[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk041-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk041-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk041.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.0 = CGTTCTGCACAACTGT-1

using 17352 reads

====================================================================================

graph has 5619 edges initially, 48 edges after simplification

total ucounts = 807
nonsolo ucounts = 369[2^153, 3^76, 4^34, 5^21, 6^9, 7^4, 8, 9^2, 10^4, 14^2, 31, 55, 77, 81, 89, 92^2, 109, 167, 173, 174, 187, 190, 196, 204, 206, 209, 214, 215, 216, 218, 219, 222, 226, 227, 229, 230, 231, 233^2, 241^2, 246^2, 249, 254, 256, 258, 262, 265, 266, 267^2, 270, 272, 277^2, 282, 287, 288, 296, 297^2, 300, 302, 309, 323, 351, 370, 534, 538, 724, 806]
surviving nonsolo ucounts = 59[77, 89, 92, 109, 167, 173, 174, 187, 190, 196, 204, 206, 209, 214, 215, 216, 218, 219, 222, 226, 227, 229, 230, 231, 233^2, 241^2, 246^2, 249, 254, 256, 258, 262, 265, 266, 267^2, 270, 272, 277^2, 282, 287, 288, 296, 297^2, 300, 302, 309, 323, 351, 370, 534, 538, 724, 806]
ids = [607, 329, 754, 78, 217, 164, 391, 580, 174, 406, ...]

====================================================================================

UMI info for barcode CGTTCTGCACAACTGT-1 contig 1 = GCATGTCCCT...
umi AACTCATTAC = 257 reads: +388 validated
umi AAGCGACTTT = 227 reads: +388 validated
umi ACAGTGTTCG = 312 reads: +388 validated
umi ACCGGTCTAG = 215 reads: +388 validated
umi AGATACGGAA = 245 reads: +388 validated
umi AGATTTAGGC = 548 reads: +5 -1XX +382 invalidated
umi AGGCCGCCTA = 303 reads: +388 validated
umi AGGGGTCAGC = 289 reads: +388 validated
umi ATCCGTCTCT = 190 reads: +388 validated
umi ATTTACCATA = 298 reads: +388 validated
umi ATTTTGTTTT = 205 reads: +388 validated
umi CAAATACCAA = 168 reads: +388 validated
umi CACACGCAAT = 223 reads: +388 validated
umi CACATTAAGA = 269 reads: +388 validated
umi CAGGTCACAG = 227 reads: +388 validated
umi CATCTTTGAT = 277 reads: +388 validated
umi CATGCACCCT = 254 reads: +388 validated
umi CCAACTTCCT = 213 reads: +388 validated
umi CCCAACGGCG = 298 reads: +388 validated
umi CCCTTCCCCC = 257 reads: +388 validated
umi CGCGATTCGG = 275 reads: +388 validated
umi CGGTCACTTT = 228 reads: +388 validated
umi CGTAACGTCC = 221 reads: +380 -4X +4 invalidated
umi CGTCGGTGGT = 272 reads: +388 validated
umi CGTGATCGTA = 237 reads: +388 validated
umi CGTTCCAGGT = 212 reads: +388 validated
umi CTACACACCT = 230 reads: +388 validated
umi CTACGCACCT = 177 reads: +388 validated
umi CTCCTGTGTT = 200 reads: +388 validated
umi CTTGGGAAGG = 267 reads: +388 validated
umi CTTTCCTAGT = 291 reads: +388 validated
umi GACACCCGCG = 214 reads: +388 validated
umi GATATCTTGC = 251 reads: +388 validated
umi GATATGCCAA = 244 reads: +388 validated
umi GATCAGGCTC = 217 reads: +388 validated
umi GCAGATGCGG = 367 reads: +388 validated
umi GCATTGTCTT = 326 reads: +388 validated
umi GGCTGTCGGT = 234 reads: +388 validated
umi GGTCGCCTGC = 230 reads: +388 validated
umi GTACTAGGAG = 280 reads: +388 validated
umi GTCAGAAGGC = 186 reads: +388 validated
umi GTTAACGAAC = 240 reads: +388 validated
umi TACTGCGCAT = 232 reads: +388 validated
umi TCCCTTGACT = 263 reads: -348 +1 -1XX +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TGCCCGGCCC = 301 reads: +388 validated
umi TGGATTTCTG = 266 reads: +388 validated
umi TGGTCGCTGC = 261 reads: +388 validated
umi TTAACCCCCT = 261 reads: +388 validated
umi TTCAAATCAC = 29 reads: +66 -1 +4 -4 +143 -170 non-validated
umi TTCAATTCAC = 201 reads: +388 validated

UMI info for barcode CGTTCTGCACAACTGT-1 contig 2 = GGACTCCTGT...
umi ATATTTTCGC = 174 reads: +421 validated
umi CCTCGTGAGG = 1 reads: -363 +1 -6X +1 -1X +1 -4X +1 -1X +5 -1X +1 -1X +32 -2 invalidated
umi GCATATGGCT = 452 reads: +421 validated
umi GGCTCATCAC = 199 reads: +421 validated
umi TACACTAAGC = 81 reads: +400 -1X +20 invalidated

GOOD CONTIGS

TIG 1[bases=621]
0-97 ==> 0-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
97-442 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
446-485 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
485-621 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 47 umis using 1977 reads
cdr3 = CQQYNNWPPLYTF at 418, score = 9 + 8
umis assigned: [28, 36, 64, 75, 113, 116, 128, 131, 174, 205] and 40 others
of which 50 are surviving nonsolos
reads assigned: 12299
start codons at 2, 42, 97, 166, 302, 527
confident = true

TIG 2[bases=510]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=4)
391-439 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
439-510 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 81 reads
cdr3 = CAHISARTGVMFDYW at 363, score = 7 + 7
umis assigned: [164, 329, 503, 547, 607]
of which 5 are surviving nonsolos
reads assigned: 787
start codons at 18, 62, 241, 244, 324, 333, 393
confident = true

REJECT CONTIGS

TIG 1[bases=316]
19-44 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
67-105 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
103-151 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
105-316 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [186, 314, 354]
of which 3 are surviving nonsolos
reads assigned: 2035
start codons at 69, 237
confident = false
did not find CDR3
now this is a cell
paired!

