[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk039-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk039-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk039.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.0 = CGCGGTACAATAACGA-1

using 5832 reads

====================================================================================

graph has 3398 edges initially, 60 edges after simplification

total ucounts = 542
nonsolo ucounts = 231[2^92, 3^47, 4^35, 5^15, 6^9, 7^4, 8^2, 9, 10, 11^2, 12, 25, 41, 131, 164, 174, 176, 181, 195, 200, 225, 227, 229, 231, 244, 245, 248, 256^2, 313, 315, 342, 412]
surviving nonsolo ucounts = 23[2, 25, 41, 131, 164, 174, 176, 181, 195, 200, 225, 227, 229, 231, 244, 245, 248, 256^2, 313, 315, 342, 412]
ids = [402, 63, 367, 303, 368, 79, 86, 330, 152, 7, ...]

====================================================================================

UMI info for barcode CGCGGTACAATAACGA-1 contig 1 = AGAGCTCTGG...
umi ACCTCGGGAC = 250 reads: +391 validated
umi ATACAACCAT = 257 reads: +391 validated
umi CAGACGTACA = 243 reads: +391 validated
umi CTTCCCACGA = 230 reads: +391 validated
umi GCCCCTTCTT = 182 reads: +391 validated
umi GTCGCGCCGT = 41 reads: -21 +5 -1 +364 non-validated
umi GTCGCGCCTT = 167 reads: +391 validated

UMI info for barcode CGCGGTACAATAACGA-1 contig 2 = AGCTCTGAGA...
umi ACACGAAATA = 173 reads: +435 -4 non-validated
umi CACACACTCG = 163 reads: +377 -1 +3 -1X +2 -1XX +51 -1 +2 invalidated
umi CACATTTAGG = 217 reads: +439 validated
umi CACCGCAGCC = 137 reads: +402 -2 +35 non-validated
umi TGTATCTATC = 197 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=624]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-374 ==> 0-352 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=0)
375-413 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
413-624 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 221 reads
cdr3 = CQTWGTEGVF at 355, score = 8 + 8
umis assigned: [17, 44, 97, 287, 330, 367, 368]
of which 7 are surviving nonsolos
reads assigned: 1336
start codons at 22, 183, 223, 239, 338
confident = true

TIG 2[bases=546]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=0)
434-465 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
472-518 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
518-546 ==> 0-28 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 4 umis using 62 reads
cdr3 = CAKDSGIVVVPAATWGGALDYW at 421, score = 9 + 7
umis assigned: [7, 79, 83, 86, 493]
of which 5 are surviving nonsolos
reads assigned: 870
start codons at 79, 230, 235, 382, 462, 536
confident = true

REJECT CONTIGS

TIG 1[bases=589]
1-396 ==> 1912-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
392-554 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
554-589 ==> 0-35 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
umis assigned: [152]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 76, 141, 173, 208, 232, 309, 362, 417, 422, 535
confident = false
did not find CDR3

TIG 2[bases=541]
3-84 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-365 ==> 0-338 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [63, 69, 229, 244, 303, 321, 338, 428, 440]
of which 9 are surviving nonsolos
reads assigned: 2205
start codons at 27, 33, 89, 102, 238, 447
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCGAAAGATAGCGGTATTGTAGTAGTACCAGCTGCTACATGGGGGGGGGCGTTGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGAAGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.3 = CGCGGTACAATGGATA-1

using 354 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 348]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGCGGTACAATGGATA-1 contig 1 = ACTTTCTGAG...
umi CGCAGCCCTT = 318 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=512]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=42)
408-471 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
471-512 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CARGREYASGQDYYYGMDVW at 380, score = 9 + 7
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 314
start codons at 35, 79, 258, 399, 428
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.6 = CGCGGTACACAGGTTT-1

using 281 reads

====================================================================================

graph has 117 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode CGCGGTACACAGGTTT-1 contig 1 = GGAGTCAGTC...
umi AACCCACGGG = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.9 = CGCGGTACACCAGCAC-1

using 270 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 6, 258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode CGCGGTACACCAGCAC-1 contig 1 = ATACTTTCTG...
umi GCAATGACCG = 261 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=523]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=26)
417-452 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
452-523 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CASTTLGYCPSFFW at 379, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 16, 37, 81
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.13 = CGCGGTACACGAAGCA-1

using 165 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [0]

