[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.24 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk044-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk044-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk044.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.0 = CTACACCCAGCCAGAA-1

using 449 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 193, 253]
surviving nonsolo ucounts = 2[193, 253]
ids = [1, 0]

====================================================================================

UMI info for barcode CTACACCCAGCCAGAA-1 contig 1 = GGAATCAGTC...
umi ACACTACCCT = 241 reads: +388 validated
umi ACACTACTCT = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-467 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 51 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 424
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.4 = CTACACCCAGGCAGTA-1

using 259 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3, 4, 5, 242]
surviving nonsolo ucounts = 1[242]
ids = [5]

====================================================================================

UMI info for barcode CTACACCCAGGCAGTA-1 contig 1 = GAGAAGAGCT...
umi GACTCTTTGA = 240 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=482]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-482 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGSSPGTF at 359, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.24 = CTACACCGTAACGACG-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.37 = CTACACCGTATAGTAG-1

using 325 reads

====================================================================================

graph has 80 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 135, 177]
surviving nonsolo ucounts = 1[135]
ids = [8]

====================================================================================

UMI info for barcode CTACACCGTATAGTAG-1 contig 1 = AGGAACTGCT...
umi TCGGTGCTCT = 129 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=487]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
414-487 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQRSNWPPTF at 353, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 32, 237, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.48 = CTACACCGTCGAGATG-1

using 477 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 209, 258]
surviving nonsolo ucounts = 2[209, 258]
ids = [7, 1]

====================================================================================

UMI info for barcode CTACACCGTCGAGATG-1 contig 1 = ACATGGGAAA...
umi TCATCAAGGG = 202 reads: +424 validated

UMI info for barcode CTACACCGTCGAGATG-1 contig 2 = GAGCTGCTCA...
umi ACTACCCGTT = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-46 ==> 26-72 on |181|IGHV4-31|5'UTR| [len=72] (mis=0)
46-402 ==> 0-356 on |182|IGHV4-31|L-REGION+V-REGION| [len=356] (mis=3)
419-470 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 15 reads
cdr3 = CAGCQDYGVGAWFDPW at 391, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 2, 46, 90, 399
confident = false

TIG 2[bases=495]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-495 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 30, 79, 238, 337, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.55 = CTACACCGTGAGGGAG-1

using 219 reads

====================================================================================

graph has 132 edges initially, 4 edges after simplification

total ucounts = 27
nonsolo ucounts = 16[2^3, 3^3, 5^2, 6, 7, 9, 10, 11, 17, 44, 79]
surviving nonsolo ucounts = 2[44, 79]
ids = [21, 20]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.62 = CTACACCGTTCCCGAG-1

using 214 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.63 = CTACACCGTTCCCTTG-1

using 166 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 1[166]
ids = [0]

====================================================================================

UMI info for barcode CTACACCGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi AATACAGGTC = 169 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=454]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-454 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 27, 30, 85, 99, 352, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.66 = CTACACCGTTGGTGGA-1

using 11786 reads

====================================================================================

graph has 5874 edges initially, 126 edges after simplification

total ucounts = 1285
nonsolo ucounts = 671[2^253, 3^160, 4^91, 5^46, 6^23, 7^14, 8^20, 9^3, 10^9, 11^5, 12^3, 13^4, 14^3, 18, 19, 22, 33, 40, 44, 71, 123, 124, 126, 132, 168, 193, 194, 205, 208, 218, 220, 225^2, 230, 243, 244, 255^2, 256, 259, 271, 275, 281, 284, 292, 325, 609, 630, 657, 919]
surviving nonsolo ucounts = 33[33, 40, 71, 123, 124, 126, 132, 168, 193, 194, 205, 208, 218, 220, 225^2, 230, 243, 244, 255^2, 256, 259, 271, 275, 281, 284, 292, 325, 609, 630, 657, 919]
ids = [1179, 754, 134, 170, 960, 599, 706, 590, 854, 437, ...]

