX +1 -4XX +1 -2XX +1 -1XX +1 -1XX +1 -4XX +1 -300X +1 -1XX +3 -1XX +1 -1XX +1 -3XX +1 -2XX +1 -2XX +25 invalidated
umi AGTGGACAGG = 276 reads: +394 validated
umi ATGATTTGCC = 267 reads: +394 validated
umi ATGTAAAGCG = 368 reads: +394 validated
umi CAAAGATACG = 341 reads: -353 +1 -1X +2 -3X +2 -1XX +7 -2XX +8 -1XX +5 -2XX +6 invalidated
umi CAGACGATCT = 373 reads: +394 validated
umi CATTGGCTTT = 250 reads: +394 validated
umi CCAGCTCGGG = 400 reads: +394 validated
umi CGATTAGGGT = 226 reads: +394 validated
umi GATACTGGGG = 122 reads: +394 validated
umi GCAGCCCCTC = 503 reads: +394 validated
umi GCTGCATCTA = 10 reads: -363 +7 -2X +8 -1X +5 -2X +6 invalidated
umi GTAGGCCATT = 190 reads: +394 validated
umi TAGGCACATA = 289 reads: +394 validated
umi TATTCTGGTC = 289 reads: +394 validated
umi TCATCTGGCT = 205 reads: +394 validated
umi TCTTGATACC = 233 reads: +394 validated
umi TGAGCTCGAT = 259 reads: +394 validated
umi TGCTACGTTG = 304 reads: +394 validated
umi TGTCATAGGC = 180 reads: +394 validated
umi TGTTCTTCAA = 643 reads: -359X +6 -1XX +4 -2XX +8 -2XX +4 -2XX +6 invalidated
umi TTCAAGTTTA = 186 reads: +394 validated
umi TTGAGAACGT = 81 reads: +394 validated
umi TTTGTTACCG = 333 reads: +394 validated

UMI info for barcode CTCGAAACACGACTCG-1 contig 2 = AGCTCTGGGA...
umi AGATGTCTAG = 28 reads: +51 -8 +349 -16 non-validated
umi CCAGTACGCG = 221 reads: +424 validated
umi TATCGGGCCA = 88 reads: +408 -16 non-validated

GOOD CONTIGS

TIG 1[bases=556]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 894 reads
cdr3 = CQQYQSYSGGLTF at 353, score = 9 + 8
umis assigned: [34, 44, 63, 75, 82, 96, 102, 108, 110, 140] and 15 others
of which 25 are surviving nonsolos
reads assigned: 6730
start codons at 26, 32, 88, 101, 462
confident = true

TIG 2[bases=535]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-409 ==> 0-329 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=20)
452-504 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=7)
504-535 ==> 0-31 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAKPSIPVSGTLYFHHW at 422, score = 8 + 6
umis assigned: [55, 111, 291]
of which 3 are surviving nonsolos
reads assigned: 336
start codons at 80, 236, 383
confident = true
now this is a cell
paired!

GACACAGGCGTTTATTACTGTGCTAAACCGTCAATACCAGTGTCTGGAACGTTATACTTCCACCACTGGGGCCAGGGCGCCCTGGTCACCGTCTCTTCAG <==> AGCCTGCAGCCTGAGGATTTTGCAACTTATTACTGCCAACAATATCAAAGTTACTCGGGGGGGCTCACTTTCGGCCCTGGGACCAAAGTGGATTTCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.15 = CTCGAAACACGGCCAT-1

using 509 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 240, 258]
surviving nonsolo ucounts = 2[240, 258]
ids = [4, 1]

====================================================================================

UMI info for barcode CTCGAAACACGGCCAT-1 contig 1 = AGCTTCAGCT...
umi ACGGTCCAAC = 239 reads: +388 validated

UMI info for barcode CTCGAAACACGGCCAT-1 contig 2 = GAGCTGCTCA...
umi CGTCGCGATA = 1 reads: -254 +1 -1 +4 -2X +4 -1 +1 -1 +2 -1 +7 -1 +3 -2X +4 -2X +6 -3X +5 -1 +2 -80 invalidated
umi CGTCGGTATA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=454]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=7)
397-435 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
435-454 ==> 0-19 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CAAWDDSLNGYVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 47, 351, 376, 381, 393, 399
confident = false