====================================================================================

UMI info for barcode CGCGGTACACGAAGCA-1 contig 1 = CCCTCCCCTA...
umi AGCGTCTGGC = 146 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
0-39 ==> 21-60 on |68|IGHV1-24|5'UTR| [len=60] (mis=0)
39-390 ==> 0-351 on |69|IGHV1-24|L-REGION+V-REGION| [len=351] (mis=44)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
457-524 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CATAAGINKWAFDSW at 381, score = 10 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 39, 184, 195, 237, 259, 303, 336, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.15 = CGCGGTACAGACACTT-1

using 634 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4, 5, 181, 444]
surviving nonsolo ucounts = 2[181, 444]
ids = [0, 2]

====================================================================================

UMI info for barcode CGCGGTACAGACACTT-1 contig 1 = GCTCTGCTTC...
umi CAAAGCATCG = 171 reads: +394 validated
umi GCCCTTGTAA = 414 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=611]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-611 ==> 0-166 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 95 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 575
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.17 = CGCGGTACAGCATGAG-1

using 9341 reads

====================================================================================

graph has 3623 edges initially, 24 edges after simplification

total ucounts = 358
nonsolo ucounts = 162[2^68, 3^27, 4^16, 5^4, 6^3, 7^3, 8, 9, 15, 72, 81, 100, 101, 123, 126^2, 161, 192^2, 198, 204, 206, 209, 210, 211, 219, 220, 223, 224, 230, 236, 238, 253, 265, 266, 270, 285, 292, 297, 302, 307, 309, 311, 312, 348, 401, 453]
surviving nonsolo ucounts = 35[81, 100, 101, 126, 161, 192^2, 198, 204, 206, 209, 210, 211, 219, 220, 223, 224, 230, 236, 238, 253, 265, 266, 270, 285, 292, 297, 302, 307, 309, 311, 312, 348, 401, 453]
ids = [19, 137, 171, 170, 142, 69, 309, 17, 335, 43, ...]

====================================================================================

UMI info for barcode CGCGGTACAGCATGAG-1 contig 1 = TGGGGACCCA...
umi ACGAAACTCT = 84 reads: +403 -25 +3 -1 +5 -1 +4 non-validated
umi ACGCGACGCT = 222 reads: +442 validated
umi ATCTTCGAGC = 211 reads: +411 -1 +30 non-validated
umi CATACCCTCC = 235 reads: +442 validated
umi CCCATTCGGG = 310 reads: +442 validated
umi CGGGGGTCCT = 100 reads: +442 validated
umi CGTATTATAT = 164 reads: +442 validated
umi GACGCGGATC = 127 reads: +442 validated
umi GAGAAATAAG = 103 reads: +361 -5 +12 -1 +1 -1 +61 non-validated
umi GCTTACTCGT = 235 reads: +442 validated
umi TACCGCTAAT = 312 reads: +442 validated
umi TTGCTTTGTA = 226 reads: +418 -24 non-validated