====================================================================================

UMI info for barcode CTACACCGTTGGTGGA-1 contig 1 = GGGGGCACCA...
umi AAACGCCTTA = 248 reads: +391 validated
umi AGAGAGTTTG = 289 reads: +391 validated
umi AGCGTGGGTC = 256 reads: +391 validated
umi AGTCTATTTC = 251 reads: +391 validated
umi CAAGAGCACC = 951 reads: -349X +2 -2XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CCTGAGTTTA = 192 reads: +391 validated
umi CGAAATGCTT = 210 reads: +391 validated
umi CGTGTCTCGC = 666 reads: +168 -2XX +3 -5XX +1 -1XX +1 -1XX +1 -7XX +1 -155XX +1 -1XX +1 -9XX +1 -2XX +2 -3XX +25 invalidated
umi CTTAAATGGG = 688 reads: -350 +1 -2XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CTTCATTATG = 166 reads: +391 validated
umi CTTTCATGGG = 122 reads: +391 validated
umi GACACGATCA = 279 reads: +391 validated
umi GCATCGTCTT = 131 reads: +391 validated
umi GCCCGGCTGG = 245 reads: +391 validated
umi GTTGTCATTT = 224 reads: +391 validated
umi TATGTCTAGG = 127 reads: +391 validated
umi TATTGTCGAC = 285 reads: +391 validated
umi TGACAGCTAG = 216 reads: +391 validated
umi TTTATGGTCT = 329 reads: +391 validated

UMI info for barcode CTACACCGTTGGTGGA-1 contig 2 = AGCTCTGAGA...
umi CAGATTATCC = 3 reads: -381 +8 -1XX +22 invalidated
umi CGACCATGCG = 267 reads: +412 validated
umi GGACTCTATG = 40 reads: +412 validated
umi GGAGGATTAC = 218 reads: +412 validated
umi GGCCTCTTCG = 234 reads: +412 validated
umi GTTAATTGCT = 40 reads: -379 +2 -2X +1 -9X +1 -2X +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi TTAGTATATT = 9 reads: -400X +1 -5X +1 -2X +3 invalidated

GOOD CONTIGS

TIG 1[bases=636]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=17)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
425-636 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 615 reads
cdr3 = CLLSYGGTRPHVF at 358, score = 8 + 8
umis assigned: [3, 146, 157, 190, 288, 437, 453, 512, 580, 590] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5673
start codons at 34, 242, 341, 371, 389, 557
confident = true

TIG 2[bases=651]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=1)
79-401 ==> 0-322 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=25)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
491-651 ==> 0-160 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 4 umis using 80 reads
cdr3 = CVKGGWGFPLDSW at 421, score = 8 + 7
umis assigned: [313, 460, 754, 756, 774, 850, 1179]
of which 7 are surviving nonsolos
reads assigned: 799
start codons at 79, 230, 235, 296, 302, 545, 564
confident = true

REJECT CONTIGS

TIG 1[bases=546]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
0-26 ==> 10880-10906 on rc of segment before IGKV2-18 exon 2 [len=10906] (mis=0)
4-74 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
26-350 ==> 0-324 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [134, 170, 193, 362, 412, 854, 1209]
of which 7 are surviving nonsolos
reads assigned: 1691
start codons at 26, 32, 101, 176, 452
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGAGCCGGGGACGCGGCCATTTATTATTGTGTCAAAGGGGGGTGGGGATTCCCCCTTGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGTGCGCAGCCTGAGGATGAGGCTGAGTATTATTGCTTGCTCTCCTATGGAGGTACTCGGCCTCATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.84 = CTACACCTCAGCAACT-1

using 211 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^2, 5^3, 6, 183]
surviving nonsolo ucounts = 1[183]
ids = [9]

====================================================================================