TIG 2[bases=554]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYDSSPALTF at 354, score = 9 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 30, 225, 238, 364, 405, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.17 = CTCGAAACACGTCAGC-1

using 193 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=305]
5-62 ==> 296-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
111-145 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
145-305 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 51, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 6, 199
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.25 = CTCGAAACAGCTGTAT-1

using 332 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.31 = CTCGAAACAGTTTACG-1

using 261 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 257]
surviving nonsolo ucounts = 1[257]
ids = [0]

====================================================================================

UMI info for barcode CTCGAAACAGTTTACG-1 contig 1 = AGGAGTCAGT...
umi CTCCTATCTT = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=20)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CHQFDDLPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 27, 33, 89, 102, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.33 = CTCGAAACATACCATG-1

using 468 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 461]
surviving nonsolo ucounts = 1[461]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=427]
4-257 ==> 98-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
254-291 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
291-427 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYSTF at 233, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 454
start codons at 117, 120, 213, 333
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.45 = CTCGAAAGTAGAAGGA-1

using 146 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=561]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
436-561 ==> 0-125 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 46, 200, 350, 375
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.46 = CTCGAAAGTATAGGGC-1

using 270 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode CTCGAAAGTATAGGGC-1 contig 1 = AGGAGTCAGT...
umi AATCTCGCTA = 265 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYDNLPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.47 = CTCGAAAGTATGAAAC-1

using 328 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4^2, 317]
surviving nonsolo ucounts = 1[317]
ids = [0]

====================================================================================

UMI info for barcode CTCGAAAGTATGAAAC-1 contig 1 = GGGAGGAGTC...
umi AAGCTATTGC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYTTPWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.53 = CTCGAAAGTGACTACT-1

using 230 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=509]
51-118 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
82-435 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=14)
481-506 ==> 17-42 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
cdr3 = CARDAPYMI at 424, score = 9 + 4
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 82, 233, 238, 296, 299, 308, 385, 434, 445, 468, 478, 484
confident = false
VJ delta = -22
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.61 = CTCGAAAGTGTTAAGA-1

using 1971 reads

====================================================================================

graph has 1396 edges initially, 18 edges after simplification

total ucounts = 287
nonsolo ucounts = 148[2^55, 3^34, 4^25, 5^14, 6^4, 7^3, 8^3, 10^3, 11, 13, 14, 218, 315, 356, 424]
surviving nonsolo ucounts = 4[218, 315, 356, 424]
ids = [167, 102, 128, 262]

====================================================================================

UMI info for barcode CTCGAAAGTGTTAAGA-1 contig 1 = GAAGAGCTGC...
umi CTAAATACGT = 312 reads: +385 validated
umi CTTCCTCTCT = 361 reads: +385 validated
umi GGTGAGTATC = 204 reads: +385 validated
umi TTCATTGGAG = 431 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 210 reads
cdr3 = CQQYGSSPWTF at 357, score = 8 + 8
umis assigned: [102, 128, 167, 262]
of which 4 are surviving nonsolos
reads assigned: 1283
start codons at 33, 241, 367, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.65 = CTCGAAAGTTACGGAG-1

using 406 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[182, 220]
surviving nonsolo ucounts = 2[182, 220]
ids = [2, 3]

====================================================================================

UMI info for barcode CTCGAAAGTTACGGAG-1 contig 1 = AGCTCTCAGA...
umi CGTACTTCTA = 184 reads: +415 validated
umi CGTACTTCTC = 217 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=628]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-387 ==> 0-308 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=34)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
494-628 ==> 0-134 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 34 reads
cdr3 = CVRSGTIVYYFESW at 421, score = 8 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 395
start codons at 79, 235, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.72 = CTCGAAAGTTGTTTGG-1

using 334 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[333]
surviving nonsolo ucounts = 1[333]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.77 = CTCGAAATCAGAGACG-1

using 136 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 126]
surviving nonsolo ucounts = 1[126]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.80 = CTCGAAATCATGGTCA-1

using 344 reads

====================================================================================

graph has 164 edges initially, 10 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^2, 3^3, 5, 92, 228]
surviving nonsolo ucounts = 2[92, 228]
ids = [8, 7]

