[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk038-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk038-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk038.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.0 = CGATTGAAGCCACTAT-1

using 1030 reads

====================================================================================

graph has 1264 edges initially, 8 edges after simplification

total ucounts = 399
nonsolo ucounts = 144[2^65, 3^29, 4^18, 5^15, 6^4, 7^6, 8, 11, 13^2, 15, 21, 264]
surviving nonsolo ucounts = 1[264]
ids = [318]

====================================================================================

UMI info for barcode CGATTGAAGCCACTAT-1 contig 1 = GAGTCAGTCT...
umi TCCTGCGGCG = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [318]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.11 = CGATTGAAGTACGTAA-1

using 531 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^3, 3, 512]
surviving nonsolo ucounts = 1[512]
ids = [13]

====================================================================================

UMI info for barcode CGATTGAAGTACGTAA-1 contig 1 = GGGGTCACAA...
umi TTGATAATTT = 505 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=571]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-571 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.14 = CGATTGAAGTCGTACT-1

using 57 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 37
nonsolo ucounts = 10[2^5, 3^3, 5, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.15 = CGATTGAAGTGATCGG-1

using 314 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[10, 302]
surviving nonsolo ucounts = 1[302]
ids = [3]

====================================================================================

UMI info for barcode CGATTGAAGTGATCGG-1 contig 1 = GAGTCAGTCT...
umi CAACTCGGTG = 2 reads: -383X +1 -1X +1 -3X +1 -1X invalidated
umi TTTGTTTTGC = 284 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=501]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
416-501 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPQITF at 352, score = 9 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 25, 31, 87, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.18 = CGATTGAAGTGGTAAT-1

using 393 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 8, 373]
surviving nonsolo ucounts = 1[373]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.31 = CGATTGACAATGCCAT-1

using 82 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 73]
surviving nonsolo ucounts = 1[73]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.33 = CGATTGACACCCATGG-1

using 194 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 13[2, 3^4, 4, 5, 6^2, 7^2, 8, 129]
surviving nonsolo ucounts = 1[129]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=472]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
405-428 ==> 0-23 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
442-472 ==> 0-30 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDTSLSGLIF at 375, score = 8 + 10
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 51, 205, 208, 358, 385
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.37 = CGATTGACACGCGAAA-1

using 301 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3^2, 7, 13, 271]
surviving nonsolo ucounts = 1[271]
ids = [5]

====================================================================================

UMI info for barcode CGATTGACACGCGAAA-1 contig 1 = GGAACTGCTC...
umi CCCTGTGTCC = 230 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=485]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-485 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYYSWPLTF at 352, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 31, 100, 236, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.38 = CGATTGACACGTAAGG-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.45 = CGATTGACAGTAAGAT-1

using 292 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3^2, 4, 274]
surviving nonsolo ucounts = 1[274]
ids = [4]

====================================================================================

UMI info for barcode CGATTGACAGTAAGAT-1 contig 1 = GAGCTACAAC...
umi CTGCGCCCTC = 275 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.46 = CGATTGACATCGGAAG-1

using 107 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 97]
surviving nonsolo ucounts = 1[97]
ids = [2]

====================================================================================

UMI info for barcode CGATTGACATCGGAAG-1 contig 1 = AGTCTGGGCC...
umi GCGCCGCTTT = 81 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=455]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=39)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-455 ==> 0-36 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQVWDSDDHWVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 40, 101, 239, 242, 338
confident = false
>vscore_38.46_84.6%
ATGGCCGGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGTTTCTGTGACGTCGTATGAGCTGAATCAGCCACCCTCACTGTCTGTGGCCCCAGGAAAGACGGCCAGGATTTCCTGTGGGGGAGACGATATTGGTAGTAAGCTTGTGCAGTGGTACAAGCAGGAGCCAGGCCAGGCCCCTGTGGTGGTCATTTATGATGATAGGGAGCGGCCGTCACGGACCCCTGCGCGATTCTCTGGCTCCAACTCTGGAAATACGGCCACCCTGACCATCACCGGGGTCGAGGCCGGTGATGAGGCCGACTATTATTGTCAGGTGTGGGATAGTGACGATCATTGGGTGTTC
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.51 = CGATTGACATTGGTAC-1

using 557 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[219, 333]
surviving nonsolo ucounts = 2[219, 333]
ids = [6, 4]

