[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.22 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk046-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk046-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk046.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.0 = CTCAGAACATGAGCGA-1

using 10593 reads

====================================================================================

graph has 4278 edges initially, 32 edges after simplification

total ucounts = 471
nonsolo ucounts = 216[2^69, 3^38, 4^15, 5^21, 6^13, 7^8, 8^6, 9^3, 10, 11^3, 12, 14, 15, 61, 89, 101, 116, 117, 122, 132, 133, 147, 198, 217, 224, 227, 232, 238^2, 246, 255, 263, 264, 286, 290, 299, 300, 306, 312, 313, 315, 353^2, 354, 358, 381, 415, 520, 853]
surviving nonsolo ucounts = 30[89, 117, 133, 147, 198, 217, 224, 227, 232, 238^2, 246, 255, 263, 264, 286, 290, 299, 306, 312, 313, 315, 353^2, 354, 358, 381, 415, 520, 853]
ids = [346, 124, 169, 143, 172, 438, 181, 189, 440, 60, ...]

====================================================================================

UMI info for barcode CTCAGAACATGAGCGA-1 contig 1 = AGGTGTTTTC...
umi AGCGCACTCC = 229 reads: +433 validated
umi CACAGAGTCT = 236 reads: +433 validated
umi CAGTAGGGCA = 116 reads: +433 validated
umi CGCGCCATCA = 123 reads: +433 validated
umi CGGCCTTTCT = 281 reads: +433 validated
umi TACATCCTGT = 88 reads: +374 -1X +11 -1 +7 -1 +18 -1 +4 -1 +1 -13 invalidated
umi TTAAATTCCG = 241 reads: +21 -1XX +4 -1XX +4 -2XX +36 -1XX +23 -1XX +16 -1XX +29 -1XX +2 -1XX +2 -1XX +1 -1XX +1 -6XX +44 -6XX +5 -3XX +1 -1XX +1 -4XX +2 -1XX +1 -1XX +1 -23XX +1 -1XX +3 -1XX +1 -1XX +11 -1XX +5 -2XX +4 -1XX +2 -1XX +31 -1XX +1 -1XX +10 -1XX +5 -1XX +9 -1XX +1 -1XX +1 -1XX +1 -40X +1 -1XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TTAGTACATT = 234 reads: +433 validated

UMI info for barcode CTCAGAACATGAGCGA-1 contig 2 = TGGGGAGGAG...
umi AATTAGATCA = 247 reads: +388 validated
umi ACTGAAGCCC = 399 reads: -358 +6 -2XX +8 -1XX +5 -1XX +7 invalidated
umi CAACAGTCAG = 262 reads: +388 validated
umi CCCTGTAGTC = 149 reads: +388 validated
umi CCTGATCACA = 298 reads: +388 validated
umi CGCTTCGGCC = 198 reads: +388 validated
umi CGGGCTTGTC = 355 reads: +388 validated
umi CGTAACTCAT = 262 reads: +388 validated
umi CGTAGTACTA = 224 reads: +388 validated
umi CGTTATTGGT = 253 reads: +388 validated
umi CGTTGTACCC = 229 reads: +388 validated
umi CTTAACTTGT = 316 reads: +388 validated
umi GATAAGGGGT = 383 reads: +388 validated
umi GCCATTAGCC = 291 reads: +388 validated
umi GGAACTGATT = 357 reads: +388 validated
umi GGTCTTTTAC = 355 reads: +388 validated
umi TGATATGGGT = 309 reads: +388 validated
umi TGCATGGCTT = 306 reads: +388 validated
umi TGTCGAAGGG = 312 reads: +388 validated
umi TTACTGTCTA = 222 reads: +388 validated
umi TTATCTATCA = 348 reads: +57 -1XX +330 invalidated
umi TTCTTTAGGG = 518 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-45 ==> 34-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
45-398 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
400-431 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
427-478 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
478-549 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 108 reads
cdr3 = CAKDPPIVVVPAAIEWFDPW at 387, score = 9 + 7
umis assigned: [60, 110, 124, 169, 175, 346, 433, 440]
of which 7 are surviving nonsolos
reads assigned: 1484
start codons at 45, 196, 201, 348, 431
confident = true

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 972 reads
cdr3 = CQQSYSTPPTF at 359, score = 9 + 8
umis assigned: [15, 44, 104, 143, 159, 172, 176, 180, 181, 188] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6497
start codons at 32, 38, 94, 107, 243, 462
confident = true
now this is a cell
paired!

