[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.27 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk034-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk034-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk034.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.0 = CCTCTGACAGCCACCA-1

using 45124 reads

====================================================================================

graph has 16637 edges initially, 156 edges after simplification

total ucounts = 2506
nonsolo ucounts = 1169[2^438, 3^244, 4^135, 5^49, 6^54, 7^31, 8^23, 9^13, 10^7, 11^11, 12^5, 13^4, 14^2, 15^2, 16^2, 21, 22^2, 24, 27, 28, 29, 56, 57, 60, 65, 71, 74, 75, 76, 77, 78^2, 84, 100, 113, 115, 129, 131, 134, 135, 136, 148^2, 156, 167, 175, 176, 178, 179, 195, 201, 206, 207, 208^2, 209^2, 210, 211, 212, 213, 215, 216, 218^3, 221, 223, 227^2, 228, 229, 236, 238, 249, 251, 252, 255, 256, 260, 261, 263, 269, 272, 276^2, 278, 279, 280^2, 283^2, 284, 286, 289, 291^3, 295, 297, 299^2, 301, 304^2, 305^2, 306, 308, 310, 313^2, 315, 318^2, 319^2, 324^2, 326, 328, 329, 330, 331, 333^3, 334, 335, 337^2, 342^2, 343^2, 351, 354, 359, 363, 367^3, 371, 372, 375, 377^2, 381, 393, 406, 409, 416, 419, 434, 435, 451, 493, 539, 544, 561, 577, 803, 1343]
surviving nonsolo ucounts = 138[57, 60, 71, 76, 77, 78^2, 84, 100, 113, 115, 129, 131, 134, 135, 136, 148^2, 156, 167, 175, 176, 178, 179, 195, 201, 206, 207, 208^2, 209^2, 210, 211, 212, 213, 215, 216, 218^3, 221, 223, 227^2, 228, 229, 236, 238, 249, 251, 252, 255, 256, 260, 261, 263, 269, 272, 276^2, 278, 279, 280^2, 283^2, 284, 286, 289, 291^3, 295, 297, 299^2, 301, 304^2, 305^2, 306, 308, 310, 313^2, 315, 318^2, 319^2, 324^2, 326, 328, 329, 330, 331, 333^3, 334, 335, 337^2, 342^2, 343^2, 351, 354, 359, 363, 367^3, 371, 372, 375, 377^2, 381, 393, 406, 409, 416, 419, 434, 435, 451, 493, 539, 544, 561, 577, 803, 1343]
ids = [1198, 1075, 703, 1784, 1050, 1404, 1728, 1682, 651, 1387, ...]

====================================================================================

UMI info for barcode CCTCTGACAGCCACCA-1 contig 1 = GGGGATCACT...
umi AAACGTAACG = 140 reads: +409 validated
umi AAACGTCCTC = 414 reads: +409 validated
umi AAGAAATTGA = 227 reads: +409 validated
umi ACCGTGGGTA = 282 reads: +409 validated
umi ACGTTCTCCT = 178 reads: +409 validated
umi ACGTTGTGAA = 304 reads: +409 validated
umi ACTTTCGGGT = 341 reads: +409 validated
umi AGCGGACCCC = 217 reads: +398 -1 +10 non-validated
umi AGTATCGGTT = 278 reads: +409 validated
umi ATAGCACGCC = 345 reads: +409 validated
umi ATCCAGCCCG = 325 reads: +409 validated
umi ATCGCACCTC = 280 reads: +409 validated
umi ATGTCTCTAT = 363 reads: +409 validated
umi ATTGTCATTT = 98 reads: +409 validated
umi ATTTCCTCCT = 298 reads: +328 -1XX +80 invalidated
umi CAAAGACTTG = 408 reads: +409 validated
umi CAAATGCACG = 154 reads: +409 validated
umi CAATCAGTGC = 72 reads: +363 -46 non-validated
umi CAGCCGTATT = 279 reads: +409 validated
umi CATCATAGCC = 342 reads: +409 validated
umi CATTCATTCC = 203 reads: +409 validated
umi CCCCTACACC = 357 reads: +409 validated
umi CCGGCAGTTT = 284 reads: +409 validated
umi CCGTGCATAC = 375 reads: +409 validated
umi CCTTATACTA = 437 reads: +409 validated
umi CGACTTATTG = 77 reads: +360 -1 +10 -1 +1 -36 non-validated
umi CGCATTCACT = 61 reads: +377 -1 +4 -27 non-validated
umi CGCGTTTAGA = 293 reads: +409 validated
umi CGTACATGTT = 304 reads: +409 validated
umi CGTCTAAGCG = 321 reads: +409 validated
umi CTAGTACGAT = 58 reads: +366 -39 +4 non-validated
umi CTATGCTCGC = 201 reads: +409 validated
umi CTCCCGTACA = 278 reads: +409 validated
umi CTGACTTCAG = 269 reads: +409 validated
umi CTTTATTTAA = 96 reads: +409 validated
umi GAAAGGACGT = 64 reads: +409 validated
umi GAAATTGTCG = 209 reads: +409 validated
umi GAGTCACCCA = 133 reads: +409 validated
umi GCAGCAACCG = 327 reads: +409 validated
umi GCATGGGCTA = 173 reads: +409 validated
umi GCCAACTCTA = 325 reads: +409 validated
umi GCGTAGGCAT = 365 reads: +409 validated
umi GCTATAGGAC = 202 reads: +409 validated
umi GGCACTTACA = 435 reads: +409 validated
umi GGGTCGAGCG = 89 reads: +377 -1X +31 invalidated
umi GGTTTTAGGC = 285 reads: +58 -1XX +350 invalidated
umi GTACATTTGA = 382 reads: +409 validated
umi GTATGTCTCC = 263 reads: +409 validated
umi GTCCTATCAC = 246 reads: +409 validated
umi GTCCTGTCAC = 75 reads: +409 validated
umi GTGGGACAAC = 225 reads: +409 validated
umi TACCGGGTTC = 285 reads: +409 validated
umi TACGCCCACC = 329 reads: +409 validated
umi TACTTGCTCC = 341 reads: +409 validated
umi TAGTGACAAC = 130 reads: +409 validated
umi TGCCCTTTGC = 195 reads: +396 -13 non-validated
umi TTAGCATTCT = 315 reads: +409 validated

UMI info for barcode CCTCTGACAGCCACCA-1 contig 2 = GAGCTACAAC...
umi AAGTCTTCCA = 253 reads: -372X +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi AAGTTCTTCT = 329 reads: +400 validated
umi AATAGGCTCC = 336 reads: +400 validated
umi ACAATATAGC = 286 reads: +400 validated
umi ACACCTCACG = 380 reads: +400 validated
umi ACCCAACCCT = 330 reads: -369 +2 -1X +4 -2XX +8 -2XX +4 -1XX +7 invalidated
umi ACCGCGCCAG = 286 reads: +400 validated
umi ACCTAACCCC = 360 reads: -354 +2 -2X +1 -4XX +1 -1XX +6 -1XX +3 -3XX +9 -1XX +12 invalidated
umi ACGCATGCTT = 319 reads: +400 validated
umi AGCAGCTTTT = 333 reads: +400 validated
umi AGCGCTGAGC = 278 reads: +400 validated
umi AGCTATTAGA = 130 reads: +400 validated
umi AGGCCCGGAC = 360 reads: +400 validated
umi AGGGAAGCAT = 702 reads: -358X +1 -7XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi AGTTAATCAG = 320 reads: +400 validated
umi ATAGGGCCGT = 212 reads: +400 validated
umi ATCTATGGGG = 213 reads: +400 validated
umi ATCTTCAGTA = 368 reads: +400 validated
umi ATGTACTCTT = 149 reads: +400 validated
umi ATTATTACTT = 208 reads: +400 validated
umi ATTGTCGGAA = 221 reads: -354 +2 -2XX +1 -4XX +1 -1XX +6 -1XX +3 -3XX +9 -1XX +12 invalidated
umi CATCTTACTC = 336 reads: +400 validated
umi CATCTTCATG = 272 reads: +400 validated
umi CATGATCCCG = 227 reads: +400 validated
umi CCAACGCGGG = 540 reads: +400 validated
umi CCCCCCTACA = 221 reads: +400 validated
umi CCCGCTTGGG = 312 reads: +400 validated
umi CCGCGCCGCT = 207 reads: +400 validated
umi CCGCTCATCA = 296 reads: +400 validated
umi CGCTCTGTGA = 204 reads: +400 validated
umi CGCTTACTGT = 294 reads: -366X +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CGGCTAGTAC = 472 reads: -358X +1 -7XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CTAGTCCAGA = 180 reads: +400 validated
umi CTCCGCCACA = 317 reads: +400 validated
umi CTTCAAATTA = 171 reads: +400 validated
umi CTTGTGCCGG = 333 reads: +400 validated
umi GACAGTTTGC = 422 reads: +400 validated
umi GACTTTCCTT = 213 reads: +400 validated
umi GCAATTAGCC = 368 reads: +400 validated
umi GCATTATCAG = 368 reads: +400 validated
umi GCGGGGCCAG = 274 reads: +400 validated
umi GGAATACAGT = 310 reads: +400 validated
umi GGCCTTACCA = 251 reads: +20 -4XX +1 -8XX +1 -1XX +1 -3XX +2 -3XX +1 -1X +1 -1X +352 invalidated
umi GTCACATGTA = 210 reads: +400 validated
umi GTGATTGAGC = 112 reads: -373 +4 -1X +9 -2X +3 -1X +7 invalidated
umi GTTATTTCCT = 249 reads: +400 validated
umi TACCCGTTAA = 282 reads: +400 validated
umi TATTCCCACT = 311 reads: +400 validated
umi TCAACTGCAA = 1350 reads: -110X +2 -2XX +286 invalidated
umi TCGCCAGTCC = 304 reads: +400 validated
umi TCGGCCGAAC = 306 reads: +400 validated
umi TCGTCTGCGT = 298 reads: +400 validated
umi TGAGATTGGG = 355 reads: +400 validated
umi TGCGTTCGCT = 306 reads: +400 validated
umi TGTCTCCGCC = 242 reads: +400 validated
umi TTATTCACAG = 364 reads: +80 -1XX +319 invalidated
umi TTTATCAGGA = 346 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=542]
62-415 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=12)
434-471 ==> 15-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 50 umis using 1037 reads
cdr3 = CATGLLGGPIHW at 404, score = 9 + 7
umis assigned: [15, 18, 96, 248, 289, 290, 341, 388, 447, 501] and 47 others
of which 57 are surviving nonsolos
reads assigned: 14103
start codons at 62, 213, 260, 265, 269, 297, 326, 344, 359
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 49 umis using 2201 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [115, 120, 127, 176, 190, 224, 243, 251, 269, 375] and 47 others
of which 57 are surviving nonsolos
reads assigned: 17680
start codons at 30, 99, 352, 472
confident = true

REJECT CONTIGS

TIG 1[bases=305]
0-142 ==> 15-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
140-203 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
203-305 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [1728]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 26, 65, 120, 160, 221, 282
confident = false
did not find CDR3

TIG 2[bases=638]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=1)
56-364 ==> 0-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=15)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [164, 287, 345, 452, 611, 624, 754, 790, 797, 931] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5425
start codons at 56, 267, 360
confident = false
did not find CDR3
now this is a cell
paired!

AGCCTGAAATCTGAGGACACGGCCGTCTATTATTGTGCGACAGGCCTCCTAGGGGGGCCGATCCACTGGGGCCAGGGCACCCCGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCACTATTATTCTATTCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.5 = CCTCTGACAGGTCCAC-1

using 153 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 140]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.26 = CCTCTGACATTACCTT-1

using 170 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 164]
surviving nonsolo ucounts = 1[164]
ids = [1]

====================================================================================

UMI info for barcode CCTCTGACATTACCTT-1 contig 1 = GGGGGTCTCA...
umi CGTCGGTTTG = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
39-400 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-528 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSYTSSSTLVF at 363, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.29 = CCTCTGAGTAAGCACG-1

using 533 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 5, 516]
surviving nonsolo ucounts = 1[516]
ids = [3]

====================================================================================

UMI info for barcode CCTCTGAGTAAGCACG-1 contig 1 = GAAGAGCTGC...
umi CCAACATGTC = 513 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 86 reads
cdr3 = CHQHGDSPWTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 509
start codons at 33, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.36 = CCTCTGAGTAGAAGGA-1

using 52 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 4, 5, 10, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.39 = CCTCTGAGTATGGTTC-1

using 212 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 210]
surviving nonsolo ucounts = 1[210]
ids = [0]

====================================================================================

UMI info for barcode CCTCTGAGTATGGTTC-1 contig 1 = GCTCTGCTTC...
umi CGCCCTAAAC = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.46 = CCTCTGAGTCCTCTTG-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.54 = CCTCTGAGTCTTTCAT-1

using 19 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.55 = CCTCTGAGTGAGGGAG-1

using 296 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^4, 284]
surviving nonsolo ucounts = 1[284]
ids = [6]

====================================================================================

UMI info for barcode CCTCTGAGTGAGGGAG-1 contig 1 = GGGAGAGCCC...
umi GCTGCGATAT = 267 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=524]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
429-524 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNWPFTF at 368, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 47, 252, 255, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.56 = CCTCTGAGTGCAGACA-1

using 71 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[3, 6, 8, 11^2, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.69 = CCTCTGAGTTCGGCAC-1

using 599 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3^2, 590]
surviving nonsolo ucounts = 1[590]
ids = [1]

====================================================================================

UMI info for barcode CCTCTGAGTTCGGCAC-1 contig 1 = GGAGTCAGTC...
umi GGCTGTGTTG = 596 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 98 reads
cdr3 = CQQSFSTPWQF at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 586
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.74 = CCTCTGAGTTGTACAC-1

using 293 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 1[290]
ids = [3]

====================================================================================

UMI info for barcode CCTCTGAGTTGTACAC-1 contig 1 = GGGGAGGAGT...
umi TTACCTGACA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=15)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDDLPITF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 31, 37, 93, 106, 245, 368, 371, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.101 = CCTCTGATCGCACTCT-1

using 323 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4, 5, 6, 304]
surviving nonsolo ucounts = 1[304]
ids = [1]

====================================================================================

UMI info for barcode CCTCTGATCGCACTCT-1 contig 1 = GTCAGACTCA...
umi AACGTGGTCA = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.103 = CCTCTGATCGGCCGAT-1

using 354 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[354]
surviving nonsolo ucounts = 1[354]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.120 = CCTTACGAGACAAAGG-1

using 302 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 294]
surviving nonsolo ucounts = 1[294]
ids = [4]

====================================================================================

UMI info for barcode CCTTACGAGACAAAGG-1 contig 1 = ATCAGTCCCA...
umi TAACGGGGTG = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-499 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.127 = CCTTACGAGCCAACAG-1

using 31 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.128 = CCTTACGAGCCACGCT-1

using 1367 reads

====================================================================================

graph has 1758 edges initially, 10 edges after simplification

total ucounts = 522
nonsolo ucounts = 196[2^79, 3^51, 4^24, 5^18, 6^3, 7^6, 8^4, 9^6, 11^2, 12^2, 352]
surviving nonsolo ucounts = 1[352]
ids = [451]

====================================================================================

UMI info for barcode CCTTACGAGCCACGCT-1 contig 1 = GGAGAAGAGC...
umi TGGCATTGGG = 353 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQRYGYSMEYTF at 360, score = 9 + 7
umis assigned: [451]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 36, 244, 370, 381, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.161 = CCTTACGCAATCACAC-1

using 16798 reads

====================================================================================

graph has 7796 edges initially, 56 edges after simplification

total ucounts = 1353
nonsolo ucounts = 613[2^249, 3^123, 4^58, 5^36, 6^33, 7^15, 8^10, 9^9, 10^3, 11^4, 12^2, 14, 15, 17^3, 20, 25, 27, 44, 64, 70, 82, 83, 84, 89, 94, 98, 123, 138, 143, 146, 147, 159, 163, 175, 176, 178, 179, 195, 199, 207, 208, 216, 217, 219, 220, 222, 223, 224, 225, 228, 230, 233, 234^2, 235, 236^2, 239, 242^3, 243^2, 246, 255, 260, 261, 264, 277, 279, 283, 289, 291, 315, 319, 322, 352, 417, 453, 854]
surviving nonsolo ucounts = 58[64, 82, 84, 89, 98, 123, 138, 143, 146, 147, 159, 163, 175, 176, 178, 179, 195, 199, 207, 208, 216, 217, 219, 220, 222, 223, 224, 225, 228, 230, 233, 234^2, 235, 236^2, 239, 242^3, 243^2, 246, 255, 260, 261, 264, 277, 279, 283, 289, 291, 315, 319, 322, 417, 453, 854]
ids = [9, 795, 50, 893, 1124, 491, 1078, 238, 748, 291, ...]

====================================================================================

UMI info for barcode CCTTACGCAATCACAC-1 contig 1 = ATCACATAAC...
umi AACTTTCCGT = 84 reads: +430 validated
umi AGGGTTTCTC = 144 reads: +430 validated
umi CACTACTCCT = 221 reads: +430 validated
umi CATCTTGTTA = 201 reads: +430 validated
umi CCTATAGCCA = 126 reads: +430 validated
umi CCTCCACCCT = 178 reads: +430 validated
umi CCTGTCATTT = 234 reads: +430 validated
umi CGAAAAGGCT = 276 reads: +430 validated
umi GAGTTTCTCC = 255 reads: +430 validated
umi GCCGTCAACA = 136 reads: -417X +1 -7XX +2 -2XX +1 invalidated
umi GGACACTCCC = 263 reads: +430 validated
umi GGAGTAGTCT = 84 reads: +430 validated
umi GGTCCTTTAT = 245 reads: +430 validated
umi GTGGCTTACT = 324 reads: +430 validated
umi TCCGGATGCT = 287 reads: +430 validated
umi TCGTTATCGG = 221 reads: +430 validated
umi TCTCACTATG = 232 reads: +430 validated
umi TCTGAGCGCT = 97 reads: +430 validated
umi TTACAGTCTC = 236 reads: +430 validated

UMI info for barcode CCTTACGCAATCACAC-1 contig 2 = TGGGGGCTGG...
umi AAAAGCCCTC = 163 reads: +388 validated
umi AAACGTCCCC = 64 reads: +388 validated
umi AAGCAAATGG = 855 reads: -297X +2 -5X +1 -4X +1 -3X +2 -1X +2 -4XX +66 invalidated
umi ACACAGCCTC = 233 reads: +388 validated
umi ACGCCATCGC = 239 reads: +388 validated
umi ACGGGCGCTC = 217 reads: +388 validated
umi ACTCGATTGC = 197 reads: +388 validated
umi AGCGATATGG = 260 reads: +388 validated
umi CAAACGCGAG = 209 reads: +388 validated
umi CCAGCCCTAA = 238 reads: +388 validated
umi CCCTATCTAG = 247 reads: +388 validated
umi CCTACACCAA = 226 reads: +388 validated
umi CCTCATTCGC = 243 reads: +388 validated
umi CCTTTGGCCG = 176 reads: +388 validated
umi CGGTGCGGGC = 234 reads: +388 validated
umi CTAGGCGGCC = 266 reads: +388 validated
umi CTATCTCTCA = 279 reads: +388 validated
umi GAGAATCTGC = 316 reads: +388 validated
umi GCTAGGACAA = 220 reads: +388 validated
umi GGACATACCC = 195 reads: +388 validated
umi GGCAGTAACC = 278 reads: +388 validated
umi GGCCTCCTTT = 178 reads: +388 validated
umi TACCTAACAA = 234 reads: +94 -2XX +1 -2XX +1 -2XX +286 invalidated
umi TACTCTTGAT = 160 reads: +388 validated
umi TAGCACGGTG = 237 reads: +388 validated
umi TCACATGTAC = 247 reads: +388 validated
umi TCCCTCGCTC = 176 reads: +388 validated
umi TCCTCAGGAT = 140 reads: +388 validated
umi TCCTGCTTAG = 291 reads: +388 validated
umi TCGGCATCAC = 226 reads: +388 validated
umi TGACTCACGG = 449 reads: +388 validated
umi TGAGACTTCA = 215 reads: +388 validated
umi TGAGCACCAC = 242 reads: +388 validated
umi TGCTCGACAG = 328 reads: +388 validated
umi TTACAACTCT = 232 reads: +388 validated
umi TTTAAGCGGG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=648]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-350 ==> 0-292 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=17)
438-488 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
488-648 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 18 umis using 373 reads
cdr3 = CSHCGGGSCRPLSYGMDVW at 400, score = 9 + 7
umis assigned: [50, 238, 387, 412, 491, 497, 508, 518, 700, 748] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3790
start codons at 58, 209, 256, 355, 445, 542
confident = true

TIG 2[bases=645]
46-386 ==> 0-340 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=18)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=6)
434-645 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 35 umis using 1275 reads
cdr3 = CSSYTTTSTVIF at 370, score = 8 + 8
umis assigned: [4, 9, 57, 112, 162, 169, 187, 224, 355, 443] and 26 others
of which 36 are surviving nonsolos
reads assigned: 8813
start codons at 46, 203, 254, 257, 566
confident = true
now this is a cell
paired!