====================================================================================

UMI info for barcode CGATTGACATTGGTAC-1 contig 1 = ACTGCTCAGT...
umi ACAAACAGTC = 1 reads: -221 +2 -2 +3 -2X +4 -1X +2 -1 +1 -1 +1 -2X +2 -1 +1 -1 +1 -5X +2 -3 +3 -1 +2 -1 +6 -1X +1 -1 +1 -112 invalidated
umi TCACACAGTC = 210 reads: +388 validated

UMI info for barcode CGATTGACATTGGTAC-1 contig 2 = GCTCTGCTTC...
umi TAGAAGGGAG = 325 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=491]
0-28 ==> 19-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
28-373 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-491 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPPGLTF at 349, score = 9 + 9
umis assigned: [0, 6]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 28, 233, 236, 458
confident = false

TIG 2[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-564 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.55 = CGATTGAGTACTTGAC-1

using 209 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 50
nonsolo ucounts = 39[2^8, 3^8, 4^10, 5^4, 6^2, 7, 8, 10, 12, 15, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.64 = CGATTGAGTCGAATCT-1

using 181 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 176]
surviving nonsolo ucounts = 1[176]
ids = [2]

====================================================================================

UMI info for barcode CGATTGAGTCGAATCT-1 contig 1 = GGTGGTAGCT...
umi ATCAAACTTC = 175 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=639]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
39-383 ==> 0-344 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=20)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-639 ==> 0-209 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSPFVVF at 366, score = 6 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 39, 102, 193, 244, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.70 = CGATTGAGTCGCTTCT-1

using 8201 reads

====================================================================================

graph has 2592 edges initially, 94 edges after simplification

total ucounts = 415
nonsolo ucounts = 158[2^51, 3^36, 4^10, 5^6, 6^5, 7^3, 8, 9, 15, 16, 19, 23, 33, 61, 73, 75^2, 80, 83, 86, 110, 127, 141, 163^2, 167, 169^2, 170^2, 173, 184, 187, 189, 190, 191, 192, 193, 195, 199, 206, 208, 212, 218, 223, 230, 281, 283, 297, 300, 306, 314, 437]
surviving nonsolo ucounts = 41[15, 19, 23, 61, 73, 75^2, 80, 86, 110, 127, 141, 163^2, 167, 169, 170^2, 173, 184, 187, 189, 190, 191, 192, 193, 195, 199, 206, 208, 212, 218, 223, 230, 281, 283, 297, 300, 306, 314, 437]
ids = [322, 290, 413, 194, 198, 115, 400, 72, 127, 276, ...]

====================================================================================

UMI info for barcode CGATTGAGTCGCTTCT-1 contig 1 = AGCTCTGGGA...
umi AAGGTCCCAT = 168 reads: +421 validated
umi ACGTATTTCG = 188 reads: +421 validated
umi AGAGTAACCC = 194 reads: +421 validated
umi ATAAGTCGAG = 192 reads: +421 validated
umi CAATCCCGCC = 75 reads: +350 -71 non-validated
umi CACTCTTTCG = 90 reads: +325 -1 +3 -1 +2 -3 +86 non-validated
umi CAGCTTCATC = 232 reads: +399 -1 +21 non-validated
umi CAGTTTTCGG = 284 reads: +421 validated
umi CTACAGTTAA = 62 reads: +387 -34 non-validated
umi CTAGATCCCG = 72 reads: +315 -1X +85 -20 invalidated
umi GGCTCGCGTC = 194 reads: +421 validated
umi TGGGTTCCAC = 140 reads: +397 -15 +6 -1 +2 non-validated