UMI info for barcode CGCGGTACAGCATGAG-1 contig 2 = AGAGCTCTGG...
umi AAGGTCGTTA = 281 reads: +388 validated
umi AAGTCACAAC = 311 reads: +388 validated
umi ACAGTGCGGG = 304 reads: +388 validated
umi ACCGGCATAG = 198 reads: +388 validated
umi ATAATGTCAC = 206 reads: +388 validated
umi ATCGAAGCCA = 273 reads: +388 validated
umi ATGTTACGTT = 276 reads: +254 -1X +133 invalidated
umi ATTGAATTAC = 196 reads: +388 validated
umi CAGATTCTTT = 348 reads: +388 validated
umi CATATGCGGG = 318 reads: +388 validated
umi CCCAACCGTC = 484 reads: +151 -1XX +4 -4XX +1 -1XX +1 -6XX +1 -2XX +1 -88XX +1 -3XX +2 -1XX +1 -7XX +1 -1XX +1 -1XX +1 -1XX +1 -1XX +104 invalidated
umi CTATGAATGA = 221 reads: +388 validated
umi GATCCCCAAC = 211 reads: +388 validated
umi GCAATCCCCA = 205 reads: +388 validated
umi GCACGCCCGC = 252 reads: +388 validated
umi GCGGAGGGTT = 403 reads: -74X +314 invalidated
umi GCTTTACGGA = 299 reads: +388 validated
umi GTCAGCCGCC = 236 reads: +388 validated
umi TAGGTGAACC = 226 reads: +388 validated
umi TCAATCGTAC = 264 reads: +388 validated
umi TCCCTGGTCT = 291 reads: +388 validated
umi TGAATCCTTC = 199 reads: +388 validated
umi TTCCCCCGTC = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=10)
450-501 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 114 reads
cdr3 = CARSAPVSGTTFRRADEKSFDPW at 401, score = 8 + 7
umis assigned: [19, 20, 55, 91, 111, 137, 142, 170, 171, 208] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2288
start codons at 59, 210, 257, 262, 279, 323, 356
confident = true

TIG 2[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 962 reads
cdr3 = CQQYGSSPSWTF at 368, score = 9 + 8
umis assigned: [6, 7, 15, 17, 43, 51, 62, 69, 81, 93] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6053
start codons at 44, 252, 378, 474
confident = true
now this is a cell
paired!

TGTGCGAGATCGGCGCCGGTATCTGGAACTACCTTTAGGCGCGCCGACGAGAAGTCGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCATCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.25 = CGCGGTACATCACGAT-1

using 95 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 93]
surviving nonsolo ucounts = 1[93]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.37 = CGCGGTAGTAATCGTC-1

using 9 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.43 = CGCGGTAGTAGGACAC-1

using 22 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^3, 3^2, 4, 5]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.55 = CGCGGTAGTCTGCAAT-1

using 314 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 116, 192]
surviving nonsolo ucounts = 2[116, 192]
ids = [2, 3]

====================================================================================

UMI info for barcode CGCGGTAGTCTGCAAT-1 contig 1 = AGGAGTCAGA...
umi GCGGCACGTG = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.60 = CGCGGTAGTTACGACT-1

using 828 reads

====================================================================================

graph has 286 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[157, 180, 220, 264]
surviving nonsolo ucounts = 4[157, 180, 220, 264]
ids = [9, 6, 5, 0]

====================================================================================

UMI info for barcode CGCGGTAGTTACGACT-1 contig 1 = GGAGTCAGAC...
umi CCCAAGGTTA = 219 reads: +394 validated
umi CCTTCTGATA = 177 reads: +394 validated
umi GAGGCTTGTA = 157 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 87 reads
cdr3 = CQHFHSYSRMFTF at 353, score = 8 + 7
umis assigned: [5, 6, 9]
of which 3 are surviving nonsolos
reads assigned: 548
start codons at 26, 32, 88, 101, 237, 240, 333, 380, 462
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.65 = CGCGGTAGTTTAGGAA-1

using 20 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.74 = CGCGGTATCAGCCTAA-1

using 878 reads

====================================================================================

graph has 344 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 283, 289, 299]
surviving nonsolo ucounts = 2[283, 299]
ids = [2, 5]

====================================================================================