GCCGTTTATTATTGTAGTCATTGTGGAGGTGGCAGCTGCCGTCCTCTGTCCTACGGCATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGTCTCCAGCCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAACCACCAGCACTGTGATCTTCGGAACTGGGACCCACGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.171 = CCTTACGCACGAAGCA-1

using 268 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2, 3^2, 4, 249]
surviving nonsolo ucounts = 1[249]
ids = [6]

====================================================================================

UMI info for barcode CCTTACGCACGAAGCA-1 contig 1 = TGGGGGGGAA...
umi GACCTAGACG = 230 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=483]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=1)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
419-483 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CQQRSNWPITF at 358, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 37, 242, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.172 = CCTTACGCACGGCCAT-1

using 19 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.177 = CCTTACGCAGACACTT-1

using 360 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 3, 5, 347]
surviving nonsolo ucounts = 1[347]
ids = [3]

====================================================================================

UMI info for barcode CCTTACGCAGACACTT-1 contig 1 = GAGGAACTGC...
umi CGCGTTTAAT = 355 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSNWVSITF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 33, 175, 238, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.189 = CCTTACGCAGGGTATG-1

using 240 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 229]
surviving nonsolo ucounts = 1[229]
ids = [3]

====================================================================================

UMI info for barcode CCTTACGCAGGGTATG-1 contig 1 = ACCCAAAAAC...
umi ATTCGGACCA = 228 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=578]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=44)
432-481 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=8)
481-578 ==> 0-97 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDLFENAITSRWFDSW at 396, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 54, 141, 190, 274, 289, 360, 418, 434, 535
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.213 = CCTTACGGTACAGCAG-1

using 303 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=545]
0-79 ==> 5667-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
22-375 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 22, 28, 84, 97, 233, 451
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.216 = CCTTACGGTACCGTAT-1

using 330 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 323]
surviving nonsolo ucounts = 1[323]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGGTACCGTAT-1 contig 1 = GCTCTGCTTC...
umi ATTGCCACCC = 323 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.219 = CCTTACGGTACTTCTT-1

using 36 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.226 = CCTTACGGTCAGTGGA-1

using 243 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 235]
surviving nonsolo ucounts = 1[235]
ids = [1]

====================================================================================

UMI info for barcode CCTTACGGTCAGTGGA-1 contig 1 = CAGGACACAG...
umi ATCGAGGGGT = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
11-362 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
362-399 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYALSF at 338, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 11, 17, 73, 86, 222, 225, 318, 357, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.228 = CCTTACGGTCGACTAT-1

using 322 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode CCTTACGGTCGACTAT-1 contig 1 = GGGGAGTCAG...
umi ACTCTTGATC = 314 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.243 = CCTTACGGTGAGCGAT-1

using 173 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 168]
surviving nonsolo ucounts = 1[168]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGGTGAGCGAT-1 contig 1 = GCTCTGCTTC...
umi ATAACGCTGG = 164 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=541]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-541 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.251 = CCTTACGGTGTGAAAT-1

using 2607 reads

====================================================================================

graph has 2926 edges initially, 32 edges after simplification

total ucounts = 872
nonsolo ucounts = 408[2^164, 3^87, 4^61, 5^25, 6^27, 7^22, 8^8, 9^4, 10^4, 11, 12^2, 13, 22, 659]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.257 = CCTTACGGTTACGACT-1

using 5171 reads

====================================================================================

graph has 4191 edges initially, 84 edges after simplification

total ucounts = 996
nonsolo ucounts = 459[2^195, 3^96, 4^56, 5^32, 6^29, 7^10, 8^7, 9^4, 10^4, 11^5, 12^5, 13^2, 15^2, 23, 82, 176, 177, 194, 236, 254, 274, 300, 317, 371, 621]
surviving nonsolo ucounts = 9[176, 177, 194, 236, 254, 274, 300, 317, 371]
ids = [923, 209, 521, 751, 431, 245, 940, 447, 526]

====================================================================================

UMI info for barcode CCTTACGGTTACGACT-1 contig 1 = GTGGGTCCAG...
umi CGGTACAAAA = 254 reads: +385 validated
umi GAAAGTCCGT = 192 reads: +385 validated
umi TAGTTAGCCA = 228 reads: +385 validated
umi TTAGGATTTC = 175 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=24)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
420-554 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 126 reads
cdr3 = CQSSDSSDTYSWAF at 350, score = 7 + 8
umis assigned: [431, 521, 751, 923]
of which 4 are surviving nonsolos
reads assigned: 832
start codons at 35, 96, 165, 183
confident = true

REJECT CONTIGS

TIG 1[bases=439]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=2)
0-80 ==> 7066-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=2)
0-80 ==> 7060-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=2)
49-116 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=30)
umis assigned: [136, 245, 447, 940]
of which 3 are surviving nonsolos
reads assigned: 1185
start codons at 80, 133, 231, 236, 289, 294, 315, 383
confident = false
did not find CDR3

TIG 2[bases=465]
3-22 ==> 5788-5807 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
23-88 ==> 5810-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
41-239 ==> 0-198 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
254-465 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [209, 526]
of which 2 are surviving nonsolos
reads assigned: 502
start codons at 41, 189, 198, 249, 252, 386
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.259 = CCTTACGGTTAGGGTG-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.264 = CCTTACGGTTGTCGCG-1

using 346 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 341]
surviving nonsolo ucounts = 1[341]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=528]
0-79 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-394 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
433-528 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 354, score = 4 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 34, 67, 103, 191, 353, 373, 475
confident = false
not full
frameshifted full length transcript of length 528
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.270 = CCTTACGTCAAAGTAG-1

using 8923 reads

====================================================================================

graph has 5355 edges initially, 132 edges after simplification

total ucounts = 862
nonsolo ucounts = 630[2^95, 3^73, 4^74, 5^63, 6^46, 7^55, 8^36, 9^26, 10^31, 11^21, 12^19, 13^22, 14^16, 15^8, 16^6, 17^12, 18^3, 19^3, 20^2, 22, 23, 50, 90, 96, 149, 163, 186, 193, 199, 209, 212, 226, 229, 258, 259, 279, 897, 898]
surviving nonsolo ucounts = 16[50, 90, 149, 163, 186, 193, 199, 209, 212, 226, 229, 258, 259, 279, 897, 898]
ids = [561, 773, 118, 2, 818, 653, 816, 209, 95, 294, ...]

====================================================================================

UMI info for barcode CCTTACGTCAAAGTAG-1 contig 1 = AGAGGAGCCC...
umi AAACAGGACT = 163 reads: +409 validated
umi AGGAGTGCAG = 147 reads: +409 validated
umi GTAGCGTCGT = 49 reads: +409 validated
umi TTCGTTTTCG = 199 reads: +409 validated
umi TTCTCTCTTG = 186 reads: +409 validated

UMI info for barcode CCTTACGTCAAAGTAG-1 contig 2 = GGGGTCTCAG...
umi AGAAGACCGA = 211 reads: +388 validated
umi ATATCGTACC = 258 reads: +388 validated
umi CAAGTTAGCG = 209 reads: +388 validated
umi CCCTAAGGCT = 224 reads: +388 validated
umi GCTCCTGTAT = 259 reads: +388 validated
umi GTCTTGCAGG = 939 reads: -366X +11 -1XX +10 invalidated
umi TAGTAGTTTG = 193 reads: +388 validated
umi TAGTCACACG = 230 reads: +388 validated
umi TATCTTTGTA = 276 reads: +388 validated
umi TCGGAACACC = 928 reads: -350X +2 -3XX +1 -1XX +5 -4XX +11 -1XX +10 invalidated
umi TGGCTGGTTA = 93 reads: -382X +6 invalidated

GOOD CONTIGS

TIG 1[bases=574]
0-70 ==> 10-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
70-421 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=25)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
479-574 ==> 0-95 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 5 umis using 77 reads
cdr3 = CASAMAFYFEDW at 412, score = 7 + 7
umis assigned: [2, 118, 561, 816, 818]
of which 5 are surviving nonsolos
reads assigned: 728
start codons at 70, 221, 226, 284, 287, 296, 305, 373, 424
confident = true

TIG 2[bases=637]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=19)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-637 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=3)
junction support: 8 umis using 300 reads
cdr3 = CTSFAGSNNFIF at 362, score = 8 + 9
umis assigned: [95, 148, 209, 294, 508, 580, 653, 654, 670, 722] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3675
start codons at 38, 195, 246, 345
confident = true
now this is a cell
paired!

AACCTGAGGGGCGACGACACGGCTGTTTATTACTGTGCGAGTGCCATGGCCTTCTACTTTGAAGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGACTATTACTGCACCTCATTTGCAGGCAGCAACAATTTCATCTTCGGAACTGGGACCAAGCTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.276 = CCTTACGTCACCGGGT-1

using 168 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 4, 159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================

UMI info for barcode CCTTACGTCACCGGGT-1 contig 1 = CTCTCAGGAC...
umi TGTTCGGTCC = 157 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-19 ==> 22-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
19-340 ==> 0-321 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=10)
369-407 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=7)
407-507 ==> 0-100 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSFSGTNTLVF at 343, score = 7 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 19, 220, 227
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.279 = CCTTACGTCACGGTTA-1

using 172 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 6, 160]
surviving nonsolo ucounts = 1[160]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGTCACGGTTA-1 contig 1 = GAACTGCTCA...
umi ACGAAGGCGC = 136 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=480]
0-30 ==> 67-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
30-375 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-480 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYNNWPPWTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 30, 99, 235, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.289 = CCTTACGTCCCTCTTT-1

using 494 reads

====================================================================================

graph has 219 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 11[2^2, 6, 7, 8, 9, 11, 12, 13, 64, 358]
surviving nonsolo ucounts = 2[64, 358]
ids = [12, 10]

====================================================================================

UMI info for barcode CCTTACGTCCCTCTTT-1 contig 1 = AGTCTCAGTC...
umi TGGTTATAAA = 355 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQSYRRPITF at 347, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 20, 26, 82, 95, 231, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.291 = CCTTACGTCCGCTGTT-1

using 217 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode CCTTACGTCCGCTGTT-1 contig 1 = AGCTCTGGGA...
umi GCTTGTTCCC = 214 reads: +475 validated

GOOD CONTIGS

TIG 1[bases=570]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
457-488 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=5)
492-555 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 1 umis using 10 reads
cdr3 = CTTDPIPSPREYDFWSGYYKPRSYYYYGMDVW at 428, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 80, 236, 303, 360, 389, 512
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.294 = CCTTACGTCCTATTCA-1

using 581 reads

====================================================================================

graph has 212 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 223, 350]
surviving nonsolo ucounts = 2[223, 350]
ids = [5, 2]

====================================================================================

UMI info for barcode CCTTACGTCCTATTCA-1 contig 1 = GGAGTCAGAC...
umi TGGTGCACCG = 224 reads: +388 validated

UMI info for barcode CCTTACGTCCTATTCA-1 contig 2 = GGGGAGGAAC...
umi CGTAAGATGG = 345 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQGNSFPYTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 26, 32, 88, 101, 456
confident = false

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNNWPPATF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.304 = CCTTACGTCGTCCAGG-1

using 230 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGTCGTCCAGG-1 contig 1 = CTCAGGACAC...
umi AATCAGTCCC = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
13-364 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 340, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 13, 19, 88, 224, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.305 = CCTTACGTCGTCCGTT-1

using 365 reads

====================================================================================

graph has 542 edges initially, 6 edges after simplification

total ucounts = 171
nonsolo ucounts = 78[2^33, 3^16, 4^15, 5^6, 6^4, 8, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.306 = CCTTACGTCGTGACAT-1

using 151 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[151]
surviving nonsolo ucounts = 1[151]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGTCGTGACAT-1 contig 1 = GAGTCCCAAC...
umi GCCACTGGCT = 138 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=495]
27-275 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
409-495 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLHYDNRRRTF at 348, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 27, 83, 96, 235, 358, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.310 = CCTTACGTCTACTTAC-1

using 518 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^3, 3, 17, 224, 260]
surviving nonsolo ucounts = 2[224, 260]
ids = [11, 9]

====================================================================================

UMI info for barcode CCTTACGTCTACTTAC-1 contig 1 = AGAGCTGCTC...
umi GGTGCAGCCA = 247 reads: +388 validated

UMI info for barcode CCTTACGTCTACTTAC-1 contig 2 = TGAGCGCAGA...
umi TAAATCTATC = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=28)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-505 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQHYGNSSPYTF at 355, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 31, 365, 461
confident = false

TIG 2[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-537 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.311 = CCTTACGTCTCACATT-1

using 62 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 1[62]
ids = [0]

====================================================================================

UMI info for barcode CCTTACGTCTCACATT-1 contig 1 = AGACCCAGTC...
umi GTGGCTGTTC = 57 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-458 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQYNSYSRTF at 347, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 20, 26, 82, 95, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.322 = CCTTACGTCTTTACGT-1

using 30 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.330 = CCTTCCCAGACTAGGC-1

using 315 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[4, 303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode CCTTCCCAGACTAGGC-1 contig 1 = AGTCTGGGCC...
umi AGGCGACGGC = 292 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=588]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-588 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQVWDSSSDHVVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 40, 101, 239, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.332 = CCTTCCCAGACTTTCG-1

using 44 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 34]
surviving nonsolo ucounts = 1[34]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.343 = CCTTCCCAGCCCAACC-1

using 237 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 1[233]
ids = [2]

====================================================================================

UMI info for barcode CCTTCCCAGCCCAACC-1 contig 1 = AGGAGTCAGA...
umi TGAGCTTCAA = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 89, 102, 241, 259, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.350 = CCTTCCCAGCTAACAA-1

using 241 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[6, 17, 212]
surviving nonsolo ucounts = 1[212]
ids = [5]

====================================================================================

UMI info for barcode CCTTCCCAGCTAACAA-1 contig 1 = TGAGCGCAGA...
umi GTGTCACCTT = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-564 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.354 = CCTTCCCAGCTCTCGG-1

using 38 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 8, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.356 = CCTTCCCAGCTTCGCG-1

using 97 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 93]
surviving nonsolo ucounts = 1[93]
ids = [2]

====================================================================================

UMI info for barcode CCTTCCCAGCTTCGCG-1 contig 1 = GCACAGCTCA...
umi TCAGATCCTT = 88 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=523]
15-368 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=10)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
436-523 ==> 0-87 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CARSELVIAIQRFDYW at 357, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 15, 166, 213, 312
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.363 = CCTTCCCAGGCGATAC-1

using 305 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 6, 287]
surviving nonsolo ucounts = 1[287]
ids = [6]

====================================================================================

UMI info for barcode CCTTCCCAGGCGATAC-1 contig 1 = TGGGGAGGAA...
umi GTGTCTCGTT = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.365 = CCTTCCCAGGGCACTA-1

using 904 reads

====================================================================================

graph has 430 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 285, 292, 325]
surviving nonsolo ucounts = 3[285, 292, 325]
ids = [3, 2, 1]

====================================================================================

UMI info for barcode CCTTCCCAGGGCACTA-1 contig 1 = AGTCTCAGTC...
umi ACGCTCTGGG = 326 reads: +388 validated
umi TTCAATTGCG = 287 reads: +388 validated

UMI info for barcode CCTTCCCAGGGCACTA-1 contig 2 = TGCTTTCTGA...
umi TCTGCCACGG = 241 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 102 reads
cdr3 = CQQSYRRPITF at 347, score = 8 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 594
start codons at 20, 26, 82, 95, 231, 330, 450
confident = true

TIG 2[bases=498]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
432-475 ==> 9-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
475-498 ==> 0-23 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARVVHSAGTQHSSSWGTTFQHW at 375, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 15, 36, 80, 166
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.380 = CCTTCCCAGTGCCAGA-1

using 82 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[82]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.385 = CCTTCCCCAAAGGCGT-1

using 400 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[400]
surviving nonsolo ucounts = 1[400]
ids = [0]

====================================================================================

UMI info for barcode CCTTCCCCAAAGGCGT-1 contig 1 = GAGGAACTGC...
umi ACGTATGGTA = 400 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPPGSTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 396
start codons at 33, 238, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.389 = CCTTCCCCAACGATGG-1

using 371 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4^2, 355]
surviving nonsolo ucounts = 1[355]
ids = [4]

====================================================================================

UMI info for barcode CCTTCCCCAACGATGG-1 contig 1 = GGGGAGGAGT...
umi CGATACTTGG = 351 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDNLPTF at 358, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 31, 37, 93, 106, 245, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.392 = CCTTCCCCAAGCCCAC-1

using 297 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 22
nonsolo ucounts = 12[2, 3^3, 4^3, 6, 7, 10, 12, 229]
surviving nonsolo ucounts = 1[229]
ids = [12]

====================================================================================

UMI info for barcode CCTTCCCCAAGCCCAC-1 contig 1 = TGGGAGGAAT...
umi GCGGACAGTT = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.402 = CCTTCCCCACAGGTTT-1

using 362 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 9, 346]
surviving nonsolo ucounts = 1[346]
ids = [3]

====================================================================================

UMI info for barcode CCTTCCCCACAGGTTT-1 contig 1 = AGTCCCAACC...
umi ATTTCGCTCG = 350 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYDNLPTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.419 = CCTTCCCCAGACAGGT-1

using 164 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 4, 149]
surviving nonsolo ucounts = 1[149]
ids = [7]

====================================================================================

UMI info for barcode CCTTCCCCAGACAGGT-1 contig 1 = CTGTGCCCCA...
umi GTAGGAACCG = 135 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=481]
12-370 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
395-445 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
445-481 ==> 0-36 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 357, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 12, 56, 235, 238, 241, 327, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.432 = CCTTCCCCAGGAACGT-1

using 57 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[57]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.433 = CCTTCCCCAGGGAGAG-1

using 353 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 346]
surviving nonsolo ucounts = 1[346]
ids = [4]

====================================================================================

UMI info for barcode CCTTCCCCAGGGAGAG-1 contig 1 = GATCAGGACT...
umi TACAGTCATC = 347 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQALQTPITF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.446 = CCTTCCCCATAACCTG-1

using 251 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 244]
surviving nonsolo ucounts = 1[244]
ids = [2]

====================================================================================

UMI info for barcode CCTTCCCCATAACCTG-1 contig 1 = GGGGGGGTCT...
umi TCGGGGCGTG = 239 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=520]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-387 ==> 0-346 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-520 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTSSTSYVVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 41, 198, 242, 249, 252, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.449 = CCTTCCCCATCAGTAC-1

using 377 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 365]
surviving nonsolo ucounts = 1[365]
ids = [3]

====================================================================================

UMI info for barcode CCTTCCCCATCAGTAC-1 contig 1 = GCAGGAGTCA...
umi CCCTCCGCGC = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.450 = CCTTCCCCATCAGTCA-1

using 357 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 155, 197]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.455 = CCTTCCCCATCTCGCT-1

using 26 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^3, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.462 = CCTTCCCGTACATGTC-1

using 208 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [0]

====================================================================================

UMI info for barcode CCTTCCCGTACATGTC-1 contig 1 = ACCCAAAAAC...
umi TCCCTTATCA = 202 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=524]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-524 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.464 = CCTTCCCGTACCTACA-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.468 = CCTTCCCGTAGCCTAT-1

using 315 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3, 4, 8, 290]
surviving nonsolo ucounts = 1[290]
ids = [9]

====================================================================================

UMI info for barcode CCTTCCCGTAGCCTAT-1 contig 1 = TCAGCTTCAG...
umi TGTTCAACGG = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=561]
0-49 ==> 65-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
49-402 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-561 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CASWDDSLRGRVF at 370, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 49, 203, 353, 378, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.486 = CCTTCCCGTCCTGCTT-1

using 290 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 7, 272]
surviving nonsolo ucounts = 1[272]
ids = [3]

====================================================================================

UMI info for barcode CCTTCCCGTCCTGCTT-1 contig 1 = AGTCCCACTC...
umi GTTGATATGA = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-483 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.503 = CCTTCCCGTGCCTGCA-1

using 328 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3^2, 4, 6, 8, 298]
surviving nonsolo ucounts = 1[298]
ids = [3]

====================================================================================

UMI info for barcode CCTTCCCGTGCCTGCA-1 contig 1 = GCTCTGCTTC...
umi CGTTCATTGT = 262 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=594]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-594 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQSYDSSLNGSVF at 375, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 51, 135, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.505 = CCTTCCCGTGCGGTAA-1

using 392 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[387]
surviving nonsolo ucounts = 1[387]
ids = [3]

====================================================================================

UMI info for barcode CCTTCCCGTGCGGTAA-1 contig 1 = GAGTGCTCTC...
umi GGAGCCATAC = 382 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=528]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
411-457 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGAARSGTVTLDYW at 378, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 18, 39, 83, 169, 274
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.512 = CCTTCCCGTGTTAAGA-1

using 327 reads

====================================================================================

graph has 108 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 89, 234]
surviving nonsolo ucounts = 2[89, 234]
ids = [0, 2]

====================================================================================

UMI info for barcode CCTTCCCGTGTTAAGA-1 contig 1 = GCTCTGCTTC...
umi GGTATTACCC = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
439-575 ==> 0-136 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDSSLREVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.515 = CCTTCCCGTTACGCGC-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.522 = CCTTCCCGTTCCACGG-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.526 = CCTTCCCGTTCGTGAT-1

using 340 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 330]
surviving nonsolo ucounts = 1[330]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
0-33 ==> 64-97 on |287|IGKV3D-11|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
6-47 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-380 ==> 0-347 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=2)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 238, 241, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.529 = CCTTCCCGTTTACTCT-1

using 377 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 4^2, 359]
surviving nonsolo ucounts = 1[359]
ids = [2]

====================================================================================

UMI info for barcode CCTTCCCGTTTACTCT-1 contig 1 = GGAGTCAGTC...
umi ACTGTTTCAT = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
414-511 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPYTF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 26, 32, 88, 101, 291, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.530 = CCTTCCCGTTTAGCTG-1

using 67 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[61]
surviving nonsolo ucounts = 1[61]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.541 = CCTTCCCTCAATCACG-1

using 94 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^4, 3, 4, 75]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.550 = CCTTCCCTCATACGGT-1

using 5368 reads

====================================================================================

graph has 4510 edges initially, 52 edges after simplification

total ucounts = 919
nonsolo ucounts = 469[2^185, 3^109, 4^62, 5^41, 6^16, 7^19, 8^9, 9^3, 10^6, 11^2, 12^3, 13, 15, 18, 147, 193, 225, 231, 270, 274, 301, 310, 319, 322, 683]
surviving nonsolo ucounts = 11[147, 193, 225, 231, 270, 274, 301, 310, 319, 322, 683]
ids = [629, 195, 653, 104, 845, 18, 798, 801, 838, 258, ...]