UMI info for barcode CGATTGAGTCGCTTCT-1 contig 2 = GGGGAGGAGT...
umi AGTTCTCGCC = 80 reads: +388 validated
umi ATACATGATC = 304 reads: +388 validated
umi ATGCAAGCTC = 316 reads: +388 validated
umi CGGCAATGGC = 297 reads: +388 validated
umi GCGTCGCCAC = 218 reads: +388 validated
umi GTTCAGTTTA = 19 reads: -35 +8 -1 +6 -1 +316 -1 +5 -1 +5 -9 non-validated
umi GTTCAGTTTC = 174 reads: +388 validated
umi TCACCAGTAA = 15 reads: -17 +269 -1 +6 -95 non-validated
umi TGGTCCCGGC = 210 reads: +388 validated
umi TGGTTACCAT = 188 reads: +388 validated
umi TTTACTCAAC = 73 reads: +388 validated
umi TTTTTAGGGG = 23 reads: -87 +56 -71 +174 non-validated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
450-501 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 98 reads
cdr3 = CAKDGNSDTGSWFDPW at 422, score = 9 + 7
umis assigned: [15, 47, 57, 77, 115, 127, 134, 135, 194, 198] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1864
start codons at 80, 225, 231, 236, 315, 383, 432
confident = true

TIG 2[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 291 reads
cdr3 = CQQYDNLPLTF at 358, score = 9 + 9
umis assigned: [72, 79, 93, 184, 245, 290, 291, 322, 366, 368] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1900
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

REJECT CONTIGS

TIG 1[bases=632]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
30-50 ==> 1493-1513 on rc of segment before IGLV10-54 exon 1 [len=5448] (mis=0)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=1)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
421-632 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CLLYY at 358, score = 8 + 4
umis assigned: [16, 78, 147, 236, 252, 297, 301, 350, 358, 406]
of which 10 are surviving nonsolos
reads assigned: 1813
start codons at 34, 371
confident = false
not full
frameshifted full length stopped transcript of length 632
VJ delta = -3
not full

TIG 2[bases=643]
0-84 ==> 5927-6011 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
38-63 ==> 0-25 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
63-373 ==> 26-336 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=26) [SHIFT!]
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
432-643 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [74, 105, 158, 182, 202, 276, 327, 339]
of which 7 are surviving nonsolos
reads assigned: 1548
start codons at 38, 176, 188, 194, 238, 248, 316, 396, 564
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCCTTGTATTACTGTGCAAAAGATGGGAATAGCGACACCGGGTCCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.77 = CGATTGAGTTCCACAA-1

using 740 reads

====================================================================================

graph has 316 edges initially, 8 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[216, 239, 283]
surviving nonsolo ucounts = 3[216, 239, 283]
ids = [3, 1, 0]

====================================================================================

UMI info for barcode CGATTGAGTTCCACAA-1 contig 1 = AGCATCATCC...
umi GCCAATACGT = 235 reads: +418 validated
umi GTCTGCCGCT = 222 reads: +418 validated

UMI info for barcode CGATTGAGTTCCACAA-1 contig 2 = GAGGAACTGC...
umi CAATGCACGT = 290 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=570]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
433-479 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
479-570 ==> 0-91 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 56 reads
cdr3 = CALVSTLSALPFDFW at 403, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 446
start codons at 61, 259, 265, 358
confident = true

TIG 2[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYYNWPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 33, 88, 102, 238, 457
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.81 = CGATTGAGTTTACTCT-1

using 395 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[390]
surviving nonsolo ucounts = 1[390]
ids = [3]

====================================================================================