CCTGTGGACACAGCCACATATTACTGTGCACACATTTCAGCCCGGACCGGAGTGATGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCCTTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.13 = CGTTCTGCACCTGGTG-1

using 112 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 102]
surviving nonsolo ucounts = 1[102]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=485]
0-129 ==> 6458-6587 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=14)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=13)
cdr3 = CARGIT at 422, score = 9 + 4
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 80, 225, 236, 297, 383, 479
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.19 = CGTTCTGCAGACACTT-1

using 159 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================

UMI info for barcode CGTTCTGCAGACACTT-1 contig 1 = GGGGTCACAA...
umi GAAAACACCT = 151 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-550 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.22 = CGTTCTGCAGATAATG-1

using 130 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 122]
surviving nonsolo ucounts = 1[122]
ids = [2]

====================================================================================

UMI info for barcode CGTTCTGCAGATAATG-1 contig 1 = AGCTTCAGCT...
umi AGCGGATCGG = 123 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-496 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.26 = CGTTCTGCAGCTCCGA-1

using 142 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 138]
surviving nonsolo ucounts = 1[138]
ids = [3]

====================================================================================

UMI info for barcode CGTTCTGCAGCTCCGA-1 contig 1 = AGTCTCAGTC...
umi GCTACGGTCA = 127 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=473]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
405-473 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQSYSTPSF at 347, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 20, 26, 82, 95, 231, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.30 = CGTTCTGCATAACCTG-1

using 245 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [0]

====================================================================================

UMI info for barcode CGTTCTGCATAACCTG-1 contig 1 = GGAACTGCTC...
umi TTGGACACAA = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-501 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNNWPPLYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 31, 100, 236, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.31 = CGTTCTGCATACGCTA-1

using 739 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 736]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.40 = CGTTCTGGTAAGAGGA-1

using 237 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode CGTTCTGGTAAGAGGA-1 contig 1 = AGCTCTCAGA...
umi AGAGCTTAAA = 225 reads: +419 -1 +28 non-validated

GOOD CONTIGS

TIG 1[bases=528]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
443-470 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=4)
466-527 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=4)
junction support: 1 umis using 8 reads
cdr3 = CARVGRARITMVRGVPNYYYYMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 79, 235, 356, 382, 451, 484
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.41 = CGTTCTGGTAAGGGCT-1

using 17 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.43 = CGTTCTGGTACAGTGG-1

using 284 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 37, 241]
surviving nonsolo ucounts = 2[37, 241]
ids = [3, 4]

====================================================================================

UMI info for barcode CGTTCTGGTACAGTGG-1 contig 1 = GAGGAACTGC...
umi GTCGTCAGAT = 37 reads: -1 +381 non-validated
umi GTCGTCGGAT = 243 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 42 reads
cdr3 = CQQYNNWPRTF at 354, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 276
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.44 = CGTTCTGGTACGACCC-1

using 499 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^7, 228, 255]
surviving nonsolo ucounts = 2[228, 255]
ids = [7, 9]

====================================================================================

UMI info for barcode CGTTCTGGTACGACCC-1 contig 1 = AGAGAGGAGC...
umi GTAGTTTGCA = 228 reads: +424 validated

UMI info for barcode CGTTCTGGTACGACCC-1 contig 2 = AGCTTCAGCT...
umi TTCCGGGCAT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=612]
0-72 ==> 7-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
449-496 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
496-612 ==> 0-116 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDRAATARLGGMDVW at 414, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 72, 223, 228, 375, 453
confident = false

TIG 2[bases=567]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-567 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.58 = CGTTCTGGTCAAAGAT-1

using 66 reads

====================================================================================

graph has 122 edges initially, 8 edges after simplification

total ucounts = 58
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 1[9]
ids = [52]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.60 = CGTTCTGGTCAGCTAT-1

using 2504 reads

====================================================================================

graph has 1955 edges initially, 46 edges after simplification

total ucounts = 1149
nonsolo ucounts = 535[2^274, 3^134, 4^68, 5^29, 6^17, 7^6, 8^2, 9, 11^2, 15, 317]
surviving nonsolo ucounts = 1[317]
ids = [675]

====================================================================================

REJECT CONTIGS

TIG 1[bases=512]
4-311 ==> 44-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=1)
313-351 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
351-512 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CLLYYGGAQPVAF at 284, score = 8 + 8
umis assigned: [675]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 297
confident = false
not full
VJ delta = 17
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.68 = CGTTCTGGTCGTCTTC-1

using 131 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.79 = CGTTCTGGTGCGAAAC-1

using 490 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 5, 475]
surviving nonsolo ucounts = 1[475]
ids = [4]

====================================================================================

UMI info for barcode CGTTCTGGTGCGAAAC-1 contig 1 = AGGAATCAGT...
umi TCGAAACGGT = 449 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-498 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.87 = CGTTCTGGTTCCGTCT-1

using 23 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 3, 4, 5]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.107 = CGTTCTGTCAGAGCTT-1

using 1043 reads

====================================================================================

graph has 436 edges initially, 14 edges after simplification

total ucounts = 20
nonsolo ucounts = 11[2^4, 3, 4, 8, 122, 160, 257, 472]
surviving nonsolo ucounts = 3[122, 160, 472]
ids = [16, 15, 19]

====================================================================================

REJECT CONTIGS

TIG 1[bases=549]
0-27 ==> 10879-10906 on rc of segment before IGKV2-18 exon 2 [len=10906] (mis=0)
5-79 ==> 5667-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6, 16, 19]
of which 2 are surviving nonsolos
reads assigned: 751
start codons at 27, 33, 89, 102, 241, 364, 455
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.115 = CGTTCTGTCATATCGG-1

using 312 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [12]

====================================================================================

UMI info for barcode CGTTCTGTCATATCGG-1 contig 1 = GAACTGCTCA...
umi GTGTCAATAG = 297 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-30 ==> 17-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
30-375 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQRSNWPLTF at 351, score = 9 + 9
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 30, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.119 = CGTTCTGTCATTATCC-1

using 37 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.123 = CGTTCTGTCCAAGCCG-1

using 62 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.130 = CGTTCTGTCCCGACTT-1

using 576 reads

====================================================================================

graph has 186 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3^3, 4, 242, 315]
surviving nonsolo ucounts = 2[242, 315]
ids = [9, 5]

====================================================================================

UMI info for barcode CGTTCTGTCCCGACTT-1 contig 1 = GGAGGAGTCA...
umi TTCATTGGCT = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false

REJECT CONTIGS

TIG 1[bases=511]
0-44 ==> 53-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
17-69 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
44-93 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
89-335 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=1)
338-375 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
375-511 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQDYNLPLLTF at 311, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 44, 195, 417
confident = false
not full
full length transcript of length 511
VJ delta = 70
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.136 = CGTTCTGTCCGGCACA-1

using 218 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 210]
surviving nonsolo ucounts = 1[210]
ids = [6]

====================================================================================

UMI info for barcode CGTTCTGTCCGGCACA-1 contig 1 = GGAGTCAGTC...
umi TGCGTTAAGG = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-504 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.144 = CGTTCTGTCGTCCAGG-1

using 24 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.146 = CGTTCTGTCGTTTATC-1

using 189 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[188]
surviving nonsolo ucounts = 1[188]
ids = [1]

====================================================================================

