[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.26 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk036-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk036-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk036.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.0 = CGATCGGTCTGACCTC-1

using 684 reads

====================================================================================

graph has 892 edges initially, 10 edges after simplification

total ucounts = 285
nonsolo ucounts = 93[2^34, 3^22, 4^15, 5^6, 6^3, 7^2, 8^4, 9, 11^2, 12, 15, 17, 129]
surviving nonsolo ucounts = 1[129]
ids = [221]

====================================================================================

UMI info for barcode CGATCGGTCTGACCTC-1 contig 1 = GAGAGAGGAG...
umi TCCAGACGCA = 130 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=559]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-559 ==> 0-62 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [221]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.2 = CGATCGGTCTTCGAGA-1

using 228 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode CGATCGGTCTTCGAGA-1 contig 1 = TGAGCGCAGA...
umi CATGGTTTCG = 220 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=498]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-498 ==> 0-68 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CATWDSSLSAGEVVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.3 = CGATCGGTCTTGCAAG-1

using 175 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [2]

====================================================================================

UMI info for barcode CGATCGGTCTTGCAAG-1 contig 1 = CTGGGCCTAA...
umi TTAGTATGAG = 167 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=532]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-370 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-532 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQVWDSDGHYVVF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 37, 98, 167, 335, 371, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.22 = CGATGGCAGCGAGAAA-1

using 79 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 74]
surviving nonsolo ucounts = 1[74]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.24 = CGATGGCAGCGTTTAC-1

using 283 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 278]
surviving nonsolo ucounts = 1[278]
ids = [2]

====================================================================================

UMI info for barcode CGATGGCAGCGTTTAC-1 contig 1 = AGCTTCAGCT...
umi AGCTTTGACC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.39 = CGATGGCAGTGAACGC-1

using 565 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 22, 231, 309]
surviving nonsolo ucounts = 2[231, 309]
ids = [3, 2]

====================================================================================

UMI info for barcode CGATGGCAGTGAACGC-1 contig 1 = AGGAGTCAGA...
umi AGGCGCCGTC = 18 reads: -7 +18 -1 +2 -1 +12 -1X +10 -1XX +14 -1XX +4 -2XX +20 -2XX +2 -1XX +9 -2XX +20 -1XX +3 -1XX +3 -32XX +9 -1XX +18 -1XX +24 -1XX +69 -2X +1 -53 +1 -2X +1 -1X +34 invalidated
umi ATGCTGAGTA = 310 reads: +388 validated
umi CACCCCCCCG = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 108 reads
cdr3 = CQQYYSFPRTF at 354, score = 9 + 8
umis assigned: [1, 2, 3]
of which 2 are surviving nonsolos
reads assigned: 549
start codons at 27, 33, 89, 102, 165, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.40 = CGATGGCAGTGAAGAG-1

using 991 reads

====================================================================================

graph has 274 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 266, 715]
surviving nonsolo ucounts = 2[266, 715]
ids = [2, 6]

====================================================================================

UMI info for barcode CGATGGCAGTGAAGAG-1 contig 1 = GATACTTTCT...
umi CCTGATTTAA = 265 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=631]
38-386 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=20)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
471-631 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDWGDRSVGSPHYFDYW at 383, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 38, 82, 238, 317, 525
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.41 = CGATGGCAGTGACATA-1

using 209 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCAGTGACATA-1 contig 1 = GCTTCAGCTG...
umi AAACGATTTC = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-46 ==> 68-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
46-399 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-565 ==> 0-131 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.43 = CGATGGCAGTGCCATT-1

using 724 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[347, 374]
surviving nonsolo ucounts = 2[347, 374]
ids = [1, 3]

====================================================================================

UMI info for barcode CGATGGCAGTGCCATT-1 contig 1 = ACTAGAAGTC...
umi TAATGACCTC = 370 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=592]
0-57 ==> 23-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
57-408 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
415-442 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
442-490 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
490-592 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDRLVTMVRGVNEVFDYW at 399, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 57, 208, 213, 266, 271, 274, 292, 360, 423, 439, 508, 569
confident = false

REJECT CONTIGS

TIG 1[bases=552]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 33, 241, 367, 458
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.44 = CGATGGCAGTGTACGG-1

using 1139 reads

====================================================================================

graph has 482 edges initially, 2 edges after simplification

total ucounts = 53
nonsolo ucounts = 18[2^7, 3^5, 5^3, 6, 7, 1047]
surviving nonsolo ucounts = 1[1047]
ids = [43]