UMI info for barcode CGATTGAGTTTACTCT-1 contig 1 = CTGGGCCTAA...
umi CAACGGGATT = 362 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=582]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-382 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
416-582 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CQVWDSSSDHIF at 352, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 37, 98, 236, 239, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.82 = CGATTGAGTTTGCATG-1

using 36 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 4^4, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.84 = CGATTGATCAACACTG-1

using 278 reads

====================================================================================

graph has 412 edges initially, 2 edges after simplification

total ucounts = 176
nonsolo ucounts = 48[2^26, 3^9, 4^4, 5^4, 6, 7^3, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.89 = CGATTGATCACGAAGG-1

using 563 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 235, 320]
surviving nonsolo ucounts = 2[235, 320]
ids = [5, 3]

====================================================================================

UMI info for barcode CGATTGATCACGAAGG-1 contig 1 = GGAGTCAGAC...
umi ATCTTGACTC = 321 reads: +385 validated
umi GGAATTAGGT = 233 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 88 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 549
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.91 = CGATTGATCAGTTAGC-1

using 1281 reads

====================================================================================

graph has 372 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3^3, 13, 285, 966]
surviving nonsolo ucounts = 2[285, 966]
ids = [0, 8]

====================================================================================

UMI info for barcode CGATTGATCAGTTAGC-1 contig 1 = GCTACAACAG...
umi AATATACTTG = 263 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=458]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
428-458 ==> 0-30 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYYSTPRMF at 367, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 28, 97, 350, 394
confident = false

REJECT CONTIGS

TIG 1[bases=301]
0-49 ==> 320-369 on |392|IGLV9-49|L-REGION+V-REGION| [len=369] (mis=0)
52-90 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
90-301 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 953
start codons at 26
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.97 = CGATTGATCCTTAATC-1

using 435 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 10, 153, 261]
surviving nonsolo ucounts = 2[153, 261]
ids = [4, 3]

====================================================================================

UMI info for barcode CGATTGATCCTTAATC-1 contig 1 = AGTCCTGGTG...
umi AATGAGTCGG = 255 reads: +391 validated
umi CATACTTATA = 155 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=578]
0-45 ==> 41-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
45-398 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=1)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
436-578 ==> 0-142 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 64 reads
cdr3 = CQSYDSSNRWVF at 372, score = 6 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 400
start codons at 45, 108, 199, 250, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.99 = CGATTGATCGGAGCAA-1

using 364 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[9, 353]
surviving nonsolo ucounts = 2[9, 353]
ids = [3, 1]

====================================================================================

UMI info for barcode CGATTGATCGGAGCAA-1 contig 1 = GGGAGTCCCA...
umi ATCCCCACCC = 356 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
29-277 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLHYDNRRRTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.105 = CGATTGATCTACCAGA-1

using 342 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[339]
surviving nonsolo ucounts = 1[339]
ids = [1]

====================================================================================

UMI info for barcode CGATTGATCTACCAGA-1 contig 1 = GGAGAAGAGC...
umi CAACGTGGAT = 312 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.114 = CGCCAAGAGAACTGTA-1

using 780 reads

====================================================================================

graph has 306 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 776]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=331]
8-158 ==> 201-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
157-195 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
195-331 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNTYIWTF at 134, score = 9 + 8
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 754
start codons at 20, 237
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.123 = CGCCAAGAGCCACCTG-1

using 98 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[93]
surviving nonsolo ucounts = 1[93]
ids = [2]

====================================================================================

UMI info for barcode CGCCAAGAGCCACCTG-1 contig 1 = GGCTGGGGTC...
umi AGCCTCGCTT = 88 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
42-396 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
433-498 ==> 0-65 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSSYSSSSTLRVF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 86
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.133 = CGCCAAGAGGGCATGT-1

using 305 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=552]
5-86 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
29-209 ==> 0-180 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
209-381 ==> 181-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6) [SHIFT!]
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 29, 35, 91, 104, 239, 458
confident = false
not full
frameshifted full length stopped transcript of length 552
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.135 = CGCCAAGAGGTGCTAG-1

using 269 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[7, 12, 245]
surviving nonsolo ucounts = 1[245]
ids = [7]