UMI info for barcode CGCGGTATCAGCCTAA-1 contig 1 = GTCAGTCCCA...
umi CCAACACGGG = 284 reads: +388 validated
umi GATATTCGCA = 300 reads: +388 validated
umi TAATGGTCCG = 6 reads: -324X +1 -5XX +1 -3XX +1 -2XX +1 -3XX +1 -2XX +1 -2XX +1 -6XX +1 -2XX +21 -4XX +2 -2XX +1 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=13)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 94 reads
cdr3 = CQQFHNFPLTF at 350, score = 9 + 9
umis assigned: [2, 5, 7]
of which 2 are surviving nonsolos
reads assigned: 581
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.78 = CGCGGTATCCAACCAA-1

using 258 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=529]
0-368 ==> 3-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
379-427 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
427-529 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CARAKRSYGFDYW at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 18, 62, 148, 379, 445, 506
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.85 = CGCGGTATCCTGCCAT-1

using 387 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 380]
surviving nonsolo ucounts = 1[380]
ids = [4]

====================================================================================

UMI info for barcode CGCGGTATCCTGCCAT-1 contig 1 = AGCTTCAGCT...
umi GTTCCAGCCT = 380 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=3)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CAAWDDSLNGVVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.90 = CGCGGTATCGCAAGCC-1

using 157 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[154]
surviving nonsolo ucounts = 1[154]
ids = [0]

====================================================================================

UMI info for barcode CGCGGTATCGCAAGCC-1 contig 1 = TCTGGGTGTC...
umi ACGGACACTA = 140 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
15-352 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
359-397 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
397-493 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSADSSGTPWVF at 330, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 15, 76, 145, 163
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.93 = CGCGGTATCGCTGATA-1

using 139 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[2^3, 3, 130]
surviving nonsolo ucounts = 1[130]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.99 = CGCGGTATCTCTGAGA-1

using 293 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 10, 121, 157]
surviving nonsolo ucounts = 3[10, 121, 157]
ids = [5, 1, 4]

====================================================================================

UMI info for barcode CGCGGTATCTCTGAGA-1 contig 1 = ACTTTCTGAG...
umi CCCTAAGCTA = 151 reads: +415 validated

UMI info for barcode CGCGGTATCTCTGAGA-1 contig 2 = GGGAGAGGAG...
umi ACTTTATGTA = 120 reads: +436 validated
umi TTCCAGAAAG = 10 reads: +139 -73 +56 -26 +5 -1 +15 -1 +3 -1 +7 -2 +72 -1 +19 -15 non-validated

GOOD CONTIGS

TIG 1[bases=581]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-581 ==> 0-131 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 35, 79, 159, 229, 431
confident = false

TIG 2[bases=530]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
509-530 ==> 0-21 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARESFAYCSADCHKYYFDYW at 415, score = 8 + 7
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 127
start codons at 73, 229, 280, 290, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.102 = CGCGGTATCTGCTGCT-1

using 609 reads

====================================================================================

graph has 268 edges initially, 8 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[4, 180, 193, 224]
surviving nonsolo ucounts = 3[180, 193, 224]
ids = [0, 8, 1]

====================================================================================

UMI info for barcode CGCGGTATCTGCTGCT-1 contig 1 = CAGCTGTGGG...
umi AAATACACAA = 154 reads: +385 validated

UMI info for barcode CGCGGTATCTGCTGCT-1 contig 2 = GGAGACTCAG...
umi GTGACTCTAT = 199 reads: +388 validated

UMI info for barcode CGCGGTATCTGCTGCT-1 contig 3 = TGGGGAGGAA...
umi ACCCTAGTAA = 219 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=459]
0-42 ==> 9-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
42-388 ==> 0-346 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-459 ==> 0-32 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSRYVF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 42, 196, 199, 250, 349, 376, 391
confident = false

TIG 2[bases=546]
22-373 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNSYSRTF at 349, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 22, 28, 84, 97, 233, 236, 329, 452
confident = false

TIG 3[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 37, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.104 = CGCGGTATCTGGGCCA-1

using 224 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 214]
surviving nonsolo ucounts = 1[214]
ids = [4]