GTATATTACTGTGCGAAAGATCCTCCTATTGTAGTAGTACCAGCTGCTATAGAATGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCCCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.3 = CTCAGAACATTAGGCT-1

using 200 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 190]
surviving nonsolo ucounts = 1[190]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.11 = CTCAGAAGTAGGACAC-1

using 210 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode CTCAGAAGTAGGACAC-1 contig 1 = TGAGTCTCCC...
umi TTCAAGAGGT = 188 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=508]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
433-486 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
486-508 ==> 0-22 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARLGGFVVVPAWYFDLW at 401, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 59, 233, 257, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.19 = CTCAGAAGTCCTAGCG-1

using 325 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 320]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.21 = CTCAGAAGTCGCTTCT-1

using 233 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 3[2, 11, 209]
surviving nonsolo ucounts = 1[209]
ids = [10]

====================================================================================

UMI info for barcode CTCAGAAGTCGCTTCT-1 contig 1 = ATCATCCAAC...
umi GTAAACGATG = 208 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=574]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
422-444 ==> 9-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=0)
453-503 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARSRDPVIVVVITTEEDDAFDIW at 400, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 58, 214, 256, 322, 355, 452, 455, 484
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.22 = CTCAGAAGTCGGCTCA-1

using 390 reads

====================================================================================

graph has 180 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 176, 204]
surviving nonsolo ucounts = 3[4, 176, 204]
ids = [1, 2, 0]

====================================================================================

UMI info for barcode CTCAGAAGTCGGCTCA-1 contig 1 = ACAAGAGGCA...
umi CGCGTCGCAA = 166 reads: +391 validated

UMI info for barcode CTCAGAAGTCGGCTCA-1 contig 2 = GGGAGGAACT...
umi ATCGCCAGCT = 186 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=523]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-523 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 31, 115, 188, 338, 365
confident = false

TIG 2[bases=501]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-501 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYNNWPPHTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 35, 104, 240, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.23 = CTCAGAAGTCTGGTCG-1

using 216 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [1]

====================================================================================

UMI info for barcode CTCAGAAGTCTGGTCG-1 contig 1 = GGGGTCACAA...
umi AAGCACTCTT = 208 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-547 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 33 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.24 = CTCAGAAGTGAACCTT-1

using 303 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 21, 275]
surviving nonsolo ucounts = 1[275]
ids = [4]

====================================================================================

UMI info for barcode CTCAGAAGTGAACCTT-1 contig 1 = GGAGTCAGTC...
umi CATACACGCT = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPLTF at 353, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.30 = CTCAGAAGTGGCGAAT-1

using 327 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^3, 312]
surviving nonsolo ucounts = 1[312]
ids = [6]

====================================================================================

UMI info for barcode CTCAGAAGTGGCGAAT-1 contig 1 = AGGAGTCAGA...
umi TAGCTCATGT = 314 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.35 = CTCAGAAGTTCCATGA-1

using 279 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 7, 263]
surviving nonsolo ucounts = 1[263]
ids = [1]

====================================================================================

UMI info for barcode CTCAGAAGTTCCATGA-1 contig 1 = GTCAGACCCA...
umi CAGGATAATA = 247 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=468]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-366 ==> 0-343 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
408-468 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNTPWTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 23, 29, 85, 98, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.40 = CTCAGAAGTTGGTTTG-1

using 129 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 121]
surviving nonsolo ucounts = 1[121]
ids = [7]