====================================================================================

UMI info for barcode CTCGAAATCATGGTCA-1 contig 1 = GGCTGGGATC...
umi CGGCACCAAT = 221 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=508]
42-380 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
433-508 ==> 0-75 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYTNSTTPGVF at 366, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 42, 178, 250
confident = false

REJECT CONTIGS

TIG 1[bases=483]
0-335 ==> 2-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
342-380 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
380-483 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSADSSGTYVVF at 313, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 59, 128, 146, 341
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.93 = CTCGAAATCGTGGACC-1

using 705 reads

====================================================================================

graph has 298 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 7, 344, 348]
surviving nonsolo ucounts = 2[344, 348]
ids = [5, 4]

====================================================================================

UMI info for barcode CTCGAAATCGTGGACC-1 contig 1 = GGAGAAGAGC...
umi TCACGTGGGT = 321 reads: +388 validated

UMI info for barcode CTCGAAATCGTGGACC-1 contig 2 = TTGGTGATCA...
umi AAGCATCCAA = 2 reads: +5 -1X +2 -1X +7 -1X +12 -1X +6 -1X +3 -55 +2 -1 +4 -2X +3 -2 +5 -1 +6 -1 +10 -1X +10 -1X +3 -2X +2 -297 invalidated
umi TCCGGTTACA = 341 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=520]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
424-520 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYGSSPPFTF at 360, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 36, 244, 370, 466
confident = false

TIG 2[bases=583]
0-33 ==> 46-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
33-386 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
388-419 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=2)
418-481 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
481-583 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARESITIFGVVIIRGYYYYGMDVW at 375, score = 9 + 7
umis assigned: [0, 5]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 33, 189, 250, 268, 336, 438, 499, 560
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.95 = CTCGAAATCTAACTTC-1

using 10740 reads

====================================================================================

graph has 6899 edges initially, 102 edges after simplification

total ucounts = 1177
nonsolo ucounts = 620[2^222, 3^130, 4^97, 5^58, 6^28, 7^13, 8^19, 9^5, 10^5, 11^5, 12^5, 16^2, 22, 29, 47, 62, 72, 124, 126, 145, 172, 203, 223, 225, 233, 250, 258^2, 260^2, 272, 273, 284, 285, 297, 302, 304, 308, 312, 350, 431, 477, 1154]
surviving nonsolo ucounts = 27[47, 62, 72, 126, 145, 172, 203, 223, 225, 233, 250, 258, 260^2, 272, 273, 284, 285, 297, 302, 304, 308, 312, 350, 431, 477, 1154]
ids = [265, 957, 144, 542, 664, 233, 926, 871, 502, 816, ...]

====================================================================================

UMI info for barcode CTCGAAATCTAACTTC-1 contig 1 = AGTCTGGGCC...
umi AACTTTGACC = 53 reads: -26 +7 -1XX +7 -2XX +4 -1XX +2 -3XX +1 -1XX +2 -3XX +1 -1XX +23 -1XX +3 -1XX +1 -1XX +1 -1XX +4 -1XX +2 -2XX +3 -1XX +2 -1XX +2 -2XX +2 -2XX +1 -229X +5 -1XX +2 -1XX +2 -1XX +2 -1XX +3 -1XX +13 -1XX +1 invalidated
umi ACCTCAAGTA = 72 reads: +382 validated
umi AGGTCCGTAG = 173 reads: +382 validated
umi ATATTCCTCC = 47 reads: +363 -1 +9 -1 +1 -1 +3 -1 +2 non-validated
umi ATGATACCTC = 262 reads: +382 validated
umi CACCTTGTGT = 275 reads: +382 validated
umi CGGCCTACAG = 309 reads: +382 validated
umi CGTCCCGCTA = 275 reads: +382 validated
umi CGTTGTGACA = 186 reads: +382 validated
umi GCTCCCGTGG = 258 reads: +382 validated
umi GGGATGGCAT = 299 reads: +382 validated
umi GTAATACTGC = 253 reads: +382 validated
umi TAATCCGCGC = 238 reads: +382 validated
umi TAGAAATCAG = 286 reads: +382 validated
umi TAGCGTACCG = 308 reads: +382 validated
umi TATCTATCCG = 220 reads: +382 validated
umi TCCTCATCTG = 181 reads: +376 -1 +2 -1 +2 non-validated
umi TGTACATGAT = 1092 reads: -310X +1 -2XX +1 -2XX +1 -4XX +5 -1XX +1 -4XX +1 -11XX +38 invalidated
umi TTCTCCGGGA = 318 reads: +382 validated