====================================================================================

REJECT CONTIGS

TIG 1[bases=461]
0-212 ==> 141-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=3)
212-250 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
250-461 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSNLWVF at 186, score = 6 + 8
umis assigned: [43]
of which 1 are surviving nonsolos
reads assigned: 1035
start codons at 13, 64, 196
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.51 = CGATGGCCAAGCCTAT-1

using 248 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCCAAGCCTAT-1 contig 1 = GGAGAAGAGC...
umi AACTAATCCC = 246 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-373 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYDRSWTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 36, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.52 = CGATGGCCAAGTACCT-1

using 289 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 1[289]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCCAAGTACCT-1 contig 1 = GAGGAACTGC...
umi AATTATTGTT = 287 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.55 = CGATGGCCAATGTTGC-1

using 368 reads

====================================================================================

graph has 160 edges initially, 30 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[79, 286]
surviving nonsolo ucounts = 2[79, 286]
ids = [4, 2]

====================================================================================

UMI info for barcode CGATGGCCAATGTTGC-1 contig 1 = ACAGAAGCCT...
umi CCCGGTACAT = 286 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=520]
0-31 ==> 273-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
31-384 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=4)
381-412 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=9)
403-449 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARAYYDSSGYLAYW at 373, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 31, 187, 229, 295, 328, 389
confident = false

REJECT CONTIGS

TIG 1[bases=420]
0-287 ==> 66-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
289-305 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
308-349 ==> 11-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
349-420 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CAREGTTVTTSQHW at 276, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 74
start codons at 85, 132, 231
confident = false
VJ delta = 12
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.64 = CGATGGCCACCGAATT-1

using 287 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCCACCGAATT-1 contig 1 = AGTCAGACTC...
umi ACCCAGTTCG = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=2)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=33)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
412-485 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYHSYSPTF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 24, 30, 86, 99, 235, 238, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.68 = CGATGGCCAGACAGGT-1

using 204 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
1-133 ==> 5868-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
133-481 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
482-520 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
520-553 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 38, 78, 133, 341, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.74 = CGATGGCCAGCTGCTG-1

using 1433 reads

====================================================================================

graph has 1386 edges initially, 16 edges after simplification

total ucounts = 424
nonsolo ucounts = 160[2^72, 3^27, 4^21, 5^10, 6^8, 7^6, 8^2, 9^3, 10^2, 14, 21, 29, 32, 68, 73, 107, 129, 184]
surviving nonsolo ucounts = 3[107, 129, 184]
ids = [328, 179, 52]

====================================================================================

UMI info for barcode CGATGGCCAGCTGCTG-1 contig 1 = CAGGAAGCAG...
umi ACGATTGGCC = 183 reads: +376 validated

UMI info for barcode CGATGGCCAGCTGCTG-1 contig 2 = GAGGGTCCTG...
umi CGTCGGTCCA = 120 reads: +430 validated
umi TAGTTTGTAT = 105 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=634]
0-29 ==> 86-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
29-360 ==> 0-331 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=12)
367-405 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQVWDKNTGVF at 344, score = 7 + 8
umis assigned: [52]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 29, 90, 177, 327
confident = true

TIG 2[bases=527]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=18)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
489-527 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 25 reads
cdr3 = CARAPTSEGSWGYYFDYW at 404, score = 9 + 7
umis assigned: [179, 328]
of which 2 are surviving nonsolos
reads assigned: 222
start codons at 15, 59, 103
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGCACCCACCTCGGAAGGAAGTTGGGGGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCTTCAG <==> ATCAACAGAGCCCAAGTCGGGGATGAGGCAGACTATTACTGTCAGGTGTGGGACAAGAACACGGGGGTATTCGGCGGAGGGACCAGGCTGACCGTAGGGG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.76 = CGATGGCCAGGAACGT-1

using 326 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [1]

====================================================================================

UMI info for barcode CGATGGCCAGGAACGT-1 contig 1 = GGGGAGGAAC...
umi AGCGCCACAG = 322 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNNWPPGFF at 357, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.77 = CGATGGCCAGGCTCAC-1

using 465 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 460]
surviving nonsolo ucounts = 1[460]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=342]
3-169 ==> 179-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
169-206 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
206-342 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWPLTF at 145, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 443
start codons at 2, 32, 248
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.78 = CGATGGCCAGTAACGG-1

using 279 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 7, 267]
surviving nonsolo ucounts = 1[267]
ids = [4]