====================================================================================

UMI info for barcode CTCAGAAGTTGGTTTG-1 contig 1 = TCAGGACGTC...
umi TTTCGCGTTC = 117 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
16-370 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=4)
366-404 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
404-505 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYAGSNNWVF at 340, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 16, 173, 217, 224, 323, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.42 = CTCAGAAGTTTCCACC-1

using 292 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 4[2, 3, 5, 269]
surviving nonsolo ucounts = 1[269]
ids = [1]

====================================================================================

UMI info for barcode CTCAGAAGTTTCCACC-1 contig 1 = ACTTTCTGAG...
umi AATGGTTCAA = 247 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=532]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=28)
414-462 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
462-532 ==> 0-70 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARESVWGGYSSNFDNW at 380, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 35, 79, 516
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.43 = CTCAGAATCAAACCGT-1

using 315 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 13, 293]
surviving nonsolo ucounts = 1[293]
ids = [3]

====================================================================================

UMI info for barcode CTCAGAATCAAACCGT-1 contig 1 = AGACCCAGTC...
umi GTCAGCCCTA = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-507 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNYYPYTF at 347, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 20, 26, 82, 95, 198, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.44 = CTCAGAATCAATACCG-1

using 2562 reads

====================================================================================

graph has 3266 edges initially, 34 edges after simplification

total ucounts = 894
nonsolo ucounts = 426[2^169, 3^80, 4^54, 5^40, 6^41, 7^18, 8^5, 9^6, 10^4, 11^3, 12, 13, 14^2, 247, 261]
surviving nonsolo ucounts = 2[247, 261]
ids = [397, 61]

====================================================================================

UMI info for barcode CTCAGAATCAATACCG-1 contig 1 = GAGACTCAGT...
umi AATTGCCAAC = 252 reads: +388 validated

UMI info for barcode CTCAGAATCAATACCG-1 contig 2 = AGTCTCAGTC...
umi CGCCAGTGCT = 233 reads: +86 -1XX +2 -1XX +3 -1XX +5 -1XX +5 -2XX +281 invalidated

GOOD CONTIGS

TIG 1[bases=506]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
409-506 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYPLTF at 348, score = 8 + 9
umis assigned: [61]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 21, 27, 83, 96, 232, 235, 328, 451
confident = false

TIG 2[bases=505]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-355 ==> 0-335 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
408-505 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQHTHSSPRTF at 347, score = 9 + 8
umis assigned: [397]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.46 = CTCAGAATCACGACTA-1

using 203 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3^2, 192]
surviving nonsolo ucounts = 1[192]
ids = [5]

====================================================================================

UMI info for barcode CTCAGAATCACGACTA-1 contig 1 = ACCCAAAAAC...
umi GCTAAGAGCC = 177 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=500]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.47 = CTCAGAATCACGGTTA-1

using 172 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 161]
surviving nonsolo ucounts = 1[161]
ids = [4]

====================================================================================

UMI info for barcode CTCAGAATCACGGTTA-1 contig 1 = AGGAGTCAGA...
umi GAACGGTTAA = 147 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=508]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.52 = CTCAGAATCAGTACGT-1

using 299 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 291]
surviving nonsolo ucounts = 1[291]
ids = [4]

====================================================================================

UMI info for barcode CTCAGAATCAGTACGT-1 contig 1 = GATCAGGACT...
umi GATAGGTGCA = 280 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=478]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-478 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.63 = CTCAGAATCCCGACTT-1

using 464 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 219, 235]
surviving nonsolo ucounts = 2[219, 235]
ids = [2, 6]

====================================================================================