====================================================================================

UMI info for barcode CGCCAAGAGGTGCTAG-1 contig 1 = AGGACCCAGA...
umi TTGAATTGTT = 241 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=535]
17-362 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
362-399 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPLTF at 338, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 17, 225, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.136 = CGCCAAGAGTATGACA-1

using 234 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode CGCCAAGAGTATGACA-1 contig 1 = ATGCTTTCTG...
umi AAGTGTCCTG = 219 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=579]
16-393 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=14)
414-464 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
464-579 ==> 0-115 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CGRQGVSVGGFDAFDIW at 382, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 0, 16, 25, 37, 81, 416, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.144 = CGCCAAGCAACTGGCC-1

using 45 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 10[2^4, 3^2, 4^2, 7^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.150 = CGCCAAGCACCACGTG-1

using 333 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 325]
surviving nonsolo ucounts = 1[325]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=630]
0-35 ==> 3-38 on |354|IGLV3-16|5'UTR| [len=38] (mis=0)
35-69 ==> 0-34 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=0)
69-380 ==> 36-347 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=1) [SHIFT!]
382-419 ==> 9-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
419-630 ==> 0-211 on |308|IGLC7|C-REGION| [len=317] (mis=1)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 35, 94, 138, 181, 551, 614
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.153 = CGCCAAGCACCCATTC-1

using 127 reads

====================================================================================

graph has 96 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 9, 111]
surviving nonsolo ucounts = 1[111]
ids = [1]

====================================================================================

UMI info for barcode CGCCAAGCACCCATTC-1 contig 1 = CCCTCCTTGG...
umi AGATCGCGGG = 100 reads: +436 validated
umi ATGACGTGCT = 8 reads: +17 -1X +4 -43 +1 -1X +3 -1 +2 -1X +6 -1X +10 -1 +9 -1 +1 -1 +2 -2 +8 -1X +3 -7 +1 -1X +5 -1X +13 -2X +1 -1XX +2 -1XX +5 -2XX +45 -1XX +1 -1XX +1 -165X +2 -2X +1 -4X +1 -7X +1 -2X +1 -3X +1 -1X +29 -5 invalidated

GOOD CONTIGS

TIG 1[bases=485]
0-39 ==> 20-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
39-392 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
441-475 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 381, score = 7 + 7
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 39, 237, 242, 259, 303, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.154 = CGCCAAGCACGAAAGC-1

using 278 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=537]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-32 ==> 5968-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
5-57 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
32-246 ==> 0-214 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=6)
246-353 ==> 223-330 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
363-401 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 32, 237, 240, 443
confident = false
see deletion of 9 bases at pos 214 on |279|IGKV3-11|L-REGION+V-REGION|
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.160 = CGCCAAGCAGCGAACA-1

using 305 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [1]

====================================================================================

UMI info for barcode CGCCAAGCAGCGAACA-1 contig 1 = GGGAGGAATC...
umi GCCAGTATAC = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-478 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.175 = CGCCAAGGTAAGTTCC-1

using 284 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 273]
surviving nonsolo ucounts = 1[273]
ids = [7]

====================================================================================

UMI info for barcode CGCCAAGGTAAGTTCC-1 contig 1 = AGTCCCACTC...
umi TCAGAGGTGC = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.183 = CGCCAAGGTCAAAGAT-1

using 204 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [0]

====================================================================================

UMI info for barcode CGCCAAGGTCAAAGAT-1 contig 1 = GGGATCACAC...
umi CTCATGTCGG = 198 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=513]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
469-513 ==> 0-44 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.187 = CGCCAAGGTCAGAATA-1

using 335 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode CGCCAAGGTCAGAATA-1 contig 1 = GGGGAGGAAC...
umi AGGTCCTGTC = 337 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDQWPITF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 36, 85, 105, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.191 = CGCCAAGGTCTCCATC-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.194 = CGCCAAGGTGACCAAG-1

using 349 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 341]
surviving nonsolo ucounts = 1[341]
ids = [3]