UMI info for barcode CTCGAAATCTAACTTC-1 contig 2 = ATACTTTCTG...
umi AAAGTCAGGC = 355 reads: +424 validated
umi ACATCTTATG = 300 reads: +424 validated
umi AGCATCAACC = 259 reads: +424 validated
umi CTCTATCCTC = 130 reads: +424 validated
umi GCCATTATTA = 132 reads: -398X +1 -1X +1 -7X +1 -5XX +1 -1XX +2 -3XX +3 invalidated
umi GGGCCTATGC = 437 reads: +424 validated
umi GTGATTTCAC = 285 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=9)
384-422 ==> 8-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
422-633 ==> 0-211 on |308|IGLC7|C-REGION| [len=317] (mis=1)
junction support: 17 umis using 592 reads
cdr3 = CQVWDSSSDLAVF at 355, score = 8 + 7
umis assigned: [56, 144, 233, 265, 295, 359, 481, 494, 502, 690] and 9 others
of which 18 are surviving nonsolos
reads assigned: 4986
start codons at 40, 101, 242, 338, 554, 617
confident = true

TIG 2[bases=532]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=2)
410-461 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
461-532 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 158 reads
cdr3 = CARSGSSSGSYSNWFDPW at 376, score = 9 + 7
umis assigned: [22, 118, 202, 542, 664, 726, 786]
of which 7 are surviving nonsolos
reads assigned: 1862
start codons at 37, 81
confident = true

REJECT CONTIGS

TIG 1[bases=545]
1-40 ==> 5948-5987 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
49-69 ==> 102-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=1)
300-334 ==> 36-70 on |316|IGLJ6|J-REGION| [len=70] (mis=0)
334-545 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=10)
umis assigned: [742, 957]
of which 2 are surviving nonsolos
reads assigned: 516
start codons at 98, 148, 273, 296, 466
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGATCTGGTTCTAGTTCGGGGAGTTATTCCAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCTTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.97 = CTCGAAATCTCACATT-1

using 401 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 396]
surviving nonsolo ucounts = 1[396]
ids = [0]

====================================================================================

UMI info for barcode CTCGAAATCTCACATT-1 contig 1 = GCTACAACAG...
umi AGTCAACCGC = 401 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSTPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.101 = CTCGAAATCTGGGCCA-1

using 349 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 346]
surviving nonsolo ucounts = 1[346]
ids = [1]

====================================================================================

UMI info for barcode CTCGAAATCTGGGCCA-1 contig 1 = GGAGGAGTCA...
umi ATCGCGGTCA = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=27)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQDHNYPYSF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.102 = CTCGAAATCTTATCTG-1

using 437 reads

====================================================================================

graph has 270 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 15[2^3, 3, 4^2, 5, 6^2, 7, 9^2, 12, 15, 346]
surviving nonsolo ucounts = 1[346]
ids = [13]

====================================================================================

UMI info for barcode CTCGAAATCTTATCTG-1 contig 1 = AGCACTGAAC...
umi TAGTCTACAT = 290 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=482]
0-24 ==> 56-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
24-375 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
377-404 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=2)
409-460 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
460-482 ==> 0-22 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGNYDILTGYYARSWFDPW at 366, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 24, 175, 180, 233, 238, 241, 259, 327, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.103 = CTCGAAATCTTCAACT-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 48.105 = CTCGAAATCTTTACGT-1

using 67 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[5, 6^2, 7^3, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk048-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk048-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

9.272 seconds used processing barcodes, peak mem = 0.23