UMI info for barcode CGTTCTGTCGTTTATC-1 contig 1 = GGGGTCACAA...
umi CATGGACCCC = 183 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=492]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-492 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.147 = CGTTCTGTCTAACGGT-1

using 137 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 56
nonsolo ucounts = 32[2^12, 3^9, 4^4, 5^2, 6^2, 7, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.153 = CGTTCTGTCTCACATT-1

using 231 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 223]
surviving nonsolo ucounts = 1[223]
ids = [5]

====================================================================================

UMI info for barcode CGTTCTGTCTCACATT-1 contig 1 = GAGTCAGTCC...
umi CTGAGATCCT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYEDLPYTF at 352, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 25, 31, 87, 100, 362, 406, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.168 = CGTTCTGTCTTCGGTC-1

using 15 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.173 = CGTTCTGTCTTTCCTC-1

using 739 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[10, 728]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.174 = CGTTGGGAGAACAATC-1

using 35 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.179 = CGTTGGGAGACTTTCG-1

using 722 reads

====================================================================================

graph has 440 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[3^2, 5, 6, 7, 281, 414]
surviving nonsolo ucounts = 2[281, 414]
ids = [3, 2]

====================================================================================

UMI info for barcode CGTTGGGAGACTTTCG-1 contig 1 = AGGAGTCAGA...
umi CATGCACACA = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false

REJECT CONTIGS

TIG 1[bases=388]
7-261 ==> 99-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=18)
269-317 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
317-388 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CASRRESAFDYW at 250, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 373
start codons at 59, 64, 211
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.182 = CGTTGGGAGATATACG-1

using 210 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode CGTTGGGAGATATACG-1 contig 1 = GCTCTGCTTC...
umi CATGACTTAA = 196 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=505]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-505 ==> 0-60 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.183 = CGTTGGGAGATCCTGT-1

using 335 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 332]
surviving nonsolo ucounts = 1[332]
ids = [1]

====================================================================================

UMI info for barcode CGTTGGGAGATCCTGT-1 contig 1 = CAGTTAGGAC...
umi TCAATAATCG = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-22 ==> 75-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
22-367 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNNWPPLLTF at 343, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 22, 91, 227, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.187 = CGTTGGGAGCCACGCT-1

using 576 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 568]
surviving nonsolo ucounts = 1[568]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.200 = CGTTGGGAGGTGCTAG-1

using 160 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 1[160]
ids = [0]

====================================================================================

UMI info for barcode CGTTGGGAGGTGCTAG-1 contig 1 = AGCATCATCC...
umi TATAATTCCT = 156 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=518]
0-61 ==> 243-304 on |76|IGHV1-46|5'UTR| [len=304] (mis=3)
61-412 ==> 0-351 on |77|IGHV1-46|L-REGION+V-REGION| [len=351] (mis=42)
443-506 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
junction support: 1 umis using 8 reads
cdr3 = CVRGYCGRSCSRGLNYYYYPMDVW at 403, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 61, 148, 259, 325, 358, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.209 = CGTTGGGCAAACAACA-1

using 273 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 4, 9, 252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

UMI info for barcode CGTTGGGCAAACAACA-1 contig 1 = GAATCAGTCC...
umi CACGAGAATT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.211 = CGTTGGGCAAAGTGCG-1

using 12495 reads

====================================================================================

graph has 3938 edges initially, 26 edges after simplification

total ucounts = 572
nonsolo ucounts = 247[2^87, 3^43, 4^22, 5^11, 6^8, 7^8, 8^6, 9^2, 11, 12^2, 15, 19, 29, 39, 80, 87, 94, 100, 105, 125, 126, 132, 138, 144, 157, 162, 164, 165, 170, 172, 187, 191, 205, 209, 211, 213, 217, 218, 220, 228, 229^2, 230, 232, 235, 236^2, 243, 245, 248^2, 254, 257, 260, 263, 265, 266, 269, 276, 279, 285, 288, 290, 293, 299, 303, 439]
surviving nonsolo ucounts = 52[87, 94, 100, 105, 125, 126, 132, 138, 144, 157, 162, 164, 165, 170, 172, 187, 191, 205, 209, 211, 213, 217, 218, 220, 228, 229^2, 230, 232, 235, 236^2, 243, 245, 248^2, 254, 257, 260, 263, 265, 266, 269, 276, 279, 285, 288, 290, 293, 299, 303, 439]
ids = [475, 357, 188, 56, 75, 34, 73, 278, 492, 77, ...]

====================================================================================

UMI info for barcode CGTTGGGCAAAGTGCG-1 contig 1 = AGCTCTGGGA...
umi CAAAGAGATC = 146 reads: +367 -1 +12 -1 +4 -18 non-validated
umi CTAGATTGGA = 149 reads: +403 validated
umi CTCATTGGCC = 210 reads: +389 -3X +1 -1 +6 -1 +1 -1 invalidated
umi TCTGTGCGGT = 144 reads: +403 validated

UMI info for barcode CGTTGGGCAAAGTGCG-1 contig 2 = GGGGAGGAAC...
umi AAACTGGCAA = 267 reads: +382 validated
umi AACAACCACT = 234 reads: +382 validated
umi AAGTGGGTGA = 238 reads: +382 validated
umi ACAACCATAG = 123 reads: +382 validated
umi ACAACTACGA = 213 reads: +382 validated
umi ACACAGGGCT = 174 reads: +382 validated
umi ACTCCTCCTA = 106 reads: +382 validated
umi ACTTCTATCG = 232 reads: +382 validated
umi AGCGGACGTT = 132 reads: +382 validated
umi AGCGTCTAAT = 129 reads: -5 +377 non-validated
umi AGCTGACTCT = 157 reads: +382 validated
umi AGGAATTAGG = 231 reads: +382 validated
umi AGGCAAGGAG = 222 reads: +382 validated
umi AGTCTCCCAC = 280 reads: +382 validated
umi ATACGGCGCC = 286 reads: +382 validated
umi ATTCGCACCG = 433 reads: -105X +2 -1X +274 invalidated
umi CACACTTGTA = 275 reads: +382 validated
umi CATAACGATT = 161 reads: +382 validated
umi CATAGCAATG = 304 reads: +382 validated
umi CCAAGTCTGT = 100 reads: +382 validated
umi CCAGTAACGG = 296 reads: +382 validated
umi CCATGGGTAT = 271 reads: +382 validated
umi CCGGTATAGT = 230 reads: +382 validated
umi CCTTGGGGTA = 260 reads: +382 validated
umi CGAGAATGGT = 232 reads: +382 validated
umi CTCCGTCTAT = 137 reads: +382 validated
umi CTTACGTGTG = 191 reads: +382 validated
umi GATCGAGACA = 193 reads: +382 validated
umi GCCCGTTTTT = 93 reads: +382 validated
umi GGGCATCCCG = 224 reads: +382 validated
umi GGTTAAGCTA = 290 reads: +382 validated
umi GTAGGGTTAT = 295 reads: +382 validated
umi GTGCCAAGGG = 261 reads: +382 validated
umi GTGGAATTAC = 246 reads: +382 validated
umi TCCACTAGTC = 220 reads: +382 validated
umi TCCGATCTGG = 87 reads: +382 validated
umi TCCTTTCAGG = 243 reads: +382 validated
umi TCGATGGAAA = 203 reads: +382 validated
umi TCTGCCGAGT = 266 reads: +382 validated
umi TGGCGGAATT = 262 reads: +382 validated
umi TGTAAACAAG = 258 reads: +382 validated
umi TGTGTTGGAG = 209 reads: +382 validated
umi TTAATATCGG = 250 reads: +382 validated
umi TTCGTCTCCG = 243 reads: +382 validated
umi TTTATAGGTA = 292 reads: +382 validated
umi TTTATGCCGC = 177 reads: +186 -1XX +195 invalidated
umi TTTCTTCACA = 226 reads: +382 validated
umi TTTGTTTCTG = 218 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=12)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 28 reads
cdr3 = CARTAVGDYW at 422, score = 9 + 7
umis assigned: [152, 265, 277, 492]
of which 4 are surviving nonsolos
reads assigned: 635
start codons at 80, 236, 383
confident = true