UMI info for barcode CTACACCTCAGCAACT-1 contig 1 = GTGGGCTCAG...
umi TTGAAGATGT = 185 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=469]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=8)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
418-469 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CNSRDSSGNHVVF at 351, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 36, 155, 235, 334, 379
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.102 = CTACACCTCCCATTTA-1

using 109 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 98]
surviving nonsolo ucounts = 1[98]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.103 = CTACACCTCCCGACTT-1

using 189 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 5, 171]
surviving nonsolo ucounts = 1[171]
ids = [7]

====================================================================================

UMI info for barcode CTACACCTCCCGACTT-1 contig 1 = GGAGTCAGTC...
umi GTTTATCGCT = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-471 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.108 = CTACACCTCCGCGTTT-1

using 278 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode CTACACCTCCGCGTTT-1 contig 1 = GTCAGTCCCA...
umi CCAACAAGTG = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=462]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
379-411 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
411-462 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLPQTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.122 = CTACACCTCGGATGGA-1

using 8903 reads

====================================================================================

graph has 3805 edges initially, 78 edges after simplification

total ucounts = 897
nonsolo ucounts = 413[2^179, 3^79, 4^36, 5^26, 6^19, 7^8, 8^10, 9^3, 10^2, 11, 12^5, 14, 15, 16, 23, 29, 49, 50, 57, 66, 87, 101, 108, 113, 123^2, 128, 129, 149, 159, 160, 162, 164, 166, 167, 168, 172^2, 174, 180, 181, 194, 197, 203, 204, 205, 209, 211, 219, 220, 232, 233, 236, 245, 436, 532]
surviving nonsolo ucounts = 40[12, 50, 57, 66, 87, 101, 108, 113, 123^2, 128, 129, 149, 159, 160, 162, 164, 166, 167, 168, 172^2, 174, 180, 181, 194, 197, 203, 204, 205, 209, 211, 219, 220, 232, 233, 236, 245, 436, 532]
ids = [458, 842, 111, 525, 459, 697, 206, 45, 66, 679, ...]

====================================================================================

UMI info for barcode CTACACCTCGGATGGA-1 contig 1 = GGGGTCACAA...
umi AACGACAGCA = 210 reads: +388 validated
umi ACATTTGGTT = 113 reads: +388 validated
umi ACCACAATGC = 131 reads: +388 validated
umi ACGCCGTGAC = 125 reads: +388 validated
umi AGGCACTCCG = 58 reads: +388 validated
umi AGTAAAGTGC = 232 reads: +388 validated
umi ATAGGGCCCC = 173 reads: +388 validated
umi CAAATAGCGG = 239 reads: -28 +360 non-validated
umi CAATGCAGTC = 206 reads: +363 -1 +10 -14 non-validated
umi CACCGGAACC = 109 reads: +388 validated
umi CCAATGTGGC = 159 reads: +388 validated
umi CGATTATCTT = 224 reads: +388 validated
umi CGCGACGGCC = 168 reads: +388 validated
umi CGTCACAGCA = 245 reads: +388 validated
umi CTGGGGTACT = 164 reads: +388 validated
umi GATATTGGCA = 150 reads: +388 validated
umi GCTAGGCGTG = 66 reads: +388 validated
umi GGCAGGGCTT = 176 reads: +388 validated
umi GTGTGGCAGT = 205 reads: +388 validated
umi GTTTGACCGG = 200 reads: +388 validated
umi TATCGAAGAT = 123 reads: +388 validated
umi TATTTATACG = 231 reads: +388 validated
umi TCACTGCAAA = 99 reads: +388 validated
umi TCGAGGCACT = 432 reads: +388 validated
umi TCTCGTTCCA = 201 reads: +388 validated
umi TGCTTTATTC = 180 reads: +388 validated
umi TGGAGGGTGT = 207 reads: +388 validated
umi TTCCCACGTG = 52 reads: +314 -21 +11 -1 +2 -1 +6 -1 +31 non-validated
umi TTGTATCTAG = 182 reads: +388 validated