====================================================================================

UMI info for barcode CGATGGCCAGTAACGG-1 contig 1 = AGGAGTCAGA...
umi TGGTACAGCC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.82 = CGATGGCCATACTCTT-1

using 11275 reads

====================================================================================

graph has 4379 edges initially, 80 edges after simplification

total ucounts = 589
nonsolo ucounts = 273[2^95, 3^59, 4^32, 5^21, 6^8, 7^5, 8, 9^2, 10, 11^2, 12, 13, 14, 19, 22, 53^2, 78, 85, 99, 113, 115, 118, 124, 132^2, 134, 141, 144^2, 161, 173, 175, 182, 194^2, 197, 203, 210, 215, 216, 219, 226, 227, 238, 255, 262, 266, 298, 319, 334, 394, 400, 529, 637, 871, 878]
surviving nonsolo ucounts = 41[53, 78, 85, 99, 113, 115, 118, 124, 132^2, 134, 141, 144^2, 161, 173, 175, 182, 194^2, 197, 203, 210, 215, 216, 219, 226, 227, 238, 255, 262, 266, 298, 319, 334, 394, 400, 529, 637, 871, 878]
ids = [396, 470, 128, 73, 417, 172, 370, 155, 105, 566, ...]

====================================================================================

UMI info for barcode CGATGGCCATACTCTT-1 contig 1 = TGGGGAGGGT...
umi AAATTGTTCC = 143 reads: +445 validated
umi AACTATTTCT = 175 reads: +399 -5 +41 non-validated
umi ACCGATGCGT = 220 reads: +445 validated
umi ACCGTTGGGG = 227 reads: +445 validated
umi ATCCGGGTGT = 126 reads: +445 validated
umi CAATCCGCGA = 80 reads: +445 validated
umi CATAGTAGTC = 225 reads: +445 validated
umi CCAATGGATT = 183 reads: +445 validated
umi CCCGTGCCTA = 179 reads: +445 validated
umi CGAGTCCAAG = 142 reads: +428 -1 +16 non-validated
umi CGCTGCTATC = 135 reads: +445 validated
umi CTTTACGCCC = 240 reads: +445 validated
umi GGCCTCCCGT = 118 reads: +445 validated
umi GGTTAACAAT = 208 reads: +445 validated
umi GTCAGCCGCT = 48 reads: -388 +23 -1 +33 non-validated
umi TCAGCGGCGT = 201 reads: +427 -1 +17 non-validated
umi TCATTTTAGT = 69 reads: +445 validated
umi TGGCAGACCA = 194 reads: +445 validated
umi TTTGTAATCC = 217 reads: +445 validated
umi TTTGTTTCCT = 222 reads: +442 -1 +2 non-validated

UMI info for barcode CGATGGCCATACTCTT-1 contig 2 = CTGGGCCTCA...
umi ACACTTCTCT = 215 reads: +376 validated
umi AGACACCTAG = 100 reads: +376 validated
umi CAAGTATTGT = 262 reads: +376 validated
umi CATAACGTCT = 123 reads: +376 validated
umi CCACAAACAG = 379 reads: +376 validated
umi CCAGACGACA = 110 reads: +376 validated
umi CTGTTTCATA = 266 reads: +376 validated
umi GGAGTACACG = 192 reads: +376 validated
umi TAAACTTTCT = 115 reads: +376 validated
umi TCCGCTGAGT = 335 reads: -104 +272 non-validated
umi TCTGCTTCCT = 145 reads: +376 validated
umi TTCCGTGGTT = 198 reads: +376 validated
umi TTGGCTACGC = 132 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=579]
63-411 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
428-459 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=2)
457-508 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
508-579 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 18 umis using 195 reads
cdr3 = CARHRDAYYYDSSGYYWGWFDPW at 408, score = 9 + 7
umis assigned: [9, 15, 48, 50, 105, 128, 157, 168, 192, 224] and 10 others
of which 20 are surviving nonsolos
reads assigned: 3310
start codons at 19, 63, 107, 424, 436
confident = true

TIG 2[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
413-624 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 474 reads
cdr3 = CQAWDSSTAVF at 352, score = 6 + 8
umis assigned: [30, 73, 127, 155, 169, 172, 295, 365, 417, 477] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2539
start codons at 37, 42, 98, 185, 331, 335, 545
confident = true