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 1790 reads
cdr3 = CQQCNNWLYTF at 357, score = 9 + 8
umis assigned: [1, 7, 25, 34, 35, 37, 56, 61, 73, 75] and 38 others
of which 48 are surviving nonsolos
reads assigned: 10507
start codons at 36, 105, 460
confident = true
now this is a cell
paired!

ATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAACAGCCGTCGGTGACTACTGGGGCCGGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTGTAATAACTGGCTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.219 = CGTTGGGCAATGGACG-1

using 5456 reads

====================================================================================

graph has 2732 edges initially, 38 edges after simplification

total ucounts = 734
nonsolo ucounts = 308[2^137, 3^63, 4^37, 5^19, 6^10, 7^7, 8^5, 10^3, 11^3, 13, 17, 20, 23, 24, 25, 74, 82, 154, 174, 184, 190, 195, 203, 218, 229, 248, 253, 260^2, 274, 284, 287, 421]
surviving nonsolo ucounts = 18[74, 82, 154, 174, 184, 190, 195, 203, 218, 229, 248, 253, 260^2, 274, 284, 287, 421]
ids = [412, 431, 184, 226, 443, 342, 669, 61, 641, 219, ...]

====================================================================================

UMI info for barcode CGTTGGGCAATGGACG-1 contig 1 = GAGGAGTCAG...
umi ACATGATGGA = 204 reads: +391 validated
umi ATAATGTCTG = 274 reads: +391 validated
umi ATTGAATACG = 156 reads: +391 validated
umi CACAATTCTC = 428 reads: +391 validated
umi CAGGTTACGC = 233 reads: +391 validated
umi CATCGGTCCT = 172 reads: +391 validated
umi CGCATACAGA = 255 reads: +391 validated
umi CTCTCAATCG = 188 reads: +391 validated
umi GAGGTTCTTT = 73 reads: +391 validated
umi GATGTCTCCG = 261 reads: +391 validated
umi GCCAAGTGGA = 183 reads: +391 validated
umi GTGAGCCCAG = 260 reads: +391 validated
umi GTTTGACCCG = 288 reads: +391 validated
umi TGATATGAGC = 218 reads: +391 validated
umi TGTGTGTCAG = 195 reads: +391 validated
umi TGTTAACCGC = 290 reads: +391 validated
umi TTCAAACAGC = 247 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=555]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 578 reads
cdr3 = CQQSYSTPPITF at 355, score = 9 + 8
umis assigned: [61, 146, 184, 202, 219, 226, 306, 342, 412, 422] and 7 others
of which 17 are surviving nonsolos
reads assigned: 3877
start codons at 28, 34, 90, 103, 239, 461
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.220 = CGTTGGGCAATGGTCT-1

using 847 reads

====================================================================================

graph has 382 edges initially, 8 edges after simplification

total ucounts = 68
nonsolo ucounts = 28[2^12, 3^6, 4^4, 7^2, 10, 68, 130, 527]
surviving nonsolo ucounts = 3[68, 130, 527]
ids = [39, 8, 55]

====================================================================================

UMI info for barcode CGTTGGGCAATGGTCT-1 contig 1 = AGCTTCAGCT...
umi GACCCGCCAA = 62 reads: +388 validated

UMI info for barcode CGTTGGGCAATGGTCT-1 contig 2 = GAGAAGAGCT...
umi TAGTTATCCG = 486 reads: +385 validated

UMI info for barcode CGTTGGGCAATGGTCT-1 contig 3 = CTCAGAGAGG...
umi AAACCACTAT = 1 reads: -430 +1 -2X +3 invalidated
umi ACCCCCAAAT = 128 reads: +413 -1X +22 invalidated

GOOD CONTIGS

TIG 1[bases=493]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-493 ==> 0-58 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [39]
of which 1 are surviving nonsolos
reads assigned: 60
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=508]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-508 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CQQYGSSPYTF at 359, score = 9 + 8
umis assigned: [55]
of which 1 are surviving nonsolos
reads assigned: 482
start codons at 35, 243, 369, 462
confident = false

TIG 3[bases=561]
0-75 ==> 4-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
75-428 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=15)
431-462 ==> 0-31 on |19|IGHD3-16|D-REGION| [len=37] (mis=6)
463-511 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
511-561 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARGHWGDYVWGSNRGGFDYW at 417, score = 9 + 6
umis assigned: [0, 8]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 75, 231, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.235 = CGTTGGGCAGCTCGAC-1

using 124 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 118]
surviving nonsolo ucounts = 1[118]
ids = [1]

====================================================================================

UMI info for barcode CGTTGGGCAGCTCGAC-1 contig 1 = TGCCCAGCTG...
umi GATTAGTCCT = 116 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=519]
0-45 ==> 14-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
45-398 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
437-487 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
487-519 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARQMSRQILLITAAVRGAFDMW at 387, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 45, 219, 243, 378, 399, 450, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.239 = CGTTGGGCAGGCTGAA-1

using 77 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2, 3^3, 4^2, 6, 8, 10, 13, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.246 = CGTTGGGCATGCCTAA-1

using 86 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 16[2^2, 3^3, 4^4, 6^3, 8, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.255 = CGTTGGGGTAGCAAAT-1

using 28 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.269 = CGTTGGGGTCTCCACT-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.271 = CGTTGGGGTCTGATCA-1

using 16 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.301 = CGTTGGGGTTGTACAC-1

using 341 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 6, 323]
surviving nonsolo ucounts = 1[323]
ids = [6]

====================================================================================