====================================================================================

UMI info for barcode CGCCAAGGTGACCAAG-1 contig 1 = ATCAGTCCCA...
umi CATTCAGCAA = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.199 = CGCCAAGGTGTAACGG-1

using 283 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 278]
surviving nonsolo ucounts = 1[278]
ids = [1]

====================================================================================

UMI info for barcode CGCCAAGGTGTAACGG-1 contig 1 = GAGTCTCCCT...
umi CGATTCTAGG = 268 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=524]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=51)
444-497 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=6)
497-524 ==> 0-27 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVRLGGALSSHGDYEHWYFDVW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 58, 252, 262, 293, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.203 = CGCCAAGGTTATCCGA-1

using 597 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 592]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.204 = CGCCAAGGTTCCGGCA-1

using 687 reads

====================================================================================

graph has 320 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 330, 352]
surviving nonsolo ucounts = 2[330, 352]
ids = [2, 1]

====================================================================================

UMI info for barcode CGCCAAGGTTCCGGCA-1 contig 1 = AGGAACTGCT...
umi GATCGCTGGT = 329 reads: +385 validated

UMI info for barcode CGCCAAGGTTCCGGCA-1 contig 2 = ATACTTTCTG...
umi GAACCACGTA = 356 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=553]
32-382 ==> 0-350 on |286|IGKV3/OR2-268|L-REGION+V-REGION| [len=350] (mis=8)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQDYNLPWTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 32, 101, 240, 459
confident = false

TIG 2[bases=547]
37-385 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
393-424 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=1)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARAYYDFWSGYYNWVYFDYW at 382, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 37, 81
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.221 = CGCCAAGTCCAGTATG-1

using 1931 reads

====================================================================================

graph has 2684 edges initially, 24 edges after simplification

total ucounts = 1007
nonsolo ucounts = 415[2^201, 3^89, 4^53, 5^37, 6^18, 7^6, 8^3, 9, 10, 11^2, 12^2, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.228 = CGCCAAGTCGCAGGCT-1

using 268 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================

UMI info for barcode CGCCAAGTCGCAGGCT-1 contig 1 = GGGAGGAACT...
umi TTATCTGGGG = 268 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSDWPRTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.234 = CGCCAAGTCGTTTGCC-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 1[15]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.241 = CGCCAAGTCTTCGAGA-1

using 302 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 295]
surviving nonsolo ucounts = 1[295]
ids = [1]

====================================================================================

UMI info for barcode CGCCAAGTCTTCGAGA-1 contig 1 = GCTGGGGTCT...
umi ATATTTACTA = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=566]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-566 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 41, 249, 348, 375, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.250 = CGCGGTAAGACTCGGA-1

using 232 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 217]
surviving nonsolo ucounts = 1[217]
ids = [5]

====================================================================================

UMI info for barcode CGCGGTAAGACTCGGA-1 contig 1 = GGGCACAAGA...
umi GGTCAACGTT = 197 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=567]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-375 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
426-567 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDKSLRGAVF at 359, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 35, 119, 192, 342, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.255 = CGCGGTAAGCCCGAAA-1

using 691 reads

====================================================================================

graph has 300 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 139, 248, 296]
surviving nonsolo ucounts = 3[139, 248, 296]
ids = [3, 7, 0]

====================================================================================

UMI info for barcode CGCGGTAAGCCCGAAA-1 contig 1 = ATCAGTCCCA...
umi AAAGATTCCA = 301 reads: +388 validated