UMI info for barcode CTCAGAATCCCGACTT-1 contig 1 = AGCTTCAGCT...
umi CGACAGAGCA = 214 reads: +388 validated
umi GATCCGAATG = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=605]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-605 ==> 0-170 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 60 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 444
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.68 = CTCAGAATCCGGGTGT-1

using 165 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode CTCAGAATCCGGGTGT-1 contig 1 = GGGCCTCAGG...
umi TCTCGGCTCG = 160 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=506]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
373-411 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
411-506 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQAWDSSTAVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.74 = CTCAGAATCGCTTAGA-1

using 18 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.76 = CTCAGAATCGGTCTAA-1

using 156 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 150]
surviving nonsolo ucounts = 1[150]
ids = [2]

====================================================================================

UMI info for barcode CTCAGAATCGGTCTAA-1 contig 1 = TGGGGATGCT...
umi AGTTCTTACG = 150 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=515]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=6)
403-423 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
420-466 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
466-515 ==> 0-49 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARRFGGYSYGPHDYW at 387, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 5, 21, 30, 42, 86, 415, 424
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.78 = CTCAGAATCTCAACTT-1

using 444 reads

====================================================================================

graph has 181 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 208, 226]
surviving nonsolo ucounts = 2[208, 226]
ids = [1, 0]

====================================================================================

UMI info for barcode CTCAGAATCTCAACTT-1 contig 1 = CTCTCAGAAT...
umi AATCTTGTCG = 227 reads: +388 validated
umi CAGAGGGGGG = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=594]
64-415 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
414-452 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
452-594 ==> 0-142 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 55 reads
cdr3 = CSSYTSSSTWVF at 388, score = 7 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 413
start codons at 64, 221, 265, 272, 275
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.79 = CTCAGAATCTCATTCA-1

using 171 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 166]
surviving nonsolo ucounts = 1[166]
ids = [1]

====================================================================================

UMI info for barcode CTCAGAATCTCATTCA-1 contig 1 = GGCATGAGCA...
umi GCCTCGCAAT = 153 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=417]
0-34 ==> 30-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
34-376 ==> 0-342 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=16)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CHQSNSLPLTF at 352, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 3, 34, 232, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.88 = CTCATTAAGACAAAGG-1

using 74 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[70]
surviving nonsolo ucounts = 1[70]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.91 = CTCATTAAGACTAAGT-1

using 538 reads

====================================================================================

graph has 790 edges initially, 6 edges after simplification

total ucounts = 191
nonsolo ucounts = 96[2^28, 3^14, 4^19, 5^4, 6^11, 7^8, 8^3, 9^2, 10^4, 11, 17^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.98 = CTCATTAAGCGTGAGT-1

using 279 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 4, 265]
surviving nonsolo ucounts = 1[265]
ids = [3]

====================================================================================

UMI info for barcode CTCATTAAGCGTGAGT-1 contig 1 = GGAGTCAGAC...
umi ATCGAGGTTA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-483 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYSNTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.99 = CTCATTAAGCGTTCCG-1

using 475 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 196, 272]
surviving nonsolo ucounts = 2[196, 272]
ids = [1, 2]

====================================================================================

UMI info for barcode CTCATTAAGCGTTCCG-1 contig 1 = GCTCTGCTTC...
umi GGGTAAACCG = 271 reads: +391 validated

UMI info for barcode CTCATTAAGCGTTCCG-1 contig 2 = TGAGTCTCCC...
umi CCTTTCCGGA = 196 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=565]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-565 ==> 0-123 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDSSLSGSVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 51, 205, 358, 385
confident = false

TIG 2[bases=506]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=19)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
483-506 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARILSFRDSSGYFDNW at 401, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 59, 233, 257, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.102 = CTCATTAAGGAATTAC-1

using 779 reads

====================================================================================

graph has 400 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[773]
surviving nonsolo ucounts = 1[773]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=336]
15-163 ==> 203-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=2)
162-200 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
200-336 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSYPFTF at 139, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 757
start codons at 23, 149, 242
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.107 = CTCATTAAGTATGACA-1

using 273 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[34, 237]
surviving nonsolo ucounts = 2[34, 237]
ids = [0, 3]

