[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk043-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk043-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk043.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.0 = CTAATGGCACTCGACG-1

using 193 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 186]
surviving nonsolo ucounts = 1[186]
ids = [5]

====================================================================================

UMI info for barcode CTAATGGCACTCGACG-1 contig 1 = GAGTGCTTTC...
umi TTGGTTTTGT = 183 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=571]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-571 ==> 0-117 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.10 = CTAATGGCATACTCTT-1

using 383 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 374]
surviving nonsolo ucounts = 1[374]
ids = [3]

====================================================================================

UMI info for barcode CTAATGGCATACTCTT-1 contig 1 = GAAGAGCTGC...
umi CTGGTCTATT = 357 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=490]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-371 ==> 0-338 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
367-406 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
406-490 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 33, 241, 367, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.11 = CTAATGGCATATACGC-1

using 717 reads

====================================================================================

graph has 297 edges initially, 22 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[3, 7, 10, 11, 17, 275, 385]
surviving nonsolo ucounts = 2[275, 385]
ids = [11, 7]

====================================================================================

UMI info for barcode CTAATGGCATATACGC-1 contig 1 = AGGAGTCAGA...
umi TGTGACGCCA = 277 reads: +388 validated

UMI info for barcode CTAATGGCATATACGC-1 contig 2 = AGGAGTCAGA...
umi CTTATGCTGA = 380 reads: +263 -1XX +9 -1XX +1 -1XX +4 -1XX +101 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 2[bases=545]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=9)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQAKSFSF at 354, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 27, 33, 89, 102, 238, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.14 = CTAATGGCATCCGGGT-1

using 54 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2, 4^2, 6, 8, 9, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.31 = CTAATGGGTAGAGTGC-1

using 205 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 201]
surviving nonsolo ucounts = 1[201]
ids = [3]

====================================================================================

UMI info for barcode CTAATGGGTAGAGTGC-1 contig 1 = GGGGTCACAA...
umi GGGTCACCCT = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
426-539 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CCSYAGSSTYVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 38, 177, 239, 246, 372, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.34 = CTAATGGGTATCGCAT-1

using 478 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 215, 254]
surviving nonsolo ucounts = 2[215, 254]
ids = [3, 8]

====================================================================================

UMI info for barcode CTAATGGGTATCGCAT-1 contig 1 = AGTGACTCCT...
umi TTTTCGGCCT = 246 reads: +433 validated

UMI info for barcode CTAATGGGTATCGCAT-1 contig 2 = GTGGGTCCAG...
umi CCCTACTAGC = 209 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=531]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
453-531 ==> 0-78 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CAHRLTHSSGWYGYFFDYW at 365, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 20, 64, 243, 246, 326, 335
confident = false

TIG 2[bases=562]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=7)
370-408 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
408-562 ==> 0-154 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSPDSQGVF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.50 = CTAATGGGTCTTCGTC-1

using 255 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode CTAATGGGTCTTCGTC-1 contig 1 = AGCTTCAGCT...
umi AGGTTCTTCA = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.59 = CTAATGGGTTATCGGT-1

using 10983 reads

====================================================================================

graph has 5158 edges initially, 44 edges after simplification

total ucounts = 900
nonsolo ucounts = 410[2^147, 3^71, 4^55, 5^42, 6^24, 7^11, 8^8, 9^6, 10^3, 11^2, 12, 14, 15, 17, 40, 43, 109, 111, 113, 134, 144, 171, 174, 188, 190, 192, 198, 206, 231, 236, 247, 252, 253, 260, 274, 276, 277, 280^2, 287, 289, 300, 306, 315^2, 345, 348, 385^2, 392, 561]
surviving nonsolo ucounts = 34[109, 113, 134, 144, 171, 174, 188, 190, 192, 198, 206, 231, 236, 247, 252, 253, 260, 274, 276, 277, 280^2, 287, 289, 300, 306, 315^2, 345, 348, 385^2, 392, 561]
ids = [754, 131, 248, 732, 505, 305, 67, 346, 600, 816, ...]