====================================================================================

UMI info for barcode CCTTCCCTCATACGGT-1 contig 1 = TGGGGAGGAG...
umi AACGATTTCT = 278 reads: +391 validated
umi ACTAGCACCG = 677 reads: +391 validated
umi CATAGATCTG = 320 reads: +391 validated
umi GTTCAACCTG = 147 reads: +391 validated
umi TGCGTTCTTT = 311 reads: +391 validated
umi TTAAGGGATC = 322 reads: +391 validated
umi TTAGTAGCAA = 287 reads: +154 -1XX +236 invalidated

UMI info for barcode CCTTCCCTCATACGGT-1 contig 2 = AGCTGTTTCT...
umi ACTTCATTAC = 228 reads: +424 validated
umi ATTGTTCAAC = 178 reads: +424 validated
umi TAAGATCAGC = 215 reads: +421 -1 +2 non-validated
umi TGCCTTACAC = 298 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=559]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 371 reads
cdr3 = CQQSYGTPLYNF at 359, score = 9 + 7
umis assigned: [18, 89, 258, 629, 801, 838, 845]
of which 7 are surviving nonsolos
reads assigned: 2295
start codons at 32, 38, 94, 107, 243, 465
confident = true

TIG 2[bases=542]
0-45 ==> 191-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
45-398 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=17)
419-469 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
469-542 ==> 0-73 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 4 umis using 78 reads
cdr3 = CARLSVGGSWSKAFDIW at 387, score = 9 + 8
umis assigned: [104, 195, 653, 798]
of which 4 are surviving nonsolos
reads assigned: 898
start codons at 45, 201, 262, 348, 450, 523
confident = true
now this is a cell
paired!

GACACGGCTGTATATTATTGTGCAAGATTGTCCGTCGGAGGCAGTTGGTCGAAGGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACGGTACCCCCCTATACAATTTCGGCCCTGGGACCAAAGTGAATATAAGAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.551 = CCTTCCCTCATCGCTC-1

using 20 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.558 = CCTTCCCTCCATGCTC-1

using 1999 reads

====================================================================================

graph has 702 edges initially, 12 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[7, 159, 249, 261, 1318]
surviving nonsolo ucounts = 4[159, 249, 261, 1318]
ids = [1, 0, 6, 9]

====================================================================================

UMI info for barcode CCTTCCCTCCATGCTC-1 contig 1 = GGGGCTGAGA...
umi ACGTAACAAC = 163 reads: +424 validated
umi GCACCTAGAA = 258 reads: +424 validated
umi TTGCAACATA = 714 reads: +243 -5XX +1 -3XX +1 -2XX +1 -3XX +1 -2XX +3 -1XX +2 -156XX invalidated

UMI info for barcode CCTTCCCTCCATGCTC-1 contig 2 = GTCAGTCCCA...
umi AAGAACGCAC = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=606]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-606 ==> 0-103 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 30 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 6, 9]
of which 3 are surviving nonsolos
reads assigned: 1103
start codons at 79, 230, 235, 382, 460
confident = true

TIG 2[bases=492]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYDNLPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 23, 29, 85, 98, 237, 360, 453
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGCGGCGACAGCTCGTCTTGGCGGTATGGACGTCTGGGGCCAAGGGACCGCGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCCCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.567 = CCTTCCCTCCGCAGTG-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.568 = CCTTCCCTCCGTTGTC-1

using 64 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 54]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.570 = CCTTCCCTCCTCAATT-1

using 130 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 3, 116]
surviving nonsolo ucounts = 1[116]
ids = [4]

====================================================================================

UMI info for barcode CCTTCCCTCCTCAATT-1 contig 1 = GGGGTCTCAG...
umi CGTTTACCGT = 110 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=480]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-390 ==> 0-352 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
429-480 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CCSYAGSYTYVVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 38, 177, 195, 239, 246, 249, 345, 372, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.571 = CCTTCCCTCCTCCTAG-1

using 263 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 28, 226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================

UMI info for barcode CCTTCCCTCCTCCTAG-1 contig 1 = AAAAACCACA...
umi ACAAACCGTC = 220 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=527]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-527 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.580 = CCTTCCCTCGCCATAA-1

using 761 reads

====================================================================================

graph has 1058 edges initially, 26 edges after simplification

total ucounts = 378
nonsolo ucounts = 161[2^68, 3^45, 4^14, 5^17, 6^7, 7^5, 8, 9, 10, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.581 = CCTTCCCTCGCCTGAG-1

using 344 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[343]
surviving nonsolo ucounts = 1[343]
ids = [1]

====================================================================================

UMI info for barcode CCTTCCCTCGCCTGAG-1 contig 1 = GAGTCAGACT...
umi GGTCTGCGTA = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYYTFSHTF at 352, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 25, 31, 87, 100, 183, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.582 = CCTTCCCTCGCGATCG-1

using 125 reads

====================================================================================

graph has 128 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 16[2^3, 3, 4^4, 5^2, 6, 7, 8, 13, 14, 34]
surviving nonsolo ucounts = 1[34]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.587 = CCTTCCCTCGTCCGTT-1

using 54 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 6, 11, 28]
surviving nonsolo ucounts = 1[28]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.588 = CCTTCCCTCGTCGTTC-1

using 70 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[3, 4, 7^2, 8, 9^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.594 = CCTTCCCTCTCACATT-1

using 20309 reads

====================================================================================

graph has 8306 edges initially, 58 edges after simplification

total ucounts = 1617
nonsolo ucounts = 804[2^303, 3^172, 4^104, 5^70, 6^35, 7^20, 8^13, 9^11, 10^2, 11, 12, 14, 15^2, 17, 21, 22, 37, 41, 51, 72, 84, 109^2, 111, 121^2, 124, 131, 140, 145, 155, 172, 175, 184, 185, 201, 202, 203, 211, 218, 221, 225, 231^2, 235, 237, 240, 242, 250, 251^2, 254, 261, 262, 265^2, 268, 272, 274, 288, 293^2, 297, 308, 315, 318, 328, 329, 331, 332, 334, 336, 338, 347, 353, 357, 369, 379, 505, 652, 726, 743]
surviving nonsolo ucounts = 63[37, 41, 72, 109, 111, 121^2, 124, 131, 140, 145, 155, 172, 175, 184, 185, 201, 202, 203, 211, 218, 221, 225, 231^2, 235, 237, 240, 242, 250, 251^2, 254, 261, 262, 265^2, 268, 272, 274, 288, 293^2, 297, 308, 315, 318, 328, 329, 331, 332, 334, 336, 338, 347, 353, 357, 369, 379, 505, 652, 726, 743]
ids = [60, 640, 1604, 131, 1153, 774, 819, 1233, 1592, 226, ...]

====================================================================================

UMI info for barcode CCTTCCCTCTCACATT-1 contig 1 = AGGAGTCAGA...
umi AAAGGGCGAA = 321 reads: +388 validated
umi AAATAAGACC = 262 reads: +388 validated
umi AACTTCTACG = 250 reads: +388 validated
umi AACTTTCACA = 468 reads: -351X +1 -2XX +5 -1XX +4 -2XX +8 -2XX +4 -1XX +7 invalidated
umi AAGAGAGCCC = 332 reads: +388 validated
umi ACATACTTAA = 281 reads: +388 validated
umi ACCGCTTTTC = 111 reads: +388 validated
umi ACCTGAACAC = 249 reads: +388 validated
umi ACGCACCCTC = 149 reads: -387 +1 non-validated
umi ACTGTCGGGG = 295 reads: +388 validated
umi AGGGATAGCG = 238 reads: +388 validated
umi AGTCCCTTCC = 299 reads: +388 validated
umi CAAGGGTCAT = 227 reads: +388 validated
umi CAGTACTTCA = 185 reads: +330 -6XX +1 -1XX +1 -2XX +1 -2XX +1 -2XX +3 -4X +1 -20X +3 -2X +3 -4XX +1 invalidated
umi CATGCACTAC = 341 reads: +388 validated
umi CATTCGGCGG = 312 reads: +388 validated
umi CCTGCAGGGT = 332 reads: +388 validated
umi CCTGTACACC = 268 reads: -353 +3 -2XX +1 -2XX +1 -3XX +1 -5XX +2 -13XX +1 -1XX invalidated
umi CCTTATGTGC = 339 reads: +388 validated
umi CGGCCGTCCG = 198 reads: -354X +34 invalidated
umi CGGGTTGGGT = 202 reads: +388 validated
umi CGGTCACTTT = 212 reads: +388 validated
umi CTAGCACTGC = 290 reads: +388 validated
umi CTCCGAAGTG = 225 reads: +388 validated
umi CTGATCTATC = 234 reads: +388 validated
umi CTGGTAAGGG = 264 reads: +388 validated
umi CTTGCGACGG = 395 reads: -356X +2 -1XX +1 -3XX +1 -6XX +1 -3XX +1 -7XX +1 -2XX +2 -1XX invalidated
umi CTTGTACAGT = 268 reads: +388 validated
umi GATTGTCCCT = 317 reads: +56 -2XX +1 -6XX +2 -9XX +1 -3XX +1 -299XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi GCCAGTTCCC = 273 reads: +388 validated
umi GCTCTTTCGA = 326 reads: +388 validated
umi GTCTGCGCGA = 262 reads: +388 validated
umi GTTTTTCCCT = 239 reads: +388 validated
umi TACACTGTCG = 355 reads: +388 validated
umi TACCTACGGT = 345 reads: +388 validated
umi TACGTACTGA = 109 reads: -360X +2 -2XX +24 invalidated
umi TAGCCCAATA = 349 reads: +388 validated
umi TCAATATCGG = 367 reads: +388 validated
umi TCACTTTCAC = 270 reads: +388 validated
umi TCATCGCATG = 121 reads: +388 validated
umi TCATGTCAGT = 199 reads: +388 validated
umi TCGCTCATAA = 247 reads: +388 validated
umi TCTAGAGGCG = 146 reads: +388 validated
umi TCTAGGGTCA = 333 reads: +388 validated
umi TCTGATTCCT = 251 reads: +388 validated
umi TGCAATCGGC = 365 reads: -353X +3 -2XX +1 -2XX +1 -3XX +1 -5XX +2 -13XX +1 -1XX invalidated
umi TGGACCACCC = 168 reads: -344X +1 -6X +1 -2XX +34 invalidated
umi TTAAGGCGGC = 214 reads: +388 validated
umi TTGCTGAGGC = 254 reads: +388 validated
umi TTGTCGTATG = 230 reads: +388 validated
umi TTTATTTTGA = 275 reads: -351X +1 -2X +5 -1XX +4 -2XX +8 -2XX +4 -1XX +7 invalidated
umi TTTCCATTCC = 336 reads: +388 validated
umi TTTCGACCAA = 222 reads: +388 validated
umi TTTCGTAGTC = 131 reads: +388 validated

UMI info for barcode CCTTCCCTCTCACATT-1 contig 2 = AGCTCTGGGA...
umi AAGTTTTGGG = 36 reads: +255 -4X +81 -75 invalidated
umi ACGCCGACCA = 182 reads: +415 validated
umi AGGTGTCATC = 142 reads: +415 validated
umi CGGCTCTCAC = 36 reads: +33 -11 +366 -5 non-validated
umi CTTAATGAGG = 109 reads: +415 validated
umi GAACGCGTTT = 124 reads: +415 validated
umi GACCGTCCAG = 169 reads: +396 -7 +3 -1 +8 non-validated
umi TTTGTACTTC = 70 reads: +332 -16 +56 -11 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 43 umis using 1734 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [13, 14, 46, 48, 50, 108, 131, 138, 149, 183] and 44 others
of which 54 are surviving nonsolos
reads assigned: 14059
start codons at 27, 33, 89, 102, 334, 457
confident = true

TIG 2[bases=566]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=28)
448-495 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
495-566 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 30 reads
cdr3 = CAKNTAGTGGMDVW at 422, score = 9 + 7
umis assigned: [60, 152, 226, 640, 774, 819, 835, 1604]
of which 8 are surviving nonsolos
reads assigned: 858
start codons at 80, 225, 231, 236, 315, 383, 452
confident = true
now this is a cell
paired!

AGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAGAATACAGCTGGTACGGGCGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATCCTTGGACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.598 = CCTTCCCTCTCTGCTG-1

using 24 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.602 = CCTTCCCTCTGCGTAA-1

using 329 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 317]
surviving nonsolo ucounts = 1[317]
ids = [2]

====================================================================================

UMI info for barcode CCTTCCCTCTGCGTAA-1 contig 1 = GGGGAGGAAT...
umi CATGGCATCT = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.636 = CCTTCGAAGGTAGCTG-1

using 315 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 304]
surviving nonsolo ucounts = 1[304]
ids = [3]

====================================================================================

UMI info for barcode CCTTCGAAGGTAGCTG-1 contig 1 = GGGAATCAGT...
umi AAGATAGGGC = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.639 = CCTTCGAAGTAAGTAC-1

using 285 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 6, 8, 264]
surviving nonsolo ucounts = 1[264]
ids = [4]

====================================================================================

UMI info for barcode CCTTCGAAGTAAGTAC-1 contig 1 = AGCTTCAGCT...
umi GACCGCCAGC = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=539]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
431-539 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CAAWDDSLSVVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.643 = CCTTCGAAGTCGCCGT-1

using 226 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================

UMI info for barcode CCTTCGAAGTCGCCGT-1 contig 1 = TGATCAGGAC...
umi AAGACTGTTT = 217 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=468]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-468 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 31, 64, 100, 188, 350, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.644 = CCTTCGAAGTGAACAT-1

using 265 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^2, 4, 249]
surviving nonsolo ucounts = 1[249]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.652 = CCTTCGACAAAGGTGC-1

using 50 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 8[2^2, 3^2, 4, 6^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.653 = CCTTCGACAAAGTCAA-1

using 850 reads

====================================================================================

graph has 324 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[173, 280, 392]
surviving nonsolo ucounts = 3[173, 280, 392]
ids = [7, 5, 6]

====================================================================================

UMI info for barcode CCTTCGACAAAGTCAA-1 contig 1 = ACCCAAAAAC...
umi TCGTAGTAGG = 249 reads: +448 validated

UMI info for barcode CCTTCGACAAAGTCAA-1 contig 2 = TGGGAGGAAT...
umi TCTGCTTGTA = 340 reads: +388 validated
umi TTCGTTCGGT = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
421-445 ==> 0-24 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
451-502 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARVYPRISITIFGVVTAYNWFDPW at 396, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 54, 205, 252, 257, 274, 289, 318, 351
confident = true

TIG 2[bases=514]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-514 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 2 umis using 88 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 489
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.658 = CCTTCGACAAGCGCTC-1

using 238 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CCTTCGACAAGCGCTC-1 contig 1 = GGGGTCTCAG...
umi CCTATGGGAT = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-554 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.675 = CCTTCGACAGATGAGC-1

using 103 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 5, 8, 11, 72]
surviving nonsolo ucounts = 1[72]
ids = [7]

====================================================================================

UMI info for barcode CCTTCGACAGATGAGC-1 contig 1 = GGACACAGCA...
umi TTCAGCGTCG = 62 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=421]
9-360 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
359-397 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
397-421 ==> 0-24 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CLQYSSSPWTF at 336, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 9, 15, 84, 220
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.677 = CCTTCGACAGCGATCC-1

using 329 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================

UMI info for barcode CCTTCGACAGCGATCC-1 contig 1 = TGGGAGGAAT...
umi CTTTACAGCC = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.682 = CCTTCGACAGGATCGA-1

using 590 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 292, 293]
surviving nonsolo ucounts = 2[292, 293]
ids = [1, 3]

====================================================================================

UMI info for barcode CCTTCGACAGGATCGA-1 contig 1 = TCTGCTTCAG...
umi CCCACGTTCA = 287 reads: +394 validated

UMI info for barcode CCTTCGACAGGATCGA-1 contig 2 = AGGAGTCAGA...
umi ATCCCTTTAA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-521 ==> 0-78 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 49, 203, 206, 257, 356, 383, 407
confident = false

TIG 2[bases=499]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYALSF at 354, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 27, 33, 89, 102, 238, 241, 334, 373, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.685 = CCTTCGACAGGTTTCA-1

using 678 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 670]
surviving nonsolo ucounts = 1[670]
ids = [5]

====================================================================================

UMI info for barcode CCTTCGACAGGTTTCA-1 contig 1 = GGAGGAACTG...
umi GTTACATGGA = 673 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 98 reads
cdr3 = CQQRNNWPRALTF at 355, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 661
start codons at 34, 239, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.686 = CCTTCGACAGTAACGG-1

using 372 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 364]
surviving nonsolo ucounts = 1[364]
ids = [4]

====================================================================================

UMI info for barcode CCTTCGACAGTAACGG-1 contig 1 = GAAGAGCTGC...
umi GCCATGATCT = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-517 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.690 = CCTTCGACAGTGACAG-1

using 286 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 278]
surviving nonsolo ucounts = 1[278]
ids = [3]

====================================================================================

UMI info for barcode CCTTCGACAGTGACAG-1 contig 1 = GGGAGCATCA...
umi CTGTTAATAA = 271 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=569]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-569 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 64, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.691 = CCTTCGACAGTGAGTG-1

using 623 reads

====================================================================================

graph has 214 edges initially, 48 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[307, 312]
surviving nonsolo ucounts = 2[307, 312]
ids = [0, 2]

====================================================================================

UMI info for barcode CCTTCGACAGTGAGTG-1 contig 1 = ACCCAGTCAG...
umi ACATGCGTCA = 305 reads: +388 validated

UMI info for barcode CCTTCGACAGTGAGTG-1 contig 2 = AGTCTCAGTC...
umi AGTAACCGCA = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=542]
18-369 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
368-406 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
406-542 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYPLTF at 345, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 18, 24, 80, 93, 229, 448
confident = false

TIG 2[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTPYTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.695 = CCTTCGACATCCGCGA-1

using 60 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[2^2, 3^3, 5^2, 11, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.711 = CCTTCGAGTCACTTCC-1

using 926 reads

====================================================================================

graph has 1544 edges initially, 4 edges after simplification

total ucounts = 452
nonsolo ucounts = 207[2^98, 3^53, 4^24, 5^11, 6^5, 7^4, 8^5, 9, 10^2, 11^2, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.712 = CCTTCGAGTCAGAATA-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.722 = CCTTCGAGTCTCAACA-1

using 28891 reads

====================================================================================

graph has 8746 edges initially, 132 edges after simplification

total ucounts = 1028
nonsolo ucounts = 481[2^158, 3^92, 4^62, 5^33, 6^21, 7^12, 8^5, 9^4, 10^4, 11^2, 15, 16^2, 17, 33, 37, 53, 56, 66, 75, 76, 86, 96, 118, 121, 125, 129, 154^2, 157, 173, 188, 191, 194, 198, 200, 204, 207, 217, 222, 225, 230, 232, 233, 236, 237, 240, 241, 247, 255, 261, 265, 267, 272, 273, 278, 279, 281, 282^2, 284, 285, 289^2, 292, 296, 301, 308, 309, 314, 317, 318, 324, 330, 332, 345, 347^2, 357, 366, 371, 397, 422, 429, 431, 574, 625, 683, 697, 723, 726, 732, 762, 781, 785, 822, 942, 1029]
surviving nonsolo ucounts = 77[37, 53, 56, 86, 96, 118, 121, 125, 154^2, 157, 173, 188, 194, 198, 200, 204, 207, 217, 222, 225, 230, 232, 233, 236, 237, 240, 241, 247, 255, 261, 265, 267, 272, 273, 278, 279, 281, 282^2, 284, 285, 289^2, 292, 296, 301, 308, 309, 314, 317, 318, 324, 330, 332, 345, 347^2, 357, 366, 371, 397, 422, 429, 431, 574, 625, 683, 697, 723, 726, 732, 762, 781, 785, 822, 1029]
ids = [310, 669, 331, 752, 1000, 710, 577, 476, 911, 1009, ...]