UMI info for barcode CTACACCTCGGATGGA-1 contig 2 = AGCACTAGAA...
umi GACGTGTGGT = 12 reads: -7 +170 -1 +5 -1 +9 -1 +22 -4 +56 -1 +28 -1 +17 -1 +66 -34 non-validated
umi GACGTTTGGT = 84 reads: +355 -23 +46 non-validated
umi TCTACTCGCT = 166 reads: +410 -14 non-validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 27 umis using 616 reads
cdr3 = CCSYAGSSTVVF at 362, score = 8 + 8
umis assigned: [14, 45, 48, 66, 111, 117, 137, 188, 197, 206] and 19 others
of which 29 are surviving nonsolos
reads assigned: 4996
start codons at 38, 177, 239, 246, 372
confident = true

TIG 2[bases=494]
0-60 ==> 20-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
60-411 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
435-484 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CARDLDYGSGWYGMDVW at 402, score = 9 + 7
umis assigned: [458, 459, 739]
of which 3 are surviving nonsolos
reads assigned: 257
start codons at 60, 211, 216, 269, 274, 277, 295, 363, 421, 441
confident = true

REJECT CONTIGS

TIG 1[bases=650]
0-102 ==> 11241-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=5)
56-403 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=4)
401-439 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
439-650 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CYSTD at 371, score = 7 + 4
umis assigned: [49, 253, 277, 307, 445, 580, 791]
of which 7 are surviving nonsolos
reads assigned: 1437
start codons at 56, 117, 186, 204, 255, 317, 354
confident = false
not full
frameshifted full length transcript of length 650
VJ delta = -3
not full
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCTCGACTATGGTTCAGGGTGGTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.129 = CTACACCTCTCAACTT-1

using 11019 reads

====================================================================================

graph has 5060 edges initially, 84 edges after simplification

total ucounts = 1273
nonsolo ucounts = 571[2^265, 3^129, 4^66, 5^38, 6^13, 7^10, 8^6, 9^2, 10, 12^2, 14, 16, 18, 19, 23, 25, 53, 55, 81, 91, 113, 117, 120, 129, 136, 140, 148, 152, 158, 161, 169, 171, 175, 182, 187, 190, 200, 217, 226, 250, 252, 275, 447, 487, 627, 633, 637, 723, 881]
surviving nonsolo ucounts = 33[18, 19, 55, 81, 91, 113, 117, 120, 129, 136, 140, 148, 152, 158, 161, 169, 171, 175, 182, 187, 190, 200, 217, 226, 250, 252, 275, 447, 487, 627, 637, 723, 881]
ids = [702, 1158, 1110, 830, 1209, 1029, 270, 328, 65, 564, ...]

====================================================================================

UMI info for barcode CTACACCTCTCAACTT-1 contig 1 = ACTTTCTGAG...
umi CGATAAACCA = 207 reads: +400 -12 non-validated
umi CTGCACTTCG = 487 reads: +412 validated
umi GCACCTAGCG = 18 reads: +217 -2 +96 -26 +56 -15 non-validated
umi GTAACGATCA = 79 reads: +394 -1 +16 -1 non-validated
umi TGAGAAAATG = 16 reads: -379 +7 -1XX +2 -1XX +2 -2XX +13 -1XX +4 invalidated
umi TGATGACGGC = 242 reads: -41X +2 -1XX +1 -1XX +366 invalidated
umi TGTATGCTCT = 19 reads: +334 -33 +11 -1 +33 non-validated