REJECT CONTIGS

TIG 1[bases=327]
0-32 ==> 3118-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=3)
51-82 ==> 3884-3915 on segment before IGLJ4 exon 1 [len=3915] (mis=6)
58-87 ==> 4604-4633 on segment before IGLCOR22-1 exon 1 [len=6000] (mis=1)
78-116 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
116-327 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3, 51, 69, 360, 389]
of which 5 are surviving nonsolos
reads assigned: 2494
start codons at 59
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGACATAGAGATGCGTATTACTATGATAGTAGTGGTTATTACTGGGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCCGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.83 = CGATGGCCATATACGC-1

using 1398 reads

====================================================================================

graph has 875 edges initially, 16 edges after simplification

total ucounts = 156
nonsolo ucounts = 55[2^18, 3^9, 4^5, 5^8, 6, 7^2, 8^3, 9, 10, 14^3, 101, 117, 348, 503]
surviving nonsolo ucounts = 4[8, 117, 348, 503]
ids = [65, 139, 53, 77]

====================================================================================

UMI info for barcode CGATGGCCATATACGC-1 contig 1 = GGAGTCAGTC...
umi CATCGCTCTA = 344 reads: +388 validated

UMI info for barcode CGATGGCCATATACGC-1 contig 2 = ACTGGAAGTC...
umi TGACGTATTA = 113 reads: +424 validated

UMI info for barcode CGATGGCCATATACGC-1 contig 3 = GCCTGGGCCT...
umi CGGCTCACAG = 4 reads: -331 +3 -1XX +1 -1XX +1 -1XX +24 -1XX +2 -1XX +8 -1XX invalidated
umi CTGCTTACTT = 499 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=7)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [53]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false

TIG 2[bases=505]
0-57 ==> 10-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=1)
57-410 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=16)
435-481 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
481-505 ==> 0-24 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDRFRAVAGTRVDYW at 399, score = 7 + 7
umis assigned: [139]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 57, 208, 213, 271, 274, 360
confident = false

TIG 3[bases=626]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
39-373 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
415-626 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 88 reads
cdr3 = CQAWDSTEVVF at 354, score = 6 + 8
umis assigned: [65, 77]
of which 2 are surviving nonsolos
reads assigned: 498
start codons at 39, 44, 333, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.86 = CGATGGCCATCATCCC-1

using 189 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 1[189]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCCATCATCCC-1 contig 1 = AGTCAGTCCC...
umi TTCGTTTGCC = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-498 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYDNLPLTF at 351, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 24, 30, 86, 99, 238, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.87 = CGATGGCCATCCTTGC-1

using 11853 reads

====================================================================================

graph has 3732 edges initially, 34 edges after simplification

total ucounts = 289
nonsolo ucounts = 131[2^30, 3^24, 4^8, 5^9, 6^4, 7^3, 10, 11^2, 13^2, 14, 16, 23, 28, 63, 79, 114, 115, 141, 147, 160, 170, 175, 187, 195, 196, 202, 211, 222, 228, 237, 256^2, 268, 271, 273^2, 279, 289, 293, 301, 305, 309, 312, 319, 322, 326, 329^2, 332, 334, 337^2, 345, 356^2, 369, 384]
surviving nonsolo ucounts = 43[63, 114, 115, 141, 147, 160, 170, 175, 187, 195, 196, 202, 211, 222, 228, 237, 256^2, 268, 271, 273^2, 279, 289, 293, 301, 305, 309, 312, 319, 322, 326, 329^2, 332, 334, 337^2, 345, 356^2, 369, 384]
ids = [77, 90, 214, 188, 144, 147, 263, 19, 248, 254, ...]

====================================================================================

UMI info for barcode CGATGGCCATCCTTGC-1 contig 1 = ACTTTCTGAG...
umi ACACATTCCC = 230 reads: -12X +1 -7X +1 -3XX +2 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +393 invalidated
umi ATGGTAATCC = 279 reads: +439 validated
umi ATTGGTGGGT = 47 reads: -52 +387 non-validated
umi CACGGTTTTG = 99 reads: +439 validated
umi CGCGACCCTT = 163 reads: +439 validated
umi CTGAATTCCA = 163 reads: +439 validated
umi GGACCTCGGT = 131 reads: -417X +1 -2X +1 -4X +2 -2X +1 -5X +1 -2XX +1 invalidated
umi GGTTATTGTT = 195 reads: +413 -1 +10 -1 +14 non-validated
umi GTTCTCAGTA = 116 reads: +439 validated
umi TTAGCCATTA = 269 reads: +439 validated