====================================================================================

UMI info for barcode CCTTCGAGTCTCAACA-1 contig 1 = ACTTTCTGAG...
umi AGTATGGCCC = 346 reads: +430 validated
umi CATGTAACGC = 35 reads: +284 -6 +3 -1 +19 -1 +54 -1 +26 -35 non-validated
umi CATTTATCGC = 195 reads: +430 validated
umi CCACTCGTGC = 57 reads: +430 validated
umi CTGACAGCGC = 433 reads: +430 validated
umi GTACTCCGTT = 56 reads: +5 -3 +422 non-validated
umi GTTTACAATA = 116 reads: +430 validated
umi TACGCAGCAC = 85 reads: +324 -2X +1 -1X +2 -4X +36 -60 invalidated

UMI info for barcode CCTTCGAGTCTCAACA-1 contig 2 = TGGGGAGGAG...
umi AACATGTACC = 282 reads: +388 validated
umi ACAACAGCGC = 245 reads: +388 validated
umi ACATCGCGCC = 308 reads: +388 validated
umi ACCCGTATCA = 358 reads: +388 validated
umi ACTGCCCGGA = 329 reads: +388 validated
umi ACTTCCTTGG = 228 reads: +388 validated
umi ACTTGGGCTA = 291 reads: +388 validated
umi ATCACATCGC = 332 reads: +388 validated
umi ATCGATATCA = 258 reads: +388 validated
umi CACATTGTGC = 301 reads: +388 validated
umi CAGTGTATTC = 346 reads: +388 validated
umi CATAAGCCTC = 347 reads: +388 validated
umi CATCATTCCA = 234 reads: +388 validated
umi CATGTTTGCC = 428 reads: +388 validated
umi CATTCACACT = 317 reads: +388 validated
umi CCATAATCCG = 280 reads: +388 validated
umi CCCAATATTC = 580 reads: +388 validated
umi CCCGTATCTT = 305 reads: +388 validated
umi CGCGCTTGCC = 316 reads: +388 validated
umi CTACCTTATG = 803 reads: -212X +1 -5X +1 -7X +1 -2X +1 -2X +1 -1XX +154 invalidated
umi CTAGGTCCTC = 277 reads: +388 validated
umi CTATCCCCCG = 194 reads: +388 validated
umi CTCAGCTCGT = 125 reads: +381 -7 non-validated
umi CTCGGTCGCA = 293 reads: +388 validated
umi CTCTCTCTCG = 394 reads: +388 validated
umi GCAAAGGGTA = 120 reads: +388 validated
umi GCCCACTCCT = 696 reads: +388 validated
umi GCCGTCCGCG = 172 reads: +388 validated
umi GTATCAGTCA = 236 reads: +388 validated
umi GTGTAGTTAC = 304 reads: +388 validated
umi TAATACAGGC = 279 reads: +388 validated
umi TACCATATCA = 284 reads: +388 validated
umi TACCATGCAC = 200 reads: +388 validated
umi TACTGCTCAG = 354 reads: +388 validated
umi TCCGTCTTCC = 253 reads: +388 validated
umi TCCTAACCAA = 233 reads: +388 validated
umi TGATTGTGTG = 221 reads: +388 validated
umi TGCACCATTT = 207 reads: +388 validated
umi TGTAAACCGC = 370 reads: +388 validated
umi TGTCAGTTGC = 154 reads: +388 validated
umi TTCCTTTGGG = 271 reads: +388 validated
umi TTGGTTACGG = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=18)
388-409 ==> 0-21 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
426-465 ==> 7-46 on |54|IGHJ4|J-REGION| [len=46] (mis=2)
465-536 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 95 reads
cdr3 = CARADCSGGRCQEGKNYW at 380, score = 9 + 6
umis assigned: [153, 310, 323, 331, 508, 669, 710, 752]
of which 8 are surviving nonsolos
reads assigned: 1309
start codons at 35, 79, 409
confident = true

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 41 umis using 2085 reads
cdr3 = CQQSYSTPRTF at 359, score = 9 + 8
umis assigned: [19, 64, 77, 89, 120, 123, 124, 181, 193, 266] and 32 others
of which 42 are surviving nonsolos
reads assigned: 12572
start codons at 32, 38, 94, 107, 243, 462
confident = true

REJECT CONTIGS

TIG 1[bases=340]
0-184 ==> 301-485 on rc of segment before IGHD6-25 exon 1 [len=485] (mis=0)
221-269 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
269-340 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [777]
of which 1 are surviving nonsolos
reads assigned: 415
start codons at 
confident = false
did not find CDR3

TIG 2[bases=555]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=2)
2-33 ==> 5969-6000 on rc of segment after IGKV1OR2-118 exon 1 [len=6000] (mis=2)
10-74 ==> 5672-5736 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=8)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=8)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=8)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=7)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [13, 18, 22, 28, 231, 379, 414, 494, 573, 614] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3666
start codons at 27, 33, 89, 102, 238, 461
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTTCTGTGCGAGAGCGGATTGTAGTGGTGGTAGATGCCAGGAGGGGAAGAACTACTGGGGCCAGGGAATCCTGGTAACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCGAACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.728 = CCTTCGAGTGGTAACG-1

using 185 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 174]
surviving nonsolo ucounts = 1[174]
ids = [7]

====================================================================================

UMI info for barcode CCTTCGAGTGGTAACG-1 contig 1 = CCACATCCCT...
umi TGGCTCACCA = 167 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=472]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=16)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 19 reads
cdr3 = CARGVARHDPFDFW at 384, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 42, 193, 240, 245, 262, 339, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.745 = CCTTCGAGTTCTGGTA-1

using 714 reads

====================================================================================

graph has 282 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 295, 407]
surviving nonsolo ucounts = 2[295, 407]
ids = [3, 0]

====================================================================================

UMI info for barcode CCTTCGAGTTCTGGTA-1 contig 1 = GAGGAACTGC...
umi ACTCCAGATG = 362 reads: +382 validated

UMI info for barcode CCTTCGAGTTCTGGTA-1 contig 2 = ACCCAAAAAC...
umi CATGGCCACT = 288 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=506]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-506 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQRSNWPITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 33, 238, 241, 457
confident = false

TIG 2[bases=559]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=44)
432-481 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=8)
481-559 ==> 0-78 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CARDLFENAITSRWFDSW at 396, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 54, 141, 190, 274, 289, 360, 418, 434, 535
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.748 = CCTTCGAGTTTGACAC-1

using 499 reads

====================================================================================

graph has 434 edges initially, 10 edges after simplification

total ucounts = 164
nonsolo ucounts = 61[2^32, 3^13, 4^6, 5^2, 6^2, 7^3, 9, 10, 207]
surviving nonsolo ucounts = 1[207]
ids = [90]

====================================================================================

UMI info for barcode CCTTCGAGTTTGACAC-1 contig 1 = GAGAGCTCCG...
umi GCACTTACCG = 171 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=473]
0-19 ==> 45-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
19-372 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
402-446 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
446-473 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARGTEGYGGKPTHMDVW at 361, score = 8 + 7
umis assigned: [90]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 19, 175, 217, 222, 254, 283, 316, 403, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.759 = CCTTCGATCATTATCC-1

using 91 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[88]
surviving nonsolo ucounts = 1[88]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.766 = CCTTCGATCCGAAGAG-1

using 352 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 341]
surviving nonsolo ucounts = 1[341]
ids = [1]

====================================================================================

UMI info for barcode CCTTCGATCCGAAGAG-1 contig 1 = GAGGAGTCAG...
umi CCCAGTGATA = 315 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=505]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.776 = CCTTCGATCGCCTGAG-1

using 252 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 247]
surviving nonsolo ucounts = 1[247]
ids = [3]

====================================================================================

UMI info for barcode CCTTCGATCGCCTGAG-1 contig 1 = GGAGTCAGAC...
umi GTGGGTCAGT = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-497 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYNSYPWGF at 353, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.777 = CCTTCGATCGGATGGA-1

using 15 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.779 = CCTTCGATCGGTTCGG-1

using 317 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 312]
surviving nonsolo ucounts = 1[312]
ids = [4]

====================================================================================

UMI info for barcode CCTTCGATCGGTTCGG-1 contig 1 = ACTTTCTGAG...
umi TCAGCATGCC = 314 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=536]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
414-465 ==> 10-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
465-536 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CASRQRGGSSGTDYYMDVW at 377, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 14, 35, 79, 422
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.783 = CCTTCGATCGTTACAG-1

using 661 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 649]
surviving nonsolo ucounts = 1[649]
ids = [3]

====================================================================================

UMI info for barcode CCTTCGATCGTTACAG-1 contig 1 = GAGGAACTGC...
umi TCACAGACGC = 658 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 120 reads
cdr3 = CQQRSNWLFTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 646
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.787 = CCTTCGATCTACTCAT-1

using 264 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode CCTTCGATCTACTCAT-1 contig 1 = GGTAGCTCAG...
umi CTATGCAGGA = 258 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=555]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=10)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
427-555 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSNQAVF at 363, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 36, 99, 190, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.788 = CCTTCGATCTAGCACA-1

using 12751 reads

====================================================================================

graph has 5367 edges initially, 42 edges after simplification

total ucounts = 637
nonsolo ucounts = 300[2^97, 3^56, 4^37, 5^23, 6^18, 7^5, 8^4, 9^3, 11^2, 13^2, 14, 15, 24, 29, 53, 97, 102, 116, 136^2, 149, 155, 157, 164, 167, 171, 179, 180, 183, 194, 196, 204, 211, 219, 223, 227, 230, 232, 233, 234, 235, 238, 248, 249, 253, 260, 277, 280, 285, 289, 292, 301^2, 303, 305, 315, 319, 332, 336, 341, 346, 384, 420]
surviving nonsolo ucounts = 49[53, 97, 102, 116, 136^2, 149, 155, 157, 164, 167, 171, 179, 180, 183, 194, 196, 204, 211, 219, 223, 227, 230, 232, 233, 234, 235, 238, 248, 249, 253, 260, 277, 280, 285, 289, 292, 301^2, 303, 305, 315, 319, 332, 336, 341, 346, 384, 420]
ids = [235, 243, 428, 424, 420, 487, 591, 567, 86, 153, ...]

====================================================================================

UMI info for barcode CCTTCGATCTAGCACA-1 contig 1 = TGGGGAGGAG...
umi AAGCTTCCAG = 382 reads: +388 validated
umi ACCAACTTTG = 415 reads: +388 validated
umi ACTTAGTCAT = 299 reads: +388 validated
umi CCAAAACCTT = 252 reads: +388 validated
umi CCATGGTAGC = 300 reads: +388 validated
umi CGATAGGGAG = 322 reads: +388 validated
umi CTATACCGGA = 308 reads: +388 validated
umi GATCACGCTT = 181 reads: +388 validated
umi GATGGACATC = 291 reads: +388 validated
umi GCATACAGCA = 339 reads: +388 validated
umi GTATGGTCCT = 116 reads: +388 validated
umi TACAAATACT = 342 reads: +388 validated
umi TACCGTATCG = 293 reads: +388 validated
umi TACTTTCTCA = 321 reads: +388 validated
umi TTACGACAGC = 280 reads: +388 validated
umi TTGTATCGGA = 259 reads: +388 validated

UMI info for barcode CCTTCGATCTAGCACA-1 contig 2 = GGAGTCTCCC...
umi AACCGAGTGT = 179 reads: +378 -1X +3 -1X +2 -1 +1 -1X +27 invalidated
umi AATCCTTCGA = 211 reads: +415 validated
umi ACTCAAGCGG = 148 reads: +379 -36 non-validated
umi ATCCTTCACA = 329 reads: +415 validated
umi ATTGTTCGGT = 143 reads: +415 validated
umi CAACCATGCC = 159 reads: +415 validated
umi CATGTAAATA = 302 reads: +415 validated
umi CCGTGATGGA = 56 reads: +109 -1XX +271 -5 +1 -1 +27 invalidated
umi CCTGCGTGCG = 96 reads: +415 validated
umi CGACTGGCCT = 196 reads: +415 validated
umi CGTTGAACTC = 220 reads: +415 validated
umi CTTGGAGCAT = 220 reads: +415 validated
umi GACTGGTCCT = 334 reads: +415 validated
umi GATCGATGAT = 168 reads: +415 validated
umi GTACGTATGG = 124 reads: +415 validated
umi GTCCAGCCAT = 95 reads: +355 -1 +59 non-validated
umi TACTAGCATT = 259 reads: +415 validated
umi TATGGCCACA = 139 reads: +415 validated
umi TCCGGTCCTG = 231 reads: +415 validated
umi TGATCTCGCT = 220 reads: +415 validated
umi TGCCAGGCAT = 227 reads: +415 validated
umi TGCCCGGAGA = 247 reads: +415 validated
umi TGGGCGTTTT = 144 reads: +377 -1 +1 -36 non-validated
umi TTATACTCGT = 147 reads: +408 -4 +3 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 780 reads
cdr3 = CQQSYSTPITF at 359, score = 9 + 8
umis assigned: [23, 61, 92, 210, 220, 255, 290, 360, 365, 372] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4624
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=545]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
411-474 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 19 umis using 259 reads
cdr3 = CARNHAHYYGMDVW at 401, score = 8 + 7
umis assigned: [14, 39, 86, 133, 153, 160, 205, 235, 243, 252] and 14 others
of which 24 are surviving nonsolos
reads assigned: 4532
start codons at 59, 233, 257, 392, 431
confident = true

REJECT CONTIGS

TIG 1[bases=748]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-79 ==> 0-43 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-51 exon 2 [len=109] (mis=0)
188-498 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=1) [SHIFT!]
499-537 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
537-748 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [45, 88, 112, 158, 184, 214, 250, 442]
of which 8 are surviving nonsolos
reads assigned: 1765
start codons at 36, 122, 299, 350, 474
confident = false
did not find CDR3

TIG 2[bases=649]
0-52 ==> 5948-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
36-68 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
52-68 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
52-76 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
52-77 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
95-174 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
95-123 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
265-372 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
268-371 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
348-373 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
438-649 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [59]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 52, 203, 253, 378
confident = false
did not find CDR3
now this is a cell
paired!

AAGGCCTCGGACACCGCCATGTATTACTGTGCGAGAAATCACGCCCACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.792 = CCTTCGATCTCGCTTG-1

using 256 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 252]
surviving nonsolo ucounts = 1[252]
ids = [1]

====================================================================================

UMI info for barcode CCTTCGATCTCGCTTG-1 contig 1 = AGTCTGGGCC...
umi GGTGAGCACG = 238 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=518]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-518 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.797 = CCTTCGATCTGGAGCC-1

using 116 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 7, 102]
surviving nonsolo ucounts = 1[102]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.801 = CCTTCGATCTGTCTAT-1

using 225 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode CCTTCGATCTGTCTAT-1 contig 1 = GCTACAACAG...
umi CGGTTCTCGG = 206 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=514]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-514 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.810 = CCTTTCTAGAAGGACA-1

using 384 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^2, 3^2, 4, 11, 15, 17, 323]
surviving nonsolo ucounts = 1[323]
ids = [9]

====================================================================================

UMI info for barcode CCTTTCTAGAAGGACA-1 contig 1 = GAACTGCTCA...
umi GGGACGCCCT = 314 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 17-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
30-375 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=6)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-498 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQRSNGPMYSF at 351, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 30, 235, 238, 375, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.813 = CCTTTCTAGACAGGCT-1

using 920 reads

====================================================================================

graph has 260 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 17[2^6, 3^3, 6, 7, 8^2, 13, 220, 270, 366]
surviving nonsolo ucounts = 3[220, 270, 366]
ids = [14, 10, 12]

====================================================================================

UMI info for barcode CCTTTCTAGACAGGCT-1 contig 1 = GAGACTCAGT...
umi TACCTATTCG = 264 reads: +388 validated
umi TATGTAGTAT = 365 reads: +388 validated
umi TCTAAGGGAA = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 145 reads
cdr3 = CQQYNGQSRAF at 348, score = 8 + 7
umis assigned: [10, 12, 14]
of which 3 are surviving nonsolos
reads assigned: 843
start codons at 21, 27, 96, 232, 235, 328, 361, 451
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.819 = CCTTTCTAGAGTGACC-1

using 67 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 11[2, 3^2, 4^2, 5^2, 7^2, 8, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.820 = CCTTTCTAGATATGGT-1

using 102 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 30
nonsolo ucounts = 16[2^2, 3^4, 4^2, 5^2, 7^3, 9^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.825 = CCTTTCTAGCCAGAAC-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.826 = CCTTTCTAGCCCAATT-1

using 61 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^2, 3, 6, 7, 14, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.827 = CCTTTCTAGCCCTAAT-1

using 266 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode CCTTTCTAGCCCTAAT-1 contig 1 = GTGGGCTCAG...
umi GTCTCTTCTT = 252 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=513]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=8)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-513 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CYSTDSSGNRRVF at 350, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.830 = CCTTTCTAGCGATATA-1

using 32 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3^2, 4^2, 6, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.831 = CCTTTCTAGCTAAACA-1

using 44 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2, 5, 6, 9, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.839 = CCTTTCTAGGAGCGTT-1

using 490 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 6, 474]
surviving nonsolo ucounts = 2[6, 474]
ids = [6, 1]

====================================================================================

UMI info for barcode CCTTTCTAGGAGCGTT-1 contig 1 = GGAGGAGTCA...
umi CGGGAGCTGT = 479 reads: +388 validated
umi TTTGGGGTGT = 6 reads: -40 +198 -150 non-validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=16)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 88 reads
cdr3 = CLQDYNFPFTF at 356, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 477
start codons at 29, 35, 91, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.841 = CCTTTCTAGGCAAAGA-1

using 187 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2, 6, 8, 9^2, 12, 136]
surviving nonsolo ucounts = 1[136]
ids = [11]

====================================================================================

UMI info for barcode CCTTTCTAGGCAAAGA-1 contig 1 = GGATCACCCA...
umi TTAGTACGAT = 131 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=495]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 59, 257, 262, 279, 323, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.842 = CCTTTCTAGGCAGTCA-1

using 347 reads

====================================================================================

graph has 152 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[2, 3^2, 4, 6^3, 9, 10, 296]
surviving nonsolo ucounts = 1[296]
ids = [6]

====================================================================================

UMI info for barcode CCTTTCTAGGCAGTCA-1 contig 1 = GTCAGACCCA...
umi TAATGGGTTC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-483 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQGNSFPYTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.846 = CCTTTCTAGGGCACTA-1

using 307 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 13, 288]
surviving nonsolo ucounts = 1[288]
ids = [3]

====================================================================================

UMI info for barcode CCTTTCTAGGGCACTA-1 contig 1 = GGGAGGAACT...
umi CAACGGATGG = 284 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=35)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CEQYNFWPRTF at 356, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.848 = CCTTTCTAGGTACTCT-1

using 324 reads

====================================================================================

graph has 96 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2, 3, 4, 6, 7, 12, 16, 267]
surviving nonsolo ucounts = 1[267]
ids = [8]

====================================================================================

UMI info for barcode CCTTTCTAGGTACTCT-1 contig 1 = GCTGGGGTCT...
umi CTTCCAGTAT = 270 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=505]
41-363 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CCSFTVNTRSYVF at 365, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 41, 198, 242, 252, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.849 = CCTTTCTAGTACACCT-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.851 = CCTTTCTAGTAGATGT-1

using 49 reads

====================================================================================

graph has 50 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^2, 3, 5^2, 8, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.852 = CCTTTCTAGTAGCGGT-1

using 553 reads

====================================================================================

graph has 250 edges initially, 8 edges after simplification

total ucounts = 27
nonsolo ucounts = 16[2^4, 3, 4^2, 5^2, 6, 7, 8, 20, 23, 198, 251]
surviving nonsolo ucounts = 3[20, 198, 251]
ids = [10, 7, 0]

====================================================================================

UMI info for barcode CCTTTCTAGTAGCGGT-1 contig 1 = GAGGAATCAG...
umi AACGGCCCAG = 249 reads: +388 validated
umi CAGTGCTTCA = 19 reads: +6 -3 +191 -10 +139 -24 +15 non-validated