UMI info for barcode CTACACCTCTCAACTT-1 contig 2 = GTGGGCTCAG...
umi AAGACACGCC = 162 reads: +382 validated
umi AATACCGCCG = 250 reads: +382 validated
umi AATGATAGCG = 132 reads: +382 validated
umi AATGTCAGAA = 174 reads: +382 validated
umi AGCACCTTCA = 639 reads: -347 +3 -1XX +31 invalidated
umi AGTAGTTTTT = 188 reads: +382 validated
umi ATCCAAGTGT = 736 reads: -344X +1 -1XX +4 -1XX +31 invalidated
umi ATTAATCATG = 117 reads: +382 validated
umi ATTGTCACAT = 641 reads: -344X +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CAAACCCGTC = 222 reads: +382 validated
umi CACAGCCGCA = 199 reads: +382 validated
umi CACCATAGCC = 120 reads: +374 -1 +1 -2 +1 -1 +1 -1 non-validated
umi CACGTCTTCA = 188 reads: +382 validated
umi CCTCCGTACA = 642 reads: -346X +3 -2XX +31 invalidated
umi CCTGTTTAGC = 278 reads: -337 +1 -2X +1 -3XX +1 -1XX +4 -1XX +31 invalidated
umi CTATTTTCTC = 136 reads: +382 validated
umi CTCGAGTCGA = 882 reads: -327X +2 -11XX +1 -3XX +1 -1XX +4 -1XX +31 invalidated
umi CTGTCAGTGC = 182 reads: +382 validated
umi GCATTTGTTC = 169 reads: +382 validated
umi GCCCTACGCT = 152 reads: +382 validated
umi GGTCGGGTAT = 459 reads: -344X +1 -1XX +4 -1XX +31 invalidated
umi GTTTTATATC = 170 reads: +382 validated
umi TCATACTCTT = 164 reads: +382 validated
umi TCCAACGTCT = 114 reads: +382 validated
umi TGCTTGTATT = 159 reads: +382 validated
umi TTCACCTTGT = 93 reads: +382 validated
umi TTGGCTGCTA = 140 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
397-447 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
447-549 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 99 reads
cdr3 = CARKVGSDAFDIW at 377, score = 9 + 8
umis assigned: [493, 602, 702, 830, 1110, 1116, 1158]
of which 7 are surviving nonsolos
reads assigned: 1062
start codons at 14, 35, 79, 399, 428, 465, 526
confident = true

TIG 2[bases=628]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-628 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 20 umis using 382 reads
cdr3 = CYSTDSSGNHRVF at 350, score = 7 + 8
umis assigned: [40, 54, 65, 68, 172, 201, 241, 270, 285, 298] and 17 others
of which 26 are surviving nonsolos
reads assigned: 7341
start codons at 35, 96, 165, 183, 234, 296, 333
confident = true
now this is a cell
paired!

GTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAAAAGTGGGGAGTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGGGCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCATAGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.131 = CTACACCTCTCCAACC-1

using 140 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[134]
surviving nonsolo ucounts = 1[134]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.134 = CTACACCTCTGAAAGA-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.143 = CTACACCTCTTACCTA-1

using 13 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.148 = CTACACCTCTTTACAC-1

using 307 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2^4, 3^2, 4, 54, 229]
surviving nonsolo ucounts = 1[229]
ids = [14]

====================================================================================

UMI info for barcode CTACACCTCTTTACAC-1 contig 1 = AAGAGCTGCT...
umi CTCTGAAAGA = 229 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=490]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-380 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-490 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYGSSLITF at 356, score = 9 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 32, 240, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.149 = CTACATTAGACAAAGG-1

using 35 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 3, 5^2, 6^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.163 = CTACATTAGCGAAGGG-1

using 35 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 32]
surviving nonsolo ucounts = 1[32]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.169 = CTACATTAGGCAGGTT-1

using 46 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^3, 3, 6^2, 8, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.170 = CTACATTAGGCGATAC-1

using 26 reads

====================================================================================

graph has 34 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 6, 17]
surviving nonsolo ucounts = 1[17]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.172 = CTACATTAGGCTATCT-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.175 = CTACATTAGGGTCTCC-1

using 285 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 3, 5, 267]
surviving nonsolo ucounts = 1[267]
ids = [7]

====================================================================================