====================================================================================

UMI info for barcode CGCGGTATCTGGGCCA-1 contig 1 = AGCTGTGGGT...
umi CCTTAACCGC = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=542]
0-41 ==> 73-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
41-394 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
429-542 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLNGPVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 41, 345, 370, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.105 = CGCGGTATCTGTACGA-1

using 299 reads

====================================================================================

graph has 181 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 12[2^2, 3^2, 6, 7^2, 10, 11, 12, 13, 216]
surviving nonsolo ucounts = 1[216]
ids = [13]

====================================================================================

UMI info for barcode CGCGGTATCTGTACGA-1 contig 1 = AGGAGTCAGT...
umi TAACGAAGCT = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.106 = CGCGGTATCTGTTGAG-1

using 141 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[136]
surviving nonsolo ucounts = 1[136]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.111 = CGCGTTTAGAACAACT-1

using 1316 reads

====================================================================================

graph has 1908 edges initially, 18 edges after simplification

total ucounts = 741
nonsolo ucounts = 277[2^136, 3^64, 4^34, 5^22, 6^13, 7^4, 8^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.116 = CGCGTTTAGAGTCTGG-1

using 107 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4^2, 96]
surviving nonsolo ucounts = 1[96]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.118 = CGCGTTTAGCATCATC-1

using 251 reads

====================================================================================

graph has 119 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode CGCGTTTAGCATCATC-1 contig 1 = AGTCAGTCTC...
umi AGTCCCTTTA = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.122 = CGCGTTTAGCTAGGCA-1

using 220 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 214]
surviving nonsolo ucounts = 1[214]
ids = [2]

====================================================================================

UMI info for barcode CGCGTTTAGCTAGGCA-1 contig 1 = ATCACATAAC...
umi CTATATGTCG = 217 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=544]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=3)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CASTQLWSYFFDYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 58, 209, 256, 355, 417
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.129 = CGCGTTTAGGTGTTAA-1

using 30 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 21]
surviving nonsolo ucounts = 1[21]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.135 = CGCGTTTAGTTTCCTT-1

using 597 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 188^2, 213]
surviving nonsolo ucounts = 3[188^2, 213]
ids = [2, 6, 7]

====================================================================================

UMI info for barcode CGCGTTTAGTTTCCTT-1 contig 1 = ACCCAAAAAC...
umi GTAGTCATTG = 180 reads: +436 validated

UMI info for barcode CGCGTTTAGTTTCCTT-1 contig 2 = TGGGAGGAAT...
umi ACTGTGCTTT = 188 reads: +388 validated
umi TTCTGACTAC = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-517 ==> 0-27 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 54, 252, 257, 274, 318, 351
confident = true

TIG 2[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 64 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 398
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.147 = CGCGTTTCACTGTTAG-1

using 312 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 305]
surviving nonsolo ucounts = 1[305]
ids = [4]

====================================================================================

UMI info for barcode CGCGTTTCACTGTTAG-1 contig 1 = AGTCAGACTC...
umi GGGTCAACCC = 304 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNSYPLTF at 351, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 24, 30, 86, 99, 235, 238, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.148 = CGCGTTTCAGACGCTC-1

using 530 reads

====================================================================================

graph has 222 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[241, 286]
surviving nonsolo ucounts = 2[241, 286]
ids = [0, 3]

====================================================================================

UMI info for barcode CGCGTTTCAGACGCTC-1 contig 1 = GGGGTCTCCC...
umi AAGGATCCGC = 240 reads: +439 validated
umi GGTGCCACAG = 285 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=569]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=7)
415-443 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=2)
448-498 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CARQRGYCGGDCYSAADGFDIW at 401, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 520
start codons at 59, 233, 257, 392, 450, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.155 = CGCGTTTCAGTCGTGC-1

using 542 reads

====================================================================================

graph has 182 edges initially, 6 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[3^3, 5, 9, 10, 12, 173, 316]
surviving nonsolo ucounts = 2[173, 316]
ids = [2, 3]