UMI info for barcode CCTTTCTAGTAGCGGT-1 contig 2 = GCTGTGGGTC...
umi ATATGTTCGG = 196 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 10]
of which 2 are surviving nonsolos
reads assigned: 262
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=508]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
420-508 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSADSSGTYVVF at 353, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 38, 99, 168, 186, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.854 = CCTTTCTAGTCCGGTC-1

using 63 reads

====================================================================================

graph has 62 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^5, 3, 6^2, 7, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.863 = CCTTTCTCAACTGCTA-1

using 257 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[3, 4, 5^2, 232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode CCTTTCTCAACTGCTA-1 contig 1 = GGCTGGGGTC...
umi ACTTCTCTTG = 226 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=526]
42-394 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-526 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CNSYTSSSTRVVF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.864 = CCTTTCTCAAGCGATG-1

using 885 reads

====================================================================================

graph has 332 edges initially, 34 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[3^2, 4, 26, 253, 589]
surviving nonsolo ucounts = 3[26, 253, 589]
ids = [1, 10, 8]

====================================================================================

UMI info for barcode CCTTTCTCAAGCGATG-1 contig 1 = CCTGGGTCAG...
umi TGTAGGTTTT = 253 reads: +385 validated

UMI info for barcode CCTTTCTCAAGCGATG-1 contig 2 = AGACCCAGTC...
umi ACTGTACAAG = 22 reads: +48 -1XX +12 -2XX +26 -1XX +3 -1XX +46 -1XX +6 -1XX +1 -1XX +5 -1XX +1 -5XX +2 -1XX +1 -1XX +5 -1XX +3 -1XX +25 -1XX +10 -3XX +2 -1XX +2 -1XX +2 -1XX +2 -2XX +51 -1X +3 -1 +2 -1X +8 -1 +11 -1X +20 -1X +1 -1X +4 -1X +4 -44 invalidated
umi GCCTATGATG = 590 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=573]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
399-437 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSLITF at 376, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 52, 260, 386, 479
confident = false

TIG 2[bases=541]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQQYNSYSSF at 347, score = 8 + 7
umis assigned: [1, 8]
of which 2 are surviving nonsolos
reads assigned: 604
start codons at 20, 26, 82, 95, 327, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.878 = CCTTTCTCACCAGGCT-1

using 53 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 10[2^4, 3, 5, 6^2, 7, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.880 = CCTTTCTCACCCTATC-1

using 351 reads

====================================================================================

graph has 110 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 31, 311]
surviving nonsolo ucounts = 2[31, 311]
ids = [1, 4]

====================================================================================

UMI info for barcode CCTTTCTCACCCTATC-1 contig 1 = TGGGGAGGAA...
umi CAAACGGCTT = 4 reads: -251 +6 -1X +11 -1X +23 -2X +7 -1X +4 -44 +6 -2X +8 -2X +5 -1XX +7 invalidated
umi GCCTTTAGGT = 289 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=516]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
419-516 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 290
start codons at 37, 242, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.884 = CCTTTCTCACGTGAGA-1

using 385 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 16, 361]
surviving nonsolo ucounts = 1[361]
ids = [3]

====================================================================================

UMI info for barcode CCTTTCTCACGTGAGA-1 contig 1 = GAATCAGTCC...
umi CATTATTCGT = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.889 = CCTTTCTCAGATAATG-1

using 191 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 184]
surviving nonsolo ucounts = 1[184]
ids = [4]

====================================================================================

UMI info for barcode CCTTTCTCAGATAATG-1 contig 1 = AGGAATCAGA...
umi TCAACACCCT = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-473 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.890 = CCTTTCTCAGATGGCA-1

using 2170 reads

====================================================================================

graph has 1784 edges initially, 20 edges after simplification

total ucounts = 530
nonsolo ucounts = 195[2^98, 3^37, 4^25, 5^6, 6^6, 7^4, 8^5, 9, 10^2, 11, 12, 13, 16, 18, 19, 190, 203, 257^2, 269]
surviving nonsolo ucounts = 6[19, 190, 203, 257^2, 269]
ids = [132, 265, 210, 2, 335, 262]

====================================================================================

UMI info for barcode CCTTTCTCAGATGGCA-1 contig 1 = GCTCTGCTTC...
umi ATTTAATGTG = 17 reads: -57 +2 -2 +1 -1 +292 -1 +5 -1 +4 -1 +21 non-validated
umi CGGGCTCCGT = 203 reads: +388 validated
umi GAAATCTTAG = 266 reads: +388 validated
umi GTAGCTGGGG = 261 reads: +388 validated

UMI info for barcode CCTTTCTCAGATGGCA-1 contig 2 = AGTGACTCCT...
umi AAACCACCCG = 253 reads: +433 validated
umi GAAGCCCGTT = 189 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=650]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
439-650 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 115 reads
cdr3 = CQSYDSSLREVF at 375, score = 8 + 8
umis assigned: [132, 210, 262, 335]
of which 4 are surviving nonsolos
reads assigned: 734
start codons at 51, 205, 208, 259, 358, 385
confident = true

TIG 2[bases=555]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=2)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
453-555 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 39 reads
cdr3 = CAHSTYLTGTNGPDAFDIW at 365, score = 7 + 8
umis assigned: [2, 265]
of which 2 are surviving nonsolos
reads assigned: 441
start codons at 20, 64, 243, 246, 326, 335, 405, 434, 471, 532
confident = true
now this is a cell
paired!

GCCACATATTACTGTGCACACAGTACCTACTTAACTGGAACGAACGGCCCCGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGAGAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.895 = CCTTTCTCAGCTGTAT-1

using 212 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 6, 193]
surviving nonsolo ucounts = 1[193]
ids = [10]

====================================================================================

UMI info for barcode CCTTTCTCAGCTGTAT-1 contig 1 = GCTGGGGTCA...
umi TTTGAGTCGA = 188 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=505]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-505 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CCSYAGSRTPNWVF at 365, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 41, 180, 242, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.927 = CCTTTCTGTAGGACAC-1

using 1355 reads

====================================================================================

graph has 1394 edges initially, 18 edges after simplification

total ucounts = 389
nonsolo ucounts = 155[2^58, 3^30, 4^17, 5^16, 6^10, 7^10, 8^4, 9, 10, 11^2, 13, 15, 16, 19, 233, 268]
surviving nonsolo ucounts = 2[233, 268]
ids = [165, 251]

====================================================================================

UMI info for barcode CCTTTCTGTAGGACAC-1 contig 1 = AGCTGTGGGC...
umi GTAAGGAATG = 266 reads: +385 validated

UMI info for barcode CCTTTCTGTAGGACAC-1 contig 2 = GGGGGACTCC...
umi CGGATACCCT = 192 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=566]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-566 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 44 reads
cdr3 = CNSRDSSGNHRVVF at 355, score = 8 + 8
umis assigned: [251]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 40, 159, 188, 239, 338, 551
confident = false

TIG 2[bases=475]
21-379 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=2)
384-405 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=1)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
448-475 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARIGAAYSSGWYFDYW at 366, score = 7 + 7
umis assigned: [165]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 21, 169, 177, 244, 327, 336, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.929 = CCTTTCTGTATCAGTC-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.947 = CCTTTCTGTCTACCTC-1

using 131 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 15[2, 3, 5, 6^2, 7, 8^2, 10^4, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.963 = CCTTTCTGTGTGGTTT-1

using 14205 reads

====================================================================================

graph has 7563 edges initially, 78 edges after simplification

total ucounts = 1481
nonsolo ucounts = 769[2^296, 3^166, 4^113, 5^55, 6^27, 7^21, 8^14, 9^14, 10^3, 11, 12^3, 14, 15, 16^2, 20^2, 21, 24, 29, 33, 53, 56, 65, 86, 113, 114, 138, 142, 143, 151, 157, 164, 172, 197, 198, 201, 205, 208, 211, 213, 220^3, 221, 234, 245, 249^2, 265, 274, 279, 284, 287, 288, 295, 298, 301, 308, 314, 315, 320, 349, 368, 372, 445, 636]
surviving nonsolo ucounts = 45[29, 33, 53, 86, 113, 114, 138, 142, 143, 151, 157, 172, 197, 198, 201, 205, 208, 211, 213, 220^3, 221, 234, 245, 249^2, 265, 274, 279, 284, 287, 288, 295, 298, 301, 308, 314, 315, 320, 349, 368, 372, 445, 636]
ids = [1319, 1405, 553, 1332, 187, 782, 325, 1342, 597, 1355, ...]

====================================================================================

UMI info for barcode CCTTTCTGTGTGGTTT-1 contig 1 = GGGGCATCAC...
umi AAGAAACCGA = 222 reads: +446 -20 non-validated
umi AATCAGGACC = 222 reads: +409 -1X +9 -1 +18 -28 invalidated
umi AGCAGACAGG = 169 reads: +466 validated
umi AGCCATTTTA = 111 reads: +414 -52 non-validated
umi ATGTCCTCAG = 235 reads: +425 -1 +6 -34 non-validated
umi CAGATACGGC = 215 reads: +428 -38 non-validated
umi CAGCCTGGGG = 307 reads: +466 validated
umi CCCTATAACC = 192 reads: +466 validated
umi CCTTTCTTCG = 53 reads: +390 -1 +1 -1 +13 -60 non-validated
umi CGGCGTCGGG = 144 reads: +436 -30 non-validated
umi GCAGACGTCA = 202 reads: +457 -9 non-validated
umi GGCTAAGGGG = 207 reads: +466 validated
umi TAAGGTTGTA = 351 reads: +466 validated
umi TCGTGGACCC = 158 reads: +412 -28 +26 non-validated
umi TGAGTTCTGT = 219 reads: +466 validated
umi TGTACGTGCA = 29 reads: +2 -4 +323 -1 +16 -49 +56 -15 non-validated
umi TGTTCGTCAT = 141 reads: +412 -13 +41 non-validated
umi TTAAGATCCT = 146 reads: +466 validated
umi TTCGACCGGC = 207 reads: +466 validated
umi TTCTAGGTAT = 37 reads: +21 -4X +300 -1 +6 -1 +3 -17 +56 -57 invalidated

UMI info for barcode CCTTTCTGTGTGGTTT-1 contig 2 = TGGGGGATCA...
umi AATCATATTC = 282 reads: +397 validated
umi AATCATGCGA = 317 reads: +397 validated
umi AATGTATCAA = 318 reads: +397 validated
umi ACACTTTATG = 288 reads: +397 validated
umi AGCCTCTTCG = 209 reads: +397 validated
umi ATCTGTAGTA = 247 reads: +397 validated
umi ATTCTGATCG = 140 reads: +387 -10 non-validated
umi CCAAGAGGCC = 264 reads: +397 validated
umi CCTGTCTTTT = 294 reads: +397 validated
umi CGCGGAGATG = 439 reads: +397 validated
umi CGCGGCTCCG = 367 reads: -267 +130 non-validated
umi CGGTCGCGGA = 373 reads: +397 validated
umi CTCCGCCATG = 249 reads: +397 validated
umi CTTACGTGGA = 199 reads: +397 validated
umi GAAAAAACTC = 278 reads: +397 validated
umi GAGTGTGGGT = 112 reads: +397 validated
umi GGTTGTGGTT = 643 reads: +58 -1XX +4 -1XX +3 -1XX +1 -1XX +1 -3XX +1 -1XX +1 -1XX +1 -211XX +1 -1XX +2 -8XX +1 -3XX +1 -7XX +83 invalidated
umi GTCCTGGGAG = 209 reads: +397 validated
umi TACGCGTGCA = 295 reads: +397 validated
umi TATAGATCGG = 292 reads: +397 validated
umi TATAGATTCT = 318 reads: +397 validated
umi TCTGTACCGT = 308 reads: +397 validated
umi TGCTGGCCAG = 246 reads: +397 validated
umi TGTGCAGTAC = 87 reads: +397 validated
umi TTCCCTACAA = 286 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=599]
62-415 ==> 0-353 on |86|IGHV1-69-2|L-REGION+V-REGION| [len=353] (mis=1)
465-528 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
528-599 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 93 reads
cdr3 = CATGVFSHSSPTAAAGVSDIVYYYYYGMDVW at 404, score = 9 + 7
umis assigned: [45, 73, 182, 187, 304, 387, 391, 504, 553, 597] and 10 others
of which 20 are surviving nonsolos
reads assigned: 3517
start codons at 62, 218, 260, 282, 359, 485
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 868 reads
cdr3 = CMQALQTGLTF at 371, score = 9 + 9
umis assigned: [75, 76, 83, 97, 188, 278, 325, 461, 542, 578] and 15 others
of which 25 are surviving nonsolos
reads assigned: 6953
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true
now this is a cell
paired!

TCTTCCCCCACAGCAGCAGCTGGTGTATCTGACATAGTTTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACCGGCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.971 = CCTTTCTGTTCACCTC-1

using 211 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2^2, 3^2, 4^2, 7, 184]
surviving nonsolo ucounts = 1[184]
ids = [9]

====================================================================================

UMI info for barcode CCTTTCTGTTCACCTC-1 contig 1 = GGGTAGAGAA...
umi TGATCAATTT = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-35 ==> 79-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
35-388 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-545 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CASWDDSLRGRVF at 356, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 35, 189, 339, 364, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.974 = CCTTTCTGTTCCACGG-1

using 46 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.987 = CCTTTCTTCAACACGT-1

using 942 reads

====================================================================================

graph has 260 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 4, 253, 335, 340]
surviving nonsolo ucounts = 3[253, 335, 340]
ids = [7, 5, 6]

====================================================================================

UMI info for barcode CCTTTCTTCAACACGT-1 contig 1 = ACCCAAAAAC...
umi CTCTTTATCG = 249 reads: +436 validated

UMI info for barcode CCTTTCTTCAACACGT-1 contig 2 = AGGAGTCAGA...
umi CCGCGAGTGT = 336 reads: +388 validated
umi CCTGTACGAT = 342 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-529 ==> 0-39 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 54, 252, 257, 274, 318, 351
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 102 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 669
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true
now this is a cell
paired!

TATTATTGTGCGAGAGATAAACACTTCCGCGACCCGTATTATCATTATAGTGGCGCGCTTGACCATTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATCCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAGAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1007 = CCTTTCTTCCAGTATG-1

using 14 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1013 = CCTTTCTTCCGCTGTT-1

using 196 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [0]

====================================================================================

UMI info for barcode CCTTTCTTCCGCTGTT-1 contig 1 = GAGTGCTTTC...
umi AAGTCCTGAT = 195 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=545]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-545 ==> 0-91 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1030 = CCTTTCTTCGGTCCGA-1

using 1557 reads

====================================================================================

graph has 1952 edges initially, 32 edges after simplification

total ucounts = 631
nonsolo ucounts = 324[2^127, 3^73, 4^31, 5^29, 6^21, 7^10, 8^11, 9^13, 10^3, 11^4, 12, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1031 = CCTTTCTTCGTAGGAG-1

using 308 reads

====================================================================================

graph has 119 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 8, 293]
surviving nonsolo ucounts = 1[293]
ids = [2]

====================================================================================

UMI info for barcode CCTTTCTTCGTAGGAG-1 contig 1 = AGTCTGGGCC...
umi GTAGTAGCAG = 288 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=622]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
425-622 ==> 0-197 on |307|IGLC3|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 54 reads
cdr3 = CQVWDSSSDHPGVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1041 = CCTTTCTTCTATGTGG-1

using 1256 reads

====================================================================================

graph has 350 edges initially, 8 edges after simplification

total ucounts = 19
nonsolo ucounts = 9[2^3, 3, 4, 6, 260, 433, 534]
surviving nonsolo ucounts = 3[6, 260, 534]
ids = [4, 18, 9]

====================================================================================

UMI info for barcode CCTTTCTTCTATGTGG-1 contig 1 = GGGAGTCTCA...
umi CCCTTCCGTC = 538 reads: +388 validated
umi TGTTCGACTA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 134 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [9, 18]
of which 2 are surviving nonsolos
reads assigned: 786
start codons at 23, 29, 85, 98, 234, 453
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1062 = CGAACATAGAAGGTTT-1

using 25 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 18]
surviving nonsolo ucounts = 1[18]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1066 = CGAACATAGACTTGAA-1

using 280 reads

====================================================================================

graph has 81 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [4]

====================================================================================

UMI info for barcode CGAACATAGACTTGAA-1 contig 1 = GGAAGCAGCA...
umi TTAACGCGAG = 267 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=563]
0-27 ==> 224-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
27-372 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
371-409 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
409-563 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQVWDSSSDHVVF at 342, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 27, 88, 226, 229, 325, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1070 = CGAACATAGATAGTCA-1

using 107 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 99]
surviving nonsolo ucounts = 1[99]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=437]
2-54 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
29-360 ==> 0-331 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
362-390 ==> 9-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
390-437 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 29, 234, 237, 432
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1084 = CGAACATAGGAATTAC-1

using 68 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[13, 50]
surviving nonsolo ucounts = 1[50]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1089 = CGAACATAGGGCACTA-1

using 5205 reads

====================================================================================

graph has 3918 edges initially, 80 edges after simplification

total ucounts = 529
nonsolo ucounts = 390[2^52, 3^51, 4^48, 5^40, 6^28, 7^29, 8^27, 9^18, 10^19, 11^21, 12^11, 13^8, 14^10, 15^8, 16^4, 17^3, 18, 19, 21, 33, 174, 210, 221, 225, 226, 265, 271, 283, 670]
surviving nonsolo ucounts = 9[174, 210, 221, 225, 226, 265, 271, 283, 670]
ids = [62, 221, 77, 491, 126, 69, 107, 182, 97]

====================================================================================

UMI info for barcode CGAACATAGGGCACTA-1 contig 1 = CGCCCCCCCC...
umi AGATCCACGC = 173 reads: +388 validated
umi AGCCCGTATC = 264 reads: +388 validated
umi ATGATTCGTA = 265 reads: +388 validated
umi CAACCTTTTG = 225 reads: +388 validated
umi CCAGCTTGTA = 280 reads: +388 validated
umi CGGAGATTGA = 205 reads: +388 validated
umi TGTTCTACGT = 237 reads: +154 -2XX +1 -1XX +1 -1 +228 invalidated

GOOD CONTIGS

TIG 1[bases=636]
37-388 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 231 reads
cdr3 = CSSYTSSSTVRF at 361, score = 6 + 8
umis assigned: [62, 69, 107, 126, 182, 221, 491]
of which 7 are surviving nonsolos
reads assigned: 1615
start codons at 37, 194, 245, 248
confident = true

REJECT CONTIGS

TIG 1[bases=467]
5-224 ==> 923-1142 on rc of segment before IGHD3-22 exon 1 [len=1142] (mis=1)
264-307 ==> 20-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
307-467 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
umis assigned: [97]
of which 1 are surviving nonsolos
reads assigned: 659
start codons at 75, 134, 264, 361
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1094 = CGAACATAGTACGACG-1

using 1135 reads

====================================================================================

graph has 1489 edges initially, 30 edges after simplification

total ucounts = 493
nonsolo ucounts = 215[2^87, 3^35, 4^30, 5^28, 6^7, 7^7, 8^5, 9^6, 10^4, 11^3, 12, 21, 27]
surviving nonsolo ucounts = 1[27]
ids = [16]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1098 = CGAACATAGTGGCACA-1

using 19943 reads

====================================================================================

graph has 5751 edges initially, 28 edges after simplification

total ucounts = 582
nonsolo ucounts = 267[2^76, 3^47, 4^28, 5^18, 6^8, 7^3, 8^3, 10^2, 11, 12, 13^3, 14, 17, 22, 49, 94, 100, 101, 102, 128, 131, 133, 136, 142^2, 147, 156, 165, 177, 179, 186, 192, 197, 204, 207, 214^2, 216, 229^2, 231, 235, 237, 238, 241, 253, 255, 258, 260, 262^2, 267, 271, 274, 276^2, 277, 279, 280, 282, 283, 285, 286^2, 287, 291, 294, 295^2, 296, 304, 306, 308, 314, 321, 322, 329, 334, 337^2, 344, 362, 366, 376, 437, 474, 509, 543]
surviving nonsolo ucounts = 69[49, 94, 128, 131, 136, 142^2, 147, 165, 177, 179, 186, 192, 197, 204, 207, 214^2, 216, 229^2, 231, 235, 237, 238, 241, 253, 255, 258, 260, 262^2, 267, 271, 274, 276^2, 277, 279, 280, 282, 283, 285, 286^2, 287, 291, 294, 295^2, 296, 304, 306, 308, 314, 321, 322, 329, 334, 337^2, 344, 362, 366, 376, 437, 474, 509, 543]
ids = [305, 233, 518, 143, 377, 351, 471, 371, 329, 82, ...]