UMI info for barcode CTACATTAGGGTCTCC-1 contig 1 = AGGAGTCAGT...
umi GTTTTCGGGC = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=431]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=36)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
junction support: 1 umis using 31 reads
cdr3 = CQQYDDLPITF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 27, 33, 89, 102, 364, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.178 = CTACATTAGTAATCCC-1

using 203 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [3]

====================================================================================

UMI info for barcode CTACATTAGTAATCCC-1 contig 1 = CCACATCCCT...
umi CCTACGTGTG = 202 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=531]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=2)
392-423 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=7)
412-460 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARRYYDSSGYFDYW at 384, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 42, 193, 198, 240, 245, 262, 339, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.182 = CTACATTAGTATTGGA-1

using 612 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 5, 598]
surviving nonsolo ucounts = 1[598]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=363]
1-190 ==> 156-345 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=5)
189-227 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
227-363 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQHDNFPWTF at 166, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 592
start codons at 1, 104, 149, 176, 269
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.185 = CTACATTAGTGCGTGA-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.186 = CTACATTAGTGCTGCC-1

using 41 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 5, 27]
surviving nonsolo ucounts = 1[27]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.187 = CTACATTAGTGGGATC-1

using 705 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 5, 9, 683]
surviving nonsolo ucounts = 1[683]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=341]
8-71 ==> 5551-5614 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
20-70 ==> 0-50 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
68-172 ==> 256-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
168-205 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
205-341 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNFPP at 132, score = 4 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 676
start codons at 20, 53, 131, 151, 247
confident = false
not full
frameshifted full length stopped transcript of length 341
VJ delta = 237
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.188 = CTACATTCAAACAACA-1

using 44 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 4, 33]
surviving nonsolo ucounts = 1[33]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.202 = CTACATTCACACCGAC-1

using 257 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^3, 4^2, 5, 230]
surviving nonsolo ucounts = 1[230]
ids = [8]

====================================================================================

UMI info for barcode CTACATTCACACCGAC-1 contig 1 = CAGTTAGGAC...
umi GACTTCTGGG = 221 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=455]
0-22 ==> 25-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
22-367 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
364-401 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
401-455 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQRSNWLTF at 343, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 22, 227, 230, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.203 = CTACATTCACAGGAGT-1

using 300 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[5, 288]
surviving nonsolo ucounts = 1[288]
ids = [5]

====================================================================================

UMI info for barcode CTACATTCACAGGAGT-1 contig 1 = GCAGGAGTCA...
umi TATGCGTATA = 288 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 18-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
35-380 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
389-417 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYSYPRTF at 356, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.212 = CTACATTCACTAGTAC-1

using 624 reads

====================================================================================

graph has 286 edges initially, 8 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 187, 202, 229]
surviving nonsolo ucounts = 3[187, 202, 229]
ids = [3, 6, 1]

====================================================================================

UMI info for barcode CTACATTCACTAGTAC-1 contig 1 = ACCCAAAAAC...
umi TCCAAGGCGT = 195 reads: +436 validated

UMI info for barcode CTACATTCACTAGTAC-1 contig 2 = GGAGTCAGAC...
umi ATACAACGGT = 215 reads: +376 validated

UMI info for barcode CTACATTCACTAGTAC-1 contig 3 = GCTACAACAG...
umi CCTAAGTGCG = 182 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=496]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=486]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-361 ==> 0-335 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
364-402 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
402-486 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQHWRTF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 26, 32, 88, 101, 333, 444
confident = false

TIG 3[bases=512]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-512 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.224 = CTACATTCAGCATACT-1

using 382 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 373]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 44.225 = CTACATTCAGCCACCA-1

using 2461 reads

====================================================================================

graph has 558 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 2456]
surviving nonsolo ucounts = 1[2456]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=338]
6-92 ==> 267-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
89-127 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
127-338 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGAWDTSLSAWVF at 60, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 2438
start codons at 68
confident = false
not full
VJ delta = 22
not full
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk044-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk044-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

8.410 seconds used processing barcodes, peak mem = 0.23