====================================================================================

UMI info for barcode CGCGTTTCAGTCGTGC-1 contig 1 = AGGAATCAGT...
umi ACTAGGGCGC = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 27, 33, 102, 238, 457
confident = false

REJECT CONTIGS

TIG 1[bases=349]
2-100 ==> 258-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
100-138 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
138-349 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 68, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 51, 78, 102, 270
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.158 = CGCGTTTCATACAGCT-1

using 556 reads

====================================================================================

graph has 218 edges initially, 30 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[158, 160, 233]
surviving nonsolo ucounts = 3[158, 160, 233]
ids = [2, 0, 6]

====================================================================================

UMI info for barcode CGCGTTTCATACAGCT-1 contig 1 = AAGAGGCAGC...
umi CACAATCAGT = 153 reads: +391 validated

UMI info for barcode CGCGTTTCATACAGCT-1 contig 2 = ACCCAAAAAC...
umi AGGTGGCCTG = 159 reads: +436 validated

UMI info for barcode CGCGTTTCATACAGCT-1 contig 3 = GCTCTGCTTC...
umi TTTATATATC = 221 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=532]
0-30 ==> 132-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
30-370 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=3)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
421-532 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CCSYAGSSTYWVF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 30, 169, 231, 238, 364
confident = false

TIG 2[bases=526]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-526 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 3[bases=545]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-545 ==> 0-100 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.160 = CGCGTTTCATATACCG-1

using 378 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[135, 239]
surviving nonsolo ucounts = 2[135, 239]
ids = [3, 1]

====================================================================================

UMI info for barcode CGCGTTTCATATACCG-1 contig 1 = AGCATGGACA...
umi CGATACTCAG = 129 reads: +388 validated

UMI info for barcode CGCGTTTCATATACCG-1 contig 2 = AGCTCTGAGA...
umi CAGTTACTCA = 229 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=451]
3-354 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
354-391 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
391-451 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNSYPLTF at 330, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 3, 9, 65, 78, 214, 217, 310, 433
confident = false

TIG 2[bases=568]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=13)
438-469 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=8)
465-515 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
515-568 ==> 0-53 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CAKTGGGDCDSSGYYCAFDIW at 421, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 79, 230, 235, 382, 496, 533
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.164 = CGCGTTTCATCCGTGG-1

using 147 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[147]
surviving nonsolo ucounts = 1[147]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=409]
13-206 ==> 106-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=11)
283-331 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
331-409 ==> 0-78 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CVRGGRSLWFGDLLDYW at 249, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 95
start codons at 63, 121, 124, 272
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.165 = CGCGTTTCATCCTTGC-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.177 = CGCGTTTGTCCCGACA-1

using 193 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[192]
surviving nonsolo ucounts = 1[192]
ids = [1]

====================================================================================

UMI info for barcode CGCGTTTGTCCCGACA-1 contig 1 = GAGGAACTGC...
umi GCGTGCGCCT = 175 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=454]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-454 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQRSNWPLFTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 33, 238, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.181 = CGCGTTTGTCGAACAG-1

using 6111 reads

====================================================================================

graph has 2160 edges initially, 28 edges after simplification

total ucounts = 220
nonsolo ucounts = 90[2^40, 3^9, 4^3, 5^4, 6, 8^2, 10, 11, 16, 25, 29, 129, 130, 147, 153, 160, 161, 182, 186, 187, 198, 206, 236, 238, 239, 246, 247, 248, 251, 252, 255, 263^2, 268, 278, 300, 306]
surviving nonsolo ucounts = 27[29, 129, 130, 147, 153, 160, 161, 182, 186, 187, 198, 206, 236, 238, 239, 246, 247, 248, 251, 252, 255, 263^2, 268, 278, 300, 306]
ids = [198, 10, 162, 52, 1, 58, 189, 110, 179, 186, ...]