====================================================================================

UMI info for barcode CTAATGGGTTATCGGT-1 contig 1 = CCAGCCCTGA...
umi AATCGTGTAT = 232 reads: +427 validated
umi AATTTCATCT = 188 reads: +416 -1 +10 non-validated
umi AGAGCGGCTC = 61 reads: -82 +7 -1 +337 non-validated
umi AGCATGTCTG = 288 reads: +418 -9 non-validated
umi CAATTGGCTT = 132 reads: +389 -1 +1 -1 +15 -1 +19 non-validated
umi CAGGCGCCCT = 254 reads: +392 -1 +25 -1 +8 non-validated
umi CCACGTCAGC = 176 reads: +427 validated
umi CCATAACTAG = 509 reads: -394X +1 -5XX +1 -3XX +1 -2XX +1 -5XX +1 -5XX +1 -2XX +2 -2XX +1 invalidated
umi CCGCTTACCT = 188 reads: +427 validated
umi CGCCCTCTTT = 248 reads: +411 -1 +10 -1 +1 -1 +2 non-validated
umi CTACACCTGC = 230 reads: +356 -4 +63 -1X +3 invalidated
umi GACGCTGTCG = 168 reads: +425 -1X +1 invalidated
umi GGTTTCTCAA = 191 reads: +427 validated
umi TAAACTGGGC = 283 reads: +374 -53 non-validated
umi TACCTCCCTG = 275 reads: +427 validated
umi TACTATCGTG = 346 reads: -71 +4 -1 +351 non-validated
umi TATGCGTTAT = 298 reads: +427 validated
umi TCAGAGAGTC = 145 reads: +427 validated
umi TGAGCATTCA = 235 reads: +427 validated
umi TGTAGTAGTA = 198 reads: +427 validated
umi TTGAGGGCCG = 262 reads: +427 validated

UMI info for barcode CTAATGGGTTATCGGT-1 contig 2 = GGGAGAGCCC...
umi AGCTTTTTGG = 346 reads: +382 validated
umi ATCACAGTTC = 287 reads: +382 validated
umi ATTATAGGCG = 280 reads: +382 validated
umi CACATACCTT = 306 reads: +382 validated
umi CCCTCGCTCG = 386 reads: +382 validated
umi CCGGAATCTC = 276 reads: +382 validated
umi CGGCTATTTG = 313 reads: +382 validated
umi GGCTCCTGTG = 392 reads: +382 validated
umi GTACTATGTC = 321 reads: +382 validated
umi GTGAGCCACC = 212 reads: +382 validated
umi TACTATAGTA = 394 reads: +382 validated
umi TATATTTTGC = 276 reads: +382 validated
umi TCCTACGCTA = 110 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=560]
0-62 ==> 0-62 on |115|IGHV3-20|5'UTR| [len=62] (mis=2)
62-415 ==> 0-353 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=30)
436-489 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 17 umis using 255 reads
cdr3 = CARGPSAADLPPWHFDLW at 404, score = 9 + 7
umis assigned: [55, 67, 131, 136, 248, 267, 305, 312, 346, 389] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4837
start codons at 62, 207, 213, 218, 297, 365
confident = true

TIG 2[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 666 reads
cdr3 = CQQRSNWPITF at 368, score = 9 + 8
umis assigned: [144, 179, 207, 251, 330, 347, 404, 575, 609, 638] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3830
start codons at 47, 252, 255, 471
confident = true
now this is a cell
paired!