====================================================================================

UMI info for barcode CGAACATAGTGGCACA-1 contig 1 = TGGGGAGGAG...
umi AACTATTTTT = 482 reads: -129X +256 invalidated
umi AATCATCGTC = 278 reads: +385 validated
umi ACAAAATTAC = 240 reads: -2X +129 -1XX +253 invalidated
umi ACCAAAGGCC = 242 reads: +385 validated
umi ACCGGTCCTC = 202 reads: +385 validated
umi ACTCTCGGCA = 284 reads: +385 validated
umi ACTTCGGGTC = 276 reads: +385 validated
umi ACTTTGTCGG = 267 reads: +385 validated
umi AGCATATCTT = 358 reads: +385 validated
umi AGCCGCCGCT = 177 reads: +385 validated
umi AGTCAATCCC = 334 reads: +385 validated
umi ATCATCGGAC = 332 reads: +385 validated
umi ATCCTACCGT = 285 reads: +385 validated
umi CAAACTCACC = 254 reads: +385 validated
umi CAAGCACAAC = 314 reads: +385 validated
umi CAATGCAATT = 131 reads: +385 validated
umi CACCCTCCGG = 346 reads: +385 validated
umi CAGCTATATG = 287 reads: +385 validated
umi CATAACCGGG = 286 reads: +385 validated
umi CCAATGTCAG = 234 reads: +385 validated
umi CCAGGGGGGC = 292 reads: +385 validated
umi CCATGGAGCC = 279 reads: +385 validated
umi CCATTGACAG = 282 reads: +385 validated
umi CCGCCGGTCG = 368 reads: +385 validated
umi CGATAGCTTC = 217 reads: +385 validated
umi CGCCCGAATG = 304 reads: +385 validated
umi CTAGGTAGAC = 315 reads: +385 validated
umi CTGGGGATTT = 208 reads: +385 validated
umi GAATGGCCCC = 277 reads: +385 validated
umi GACACAACTG = 261 reads: +385 validated
umi GAGCATATTA = 349 reads: +356 -1XX +1 -1XX +2 -1 +23 invalidated
umi GAGCGCTGGC = 517 reads: -93 +1 -4XX +287 invalidated
umi GAGCTTTAAC = 216 reads: +380 -1XX +4 invalidated
umi GAGTCTTCCT = 226 reads: +219 -1XX +165 invalidated
umi GCAACCATCT = 271 reads: +385 validated
umi GCAATGTCTA = 257 reads: +385 validated
umi GCTAGTGTTA = 384 reads: +385 validated
umi GCTTGCATTC = 325 reads: +385 validated
umi GCTTGGAGTT = 292 reads: +385 validated
umi GGGCGCAGTA = 164 reads: +385 validated
umi GGTGTACGGG = 195 reads: +385 validated
umi GTATCGGAGC = 141 reads: +385 validated
umi GTCACATACC = 542 reads: -98X +287 invalidated
umi GTCTTTACAC = 294 reads: +385 validated
umi GTTAAACTGC = 149 reads: +385 validated
umi GTTACTTGGT = 337 reads: +385 validated
umi GTTGCTTCTT = 136 reads: +385 validated
umi TAATTTGAGC = 264 reads: +385 validated
umi TAGTCGGGGT = 319 reads: +385 validated
umi TATGCCCTGC = 277 reads: +385 validated
umi TATGGCAGCT = 187 reads: +385 validated
umi TCCCAGAGAG = 294 reads: +385 validated
umi TCGCATATAA = 233 reads: +385 validated
umi TCTACATTTA = 285 reads: +385 validated
umi TCTATATCTA = 263 reads: +385 validated
umi TCTGCGTGGT = 143 reads: +385 validated
umi TCTTCACGTT = 241 reads: +385 validated
umi TCTTTATGTA = 202 reads: +385 validated
umi TGCTCGCCGT = 237 reads: +385 validated
umi TGTACCTCAG = 233 reads: +385 validated
umi TGTTTTCGCA = 125 reads: +385 validated
umi TTCTATAGAT = 280 reads: +385 validated
umi TTTAAAGCTA = 311 reads: +385 validated
umi TTTCAGCCAG = 293 reads: +385 validated
umi TTTTGCAATG = 183 reads: +385 validated

UMI info for barcode CGAACATAGTGGCACA-1 contig 2 = GGGATTCCCA...
umi CCCACGAACT = 256 reads: +436 validated
umi CTCATATGCG = 97 reads: +410 -2 +7 -17 non-validated
umi GCGGCATAGT = 47 reads: +366 -70 non-validated

GOOD CONTIGS

TIG 1[bases=553]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 64 umis using 3061 reads
cdr3 = CQQSYSTYTF at 359, score = 9 + 8
umis assigned: [22, 34, 41, 54, 60, 70, 72, 74, 81, 82] and 55 others
of which 65 are surviving nonsolos
reads assigned: 17257
start codons at 32, 38, 94, 107, 243, 459
confident = true

TIG 2[bases=561]
0-54 ==> 26-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
54-413 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=1)
444-490 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
490-561 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CTTVGEGLWFGDLKADDYW at 402, score = 8 + 7
umis assigned: [190, 233, 305]
of which 3 are surviving nonsolos
reads assigned: 390
start codons at 54, 210, 277, 334, 363, 425
confident = true
now this is a cell
paired!

GCCGTGTATTACTGTACCACAGTCGGAGAGGGACTATGGTTCGGGGACCTAAAGGCCGACGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1101 = CGAACATAGTGTACTC-1

using 915 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 5^2, 6, 890]
surviving nonsolo ucounts = 1[890]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=405]
0-159 ==> 194-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=4)
156-194 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
194-405 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGTWDSGLSAVVF at 127, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 881
start codons at 11, 135
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1114 = CGAACATCACAGACTT-1

using 256 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 110, 144]
surviving nonsolo ucounts = 2[110, 144]
ids = [0, 1]

====================================================================================

UMI info for barcode CGAACATCACAGACTT-1 contig 1 = GGGGTCTCAG...
umi CCCCATACAC = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=3)
38-382 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
426-459 ==> 0-33 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CSSYISSTTLGF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 38, 246, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1118 = CGAACATCACGACTCG-1

using 192 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 186]
surviving nonsolo ucounts = 1[186]
ids = [5]

====================================================================================

UMI info for barcode CGAACATCACGACTCG-1 contig 1 = GGAGGAGTCA...
umi TGTAAATACC = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-494 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1121 = CGAACATCACTGTGTA-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1122 = CGAACATCAGAGCCAA-1

using 267 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 257]
surviving nonsolo ucounts = 1[257]
ids = [5]

====================================================================================

UMI info for barcode CGAACATCAGAGCCAA-1 contig 1 = AGTCCCAACC...
umi GTTATTTCAC = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-479 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDDLPITF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 20, 26, 82, 95, 357, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1123 = CGAACATCAGATCGGA-1

using 238 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 6, 225]
surviving nonsolo ucounts = 2[4, 225]
ids = [1, 4]

====================================================================================

UMI info for barcode CGAACATCAGATCGGA-1 contig 1 = AGGAATCAGT...
umi CAAGGGGCGC = 4 reads: -388 non-validated
umi CGCATCCTTT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 225
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1142 = CGAACATCATTGGTAC-1

using 269 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[11, 255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================

UMI info for barcode CGAACATCATTGGTAC-1 contig 1 = AGGAGTCAGA...
umi ACAACGGGAG = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-476 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 27, 33, 89, 102, 241, 259, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1147 = CGAACATGTACCGCTG-1

using 634 reads

====================================================================================

graph has 202 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[131, 219, 279]
surviving nonsolo ucounts = 3[131, 219, 279]
ids = [7, 4, 3]

====================================================================================

UMI info for barcode CGAACATGTACCGCTG-1 contig 1 = GAGGAGTCAG...
umi CAGATGTGCA = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-515 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTPRTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 28, 34, 90, 103, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=481]
9-341 ==> 19-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
340-378 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
378-481 ==> 0-103 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTWVF at 314, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 147, 191, 198, 201
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1148 = CGAACATGTACCGTAT-1

using 43414 reads

====================================================================================

graph has 15617 edges initially, 144 edges after simplification

total ucounts = 2875
nonsolo ucounts = 1360[2^536, 3^290, 4^155, 5^87, 6^48, 7^24, 8^26, 9^17, 10^2, 11^7, 12^2, 13, 14^4, 15, 16, 18^2, 23, 24^2, 26^2, 40, 49, 51, 60, 62^2, 76, 100^2, 119, 126, 130^2, 132, 137^2, 140, 143, 144, 148^2, 152, 157, 168, 177, 180, 181, 185, 186, 190, 192, 193, 195, 196, 198, 200, 201, 204^2, 206, 207, 209^2, 213, 214^2, 217, 218, 219, 221, 223, 224^2, 227, 231^2, 234^2, 235, 238^2, 239, 240, 245^3, 246^4, 247, 250^4, 258^2, 259^2, 260, 263, 264, 269, 270, 272, 273^4, 274, 275, 276, 277^2, 280^2, 282^2, 284, 287, 288, 290^2, 292, 294^2, 296, 298^2, 300, 301^2, 302^3, 303^2, 304, 305, 306^2, 310^3, 314, 316, 317^2, 318, 321, 328, 331, 332^3, 337^3, 338^3, 341, 348, 349, 352, 359, 360, 365, 390, 399, 448, 482]
surviving nonsolo ucounts = 145[24^2, 51, 100, 130^2, 132, 137^2, 140, 143, 144, 148^2, 152, 157, 168, 177, 180, 181, 185, 186, 190, 192, 193, 195, 196, 198, 200, 201, 204^2, 206, 207, 209^2, 213, 214^2, 217, 218, 219, 221, 223, 224^2, 227, 231^2, 234^2, 235, 238^2, 239, 240, 245^3, 246^4, 247, 250^4, 258^2, 259^2, 260, 263, 264, 269, 270, 272, 273^4, 274, 275, 276, 277^2, 280^2, 282^2, 284, 287, 288, 290^2, 292, 294^2, 296, 298^2, 300, 301^2, 302^3, 303^2, 304, 305, 306^2, 310^3, 314, 316, 317^2, 318, 321, 328, 331, 332^3, 337^3, 338^3, 341, 348, 349, 352, 359, 360, 365, 390, 399, 448, 482]
ids = [1190, 1647, 1697, 6, 2845, 2875, 1488, 2158, 2358, 731, ...]

====================================================================================

UMI info for barcode CGAACATGTACCGTAT-1 contig 1 = TTGGGGAGGA...
umi AAAACCTCGG = 248 reads: +388 validated
umi AAATACCCGT = 276 reads: +388 validated
umi AAATCCCTGT = 280 reads: +388 validated
umi AAATCTTTGG = 248 reads: +388 validated
umi AAATGATGTG = 301 reads: +388 validated
umi AACCTTTAGA = 176 reads: +388 validated
umi AACGATCTAT = 178 reads: +388 validated
umi AACGCACCCC = 303 reads: +388 validated
umi AAGGGGTCGC = 299 reads: +388 validated
umi AATCCTTCTC = 193 reads: +388 validated
umi AATCTATCAT = 285 reads: +388 validated
umi ACAATATTCC = 336 reads: +388 validated
umi ACAATTTCCT = 253 reads: +388 validated
umi ACAGATGCCT = 272 reads: +388 validated
umi ACAGCTTCTC = 233 reads: +388 validated
umi ACCGCAGCCG = 208 reads: +388 validated
umi ACCTGAAGCG = 312 reads: +388 validated
umi ACCTGAAGGC = 240 reads: +388 validated
umi ACGATACGCA = 276 reads: +388 validated
umi ACGATCCATC = 357 reads: +388 validated
umi ACGCAACAGT = 198 reads: +388 validated
umi ACGCTAACTG = 186 reads: +388 validated
umi ACTACTCGCC = 324 reads: +388 validated
umi ACTTCACCGT = 278 reads: +388 validated
umi ACTTCTGTCA = 287 reads: +388 validated
umi AGAATTGCGA = 201 reads: +388 validated
umi AGATATCGCC = 216 reads: +388 validated
umi AGGGACGTTT = 274 reads: +388 validated
umi AGGGTAAGGC = 205 reads: +388 validated
umi ATAGTGCCGG = 289 reads: +388 validated
umi ATCCTAATCC = 166 reads: +388 validated
umi ATCTAGACCT = 321 reads: +388 validated
umi ATCTTCAGCG = 199 reads: +51 -1 +336 non-validated
umi ATGCCATTCC = 223 reads: +388 validated
umi ATGTTAGTAG = 182 reads: +388 validated
umi ATTCAATATA = 143 reads: +388 validated
umi CAAGTGTCCA = 276 reads: +388 validated
umi CAATTGATCA = 311 reads: +388 validated
umi CACGTTCTGG = 356 reads: +388 validated
umi CAGACAGCAC = 282 reads: +388 validated
umi CAGATCTGGT = 290 reads: +388 validated
umi CATAACTGGC = 240 reads: +388 validated
umi CATATGCCTA = 262 reads: +388 validated
umi CATCAATGGC = 248 reads: +388 validated
umi CATGCAGTCC = 259 reads: +388 validated
umi CCGACTCAAT = 188 reads: +388 validated
umi CCTCGTGAGT = 245 reads: +388 validated
umi CGAGTTAGGG = 267 reads: +388 validated
umi CGATGCTCAG = 253 reads: +388 validated
umi CGCAAACGTC = 364 reads: +388 validated
umi CGCCAACTGC = 251 reads: +388 validated
umi CGCCTTTGCG = 335 reads: +388 validated
umi CGCTCGTCCG = 301 reads: +388 validated
umi CGGCAGTCTT = 249 reads: +388 validated
umi CGTATGTATT = 283 reads: +388 validated
umi CGTGTTTACG = 243 reads: +388 validated
umi CTAATGCACT = 201 reads: +388 validated
umi CTAGATCCAC = 248 reads: +388 validated
umi CTAGCTCTTC = 223 reads: +388 validated
umi CTCCAGACTC = 300 reads: +388 validated
umi CTCTCCCGTG = 323 reads: +388 validated
umi CTTATCTCCT = 329 reads: +388 validated
umi CTTTACACTT = 300 reads: +388 validated
umi GAACGCGTGG = 302 reads: +388 validated
umi GACACCTGCC = 296 reads: +388 validated
umi GACCGAACTA = 345 reads: +388 validated
umi GACGCTTTTT = 294 reads: +388 validated
umi GAGGTTTTCG = 306 reads: +388 validated
umi GAGTGGGAGT = 237 reads: +388 validated
umi GAGTTTACAG = 343 reads: +388 validated
umi GATACTGCAG = 273 reads: +388 validated
umi GCCGTCACGC = 279 reads: +388 validated
umi GCTGCTCACC = 271 reads: +388 validated
umi GGACTCTGGC = 334 reads: +388 validated
umi GGATTGCGCA = 195 reads: +388 validated
umi GGGAGTGCAA = 314 reads: +388 validated
umi GGGTGTGAGC = 227 reads: +388 validated
umi GTGGAATCTA = 335 reads: +388 validated
umi GTGTAAACCT = 205 reads: +388 validated
umi GTTCAATGCT = 323 reads: +388 validated
umi GTTGTTTGCT = 207 reads: +388 validated
umi TAACCAACAT = 214 reads: +388 validated
umi TACATACAAG = 329 reads: +388 validated
umi TACCGTAACC = 302 reads: +388 validated
umi TACCTACACC = 299 reads: +388 validated
umi TAGAATTTAC = 400 reads: +388 validated
umi TAGTGTCCTG = 310 reads: +388 validated
umi TATGGATTAC = 315 reads: +388 validated
umi TATTAGTGCC = 130 reads: +388 validated
umi TATTTCAACT = 234 reads: +388 validated
umi TCAAACGGGC = 304 reads: +388 validated
umi TCACACTTCT = 272 reads: +388 validated
umi TCACCATAGG = 278 reads: +388 validated
umi TCATGATGTG = 226 reads: +388 validated
umi TCCCGCCTTT = 366 reads: +388 validated
umi TCCTTCTACG = 213 reads: +388 validated
umi TCGATTGATG = 188 reads: +388 validated
umi TCTAGAAGAA = 149 reads: +388 validated
umi TCTCGGATTC = 259 reads: +388 validated
umi TCTTCAGTCG = 240 reads: +388 validated
umi TCTTCCACCT = 138 reads: +388 validated
umi TGAACGTGGA = 238 reads: +388 validated
umi TGATGAGGCA = 308 reads: +388 validated
umi TGCGCGCCTC = 252 reads: +388 validated
umi TGCTTTTCTT = 278 reads: +388 validated
umi TGGAGGCTTC = 293 reads: +388 validated
umi TGTCACAAGG = 281 reads: +388 validated
umi TGTCACATTG = 242 reads: +388 validated
umi TGTCCTTGCA = 301 reads: +388 validated
umi TGTGAACAAT = 489 reads: +388 validated
umi TGTTTTTTAG = 342 reads: +388 validated
umi TTAATGCGGG = 352 reads: +388 validated
umi TTCGACTGCT = 311 reads: +388 validated
umi TTCTAGCTCG = 266 reads: +388 validated
umi TTCTTGTGCA = 149 reads: +388 validated
umi TTGATCCCTG = 213 reads: +388 validated
umi TTTAAGATTG = 334 reads: +388 validated
umi TTTCCGTTTA = 350 reads: +388 validated
umi TTTGCAAACA = 195 reads: +388 validated
umi TTTGGTGTAG = 259 reads: +388 validated
umi TTTTTGTATG = 226 reads: +388 validated
umi TTTTTTTTGA = 129 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 122 umis using 5192 reads
cdr3 = CQQSYTTLLTF at 360, score = 9 + 9
umis assigned: [4, 44, 50, 53, 55, 91, 92, 93, 142, 192] and 112 others
of which 122 are surviving nonsolos
reads assigned: 32000
start codons at 33, 39, 95, 108, 244, 463
confident = true

REJECT CONTIGS

TIG 1[bases=797]
274-619 ==> 0-345 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=11)
618-656 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
656-797 ==> 0-141 on rc of segment before IGKJ1 exon 1 [len=322] (mis=3)
cdr3 = CLQHDNFPWTF at 595, score = 7 + 8
umis assigned: [247, 348, 731, 1016]
of which 4 are surviving nonsolos
reads assigned: 684
start codons at 73, 79, 127, 141, 223, 232, 236, 364, 422, 425, 430, 533, 578, 605, 714
confident = false
not full
VJ delta = 14
not full
note long unannotated region

TIG 2[bases=580]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-149 ==> 0-132 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
149-333 ==> 187-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9) [SHIFT!]
352-398 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
398-580 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
cdr3 = CARAHGDYYTLLDWW at 322, score = 8 + 7
umis assigned: [6, 760, 771, 1128, 1190, 1488, 1647, 1697, 1978, 2845]
of which 10 are surviving nonsolos
reads assigned: 1568
start codons at 17, 38, 82, 313
confident = false
frameshifted full length stopped transcript of length 580
VJ delta = 61
delta too large
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1152 = CGAACATGTCAATACC-1

using 83 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 75]
surviving nonsolo ucounts = 1[75]
ids = [2]

====================================================================================

UMI info for barcode CGAACATGTCAATACC-1 contig 1 = GGAGTCAGTC...
umi CGCTCCAGTC = 70 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=428]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
junction support: 1 umis using 14 reads
cdr3 = CQQYDNLPRSF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 26, 32, 88, 101, 240, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1156 = CGAACATGTCCCTACT-1

using 173 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1158 = CGAACATGTCGCTTTC-1

using 138 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1159 = CGAACATGTCTCACCT-1

using 321 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[321]
surviving nonsolo ucounts = 1[321]
ids = [0]

====================================================================================

UMI info for barcode CGAACATGTCTCACCT-1 contig 1 = GTCAGTCTCA...
umi TTCTTATATG = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1168 = CGAACATGTGGTCTCG-1

using 303 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [3]

====================================================================================

UMI info for barcode CGAACATGTGGTCTCG-1 contig 1 = AGAGCTGCTC...
umi GATTATTGGA = 288 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=480]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-480 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSRGTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1173 = CGAACATGTTCCCTTG-1

using 49 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[49]
surviving nonsolo ucounts = 1[49]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1174 = CGAACATGTTCTCATT-1

using 671 reads

====================================================================================

graph has 292 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[6, 98, 243, 322]
surviving nonsolo ucounts = 4[6, 98, 243, 322]
ids = [2, 3, 4, 0]

====================================================================================

UMI info for barcode CGAACATGTTCTCATT-1 contig 1 = AGCTCTGAGA...
umi GCATGTTTCT = 5 reads: -150 +2 -2 +4 -1 +1 -1X +3 -1 +2 -3 +1 -1 +6 -2 +1 -1 +7 -1 +7 -1X +3 -1 +4 -92 +76 -46 +4 invalidated
umi GGGACCGCTT = 240 reads: +424 validated

UMI info for barcode CGAACATGTTCTCATT-1 contig 2 = GAAGAGCTGC...
umi CTCACCCTAA = 319 reads: +385 validated
umi GCGCTTCTTT = 97 reads: -355X +1 -6XX +1 -9XX +2 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=563]
0-43 ==> 0-43 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
43-77 ==> 45-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=1)
77-430 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
454-501 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
501-563 ==> 0-62 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 419, score = 9 + 7
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 241
start codons at 77, 228, 233, 380, 458
confident = true
funny annotation

TIG 2[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
386-418 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGGSPLTF at 357, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 408
start codons at 33, 241, 367, 460
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1176 = CGAACATTCAAACGGG-1

using 1374 reads

====================================================================================

graph has 388 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 1367]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1177 = CGAACATTCAACCATG-1

using 328 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 4, 315]
surviving nonsolo ucounts = 1[315]
ids = [7]

====================================================================================

UMI info for barcode CGAACATTCAACCATG-1 contig 1 = ATCAGTCCCA...
umi GTCTGCAATG = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1182 = CGAACATTCACGCGGT-1

using 312 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 1[309]
ids = [0]

====================================================================================

UMI info for barcode CGAACATTCACGCGGT-1 contig 1 = GGGAATCAGT...
umi ACGCGATCGC = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1185 = CGAACATTCAGTCAGT-1

using 50 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 7, 36]
surviving nonsolo ucounts = 2[4, 36]
ids = [4, 5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1193 = CGAACATTCCCAACGG-1

using 195 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1195 = CGAACATTCGAATCCA-1

using 844 reads

====================================================================================

graph has 284 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 244, 592]
surviving nonsolo ucounts = 2[244, 592]
ids = [2, 5]

====================================================================================

UMI info for barcode CGAACATTCGAATCCA-1 contig 1 = GATCAGGACT...
umi ACGCTACGGG = 243 reads: +397 validated
umi CTACTGGTAA = 590 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 128 reads
cdr3 = CMQALQTPRTF at 366, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 822
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1197 = CGAACATTCGCCATAA-1

using 246 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [3]

====================================================================================

UMI info for barcode CGAACATTCGCCATAA-1 contig 1 = GGAGTCAGTC...
umi TTGATTTGGG = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQLNSYPITF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 26, 32, 88, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1201 = CGAACATTCGGCTTGG-1

using 17 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1205 = CGAACATTCGTTACGA-1

using 258 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [3]

====================================================================================

UMI info for barcode CGAACATTCGTTACGA-1 contig 1 = GAATCAGTCC...
umi GTGCCGCCAA = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1209 = CGAACATTCTCGAGTA-1

using 213 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 37
nonsolo ucounts = 29[2^10, 3^3, 4^5, 5^3, 7, 8^2, 11^2, 12, 21, 63]
surviving nonsolo ucounts = 1[63]
ids = [22]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1214 = CGAACATTCTGTTGAG-1

using 476 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 467]
surviving nonsolo ucounts = 1[467]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=450]
10-201 ==> 165-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
201-239 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
239-450 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 169, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 457
start codons at 2, 53, 152, 179, 203, 371
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1218 = CGAATGTAGAAAGTGG-1

using 7364 reads

====================================================================================

graph has 4570 edges initially, 28 edges after simplification

total ucounts = 873
nonsolo ucounts = 378[2^153, 3^76, 4^46, 5^25, 6^27, 7^7, 8^10, 9^6, 11^2, 12, 16^2, 17, 19, 82^2, 94, 111, 173, 208, 209, 227, 228, 243, 260, 288, 292, 300, 309, 328, 333, 334, 340, 461, 676]
surviving nonsolo ucounts = 20[8, 82, 94, 111, 173, 208, 209, 227, 243, 260, 288, 292, 300, 309, 328, 333, 334, 340, 461, 676]
ids = [531, 214, 462, 100, 110, 820, 23, 527, 431, 349, ...]