====================================================================================

UMI info for barcode CGCGTTTGTCGAACAG-1 contig 1 = ACCCAAAAAC...
umi AAAACGCCAT = 132 reads: +333 -1 +81 non-validated
umi ATTGCACCTC = 198 reads: +408 -7 non-validated
umi CAAACTACGC = 147 reads: +415 validated
umi CTGCCGTCTT = 153 reads: +415 validated
umi GAGACGGGCA = 222 reads: +179 -1XX +235 invalidated
umi GTCCGATCAG = 244 reads: +415 validated
umi TAATTTCCGC = 111 reads: +415 validated
umi TCTACCGTGG = 191 reads: +415 validated
umi TCTTACAATG = 160 reads: +415 validated
umi TGTCGTTGTG = 29 reads: +208 -5 +82 -2 +3 -2 +1 -3 +2 -1 +4 -1 +30 -1 +64 -1 +5 non-validated

UMI info for barcode CGCGTTTGTCGAACAG-1 contig 2 = AGAGCCCTGG...
umi AAAGTGGGGA = 253 reads: +385 validated
umi AAATAACACA = 243 reads: +385 validated
umi AAGCTTTTTC = 257 reads: +385 validated
umi AATTATCGTA = 131 reads: +365 -1 +19 non-validated
umi ACCCAGTGTC = 236 reads: +385 validated
umi CAATGTGGTG = 161 reads: +385 validated
umi CCGGGAATCA = 263 reads: +385 validated
umi CCTATAGATC = 277 reads: +385 validated
umi CGTATTGGGT = 270 reads: +385 validated
umi GAAATATTAA = 256 reads: +385 validated
umi GCCCGCTTTG = 237 reads: +385 validated
umi GCGTGATCTC = 307 reads: +385 validated
umi GGTCGGCTTA = 256 reads: +385 validated
umi TCAATCCACC = 247 reads: +385 validated
umi TCATAATACA = 187 reads: +385 validated
umi TTTCATTACT = 250 reads: +385 validated
umi TTTCGGATTA = 301 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=540]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
431-469 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 125 reads
cdr3 = CARDGEILTGYPYW at 396, score = 8 + 7
umis assigned: [1, 48, 52, 110, 129, 154, 162, 186, 189, 198]
of which 10 are surviving nonsolos
reads assigned: 1544
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 406
confident = true

TIG 2[bases=565]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 612 reads
cdr3 = CQQRSNWPPVTF at 365, score = 9 + 8
umis assigned: [2, 3, 6, 10, 17, 58, 76, 82, 98, 123] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4059
start codons at 44, 249, 252, 471
confident = true
now this is a cell
paired!

AGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATGGGGAAATTTTGACTGGTTATCCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCGGTCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.186 = CGCGTTTGTCTGCGGT-1

using 158 reads

====================================================================================

graph has 65 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=421]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
1-53 ==> 2818-2870 on segment before IGLV3-13 exon 1 [len=3075] (mis=4)
15-90 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-421 ==> 0-34 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
cdr3 = CQSADSSGTHVVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 43, 104, 173, 191, 386
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.202 = CGCGTTTTCAACTCTT-1

using 405 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[199, 200]
surviving nonsolo ucounts = 2[199, 200]
ids = [3, 5]

====================================================================================

UMI info for barcode CGCGTTTTCAACTCTT-1 contig 1 = ACCCAAAAAC...
umi GGGCATAGTC = 198 reads: +436 validated