====================================================================================

UMI info for barcode CTCATTAAGTATGACA-1 contig 1 = ATCAGTCCCA...
umi GCTTAAAGCG = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-479 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.111 = CTCATTACAAACTGCT-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.114 = CTCATTACAACGATCT-1

using 313 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^2, 4, 5^2, 6, 9, 274]
surviving nonsolo ucounts = 1[274]
ids = [11]

====================================================================================

UMI info for barcode CTCATTACAACGATCT-1 contig 1 = GGGGTCACAA...
umi TCCTCCCATC = 270 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=571]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-571 ==> 0-148 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.119 = CTCATTACAAGGGTCA-1

using 294 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode CTCATTACAAGGGTCA-1 contig 1 = GGAGTCAGTC...
umi CGTTGTATTC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.126 = CTCATTACACGAAGCA-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.127 = CTCATTACACGGACAA-1

using 604 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 250, 349]
surviving nonsolo ucounts = 2[250, 349]
ids = [5, 2]

====================================================================================

UMI info for barcode CTCATTACACGGACAA-1 contig 1 = AGTGACTCCT...
umi TGCGGCTGCT = 255 reads: +433 validated

UMI info for barcode CTCATTACACGGACAA-1 contig 2 = TGGGGAGGAA...
umi GCCGAGGTTC = 316 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=532]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
453-532 ==> 0-79 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CAHRLTHSSGWYGYFFDYW at 365, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 20, 64, 243, 246, 326, 335
confident = false

TIG 2[bases=486]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
419-486 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPPTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 37, 242, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.136 = CTCATTACAGTTTACG-1

using 6425 reads

====================================================================================

graph has 3266 edges initially, 48 edges after simplification

total ucounts = 519
nonsolo ucounts = 251[2^74, 3^55, 4^31, 5^24, 6^18, 7^8, 8^6, 9^4, 10^4, 11^4, 12^2, 37, 44, 63, 152, 179, 210, 224, 248, 269, 270^2, 275, 283, 287, 289, 297, 315, 335, 336, 377, 484]
surviving nonsolo ucounts = 19[37, 63, 179, 210, 224, 248, 269, 270^2, 275, 283, 287, 289, 297, 315, 335, 336, 377, 484]
ids = [169, 478, 211, 367, 465, 476, 349, 3, 490, 372, ...]

====================================================================================

UMI info for barcode CTCATTACAGTTTACG-1 contig 1 = ATCACATAAC...
umi ATTTACACGC = 370 reads: +436 validated
umi CAGCATCGAT = 36 reads: -1 +1 -1 +8 -2 +9 -1 +8 -1 +280 -1 +3 -1 +3 -1 +62 -53 non-validated
umi CCTGCTCGCA = 177 reads: +436 validated
umi GTCTTTGGGC = 199 reads: +436 validated
umi TCACGGACGA = 461 reads: -293X +2 -1XX +1 -1XX +2 -1XX +8 -4XX +3 -3XX +1 -1XX +1 -2XX +28 -5XX +1 -1XX +1 -13XX +1 -4XX +58 invalidated
umi TTATCTCTAC = 333 reads: +436 validated

UMI info for barcode CTCATTACAGTTTACG-1 contig 2 = AGGAGTCAGA...
umi AAACATGTTT = 271 reads: +385 validated
umi AACTTGTCCC = 291 reads: +385 validated
umi AAGGATTCCG = 319 reads: +385 validated
umi AGACCTACCA = 287 reads: +385 validated
umi CCTGTGTGTT = 331 reads: +385 validated
umi GCGACTCCTT = 297 reads: +385 validated
umi GGACAGGGAT = 285 reads: +385 validated
umi GTGTTCAGCT = 40 reads: +41 -1XX +10 -1XX +8 -1XX +27 -1XX +3 -1XX +2 -1XX +7 -1XX +35 -1XX +7 -2XX +4 -2XX +4 -2XX +2 -4XX +17 -1XX +4 -1XX +22 -3XX +2 -1XX +1 -2XX +5 -2XX +25 -1XX +20 -1XX +20 -1XX +5 -1XX +5 -1XX +14 -1X +1 -38X +9 -1XX +12 invalidated
umi GTTAACCCTT = 277 reads: +385 validated
umi TGTCCTGTTC = 253 reads: +385 validated
umi TTCACCAGCC = 271 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
414-430 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 82 reads
cdr3 = CARGSDYGDYQGYYYYGMDVW at 400, score = 9 + 7
umis assigned: [151, 169, 211, 367, 414, 487]
of which 6 are surviving nonsolos
reads assigned: 1554
start codons at 58, 209, 256, 355, 451
confident = true