====================================================================================

UMI info for barcode CGAATGTAGAAAGTGG-1 contig 1 = CACATAACAC...
umi AGAAATGCGT = 174 reads: +427 validated
umi CAACTGCATA = 87 reads: +427 validated
umi CACGCTATGT = 98 reads: +17 -2XX +4 -1XX +2 -2XX +13 -1XX +7 -1XX +3 -1XX +8 -1XX +2 -1XX +3 -1XX +4 -1XX +5 -1XX +21 -1XX +4 -1XX +5 -1XX +12 -1XX +6 -3XX +7 -1XX +1 -2XX +1 -1XX +7 -1XX +4 -1XX +42 -1XX +5 -2XX +4 -2XX +1 -2XX +3 -1XX +1 -3XX +4 -1XX +2 -1XX +1 -51 +2 -2XX +10 -1XX +4 -1XX +10 -1XX +3 -1XX +29 -2XX +2 -5XX +1 -2XX +2 -2XX +2 -1XX +2 -6XX +2 -10X +2 -1 +3 -2 +1 -1X +2 -1X +2 -2X +4 -1X +1 -3 +1 -1 +2 -1X +4 invalidated
umi GGACCGTGTA = 8 reads: +115 -92 +110 -110 non-validated
umi TAGTGTATTG = 23 reads: -90X +1 -2XX +1 -3XX +1 -2XX +1 -1XX +246 -23 +1 -1 +54 invalidated
umi TTACGGTGTG = 202 reads: +427 validated

UMI info for barcode CGAATGTAGAAAGTGG-1 contig 2 = TGGGGAGAGC...
umi AACGGTAAGA = 224 reads: +382 validated
umi ACAATTTCCG = 333 reads: +382 validated
umi ACTCCTCAAA = 112 reads: +382 validated
umi ATGGTGGTCT = 295 reads: +382 validated
umi ATGTGGGGAA = 343 reads: +382 validated
umi CATGTCACCT = 302 reads: +382 validated
umi CCGTTGACGG = 317 reads: +382 validated
umi CGGCAACTCA = 260 reads: +382 validated
umi CTTCCCTAGT = 337 reads: +382 validated
umi GAAATGTTTA = 244 reads: +382 validated
umi GATATATTAA = 96 reads: +382 validated
umi GGAATGTTAG = 227 reads: +382 validated
umi GGTAGGTGTA = 330 reads: +382 validated
umi TCCATGCAGA = 289 reads: +382 validated
umi TTGTCAGGGA = 676 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=604]
0-56 ==> 2-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
56-409 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=22)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
483-604 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 51 reads
cdr3 = CARDKSSGSGWTDYIDYW at 398, score = 8 + 7
umis assigned: [110, 214, 226, 531, 662, 820]
of which 4 are surviving nonsolos
reads assigned: 581
start codons at 56, 125, 207, 254, 353
confident = true

TIG 2[bases=567]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-396 ==> 0-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=13)
393-431 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 700 reads
cdr3 = CQQYDNWPRTF at 370, score = 9 + 8
umis assigned: [23, 61, 100, 187, 189, 255, 301, 349, 417, 431] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4287
start codons at 49, 118, 254, 380, 473
confident = true
now this is a cell
paired!

ACGGCCGTATATTTCTGTGCGAGAGATAAGTCGAGTGGTAGTGGCTGGACCGACTACATTGACTACTGGGGCCAGGGAACCCTGGTAACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATGATAACTGGCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1223 = CGAATGTAGAGCCCAA-1

using 205 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 198]
surviving nonsolo ucounts = 1[198]
ids = [4]

====================================================================================

UMI info for barcode CGAATGTAGAGCCCAA-1 contig 1 = GAGAAGACAG...
umi TACAGCTTCG = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-30 ==> 84-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
30-383 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
380-418 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
418-524 ==> 0-106 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDSLNGPVF at 351, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 30, 334, 359, 364, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1227 = CGAATGTAGATGCCAG-1

using 45 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[43]
surviving nonsolo ucounts = 1[43]
ids = [0]

====================================================================================

UMI info for barcode CGAATGTAGATGCCAG-1 contig 1 = CGTCTCCACC...
umi CTACCGCTTG = 41 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=411]
10-338 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
360-398 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 6 reads
cdr3 = CSSVAGSYSLVF at 334, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 41
start codons at 10, 149, 167, 218, 221, 317
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1228 = CGAATGTAGATGCGAC-1

using 231 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode CGAATGTAGATGCGAC-1 contig 1 = GGGGAGGAGT...
umi GTTCATACAG = 233 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=561]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDNLPRGITF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 31, 37, 93, 106, 245, 368, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1229 = CGAATGTAGCAACGGT-1

using 83 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 72]
surviving nonsolo ucounts = 1[72]
ids = [3]

====================================================================================

UMI info for barcode CGAATGTAGCAACGGT-1 contig 1 = GTCTCAGTCA...
umi CGCAACCGTC = 68 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
368-407 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
407-456 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYSTPYTF at 346, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 19, 25, 81, 94, 284, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1230 = CGAATGTAGCAATATG-1

using 104 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 13, 86]
surviving nonsolo ucounts = 1[86]
ids = [1]

====================================================================================

UMI info for barcode CGAATGTAGCAATATG-1 contig 1 = ATCAGTCCCA...
umi TCCAACCACG = 73 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=433]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-433 ==> 0-22 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 23, 29, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1245 = CGAATGTAGTCGAGTG-1

using 199 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 192]
surviving nonsolo ucounts = 1[192]
ids = [4]

====================================================================================

UMI info for barcode CGAATGTAGTCGAGTG-1 contig 1 = GGGGTCTCAG...
umi TACATGTGTA = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=467]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=11)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-467 ==> 0-41 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 22 reads
cdr3 = CSSYAGSNNLIF at 362, score = 7 + 10
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 38, 239, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1248 = CGAATGTAGTGTCCCG-1

using 840 reads

====================================================================================

graph has 294 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 29, 257, 272, 274]
surviving nonsolo ucounts = 3[29, 257, 274]
ids = [5, 4, 8]

====================================================================================

UMI info for barcode CGAATGTAGTGTCCCG-1 contig 1 = GGGGAGGAAT...
umi AGACCGCGCG = 71 reads: +17 -1XX +4 -1XX +25 -1XX +2 -1XX +10 -1XX +26 -1XX +12 -1XX +7 -1XX +2 -1XX +10 -233XX +2 -1X +5 -1X +5 -3XX +1 -1XX +4 -1XX +2 -1XX +1 -1XX +2 invalidated
umi ATCCTGAGCC = 258 reads: +388 validated
umi CGGATCCTTT = 31 reads: +2 -1 +1 -1 +347 -1 +3 -1 +4 -2 +3 -1 +3 -1 +6 -1 +2 -1 +2 -1 +4 non-validated
umi TTCCGTCCTA = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 113 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1, 4, 5, 8]
of which 3 are surviving nonsolos
reads assigned: 623
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1252 = CGAATGTCAACGATGG-1

using 466 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 186, 274]
surviving nonsolo ucounts = 2[186, 274]
ids = [1, 3]

====================================================================================

UMI info for barcode CGAATGTCAACGATGG-1 contig 1 = GCTCTGCTTC...
umi ATGTTCGCTA = 172 reads: +383 -2 +9 non-validated

UMI info for barcode CGAATGTCAACGATGG-1 contig 2 = AGTCTGGGCC...
umi TAGACGAGCT = 262 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=458]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 16 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=537]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=27)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
422-537 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQVWNSETEQKLF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 40, 101, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1264 = CGAATGTCACCAGATT-1

using 375 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 368]
surviving nonsolo ucounts = 1[368]
ids = [0]

====================================================================================

UMI info for barcode CGAATGTCACCAGATT-1 contig 1 = AAAAACCACA...
umi ACTGAATTCC = 316 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=483]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=21)
400-420 ==> 0-20 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
433-468 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CARTYCSGGTCYDGW at 392, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 50, 201, 248, 253, 270, 314, 347, 426, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1266 = CGAATGTCACCGAATT-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1267 = CGAATGTCACGGTTTA-1

using 425 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 172, 248]
surviving nonsolo ucounts = 2[172, 248]
ids = [0, 3]

====================================================================================

UMI info for barcode CGAATGTCACGGTTTA-1 contig 1 = AGGAGTCAGT...
umi GTATTGGCGG = 234 reads: +388 validated

UMI info for barcode CGAATGTCACGGTTTA-1 contig 2 = ACTTTCTGAG...
umi ACTCTTGGGT = 170 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=496]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPITF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false

TIG 2[bases=509]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=8)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
468-509 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARAHEGMIPFGGAIPFDYW at 377, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 14, 35, 79, 255, 390, 398
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1273 = CGAATGTCAGATGGGT-1

using 139 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[136]
surviving nonsolo ucounts = 1[136]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1275 = CGAATGTCAGCGTAAG-1

using 475 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3^2, 4, 5^2, 447]
surviving nonsolo ucounts = 1[447]
ids = [0]

====================================================================================

UMI info for barcode CGAATGTCAGCGTAAG-1 contig 1 = GTCAGTCTCA...
umi ACTGGCCAGG = 445 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYSTAWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1276 = CGAATGTCAGGATCGA-1

using 175 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [2]

====================================================================================

UMI info for barcode CGAATGTCAGGATCGA-1 contig 1 = TTATGGGGGA...
umi GAAAAGGTTG = 170 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=539]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
458-539 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 370, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 2, 25, 69, 248, 251, 254, 340, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1277 = CGAATGTCAGGCGATA-1

using 312 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[312]
surviving nonsolo ucounts = 1[312]
ids = [0]

====================================================================================

UMI info for barcode CGAATGTCAGGCGATA-1 contig 1 = GGGCCTCAGG...
umi CGTAACTTCT = 308 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=550]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-550 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1279 = CGAATGTCAGGGTTAG-1

using 103 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 5, 90]
surviving nonsolo ucounts = 1[90]
ids = [3]

====================================================================================

UMI info for barcode CGAATGTCAGGGTTAG-1 contig 1 = GAGCCCCAGC...
umi GCCGGAGCTC = 80 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=477]
0-67 ==> 169-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=1)
67-420 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=13)
427-476 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 5 reads
cdr3 = CARGNYYGMDVW at 409, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 78
start codons at 67, 223, 284, 370, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1283 = CGAATGTCAGTCACTA-1

using 244 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [1]

====================================================================================

UMI info for barcode CGAATGTCAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi ACGTATGCAG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-571 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1285 = CGAATGTCATATGGTC-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1291 = CGAATGTCATGCTAGT-1

using 132 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2, 3, 5, 6^2, 7, 8^3, 9^2, 11, 13, 33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1292 = CGAATGTCATGGTCAT-1

using 349 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [1]

====================================================================================

UMI info for barcode CGAATGTCATGGTCAT-1 contig 1 = GAGCTGCTCA...
umi TGAAACCCAT = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSPWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 30, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1293 = CGAATGTCATGTTCCC-1

using 13923 reads

====================================================================================

graph has 5968 edges initially, 98 edges after simplification

total ucounts = 1122
nonsolo ucounts = 438[2^185, 3^82, 4^47, 5^43, 6^23, 7^5, 8^5, 9^5, 10^4, 11^3, 13^2, 14, 15, 24, 25, 37, 90, 108, 128, 152, 192, 197, 219, 288, 306, 314, 320, 351, 375, 377, 378, 395, 408, 410, 419, 436, 453^2, 496, 582, 703, 727, 756, 784, 930]
surviving nonsolo ucounts = 32[24, 25, 37, 90, 108, 128, 152, 192, 197, 219, 288, 306, 314, 320, 351, 375, 377, 378, 395, 408, 410, 419, 436, 453^2, 496, 582, 703, 727, 756, 784, 930]
ids = [1091, 979, 811, 436, 246, 1079, 707, 634, 296, 665, ...]

====================================================================================

UMI info for barcode CGAATGTCATGTTCCC-1 contig 1 = GAAGAACATG...
umi CTCAACTCTT = 1001 reads: -400X +1 -4XX +2 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CTCAGGCTGT = 367 reads: -275X +158 invalidated
umi GCGTTCAGCG = 18 reads: -400X +3 -1X +1 -10X +1 -1XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi GGCACAAATA = 150 reads: +433 validated
umi GGGGCATGCG = 383 reads: -397X +1 -3XX +1 -2XX +1 -1XX +3 -1XX +1 -4XX +1 -1XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi TACGTCTGTT = 490 reads: -400X +1 -4X +2 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TTGCTGAGCG = 130 reads: +433 validated
umi TTGTCAGGCC = 23 reads: -433 non-validated

UMI info for barcode CGAATGTCATGTTCCC-1 contig 2 = GGCTGGGGTC...
umi ATACTCCCTC = 292 reads: +391 validated
umi ATTACCCGGC = 199 reads: +391 validated
umi GCCCCGGTCC = 193 reads: +391 validated
umi GTCTACCCGC = 417 reads: +123 -1XX +3 -7XX +1 -3XX +1 -1XX +1 -4XX +1 -2XX +1 -108X +2 -3XX +1 -8XX +1 -2XX +1 -2XX +114 invalidated
umi GTTCTCCGTT = 38 reads: +367 -4 +20 non-validated
umi TGATGGGGCT = 23 reads: +29 -17 +273 -72 non-validated

GOOD CONTIGS

TIG 1[bases=622]
7-363 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=20)
365-385 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
377-440 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
440-622 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 141 reads
cdr3 = CAREIGYTYGYFYYYMDVW at 352, score = 9 + 7
umis assigned: [503, 505, 665, 707, 728, 846, 1079, 1091]
of which 8 are surviving nonsolos
reads assigned: 1871
start codons at 7, 51, 377, 397
confident = true

TIG 2[bases=644]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-393 ==> 0-351 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=15)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 209 reads
cdr3 = CSSYAGTYTNVVF at 366, score = 7 + 8
umis assigned: [269, 296, 634, 777, 811, 979]
of which 6 are surviving nonsolos
reads assigned: 1122
start codons at 42, 181, 199, 250, 349, 376, 394
confident = true
now this is a cell
paired!

GCCGTCTATTACTGTGCGAGAGAAATTGGATACACCTATGGTTACTTCTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGACGATGAGGGTGATTATTACTGCTCCTCATATGCAGGCACCTACACTAATGTGGTATTCGGCGGAGGGACCAAGGTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1298 = CGAATGTGTACATGTC-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1304 = CGAATGTGTAGCTCCG-1

using 36 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 25]
surviving nonsolo ucounts = 1[25]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1307 = CGAATGTGTATAGGGC-1

using 257 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 52
nonsolo ucounts = 20[2^11, 3^5, 4, 6, 7, 171]
surviving nonsolo ucounts = 1[171]
ids = [20]

====================================================================================

UMI info for barcode CGAATGTGTATAGGGC-1 contig 1 = GTGAGTCTCA...
umi GCCGTGCACC = 170 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=1)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=20)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQSHSIPITF at 350, score = 8 + 8
umis assigned: [20]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1309 = CGAATGTGTCGCATAT-1

using 494 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[7, 72, 186, 227]
surviving nonsolo ucounts = 4[7, 72, 186, 227]
ids = [2, 4, 5, 0]

====================================================================================

UMI info for barcode CGAATGTGTCGCATAT-1 contig 1 = AGCTCTGAGA...
umi AGCAATAGTG = 222 reads: +421 validated
umi TCGTATCTGT = 7 reads: +7 -1 +2 -26 +58 -1 +2 -2 +23 -65 +12 -1 +22 -1 +9 -1 +2 -1 +7 -16 +3 -1 +5 -2 +3 -1 +11 -1 +1 -2 +11 -3 +6 -2 +4 -12 +1 -1 +3 -1 +10 -1 +4 -1 +3 -1 +7 -2 +2 -1 +10 -1 +7 -38 non-validated
umi TTAGCGTCGG = 73 reads: +412 -1 +8 non-validated
umi TTCGATTCGG = 184 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=612]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=15)
454-500 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
500-612 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 46 reads
cdr3 = CAKKVENRQLVPNDYW at 421, score = 8 + 6
umis assigned: [0, 2, 4, 5]
of which 4 are surviving nonsolos
reads assigned: 474
start codons at 79, 230, 235, 382, 458
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1310 = CGAATGTGTCTAACGT-1

using 200 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 8, 186]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGAATGTGTCTAACGT-1 contig 1 = TGGGGAGGGT...
umi TGAATGTGTT = 160 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=505]
63-411 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
434-484 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
484-505 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDLVTLGRAFDIW at 408, score = 9 + 8
umis assigned: [4]
of which 0 are surviving nonsolos
reads assigned: 157
start codons at 19, 63, 107, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1313 = CGAATGTGTGAAGGCT-1

using 6895 reads

====================================================================================

graph has 2854 edges initially, 36 edges after simplification

total ucounts = 279
nonsolo ucounts = 116[2^41, 3^20, 4^14, 5^8, 6^2, 7^4, 8, 9, 10^2, 12^2, 16, 74, 112, 153, 176, 195, 200, 204, 207, 215, 217, 238, 239, 254, 293, 298, 311, 531, 774, 790, 896]
surviving nonsolo ucounts = 21[16, 74, 112, 153, 176, 195, 200, 204, 207, 215, 217, 238, 239, 254, 293, 298, 311, 531, 774, 790, 896]
ids = [132, 225, 221, 0, 158, 41, 190, 6, 47, 210, ...]