UMI info for barcode CGCGGTAAGCCCGAAA-1 contig 2 = GATCAGGACT...
umi TTACGCATTT = 245 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.256 = CGCGGTAAGCCGTCGT-1

using 168 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================

UMI info for barcode CGCGGTAAGCCGTCGT-1 contig 1 = GAGGAACTGC...
umi TTGAATACAG = 136 reads: +382 validated
umi TTTAATACAT = 1 reads: -168 +4 -1 +4 -2 +5 -1 +2 -1X +9 -1 +3 -1 +3 -1 +6 -2 +1 -1 +2 -2 +4 -158 invalidated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNNWPQTF at 354, score = 9 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.258 = CGCGGTAAGCTGGAAC-1

using 61 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 9, 48]
surviving nonsolo ucounts = 1[48]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.259 = CGCGGTAAGGACAGAA-1

using 86 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 79]
surviving nonsolo ucounts = 1[79]
ids = [2]

====================================================================================

UMI info for barcode CGCGGTAAGGACAGAA-1 contig 1 = GCTGGGGTCT...
umi CTTACGTACC = 73 reads: +388 validated
umi TTCTCTCTTC = 1 reads: -51 +27 -1X +6 -1X +3 -1X +17 -281 invalidated

GOOD CONTIGS

TIG 1[bases=547]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-547 ==> 0-118 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [2, 4]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.266 = CGCGGTAAGGCTAGAC-1

using 392 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 7, 152, 225]
surviving nonsolo ucounts = 2[152, 225]
ids = [6, 2]

====================================================================================

UMI info for barcode CGCGGTAAGGCTAGAC-1 contig 1 = GAAAACAGAG...
umi CGCAACTTCA = 226 reads: +388 validated

UMI info for barcode CGCGGTAAGGCTAGAC-1 contig 2 = GGCTTTCTGA...
umi TTATTTGGAA = 143 reads: +460 validated
umi TTCCAATGAT = 1 reads: -338 +2 -2X +14 -1 +13 -1X +2 -11X +3 -73X invalidated

GOOD CONTIGS

TIG 1[bases=638]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSWDSSLSAWVF at 360, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 39, 178, 250, 368
confident = false

TIG 2[bases=489]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
424-475 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 13 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 375, score = 9 + 7
umis assigned: [6, 7]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 15, 36, 80, 166
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.267 = CGCGGTAAGGTGCTAG-1

using 189 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 183]
surviving nonsolo ucounts = 1[183]
ids = [0]

====================================================================================

UMI info for barcode CGCGGTAAGGTGCTAG-1 contig 1 = GCTGTGCTGT...
umi AATGGCTTGG = 175 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=530]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-530 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.272 = CGCGGTAAGTGTGGCA-1

using 938 reads

====================================================================================

graph has 404 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[3^2, 11, 180, 236, 501]
surviving nonsolo ucounts = 2[180, 501]
ids = [8, 0]

====================================================================================

UMI info for barcode CGCGGTAAGTGTGGCA-1 contig 1 = GAGTCAGTCT...
umi AAAGCGTCAT = 502 reads: +388 validated
umi GTGGGAGAAT = 45 reads: -212 +1 -3XX +1 -2XX +2 -1XX +1 -1XX +1 -2XX +1 -6XX +8 -4XX +20 -1XX +2 -1XX +8 -1XX +2 -1XX +2 -1XX +1 -2XX +8 -24X +3 -1X +5 -4XX +2 -3XX +1 -6XX +2 -1XX +2 -2XX +1 -1XX +34 invalidated
umi TTCCTCTCTC = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 100 reads
cdr3 = CQQSYSTPGTF at 352, score = 9 + 8
umis assigned: [0, 6, 8]
of which 2 are surviving nonsolos
reads assigned: 717
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 38.275 = CGCGGTACAAATCCGT-1

using 170 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[10, 157]
surviving nonsolo ucounts = 1[157]
ids = [4]

====================================================================================

UMI info for barcode CGCGGTACAAATCCGT-1 contig 1 = AGGAGTCAGA...
umi TTATTAGGCC = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!
sorting bam, mem = 0.04
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk038-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk038-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

6.186 seconds used processing barcodes, peak mem = 0.23