UMI info for barcode CGTTGGGGTTGTACAC-1 contig 1 = GGAGTCAGTC...
umi GTTCAGGGAG = 328 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=14)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQLKSYPSLTF at 353, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 26, 32, 88, 237, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.310 = CGTTGGGTCAGATAAG-1

using 2288 reads

====================================================================================

graph has 1732 edges initially, 28 edges after simplification

total ucounts = 491
nonsolo ucounts = 363[2^57, 3^59, 4^48, 5^36, 6^34, 7^34, 8^21, 9^21, 10^11, 11^10, 12^6, 13^7, 14^8, 15^3, 17^2, 18^2, 19^2, 20, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.320 = CGTTGGGTCCTAGAAC-1

using 314 reads

====================================================================================

graph has 354 edges initially, 2 edges after simplification

total ucounts = 145
nonsolo ucounts = 59[2^21, 3^16, 4^6, 5^6, 6^3, 7^2, 9, 10^3, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.328 = CGTTGGGTCGGAAATA-1

using 245 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [0]

====================================================================================

UMI info for barcode CGTTGGGTCGGAAATA-1 contig 1 = GGGGAGGAGT...
umi TACCACAAAC = 250 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=13)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQFGSLPSF at 358, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 31, 37, 93, 106, 245, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.334 = CGTTGGGTCGTCTGCT-1

using 1290 reads

====================================================================================

graph has 1540 edges initially, 26 edges after simplification

total ucounts = 561
nonsolo ucounts = 245[2^98, 3^49, 4^34, 5^21, 6^12, 7^6, 8^8, 9^3, 10, 11^4, 12^3, 13^2, 15^2, 17, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.338 = CGTTGGGTCTAACGGT-1

using 479 reads

====================================================================================

graph has 214 edges initially, 30 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 203, 267]
surviving nonsolo ucounts = 2[203, 267]
ids = [5, 2]

====================================================================================

UMI info for barcode CGTTGGGTCTAACGGT-1 contig 1 = AGGAGTCAGA...
umi TGATTAGTAA = 185 reads: +388 validated

UMI info for barcode CGTTGGGTCTAACGGT-1 contig 2 = GAATCAGTCC...
umi GAGGATGGGC = 251 reads: +22 -1XX +365 invalidated

GOOD CONTIGS

TIG 1[bases=493]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-493 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false

TIG 2[bases=491]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-491 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.344 = CGTTGGGTCTCTAGGA-1

using 514 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3, 5^2, 218, 277]
surviving nonsolo ucounts = 2[218, 277]
ids = [4, 5]

====================================================================================

UMI info for barcode CGTTGGGTCTCTAGGA-1 contig 1 = GCTCTGCTTC...
umi CTGATCGCTG = 216 reads: +391 validated

UMI info for barcode CGTTGGGTCTCTAGGA-1 contig 2 = GTCAGTCTCA...
umi CTTCAAAATG = 280 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=562]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=26)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-562 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 51, 135, 208, 358, 385
confident = false

TIG 2[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPLVTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.347 = CGTTGGGTCTGCCCTA-1

using 191 reads

====================================================================================

graph has 104 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 12, 168]
surviving nonsolo ucounts = 2[12, 168]
ids = [2, 6]

====================================================================================

UMI info for barcode CGTTGGGTCTGCCCTA-1 contig 1 = GGGGTCACAA...
umi CATTGTAATA = 2 reads: -51 +5 -1X +20 -3X +3 -1X +5 -1X +17 -104 +1 -1X +4 -1X +1 -1X +16 -2X +8 -1X +20 -121 invalidated
umi GGTAACCGTC = 161 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=20)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-468 ==> 0-42 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CCAYAGTTTWVF at 362, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 160
start codons at 38, 177, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.353 = CGTTGGGTCTTCGAGA-1

using 156 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 154]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.359 = CTAACTTAGACAAGCC-1

using 96 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 5, 80]
surviving nonsolo ucounts = 1[80]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=382]
6-354 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
353-382 ==> 0-29 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 6, 214, 340
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.363 = CTAACTTAGATAGCAT-1

using 83 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^4, 71]
surviving nonsolo ucounts = 1[71]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.367 = CTAACTTAGCAATCTC-1

using 50 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2, 3^2, 6, 7, 9, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.376 = CTAACTTAGGCTCAGA-1

using 353 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^3, 340]
surviving nonsolo ucounts = 1[340]
ids = [4]

====================================================================================

UMI info for barcode CTAACTTAGGCTCAGA-1 contig 1 = GGGGAGTCAG...
umi CGCGACTAAC = 323 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=475]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-475 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.378 = CTAACTTAGGGTGTTG-1

using 273 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

UMI info for barcode CTAACTTAGGGTGTTG-1 contig 1 = AGTCCCAGTC...
umi AGTAGTGTTC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQLNSYPLTF at 347, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.379 = CTAACTTAGGTGATAT-1

using 345 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 52
nonsolo ucounts = 18[2^7, 3^4, 4, 5^2, 6^2, 12, 247]
surviving nonsolo ucounts = 1[247]
ids = [35]

====================================================================================

UMI info for barcode CTAACTTAGGTGATAT-1 contig 1 = GTCAGACTCA...
umi GTAGACCTCT = 241 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=472]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-365 ==> 0-342 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
408-472 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNGLISF at 350, score = 8 + 7
umis assigned: [35]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 23, 29, 85, 98, 234, 237, 330, 363, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.380 = CTAACTTAGTAAGTAC-1

using 9 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.385 = CTAACTTAGTGTGGCA-1

using 421 reads

====================================================================================

graph has 136 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 127, 287]
surviving nonsolo ucounts = 2[127, 287]
ids = [3, 6]

====================================================================================

UMI info for barcode CTAACTTAGTGTGGCA-1 contig 1 = GTCAGTCTCA...
umi GTGCACCGAC = 113 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=419]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 110
start codons at 23, 29, 85, 98, 234, 333
confident = false

REJECT CONTIGS

TIG 1[bases=529]
4-130 ==> 5874-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
130-478 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
479-517 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 35, 75, 130, 338, 464
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.387 = CTAACTTCAAACCCAT-1

using 31 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 23]
surviving nonsolo ucounts = 1[23]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.401 = CTAACTTCACGGACAA-1

using 365 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6^2, 349]
surviving nonsolo ucounts = 1[349]
ids = [3]

====================================================================================