UMI info for barcode CGATGGCCATCCTTGC-1 contig 2 = GGAGAAGAGC...
umi AATGAGTTCT = 179 reads: +388 validated
umi ACCACTCCAA = 321 reads: +388 validated
umi ACCCCAATAT = 198 reads: +388 validated
umi ACTTCCCTCC = 356 reads: +388 validated
umi AGGGCTTGCT = 293 reads: +388 validated
umi ATCGACTTTA = 275 reads: +388 validated
umi ATGTTACTCG = 360 reads: +388 validated
umi CAAGTGGAGT = 273 reads: +388 validated
umi CATGGCTCTT = 384 reads: +388 validated
umi CATTATTGGG = 333 reads: +388 validated
umi CCTTGGTTCT = 339 reads: +388 validated
umi CGAACTCCCT = 303 reads: +388 validated
umi CGTGCTCTTC = 309 reads: +388 validated
umi CTATTGCTTC = 147 reads: +388 validated
umi CTCTGTGCTC = 320 reads: +388 validated
umi GCGCCATTGA = 366 reads: +388 validated
umi GCTATTCCCA = 336 reads: +388 validated
umi GGATTACTTA = 228 reads: +388 validated
umi GTCATATATG = 277 reads: +388 validated
umi GTCCATCGGC = 336 reads: +388 validated
umi GTCTTTCACC = 329 reads: +388 validated
umi TATCTTTGAG = 339 reads: +388 validated
umi TCCAATGTAA = 259 reads: +388 validated
umi TCGCTGTACT = 336 reads: +388 validated
umi TCTTAGCTTG = 191 reads: +388 validated
umi TGAAGATTGT = 314 reads: +388 validated
umi TGAGTCCGGT = 227 reads: +388 validated
umi TGATAGTAAC = 197 reads: +388 validated
umi TGTAAACTTA = 288 reads: +388 validated
umi TGTCGTTTTG = 170 reads: +388 validated
umi TTCCAAACCG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=576]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
426-474 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
474-576 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 143 reads
cdr3 = CARALQMVDSSGWARSNYFDYW at 377, score = 9 + 7
umis assigned: [24, 71, 77, 90, 126, 147, 188, 197, 214, 273]
of which 10 are surviving nonsolos
reads assigned: 1665
start codons at 14, 35, 79, 395, 492, 553
confident = true

TIG 2[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 31 umis using 1346 reads
cdr3 = CQQYGSSPPLTF at 360, score = 9 + 9
umis assigned: [19, 28, 32, 44, 52, 67, 73, 83, 105, 107] and 21 others
of which 31 are surviving nonsolos
reads assigned: 8695
start codons at 36, 244, 370, 466
confident = true
now this is a cell
paired!

TACTGTGCGAGAGCCTTACAAATGGTGGATAGCAGTGGCTGGGCGCGGAGCAACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.90 = CGATGGCCATGGGACA-1

using 160 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

UMI info for barcode CGATGGCCATGGGACA-1 contig 1 = GGAGGAACTG...
umi TAATAGGGAG = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYNSWPLTF at 355, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 34, 103, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.93 = CGATGGCCATTGTGCA-1

using 480 reads

====================================================================================

graph has 212 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[178, 299]
surviving nonsolo ucounts = 2[178, 299]
ids = [0, 3]

====================================================================================

UMI info for barcode CGATGGCCATTGTGCA-1 contig 1 = GGGGAGGAAC...
umi CTGCTGATAT = 155 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=489]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=13)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-489 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQHYHNWPPITF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 36, 105, 241, 463
confident = false

REJECT CONTIGS

TIG 1[bases=576]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
2-82 ==> 10060-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
425-452 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=3)
468-505 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 64, 220, 262, 267, 299, 328, 361
confident = false
frameshifted full length stopped transcript of length 576
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.103 = CGATGGCGTCAGGACA-1

using 211 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode CGATGGCGTCAGGACA-1 contig 1 = GCTGGGGTCT...
umi CAGAGACTCC = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSYAGSNNLVF at 365, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 41, 198, 242, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.110 = CGATGGCGTGACTACT-1

using 241 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGATGGCGTGACTACT-1 contig 1 = GACTCAACAA...
umi ATTGGACTCT = 205 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=482]
56-409 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=1)
417-468 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CARRSRKNWFDPW at 398, score = 9 + 7
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 203
start codons at 56, 207, 254, 259, 263, 291, 320, 353
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.118 = CGATGGCGTTCTGTTT-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.123 = CGATGGCGTTTGCATG-1