UMI info for barcode CGCGTTTTCAACTCTT-1 contig 2 = GGAATCAGTC...
umi GCCTTCGGTA = 174 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-538 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=487]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-487 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.204 = CGCGTTTTCACGATGT-1

using 626 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[623]
surviving nonsolo ucounts = 1[623]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=359]
2-77 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-134 ==> 0-108 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
223-359 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 612
start codons at 26, 32, 88, 101, 164, 265
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.209 = CGCGTTTTCCAGAAGG-1

using 937 reads

====================================================================================

graph has 1398 edges initially, 6 edges after simplification

total ucounts = 539
nonsolo ucounts = 206[2^111, 3^47, 4^20, 5^17, 6^6, 7^2, 8^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.215 = CGCGTTTTCCGCAGTG-1

using 378 reads

====================================================================================

graph has 148 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[91, 143^2]
surviving nonsolo ucounts = 3[91, 143^2]
ids = [1, 0, 3]

====================================================================================

UMI info for barcode CGCGTTTTCCGCAGTG-1 contig 1 = CGGTGTTTCC...
umi GATCTGTTGC = 88 reads: +430 validated

UMI info for barcode CGCGTTTTCCGCAGTG-1 contig 2 = GAGGAACTGC...
umi TAGTAGCGCT = 140 reads: +382 validated

UMI info for barcode CGCGTTTTCCGCAGTG-1 contig 3 = GTCACCACCA...
umi CTGATTGCGA = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
0-45 ==> 35-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
45-396 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=4)
401-424 ==> 0-23 on |20|IGHD3-22|D-REGION| [len=31] (mis=0)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
475-526 ==> 0-51 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDWYYYDSSGFGHFDYW at 387, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 87
start codons at 45, 196, 201, 254, 259, 262, 280, 348, 409
confident = false

TIG 2[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 33, 241, 457
confident = false

TIG 3[bases=457]
9-324 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
359-397 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
397-457 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CTSYAGGSNVVF at 333, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 9, 217, 316, 343, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.216 = CGCGTTTTCCGCATCT-1

using 238 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.226 = CGCGTTTTCTAACCGA-1

using 266 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 5, 7, 250]
surviving nonsolo ucounts = 1[250]
ids = [3]

====================================================================================

UMI info for barcode CGCGTTTTCTAACCGA-1 contig 1 = AGTCTGGGCC...
umi TCGTACCAAT = 239 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=582]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-383 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-582 ==> 0-160 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQVWDSSSDLVVF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.227 = CGCGTTTTCTACTTAC-1

using 63 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[63]
surviving nonsolo ucounts = 1[63]
ids = [0]

====================================================================================

UMI info for barcode CGCGTTTTCTACTTAC-1 contig 1 = GGTCTCAGGA...
umi ACGCAACCAT = 57 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=461]
0-36 ==> 5-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
36-387 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=13)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-461 ==> 0-37 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CSAYTSTSTLVF at 360, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 36, 172, 193, 237, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.228 = CGCGTTTTCTCGAGTA-1

using 194 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [0]

====================================================================================

UMI info for barcode CGCGTTTTCTCGAGTA-1 contig 1 = GCTCCAAACA...
umi GTATGGACGC = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=577]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-577 ==> 0-147 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.232 = CGCGTTTTCTGGCGAC-1

using 175 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [2]

====================================================================================

UMI info for barcode CGCGTTTTCTGGCGAC-1 contig 1 = AGACCCAGTC...
umi TCATGTTGCG = 157 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=432]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-365 ==> 0-345 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
405-432 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSPLTF at 347, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 20, 26, 82, 95, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 39.234 = CGCGTTTTCTGGTTCC-1

using 168 reads

====================================================================================

graph has 73 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[4, 53, 111]
surviving nonsolo ucounts = 2[53, 111]
ids = [0, 1]

====================================================================================

UMI info for barcode CGCGTTTTCTGGTTCC-1 contig 1 = AACTCTGGGT...
umi CACACCTGTA = 103 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=425]
18-355 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
362-400 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
400-425 ==> 0-25 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSADSSGTYVVF at 333, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 101
start codons at 18, 79, 148, 166, 361
confident = false
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk039-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk039-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

8.111 seconds used processing barcodes, peak mem = 0.23