ACGGCCTTGTATTACTGTGCAAGAGGCCCTTCAGCGGCAGACCTACCCCCCTGGCACTTCGATCTCTGGGGCCGTGGCACCTTTCTCAGTGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCCATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.78 = CTAATGGTCCCATTAT-1

using 268 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [1]

====================================================================================

UMI info for barcode CTAATGGTCCCATTAT-1 contig 1 = AGCTCTGAGA...
umi CTATATCCCT = 257 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=554]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-554 ==> 0-51 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.81 = CTAATGGTCCTAAGTG-1

using 585 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 4, 251, 319]
surviving nonsolo ucounts = 2[251, 319]
ids = [10, 3]

====================================================================================

UMI info for barcode CTAATGGTCCTAAGTG-1 contig 1 = GAGTGCTTTC...
umi TCCCAGTGTC = 234 reads: +436 validated

UMI info for barcode CTAATGGTCCTAAGTG-1 contig 2 = ATCAGTCCCA...
umi AGACAACTCG = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-535 ==> 0-81 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARAHGDYYTLLDFW at 378, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 18, 39, 83, 169, 369
confident = false

TIG 2[bases=482]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-482 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.88 = CTAATGGTCGCCCTTA-1

using 225 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode CTAATGGTCGCCCTTA-1 contig 1 = GGGGAGGAAC...
umi AATATTCTCT = 221 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=485]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
421-485 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQRSNWPPFTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 36, 241, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.94 = CTAATGGTCGTTACGA-1

using 650 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 4^2, 249, 386]
surviving nonsolo ucounts = 2[249, 386]
ids = [8, 0]

====================================================================================

UMI info for barcode CTAATGGTCGTTACGA-1 contig 1 = AGCTTCAGCT...
umi GATAATTCGG = 244 reads: +388 validated

UMI info for barcode CTAATGGTCGTTACGA-1 contig 2 = GAGGAACTGC...
umi ATCACATACA = 384 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=477]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-477 ==> 0-42 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CAAWDDSLNGVVF at 368, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 47, 351, 376, 381, 393
confident = false

TIG 2[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRRTWPPAF at 354, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 33, 82, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.95 = CTAATGGTCTAACTGG-1

using 3010 reads

====================================================================================

graph has 4362 edges initially, 18 edges after simplification

total ucounts = 1255
nonsolo ucounts = 582[2^239, 3^127, 4^78, 5^44, 6^34, 7^17, 8^10, 9^12, 10^6, 11^4, 12, 13^2, 15^3, 16^3, 17, 183]
surviving nonsolo ucounts = 1[183]
ids = [295]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.99 = CTAATGGTCTACTTAC-1

using 247 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 237]
surviving nonsolo ucounts = 1[237]
ids = [6]

====================================================================================

UMI info for barcode CTAATGGTCTACTTAC-1 contig 1 = GACCCAGTCA...
umi TGCCCATTGC = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-19 ==> 8-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
19-370 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
375-407 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYPPTF at 346, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.100 = CTAATGGTCTCACATT-1

using 221 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 9, 205]
surviving nonsolo ucounts = 1[205]
ids = [5]

====================================================================================

UMI info for barcode CTAATGGTCTCACATT-1 contig 1 = GGGGAGAAGT...
umi TCTGACACCG = 190 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=451]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-451 ==> 0-32 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQKYNSAPYTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 31, 37, 93, 106, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.102 = CTAATGGTCTCCAGGG-1

using 19 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.110 = CTAATGGTCTTCCTTC-1

using 604 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 243, 351]
surviving nonsolo ucounts = 2[243, 351]
ids = [2, 3]

====================================================================================

UMI info for barcode CTAATGGTCTTCCTTC-1 contig 1 = GAGGAATCAG...
umi GAACGTTATT = 339 reads: +388 validated

UMI info for barcode CTAATGGTCTTCCTTC-1 contig 2 = ACCCAAAAAC...
umi CTACCTCAGT = 242 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=494]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-494 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=521]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-521 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.123 = CTACACCAGCAAATCA-1

using 202 reads

====================================================================================

graph has 49 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [3]

====================================================================================