using 203 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode CGATGGCGTTTGCATG-1 contig 1 = CAGGACACAG...
umi GATATGTACA = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
11-364 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
361-399 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQSYSTPWTF at 338, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 11, 17, 73, 86, 222, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.132 = CGATGGCTCAGTTCGA-1

using 138 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[138]
surviving nonsolo ucounts = 1[138]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=371]
3-203 ==> 99-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=12)
280-328 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
328-371 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CVRGGRSLWFGDLLDYW at 246, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 60, 118, 121, 269
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.133 = CGATGGCTCATGGTCA-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.134 = CGATGGCTCATGTCCC-1

using 126 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[126]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGATGGCTCATGTCCC-1 contig 1 = GACTCTCAAC...
umi TAAGCTCGTG = 114 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=490]
58-411 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=29)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 9 reads
cdr3 = CAREAHSSDYLYYFDFW at 400, score = 10 + 7
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 114
start codons at 58, 209, 256, 261, 265, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.135 = CGATGGCTCCAAACTG-1

using 16 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 11]
surviving nonsolo ucounts = 1[11]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.137 = CGATGGCTCCACGAAT-1

using 1192 reads

====================================================================================

graph has 410 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 1181]
surviving nonsolo ucounts = 1[1181]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=355]
0-81 ==> 5533-5614 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
30-80 ==> 0-50 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
78-182 ==> 256-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2) [SHIFT!]
180-219 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
219-355 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPYTF at 158, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 1165
start codons at 30, 63, 141, 161, 261
confident = false
not full
frameshifted full length stopped transcript of length 355
VJ delta = 223
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.155 = CGATGGCTCTATCGCC-1

using 276 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 270]
surviving nonsolo ucounts = 1[270]
ids = [5]

====================================================================================

UMI info for barcode CGATGGCTCTATCGCC-1 contig 1 = GAGCTACAAC...
umi TTGCCCGCTT = 266 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CHQYYSLLSF at 369, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 30, 352, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.157 = CGATGGCTCTGAAAGA-1

using 301 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode CGATGGCTCTGAAAGA-1 contig 1 = TGATCAGGAC...
umi CTAGCAATTG = 279 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=488]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-357 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
428-488 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMNTLPGGFTF at 367, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.160 = CGATGGCTCTGTACGA-1

using 205 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [2]

====================================================================================

UMI info for barcode CGATGGCTCTGTACGA-1 contig 1 = ACCCAAAAAC...
umi CGTTGTAGCT = 202 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=515]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-515 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.169 = CGATGTAAGAGGGATA-1

using 533 reads

====================================================================================

graph has 198 edges initially, 36 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[256, 274]
surviving nonsolo ucounts = 2[256, 274]
ids = [2, 4]

====================================================================================

UMI info for barcode CGATGTAAGAGGGATA-1 contig 1 = AGGAATCAGT...
umi TGTGGGGGTA = 252 reads: +388 validated

UMI info for barcode CGATGTAAGAGGGATA-1 contig 2 = AGGAATCAGA...
umi CTATTTGTCG = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=501]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.176 = CGATGTAAGCCGGTAA-1

using 497 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[69, 428]
surviving nonsolo ucounts = 2[69, 428]
ids = [0, 1]

====================================================================================

UMI info for barcode CGATGTAAGCCGGTAA-1 contig 1 = GCTCTGCTTC...
umi CCATCAATCG = 69 reads: +394 validated
umi CTAGAATAGC = 420 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-554 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 81 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 483
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 36.178 = CGATGTAAGCGACGTA-1

using 619 reads

====================================================================================

graph has 258 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[171, 217, 229]
surviving nonsolo ucounts = 3[171, 217, 229]
ids = [0, 4, 3]

====================================================================================

UMI info for barcode CGATGTAAGCGACGTA-1 contig 1 = GCTCTGCTTC...
umi AATCATCGGC = 160 reads: +391 validated
umi TTAATCTCTT = 224 reads: +391 validated
umi TTAATCTTTT = 215 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=609]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-609 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 81 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [0, 3, 4]
of which 3 are surviving nonsolos
reads assigned: 585
start codons at 51, 135, 208, 358, 385
confident = true
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk036-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk036-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

8.408 seconds used processing barcodes, peak mem = 0.23