TIG 2[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 461 reads
cdr3 = CQQYNSYSTF at 354, score = 8 + 8
umis assigned: [3, 19, 26, 80, 214, 309, 323, 370, 372, 476] and 1 others
of which 10 are surviving nonsolos
reads assigned: 2868
start codons at 27, 33, 89, 102, 334, 454
confident = true

REJECT CONTIGS

TIG 1[bases=580]
24-369 ==> 0-345 on |742|IGHV4-38-2|L-REGION+V-REGION| [len=345] (mis=1)
384-415 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
415-478 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
478-580 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [349, 465, 478]
of which 3 are surviving nonsolos
reads assigned: 552
start codons at 3, 24, 68, 435, 496, 557
confident = false
full length stopped transcript of length 580
frameshifted full length stopped transcript of length 580
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGAGGGTCGGACTACGGTGACTACCAGGGGTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCAACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.140 = CTCATTACATCTACGA-1

using 263 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 8, 249]
surviving nonsolo ucounts = 1[249]
ids = [3]

====================================================================================

UMI info for barcode CTCATTACATCTACGA-1 contig 1 = ATCAGTCCCA...
umi GATATAGTCT = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.142 = CTCATTACATGAAGTA-1

using 713 reads

====================================================================================

graph has 344 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 702]
surviving nonsolo ucounts = 1[702]
ids = [3]

====================================================================================

UMI info for barcode CTCATTACATGAAGTA-1 contig 1 = GAAGAGCTGC...
umi GAAAAGACGA = 711 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CQQYGSSLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 692
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.149 = CTCATTAGTAAGGGAA-1

using 1713 reads

====================================================================================

graph has 2328 edges initially, 22 edges after simplification

total ucounts = 679
nonsolo ucounts = 328[2^124, 3^66, 4^40, 5^22, 6^26, 7^13, 8^11, 9^6, 10^7, 11^3, 12^2, 13^3, 14^2, 15, 17, 31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.150 = CTCATTAGTAATCGTC-1

using 725 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 713]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.154 = CTCATTAGTACTCTCC-1

using 348 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 7, 335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode CTCATTAGTACTCTCC-1 contig 1 = GAGTCAGTCC...
umi AAATATCTAG = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-486 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYDNLLYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.157 = CTCATTAGTCACACGC-1

using 278 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode CTCATTAGTCACACGC-1 contig 1 = GGAGGAATCA...
umi ATCCTTTGTA = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-479 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.170 = CTCATTAGTCTGGAGA-1

using 210 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 204]
surviving nonsolo ucounts = 1[204]
ids = [3]

====================================================================================