UMI info for barcode CTACACCAGCAAATCA-1 contig 1 = GTGGGTCCAG...
umi GCGCAATTTC = 193 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
420-553 ==> 0-133 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSADSSGTPRVVF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.129 = CTACACCAGCGATCCC-1

using 187 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 179]
surviving nonsolo ucounts = 1[179]
ids = [4]

====================================================================================

UMI info for barcode CTACACCAGCGATCCC-1 contig 1 = GTCAGACTCA...
umi TCACCCTAAA = 176 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
411-446 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYNSYALSF at 350, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 23, 29, 85, 98, 234, 237, 330, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.130 = CTACACCAGCGCTTAT-1

using 263 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 3, 247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode CTACACCAGCGCTTAT-1 contig 1 = TGGGGGACTC...
umi AGACCTCCTA = 243 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=532]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=20)
410-458 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
458-532 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAHIVGFYFPNSGYYYFDSW at 367, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 22, 66, 245, 248, 337, 512
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.132 = CTACACCAGCTAACAA-1

using 237 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 40, 185]
surviving nonsolo ucounts = 2[40, 185]
ids = [2, 1]

====================================================================================

UMI info for barcode CTACACCAGCTAACAA-1 contig 1 = AGGAATCAGT...
umi AGACGGGGTT = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=449]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-449 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 27, 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.133 = CTACACCAGCTACCTA-1

using 456 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 202, 246]
surviving nonsolo ucounts = 2[202, 246]
ids = [6, 2]

====================================================================================

UMI info for barcode CTACACCAGCTACCTA-1 contig 1 = TGGGGAGGAA...
umi CTACTTATAC = 239 reads: +385 validated

UMI info for barcode CTACACCAGCTACCTA-1 contig 2 = TGGGGCTGGG...
umi TCCAACCGCC = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=435]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=18)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
junction support: 1 umis using 26 reads
cdr3 = CQQYYNWPPYTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 37, 106, 242
confident = false

TIG 2[bases=438]
45-396 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 23 reads
cdr3 = CSSYTSSSTKVF at 369, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 45, 202, 246, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.139 = CTACACCAGGACTGGT-1

using 577 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 9[2^5, 4, 7^2, 537]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=370]
0-38 ==> 2269-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
34-196 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
196-234 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
234-370 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [17]
of which 0 are surviving nonsolos
reads assigned: 530
start codons at 4, 59, 64, 177, 276
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.141 = CTACACCAGGATGTAT-1

using 399 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3^2, 382]
surviving nonsolo ucounts = 1[382]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=410]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-336 ==> 0-289 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 47, 201
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.144 = CTACACCAGGCTACGA-1

using 220 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 6, 204]
surviving nonsolo ucounts = 1[204]
ids = [6]

====================================================================================

UMI info for barcode CTACACCAGGCTACGA-1 contig 1 = ATCAGTCCCA...
umi CGTGTCAACT = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=453]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-453 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 23, 29, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.161 = CTACACCCAAGCCGTC-1

using 183 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [0]

====================================================================================

UMI info for barcode CTACACCCAAGCCGTC-1 contig 1 = GCTCTGCTTC...
umi AGAGATTCCC = 172 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=488]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-488 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.163 = CTACACCCAAGGACAC-1

using 275 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[3, 10, 106, 148]
surviving nonsolo ucounts = 1[148]
ids = [6]

====================================================================================

UMI info for barcode CTACACCCAAGGACAC-1 contig 1 = AGCTTCAGCT...
umi GCACTTATCC = 148 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-504 ==> 0-69 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.169 = CTACACCCAATGTAAG-1

using 149 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 5, 136]
surviving nonsolo ucounts = 1[136]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 43.171 = CTACACCCAATTCCTT-1

using 125 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[120]
surviving nonsolo ucounts = 1[120]
ids = [1]

====================================================================================
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk043-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk043-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

4.419 seconds used processing barcodes, peak mem = 0.23