UMI info for barcode CTAACTTCACGGACAA-1 contig 1 = GCAGAGCCTG...
umi CTTGTCCCAG = 330 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=518]
0-52 ==> 0-52 on |206|IGHV6-1|5'UTR| [len=52] (mis=0)
52-417 ==> 0-365 on |207|IGHV6-1|L-REGION+V-REGION| [len=365] (mis=1)
442-488 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
488-518 ==> 0-30 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARVGRLLPWEAALDYW at 406, score = 10 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 52, 96, 293, 299, 506
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.406 = CTAACTTCAGACGTAG-1

using 513 reads

====================================================================================

graph has 704 edges initially, 8 edges after simplification

total ucounts = 191
nonsolo ucounts = 100[2^45, 3^17, 4^12, 5^10, 6^6, 7^2, 8^2, 9^2, 10^2, 14, 65]
surviving nonsolo ucounts = 1[65]
ids = [127]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.415 = CTAACTTCAGGGAGAG-1

using 250 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 244]
surviving nonsolo ucounts = 1[244]
ids = [1]

====================================================================================

UMI info for barcode CTAACTTCAGGGAGAG-1 contig 1 = AGGAGTCAGA...
umi AATACCATTG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-472 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.416 = CTAACTTCAGGGTATG-1

using 273 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^4, 260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode CTAACTTCAGGGTATG-1 contig 1 = GGAGAAGAGC...
umi CACGCCGCAA = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=485]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-485 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.422 = CTAACTTCATAAAGGT-1

using 54030 reads

====================================================================================

graph has 18692 edges initially, 166 edges after simplification

total ucounts = 2959
nonsolo ucounts = 1428[2^475, 3^268, 4^185, 5^116, 6^68, 7^47, 8^25, 9^14, 10^15, 11^8, 12^7, 13^5, 14^2, 15^2, 16^2, 19, 20^2, 21, 33, 42, 47, 53, 54, 56, 59, 60, 62, 63, 64, 65, 66, 69, 83, 90, 94, 95, 98, 103, 108, 109, 122, 131, 143, 146, 147^2, 148^2, 150, 153, 155, 158, 160, 163, 164, 166, 167, 171, 173^2, 176, 179, 183, 186, 187, 199, 200, 206, 211^3, 214^3, 215^2, 216, 217^2, 218, 219, 220, 221^2, 227, 230, 232, 233, 236, 238, 242^3, 243, 247, 248, 251^2, 253, 256, 260, 263^2, 265, 268, 270^2, 271, 272, 274, 275, 279^3, 281^2, 282^3, 283, 284, 285^2, 286, 287, 288, 289, 291, 292^2, 293^2, 294^2, 295, 302^2, 306^2, 308^2, 312, 313, 314, 317, 318^3, 319, 325, 327, 328^3, 331^2, 332^3, 335^3, 336, 337, 338, 342^2, 344^3, 345, 347^2, 350^2, 352^2, 353^2, 358, 360, 362, 363, 364, 365, 368, 370^2, 379, 385, 386^2, 387^2, 388, 390, 398, 403, 406, 510, 575, 604, 678]
surviving nonsolo ucounts = 170[42, 47, 59, 62, 66, 69, 90, 95, 103, 122, 131, 143, 146, 147, 148^2, 150, 153, 155, 158, 160, 163, 164, 166, 167, 171, 173^2, 176, 179, 183, 186, 187, 199, 200, 206, 211^3, 214^3, 215^2, 216, 217^2, 218, 219, 220, 221^2, 227, 230, 233, 236, 238, 242^3, 243, 247, 248, 251^2, 253, 256, 260, 263^2, 265, 268, 270^2, 271, 272, 274, 275, 279^3, 281^2, 282^3, 283, 284, 285^2, 286, 287, 288, 289, 291, 292^2, 293^2, 294^2, 295, 302^2, 306^2, 308^2, 312, 313, 314, 317, 318^3, 319, 325, 327, 328^3, 331^2, 332^3, 335^3, 336, 337, 338, 342^2, 344^3, 345, 347^2, 350^2, 352^2, 353^2, 358, 360, 362, 363, 364, 365, 368, 370^2, 379, 385, 386^2, 387^2, 388, 390, 398, 403, 406, 510, 575, 604, 678]
ids = [741, 826, 214, 2597, 1671, 882, 2731, 5, 2347, 577, ...]

====================================================================================