UMI info for barcode CTCATTAGTCTGGAGA-1 contig 1 = AGCTCTGAGA...
umi TTAACGAAGG = 190 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=534]
0-80 ==> 0-80 on |162|IGHV3-72|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |163|IGHV3-72|L-REGION+V-REGION| [len=359] (mis=2)
438-463 ==> 0-25 on |13|IGHD2-15|D-REGION| [len=31] (mis=1)
465-507 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
507-534 ==> 0-27 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CTRVDIVVVVAALDVW at 428, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 80, 236, 360, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.174 = CTCATTAGTGATGCCC-1

using 232 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CTCATTAGTGATGCCC-1 contig 1 = TGAGCGCAGA...
umi GACATCCACG = 1 reads: -59X +5 -1 +2 -1 +4 -2X +3 -2 +1 -2 +1 -1 +2 -1 +1 -1 +7 -1 +4 -2X +1 -1 +1 -2X +1 -279X invalidated
umi GACATCCTGG = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=447]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-447 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.178 = CTCATTAGTGGACGAT-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.180 = CTCATTAGTGGGTCAA-1

using 1045 reads

====================================================================================

graph has 1378 edges initially, 20 edges after simplification

total ucounts = 416
nonsolo ucounts = 187[2^66, 3^34, 4^29, 5^18, 6^11, 7^11, 8^5, 9, 10^3, 11^3, 12^2, 13, 14, 16, 54]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.199 = CTCATTATCACTTACT-1

using 88 reads

====================================================================================

graph has 132 edges initially, 6 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[3^4, 4^2, 5, 6^3, 7^2, 10, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.200 = CTCATTATCACTTATC-1

using 1065 reads

====================================================================================

graph has 240 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[6, 42, 1011]
surviving nonsolo ucounts = 2[42, 1011]
ids = [2, 4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=313]
1-65 ==> 290-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
64-102 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
102-313 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYSSSSTLRVF at 35, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 996
start codons at 
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.225 = CTCATTATCGACGGAA-1

using 586 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[10, 252, 322]
surviving nonsolo ucounts = 2[252, 322]
ids = [3, 2]

====================================================================================

UMI info for barcode CTCATTATCGACGGAA-1 contig 1 = GCAGGAGTCA...
umi GCAACGCCAT = 330 reads: +388 validated
umi TCCCTAACGA = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 569
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.229 = CTCATTATCGGACAAG-1

using 158 reads

====================================================================================

graph has 81 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[158]
surviving nonsolo ucounts = 1[158]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.234 = CTCATTATCTACGAGT-1

using 337 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[6, 324]
surviving nonsolo ucounts = 1[324]
ids = [6]

====================================================================================

UMI info for barcode CTCATTATCTACGAGT-1 contig 1 = GATCAGGACT...
umi GTTCTTTGCA = 325 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTWTF at 366, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.236 = CTCATTATCTATCGCC-1

using 260 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 4, 6, 237]
surviving nonsolo ucounts = 1[237]
ids = [8]

====================================================================================

UMI info for barcode CTCATTATCTATCGCC-1 contig 1 = AGTCTGGGCC...
umi GCACCGTTGT = 230 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=563]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-383 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-563 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQVWDSSSDLVVF at 355, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.245 = CTCATTATCTGTCTAT-1

using 320 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 314]
surviving nonsolo ucounts = 1[314]
ids = [0]

====================================================================================

UMI info for barcode CTCATTATCTGTCTAT-1 contig 1 = ATCAGTCCCA...
umi CGAACGCGGC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-494 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.260 = CTCCTAGAGAGTACCG-1

using 365 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 360]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.263 = CTCCTAGAGCAACGGT-1

using 266 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2, 3, 5, 246]
surviving nonsolo ucounts = 1[246]
ids = [12]

====================================================================================

UMI info for barcode CTCCTAGAGCAACGGT-1 contig 1 = ATCACATAAC...
umi TGCCAGTAGA = 245 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=497]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-336 ==> 0-278 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=22)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 30 reads
cdr3 = CARDGGTEARQYSAYW at 400, score = 9 + 7
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 16, 58, 209, 256, 278, 322, 355, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 46.264 = CTCCTAGAGCACCGTC-1

using 42 reads

====================================================================================

graph has 40 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 4^2, 8, 18]
surviving nonsolo ucounts = 2[8, 18]
ids = [4, 1]

====================================================================================
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk046-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk046-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.679 seconds used processing barcodes, peak mem = 0.23