UMI info for barcode CTAACTTCATAAAGGT-1 contig 1 = GGAGAAGAGC...
umi AAACAGGGGG = 97 reads: +385 validated
umi AACTGTATCG = 273 reads: +385 validated
umi AAGCTGAATG = 297 reads: +385 validated
umi AAGTACCCTT = 353 reads: +385 validated
umi ACATCCCTTT = 288 reads: +385 validated
umi ACCAGCCATC = 341 reads: +385 validated
umi ACCATTAGTC = 224 reads: +385 validated
umi ACCCCCCTCG = 542 reads: +49 -3XX +2 -1XX +1 -8XX +1 -93XX +1 -9X +1 -2XX +1 -2XX +1 -6XX +2 -3XX +1 -1XX +197 invalidated
umi ACCTAGTAAG = 309 reads: +385 validated
umi AGATATATGA = 307 reads: +385 validated
umi AGGTCGTTAG = 269 reads: +385 validated
umi AGTCACTCCA = 346 reads: +385 validated
umi ATAAGACGGT = 343 reads: -350 +3 -1X +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi ATACCCTGTC = 351 reads: +385 validated
umi ATCTTGTCAT = 285 reads: +385 validated
umi ATGCCCTGTT = 286 reads: +385 validated
umi ATGTGTGATA = 310 reads: +385 validated
umi ATTAACTACA = 399 reads: +385 validated
umi ATTCTTGTCA = 377 reads: +385 validated
umi CAAATCTATC = 274 reads: +385 validated
umi CAATGCTTCC = 340 reads: +385 validated
umi CACCTTGGAC = 130 reads: +385 validated
umi CACTATACCA = 179 reads: +385 validated
umi CACTCATCCA = 330 reads: +385 validated
umi CACTCCATTT = 201 reads: +385 validated
umi CACTTGAACA = 249 reads: +385 validated
umi CAGGCAGCCT = 185 reads: +385 validated
umi CATAAAGTTT = 336 reads: +385 validated
umi CATAGAGAGA = 279 reads: +385 validated
umi CATATCAGAG = 163 reads: +385 validated
umi CATATGTTCG = 158 reads: +385 validated
umi CATCCAACTA = 344 reads: +385 validated
umi CATCTCTCCT = 231 reads: +385 validated
umi CATGTAATAG = 371 reads: +385 validated
umi CATGTCCCGC = 266 reads: +385 validated
umi CCATCTATAA = 177 reads: +385 validated
umi CCCAGTGGTT = 282 reads: +385 validated
umi CCCATTCCCT = 362 reads: +385 validated
umi CCCTGGGGTT = 363 reads: +385 validated
umi CCGCTGTGTT = 411 reads: +385 validated
umi CCTATTCCGC = 220 reads: +385 validated
umi CCTTCATTTC = 282 reads: +385 validated
umi CCTTCGCGCT = 355 reads: +385 validated
umi CGACTGGCTA = 173 reads: +385 validated
umi CGAGGAGGAC = 350 reads: +385 validated
umi CGCACAAGTC = 144 reads: +385 validated
umi CGCAGTACGG = 281 reads: +385 validated
umi CGGATATGAG = 294 reads: +385 validated
umi CGGTGCTATA = 355 reads: +385 validated
umi CGGTTACGGT = 334 reads: +385 validated
umi CGTCATCCGG = 152 reads: +385 validated
umi CGTGATTTTC = 214 reads: +385 validated
umi CTACACCTAG = 348 reads: +385 validated
umi CTACATCCAT = 320 reads: +385 validated
umi CTAGAGTCGT = 225 reads: +385 validated
umi CTATCCCCTC = 263 reads: +385 validated
umi CTATCCTCAG = 205 reads: -347 +1 -1X +4 -1X +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi CTATTGTCCA = 331 reads: +385 validated
umi CTCAACGGTG = 532 reads: -347X +1 -1XX +4 -1XX +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi CTCTAAGCAG = 252 reads: +385 validated
umi CTCTATGTCA = 338 reads: +385 validated
umi CTCTTATCCG = 278 reads: +385 validated
umi CTGATTGGAA = 251 reads: +385 validated
umi CTGGGCTGTG = 295 reads: +385 validated
umi CTTAGCTATA = 233 reads: +385 validated
umi CTTTATAGTT = 335 reads: +385 validated
umi CTTTCTCATC = 317 reads: +385 validated
umi CTTTTTGGAG = 336 reads: +385 validated
umi GAAACTTGAC = 386 reads: +385 validated
umi GAACATCATT = 315 reads: +385 validated
umi GACCCAGGGT = 280 reads: +385 validated
umi GACTGTACTA = 284 reads: +385 validated
umi GAGTAATCCC = 211 reads: +385 validated
umi GATCCCTCTT = 48 reads: +294 -91 non-validated
umi GATCCCTTCA = 399 reads: +385 validated
umi GCTCGCTATG = 391 reads: +385 validated
umi GCTGTTCATT = 339 reads: +385 validated
umi GCTTTTCATT = 316 reads: +385 validated
umi GGAAGCTCTA = 309 reads: +385 validated
umi GGACCATTTG = 334 reads: +385 validated
umi GGCTTAGGAA = 146 reads: +385 validated
umi GGGCTATGGT = 329 reads: +385 validated
umi GGTCCCCTCT = 284 reads: +385 validated
umi GGTGCTATGA = 260 reads: +385 validated
umi GGTTTAAGGT = 312 reads: +385 validated
umi GTGATAACCT = 212 reads: +385 validated
umi GTTAATCCAT = 326 reads: +385 validated
umi GTTCTTCATA = 297 reads: +385 validated
umi GTTCTTGAGT = 292 reads: +385 validated
umi GTTTCGTGAG = 279 reads: +385 validated
umi TAAATATATT = 239 reads: +385 validated
umi TAAGTCGGTG = 335 reads: +385 validated
umi TACGCGCATT = 295 reads: +385 validated
umi TAGGCCGCCA = 150 reads: +385 validated
umi TAGGGGTAAC = 325 reads: +385 validated
umi TATCCACAAG = 318 reads: +385 validated
umi TATCTACTCC = 344 reads: +385 validated
umi TATTGCTTGG = 352 reads: +385 validated
umi TCAAGTTCAC = 340 reads: +385 validated
umi TCACCTCCTA = 362 reads: +385 validated
umi TCACTGGGTG = 295 reads: +385 validated
umi TCATCCACTG = 274 reads: +385 validated
umi TCCAAGTACA = 267 reads: +385 validated
umi TCCACTCATA = 214 reads: +385 validated
umi TCCATTCGGG = 353 reads: +385 validated
umi TCCTTTGCTT = 214 reads: +385 validated
umi TCGCGTATAC = 341 reads: +385 validated
umi TCGGCGCTTG = 383 reads: +385 validated
umi TCTCTCGCTG = 215 reads: +385 validated
umi TCTCTCTGGT = 356 reads: +385 validated
umi TCTGTCCCGT = 318 reads: +385 validated
umi TGAGCGCCAC = 244 reads: +385 validated
umi TGCACTCACG = 256 reads: +385 validated
umi TGTTAATCTA = 283 reads: +385 validated
umi TGTTGGGCGT = 389 reads: +385 validated
umi TTAGGTGATT = 391 reads: +385 validated
umi TTATCGGCCA = 168 reads: +385 validated
umi TTCATATCAA = 71 reads: +249 -1 +1 -1 +1 -1X +87 -44 invalidated
umi TTCCTCGTAG = 353 reads: +385 validated
umi TTCCTCTGCC = 352 reads: +385 validated
umi TTCGGTCCGT = 367 reads: +385 validated
umi TTCTCCAGTG = 290 reads: +385 validated
umi TTGATCCCAA = 278 reads: +385 validated
umi TTGCTCTTAA = 322 reads: +385 validated
umi TTGGATTGGG = 388 reads: +385 validated
umi TTGTTGGTCT = 288 reads: +385 validated
umi TTGTTTCCCT = 214 reads: +385 validated
umi TTTCAGTTAA = 306 reads: +385 validated
umi TTTGGGAATG = 158 reads: +385 validated
umi TTTGTTGGTA = 336 reads: +385 validated

UMI info for barcode CTAACTTCATAAAGGT-1 contig 2 = AGCTCTGGGA...
umi AAATTGTAGG = 267 reads: +436 validated
umi ACAGAATCGG = 243 reads: +436 validated
umi ACCATTGGGG = 294 reads: +436 validated
umi ACTATATATA = 58 reads: +436 validated
umi AGTTTTCCCC = 248 reads: +436 validated
umi ATCACGGGTA = 285 reads: +436 validated
umi CAAGAGTTTA = 261 reads: +274 -1XX +161 invalidated
umi CACCATTTAT = 121 reads: +319 -17 +51 -1 +3 -45 non-validated
umi CATATCCGCA = 154 reads: -407X +2 -9X +2 -2X +1 -2X +2 -2X +2 -1X +4 invalidated
umi CCAACATTCT = 338 reads: +436 validated
umi CCATAGGTAG = 47 reads: +341 -51 +44 non-validated
umi CCATCATGGT = 211 reads: +413 -23 non-validated
umi CCATCCATCA = 387 reads: +436 validated
umi CCCCAAGGCT = 241 reads: +436 validated
umi CCCCGATGGT = 71 reads: +378 -1 +2 -1 +1 -1 +7 -45 non-validated
umi CCTTCTATAC = 216 reads: +427 -9 non-validated
umi CGCCCCTCTC = 173 reads: +436 validated
umi CGCCTACTAA = 169 reads: +293 -4XX +139 invalidated
umi CGCTCTTTAT = 172 reads: +436 validated
umi CTAGGCCGGA = 148 reads: +418 -18 non-validated
umi CTTAAGCGGC = 172 reads: +420 -1 +15 non-validated
umi CTTCCCCTTT = 241 reads: +436 validated
umi GATATAGTAC = 221 reads: +436 validated
umi GCATTGAGGA = 155 reads: +426 -10 non-validated
umi GCCCATCGTC = 41 reads: -418X +2 -2X +1 -2X +2 -2X +2 -1X +4 invalidated
umi GGTCCATACG = 228 reads: +375 -9X +52 invalidated
umi TATACAACGC = 191 reads: +419 -1 +3 -1 +12 non-validated
umi TGCCACCCGT = 222 reads: +432 -3 +1 non-validated
umi TGGTTTCCGT = 60 reads: +380 -1 +1 -1 +4 -49 non-validated
umi TGTCATCTCA = 205 reads: +436 validated
umi TTCATCGCCA = 214 reads: +436 validated
umi TTTATCTCTA = 148 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 125 umis using 5752 reads
cdr3 = CQQYGSSPGTF at 360, score = 9 + 8
umis assigned: [5, 42, 48, 51, 132, 150, 154, 164, 183, 264] and 120 others
of which 130 are surviving nonsolos
reads assigned: 37194
start codons at 36, 244, 370, 463
confident = true

TIG 2[bases=587]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=12)
466-516 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
516-587 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 256 reads
cdr3 = CTTGFWSTLTTRLWAFDIW at 428, score = 8 + 8
umis assigned: [22, 113, 156, 214, 347, 389, 530, 577, 686, 775] and 22 others
of which 31 are surviving nonsolos
reads assigned: 6028
start codons at 80, 236, 303, 332, 360, 389, 497
confident = true
now this is a cell
paired!

GCCGTGTATTACTGCACCACAGGCTTTTGGTCCACGCTGACTACCCGGCTGTGGGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGGGGACTTTTGGCCAGGGGACCAAACTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.425 = CTAACTTCATCAGTAC-1

using 488 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 484]
surviving nonsolo ucounts = 1[484]
ids = [1]

====================================================================================

UMI info for barcode CTAACTTCATCAGTAC-1 contig 1 = GAATCAGTCC...
umi ATACTTAAGC = 476 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 89 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 473
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.429 = CTAACTTCATCTATGG-1

using 346 reads

====================================================================================

graph has 120 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 4, 131, 207]
surviving nonsolo ucounts = 2[131, 207]
ids = [3, 4]

====================================================================================

UMI info for barcode CTAACTTCATCTATGG-1 contig 1 = AGCTTCAGCT...
umi TCCGCATCAG = 131 reads: +388 validated
umi TTAAGTTTGA = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-565 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 332
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.435 = CTAACTTCATTGGTAC-1

using 353 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 31
nonsolo ucounts = 19[2^4, 3^3, 4, 5^5, 8, 9^2, 10^2, 249]
surviving nonsolo ucounts = 1[249]
ids = [7]

====================================================================================

UMI info for barcode CTAACTTCATTGGTAC-1 contig 1 = GGAATCAGTC...
umi ATCTCGTCCG = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.436 = CTAACTTGTAAACACA-1

using 28 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 18]
surviving nonsolo ucounts = 1[18]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.442 = CTAACTTGTAGCGCAA-1

using 512 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 509]
surviving nonsolo ucounts = 1[509]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=506]
5-259 ==> 86-340 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
257-295 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
295-506 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQVWDSSSVVF at 234, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 500
start codons at 118, 121, 217
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.445 = CTAACTTGTATGCTTG-1

using 22 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.446 = CTAACTTGTCAAAGAT-1

using 248 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode CTAACTTGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi AGGGTCTATG = 240 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=478]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-478 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.456 = CTAACTTGTGGCGAAT-1

using 294 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 284]
surviving nonsolo ucounts = 1[284]
ids = [6]

====================================================================================

UMI info for barcode CTAACTTGTGGCGAAT-1 contig 1 = AGGAGTCAGT...
umi TGGGACCTCT = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.463 = CTAACTTGTTCGAATC-1

using 15 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.467 = CTAACTTTCAAACCAC-1

using 215 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2^3, 3^3, 4, 5, 10, 177]
surviving nonsolo ucounts = 1[177]
ids = [7]

====================================================================================

UMI info for barcode CTAACTTTCAAACCAC-1 contig 1 = GTCAGTCTCA...
umi ACCTTGTCAA = 1 reads: -129 +1 -1 +2 -5X +1 -2 +4 -1 +1 -3 +2 -1 +4 -1 +7 -1 +6 -1 +1 -1 +4 -2X +2 -205 invalidated
umi CCCTTGTGAA = 166 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [1, 7]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.468 = CTAACTTTCAACACAC-1

using 68 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 13[2^4, 3^2, 4, 5, 6^2, 8^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.469 = CTAACTTTCAACGGGA-1

using 698 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[4, 5, 165, 180, 343]
surviving nonsolo ucounts = 3[165, 180, 343]
ids = [5, 1, 4]

====================================================================================

UMI info for barcode CTAACTTTCAACGGGA-1 contig 1 = TGGGGACAGC...
umi CTAACAAGAT = 349 reads: +424 validated
umi GCCACAAGCC = 165 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=544]
18-371 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=6)
392-442 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
442-544 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 51 reads
cdr3 = CARDSGYDLTGHAFDIW at 360, score = 9 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 504
start codons at 18, 216, 315, 394, 423, 460, 521
confident = true

REJECT CONTIGS

TIG 1[bases=369]
0-97 ==> 0-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-97 ==> 5903-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
30-122 ==> 2403-2495 on segment after IGKV1OR2-108 exon 2 [len=6000] (mis=12)
97-369 ==> 0-272 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 2, 42, 97, 166, 302
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.471 = CTAACTTTCACAACGT-1

using 230 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode CTAACTTTCACAACGT-1 contig 1 = TGAGCGCAGA...
umi GTTAATTGTC = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=522]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-522 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.472 = CTAACTTTCACCGTAA-1

using 340 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 331]
surviving nonsolo ucounts = 1[331]
ids = [2]

====================================================================================

UMI info for barcode CTAACTTTCACCGTAA-1 contig 1 = ATCAGTCCCA...
umi CTGCGGTAGC = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-500 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 41.473 = CTAACTTTCACGGTTA-1

using 252 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 5, 237]
surviving nonsolo ucounts = 1[237]
ids = [5]

====================================================================================

UMI info for barcode CTAACTTTCACGGTTA-1 contig 1 = AGCTTCAGCT...
umi CAGCTTCATC = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=533]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-533 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!
sorting bam, mem = 0.12
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk041-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk041-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

23.348 seconds used processing barcodes, peak mem = 0.27