====================================================================================

UMI info for barcode CGAATGTGTGAAGGCT-1 contig 1 = ACCCAAAAAC...
umi AGGTCCCCCT = 189 reads: +412 validated
umi TCCACTACCG = 109 reads: +412 validated

UMI info for barcode CGAATGTGTGAAGGCT-1 contig 2 = TGAGCGCAGA...
umi AAAATACGAC = 153 reads: +394 validated
umi AAAATACGGC = 240 reads: +394 validated
umi AACCGCGTAC = 203 reads: +394 validated
umi AGTTGCTCTG = 213 reads: +394 validated
umi ATCACTTAGG = 774 reads: -218 +1 -1X +174 invalidated
umi CATCCTGTAC = 897 reads: -218X +1 -1X +174 invalidated
umi CTCTCGGCAT = 309 reads: +394 validated
umi GCTTACTCCG = 173 reads: +394 validated
umi GGGCGACTTT = 289 reads: +394 validated
umi GTTGTTTCCC = 233 reads: +394 validated
umi TACAGCTCCC = 201 reads: +394 validated
umi TATTGATACC = 213 reads: +394 validated
umi TCTCAACATC = 254 reads: +394 validated
umi TTTACAGCCT = 156 reads: +42 -1X +351 invalidated

GOOD CONTIGS

TIG 1[bases=571]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=4)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
466-571 ==> 0-105 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 38 reads
cdr3 = CARAPDPFYFDYW at 396, score = 8 + 7
umis assigned: [41, 221]
of which 2 are surviving nonsolos
reads assigned: 295
start codons at 54, 205, 252, 257, 274, 289, 318, 351
confident = true

TIG 2[bases=641]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 693 reads
cdr3 = CGTWDSSLSVVDVVF at 357, score = 7 + 8
umis assigned: [0, 1, 6, 47, 52, 83, 119, 158, 163, 181] and 4 others
of which 14 are surviving nonsolos
reads assigned: 4242
start codons at 36, 190, 241, 365, 391
confident = true

REJECT CONTIGS

TIG 1[bases=508]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
0-79 ==> 10061-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
410-441 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=3)
435-498 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
cdr3 = CYYYYYMDVW at 437, score = 3 + 7
umis assigned: [132, 225]
of which 2 are surviving nonsolos
reads assigned: 82
start codons at 61, 217, 259, 325, 358, 436, 455
confident = false
frameshifted full length stopped transcript of length 508
VJ delta = -11
not full
not full

TIG 2[bases=561]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [230]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 30, 63, 99, 187, 349, 369, 467
confident = false
did not find CDR3

TIG 3[bases=630]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
7-82 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [144, 146]
of which 2 are surviving nonsolos
reads assigned: 1286
start codons at 35, 96, 165, 183
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGATCTGACGACACGGCCGTATATTACTGTGCGAGAGCTCCCGACCCTTTCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGTTGTCGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1321 = CGAATGTGTGTGAAAT-1

using 253 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [1]

====================================================================================

UMI info for barcode CGAATGTGTGTGAAAT-1 contig 1 = AGTCAGACTC...
umi TTTCAAGGGT = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-459 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPLTF at 351, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 24, 30, 86, 99, 235, 238, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1322 = CGAATGTGTGTGAATA-1

using 7925 reads

====================================================================================

graph has 3530 edges initially, 82 edges after simplification

total ucounts = 535
nonsolo ucounts = 256[2^91, 3^44, 4^27, 5^22, 6^14, 7^8, 8^6, 9^3, 10^2, 12^3, 13, 15, 18, 20, 24, 50, 51, 56, 57, 71, 73, 125, 132, 133, 148, 155, 157^2, 168, 169, 178^2, 244, 254, 275, 276, 278, 280, 288, 294, 302, 315, 348^2, 513, 679]
surviving nonsolo ucounts = 24[50, 56, 57, 71, 125, 132, 133, 155, 168, 178, 244, 254, 275, 276, 278, 280, 288, 294, 302, 315, 348^2, 513, 679]
ids = [321, 233, 133, 471, 145, 244, 496, 236, 118, 483, ...]

====================================================================================

UMI info for barcode CGAATGTGTGTGAATA-1 contig 1 = AGAGCTCTGG...
umi AAGCTTCATT = 302 reads: +382 validated
umi AATGAGTGCA = 242 reads: +382 validated
umi ACATAGTCGC = 284 reads: +382 validated
umi ATACGTGTGC = 274 reads: +382 validated
umi CCTCTCAATA = 277 reads: +382 validated
umi CGAAGCCCCT = 305 reads: +154 -1XX +227 invalidated
umi CTATAAGGGT = 152 reads: -340X +1 -7X +2 -1X +2 -1X +4 -2X +9 -1X +4 -1X +7 invalidated
umi GTAGCGTGGG = 317 reads: +382 validated
umi GTCGTTTATT = 288 reads: +382 validated
umi TATATCGTAA = 346 reads: +382 validated
umi TGAGGATACC = 66 reads: -382 non-validated
umi TTATTAGACA = 684 reads: +382 validated
umi TTTTTTCCGC = 352 reads: +382 validated

UMI info for barcode CGAATGTGTGTGAATA-1 contig 2 = TGGGGGCTTT...
umi AAATCAACCG = 243 reads: +454 validated
umi ATCCTCATAC = 6 reads: -421 +2 -2X +1 -12X +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi ATTAGGGTTA = 56 reads: +445 -1 +3 -5 non-validated
umi CAAAGTCTTG = 124 reads: +426 -1X +20 -7 invalidated
umi CTAGCTTTCG = 54 reads: +454 validated
umi CTCATCGATA = 137 reads: +454 validated
umi GACTTTGCGG = 179 reads: -454 non-validated
umi GCTGATAGAC = 50 reads: +454 validated
umi TCATTTTTGT = 456 reads: -418X +1 -1XX +2 -5XX +1 -2XX +1 -3XX +1 -3XX +1 -2XX +1 -3XX +2 -2XX +1 -1XX +3 invalidated
umi TGGGCAACCC = 179 reads: +454 validated
umi TTAATAGGAC = 137 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 573 reads
cdr3 = CQQYGGSPTF at 368, score = 9 + 8
umis assigned: [18, 28, 38, 104, 197, 207, 236, 358, 366, 412] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3818
start codons at 44, 252, 255, 378, 468
confident = true

TIG 2[bases=655]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=12)
431-473 ==> 7-49 on |56|IGHJ5|J-REGION| [len=49] (mis=2)
473-655 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 6 umis using 100 reads
cdr3 = CASEEYSSSWSGWGYLDHW at 385, score = 8 + 7
umis assigned: [9, 118, 133, 145, 233, 244, 283, 321, 436, 483] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1531
start codons at 19, 28, 40, 84, 269
confident = true
now this is a cell
paired!

GCTATTTATTACTGTGCGAGTGAGGAATATAGTAGCAGCTGGTCCGGGTGGGGTTACCTCGACCACTGGGGCCAGGGATCCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGACTGGAACCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTGGCTCACCGACGTTCGGCCGAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1338 = CGAATGTTCAAGGTAA-1

using 307 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3, 4, 5, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode CGAATGTTCAAGGTAA-1 contig 1 = GATCAGGACT...
umi AGGTAGCCTC = 282 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-511 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1341 = CGAATGTTCAGCGATT-1

using 213 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 5, 199]
surviving nonsolo ucounts = 1[199]
ids = [5]

====================================================================================

UMI info for barcode CGAATGTTCAGCGATT-1 contig 1 = GAGCTACAAC...
umi TAACCTATTG = 185 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-511 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1343 = CGAATGTTCATATCGG-1

using 1242 reads

====================================================================================

graph has 1941 edges initially, 20 edges after simplification

total ucounts = 581
nonsolo ucounts = 260[2^117, 3^47, 4^31, 5^23, 6^16, 7^9, 8^11, 9^3, 10, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1344 = CGAATGTTCATCACCC-1

using 390 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 384]
surviving nonsolo ucounts = 1[384]
ids = [5]

====================================================================================

UMI info for barcode CGAATGTTCATCACCC-1 contig 1 = GATCAGGACT...
umi TTTCAATGGC = 381 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=12)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQALQALTF at 366, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 372
start codons at 30, 63, 99, 181, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1347 = CGAATGTTCCCTAACC-1

using 619 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[619]
surviving nonsolo ucounts = 1[619]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=338]
8-167 ==> 194-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
164-202 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
202-338 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYNTPWTF at 141, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 610
start codons at 3, 25, 244
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1351 = CGAATGTTCCGCATCT-1

using 239 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[235]
surviving nonsolo ucounts = 1[235]
ids = [4]

====================================================================================

UMI info for barcode CGAATGTTCCGCATCT-1 contig 1 = GGGGTCTCAG...
umi TTCATAAGCG = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-382 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
426-508 ==> 0-82 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CCSYAGRYSWVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 38, 177, 195, 246, 249, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1355 = CGAATGTTCGCAAACT-1

using 199 reads

====================================================================================

graph has 198 edges initially, 6 edges after simplification

total ucounts = 45
nonsolo ucounts = 34[2^8, 3^3, 4^2, 5^6, 6^3, 7^2, 8^3, 9^4, 10, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1359 = CGAATGTTCTAACGGT-1

using 283 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 9, 268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1360 = CGAATGTTCTAGAGTC-1

using 3807 reads

====================================================================================

graph has 2138 edges initially, 14 edges after simplification

total ucounts = 468
nonsolo ucounts = 193[2^79, 3^38, 4^25, 5^15, 6^12, 7^5, 8^2, 9, 10, 32, 38, 44, 71, 100, 182, 193, 216, 240, 255, 277, 296, 317, 329, 353]
surviving nonsolo ucounts = 13[44, 71, 100, 182, 193, 216, 240, 255, 277, 296, 317, 329, 353]
ids = [249, 340, 393, 336, 181, 384, 361, 406, 325, 344, ...]

====================================================================================

UMI info for barcode CGAATGTTCTAGAGTC-1 contig 1 = TGGGGGATCA...
umi CACATTCAGA = 332 reads: +397 validated
umi CGCATTACGA = 181 reads: -362 +35 non-validated
umi GAAGATTGTA = 44 reads: +334 -1 +62 non-validated
umi GGCCTTACTG = 314 reads: +397 validated
umi TAAATACGCT = 279 reads: +397 validated
umi TACATTTCTC = 352 reads: +397 validated
umi TACCTTCCTC = 184 reads: -209X +188 invalidated
umi TAGTTCGCCG = 72 reads: +397 validated
umi TATACATCAT = 293 reads: +397 validated
umi TCATCTGTAA = 238 reads: +397 validated
umi TCGTTAATCC = 216 reads: +397 validated
umi TGCATTACTG = 255 reads: +397 validated

UMI info for barcode CGAATGTTCTAGAGTC-1 contig 2 = GGTGATCAGG...
umi TCTCATATCG = 97 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 354 reads
cdr3 = CMQSLQTPLTF at 371, score = 9 + 9
umis assigned: [134, 181, 249, 289, 325, 335, 336, 340, 344, 361] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2716
start codons at 35, 68, 104, 354, 374, 474
confident = true

TIG 2[bases=494]
0-31 ==> 48-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
31-384 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=14)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
455-494 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CANDPQRRGELTSLDYW at 373, score = 10 + 7
umis assigned: [393]
of which 1 are surviving nonsolos
reads assigned: 95
start codons at 31, 182, 187, 334
confident = true
now this is a cell
paired!

GACACGGCCGTATATTACTGTGCGAACGACCCCCAACGGCGCGGGGAGTTAACGTCGCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCACAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAATCTCTACAAACTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1368 = CGAATGTTCTTGTACT-1

using 783 reads

====================================================================================

graph has 866 edges initially, 4 edges after simplification

total ucounts = 281
nonsolo ucounts = 90[2^44, 3^16, 4^14, 5^6, 6^2, 7^2, 8^2, 9^3, 301]
surviving nonsolo ucounts = 1[301]
ids = [41]

====================================================================================

UMI info for barcode CGAATGTTCTTGTACT-1 contig 1 = AGTCCCAGTC...
umi AGACGTCGGA = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=16)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CQHLNGYPITF at 347, score = 8 + 8
umis assigned: [41]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 20, 26, 82, 231, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1369 = CGAATGTTCTTTCCTC-1

using 367 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 362]
surviving nonsolo ucounts = 1[362]
ids = [2]

====================================================================================

UMI info for barcode CGAATGTTCTTTCCTC-1 contig 1 = GATCAGGACT...
umi CATGGCGCGC = 352 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1373 = CGACCTTAGACTGTAA-1

using 317 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 7, 303]
surviving nonsolo ucounts = 1[303]
ids = [1]

====================================================================================

UMI info for barcode CGACCTTAGACTGTAA-1 contig 1 = GGGGAGGAAC...
umi ACCGGCAAGA = 288 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=515]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-515 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNNWPPLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1378 = CGACCTTAGCACACAG-1

using 631 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[309, 322]
surviving nonsolo ucounts = 2[309, 322]
ids = [1, 0]

====================================================================================

UMI info for barcode CGACCTTAGCACACAG-1 contig 1 = TGAGCGCAGA...
umi GCTAATCCGG = 312 reads: +388 validated

UMI info for barcode CGACCTTAGCACACAG-1 contig 2 = AGACCCAGTC...
umi GCCGTTAAGC = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 36, 241, 365
confident = false

TIG 2[bases=544]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQAHSFPLTF at 347, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 20, 26, 82, 95, 146, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1383 = CGACCTTAGCGATAGC-1

using 212 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode CGACCTTAGCGATAGC-1 contig 1 = GCTCTGCTTC...
umi GGAGCAACCT = 207 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=525]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-525 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1384 = CGACCTTAGCGATTCT-1

using 177 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 167]
surviving nonsolo ucounts = 1[167]
ids = [6]

====================================================================================

UMI info for barcode CGACCTTAGCGATTCT-1 contig 1 = AGTCTGGGCC...
umi TGGCATTTCT = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=480]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-351 ==> 0-311 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=41)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
422-480 ==> 0-58 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQVWDRNSDQIVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 40, 101, 235, 338
confident = false
>vscore_34.1384_84.3%
ATGGCCTGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGCCTCTGTGACCTCTTATGGGCTGACTCAGCCACCCTCCCTGTCAGTGGCCCCAGGGAAGACGGCCACAATTACCTGCGCGGGAAATAACATTGAATACACGGGTGTCCACTGGTATCAGAAGAAGCCAGGCCAGGCCCCTGTCTTGGTCATGTCTTTGGACAGCGACCGGCCCTCAGGGATCCCCGAGCGATTTTCTGGCTCCATTTCTGGCAACACGGCCGCCCTGATCGTCAGCAGGGTCGAACCCGGGGATGAGGCCGACTACTTCTGTCAGGTGTGGGATCGGAATTCTGATCAAATTGTC
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1390 = CGACCTTAGGACTGGT-1

using 87 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[87]
surviving nonsolo ucounts = 1[87]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1400 = CGACCTTAGTGAACAT-1

using 366 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 146, 213]
surviving nonsolo ucounts = 2[146, 213]
ids = [6, 2]

====================================================================================

UMI info for barcode CGACCTTAGTGAACAT-1 contig 1 = GCTCTGCTTC...
umi AATTAGTCGT = 207 reads: +394 validated

UMI info for barcode CGACCTTAGTGAACAT-1 contig 2 = GGAACTGCTC...
umi TCAGCTTGTG = 134 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-554 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=427]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQRSNWQGLTF at 352, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 31, 236, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1406 = CGACCTTCAAATCCGT-1

using 286 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3^2, 4, 5, 266]
surviving nonsolo ucounts = 1[266]
ids = [5]

====================================================================================

UMI info for barcode CGACCTTCAAATCCGT-1 contig 1 = GAGCTACAAC...
umi AGCATGCTAT = 263 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-522 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1408 = CGACCTTCAAGGTTCT-1

using 60 reads

====================================================================================

graph has 87 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[59]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1410 = CGACCTTCAATAGCGG-1

using 30 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1414 = CGACCTTCACACATGT-1

using 144 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 136]
surviving nonsolo ucounts = 1[136]
ids = [0]

====================================================================================

UMI info for barcode CGACCTTCACACATGT-1 contig 1 = AAAACCACAC...
umi ACGATTCTGT = 136 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=519]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-519 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1415 = CGACCTTCACCCATGG-1

using 124 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 9, 110]
surviving nonsolo ucounts = 1[110]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=434]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
0-20 ==> 789-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=0)
0-20 ==> 9990-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=0)
0-20 ==> 793-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=0)
5-37 ==> 5674-5706 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
34-372 ==> 15-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
369-407 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
407-434 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTQITF at 346, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 20, 26, 81, 94, 230
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1426 = CGACCTTCAGATCTGT-1

using 220 reads

====================================================================================

graph has 226 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2, 3, 5^2, 6^2, 8, 10, 11^2, 47, 50, 54]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1428 = CGACCTTCAGATTGCT-1

using 131 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1431 = CGACCTTCAGCGTTCG-1

using 334 reads

====================================================================================

graph has 204 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3^2, 62, 265]
surviving nonsolo ucounts = 2[62, 265]
ids = [4, 2]

====================================================================================

UMI info for barcode CGACCTTCAGCGTTCG-1 contig 1 = AGAGCCCTGG...
umi GTGAAACAAT = 252 reads: +382 validated
umi TTCGTTGTTC = 56 reads: +14 -4 +33 -1XX +92 -1XX +72 -2XX +70 -1XX +1 -1XX +4 -1XX +31 -2XX +14 -2XX +9 -27 invalidated

GOOD CONTIGS

TIG 1[bases=510]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
388-426 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
426-510 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPITF at 365, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 295
start codons at 44, 249, 252, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1433 = CGACCTTCAGCTTAAC-1

using 6178 reads

====================================================================================

graph has 3234 edges initially, 48 edges after simplification

total ucounts = 707
nonsolo ucounts = 289[2^129, 3^61, 4^34, 5^23, 6^12, 7^3, 8^4, 10^2, 12, 16, 17, 20, 50, 66, 108, 127, 169, 186, 193, 252, 263^2, 286, 308, 326, 335, 342, 357, 1227]
surviving nonsolo ucounts = 15[50, 127, 169, 186, 193, 252, 263^2, 286, 308, 326, 335, 342, 357, 1227]
ids = [518, 354, 453, 293, 474, 82, 259, 705, 113, 570, ...]

====================================================================================

UMI info for barcode CGACCTTCAGCTTAAC-1 contig 1 = CCTGGGTCAG...
umi AAGTATACTA = 357 reads: +382 validated
umi AATATGCCAG = 326 reads: +382 validated
umi ACGCACAGTA = 252 reads: +382 validated
umi AGGATCACGG = 286 reads: +382 validated
umi CGCATTTCAT = 263 reads: +382 validated
umi GACTGCCCCC = 125 reads: +382 validated
umi GATCATTCTT = 335 reads: +382 validated
umi GTGAGATCTA = 171 reads: +382 validated
umi GTTTGCAATT = 192 reads: +382 validated
umi TATCTTGTTG = 49 reads: +382 validated
umi TCGTCGGGTA = 332 reads: +176 -1XX +205 invalidated
umi TTTCGGTTCT = 341 reads: +382 validated
umi TTTTTATGGT = 267 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=570]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
396-434 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 518 reads
cdr3 = CQQYGGSPLF at 376, score = 9 + 7
umis assigned: [41, 47, 82, 113, 259, 354, 363, 453, 474, 518] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3228
start codons at 52, 260, 386, 476
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1434 = CGACCTTCAGGCGATA-1

using 343 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[343]
surviving nonsolo ucounts = 1[343]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1443 = CGACCTTCATAGTAAG-1

using 10060 reads

====================================================================================

graph has 4794 edges initially, 72 edges after simplification

total ucounts = 904
nonsolo ucounts = 410[2^171, 3^78, 4^43, 5^25, 6^19, 7^13, 8^10, 9^5, 10, 11^2, 12, 13, 14, 17, 47, 59, 95, 109, 131, 136, 137, 145, 147, 171, 173^2, 176, 186, 188, 194, 195, 200^2, 202, 210, 212, 216, 219, 220, 223, 224^2, 233, 244, 247, 253, 265, 291, 292, 346, 370, 438, 484]
surviving nonsolo ucounts = 36[95, 109, 131, 136, 137, 145, 147, 171, 173^2, 176, 186, 188, 194, 195, 200^2, 202, 210, 212, 216, 219, 220, 223, 224^2, 233, 244, 247, 253, 265, 291, 346, 370, 438, 484]
ids = [736, 569, 676, 472, 431, 153, 653, 247, 50, 402, ...]

====================================================================================

UMI info for barcode CGACCTTCATAGTAAG-1 contig 1 = ACTTTCTGAG...
umi CCCAATCAAT = 267 reads: +97 -1XX +326 invalidated
umi CTCTAATCTC = 156 reads: -361X +1 -2X +1 -5X +1 -2X +1 -4XX +1 -2XX +2 -1XX +3 -2XX +35 invalidated
umi GCATAAATCC = 128 reads: -390X +2 -5X +1 -2XX +1 -1XX +1 -1XX +1 -3XX +1 -2XX +1 -3XX +2 -2XX +1 -1XX +3 invalidated
umi GTATTGACCA = 222 reads: +409 -15 non-validated

UMI info for barcode CGACCTTCATAGTAAG-1 contig 2 = AGCTTCAGCT...
umi ACCCCAACGA = 212 reads: +388 validated
umi ACTACATCCA = 178 reads: +388 validated
umi ATCATAATTA = 381 reads: +299 -6XX +1 -8XX +1 -2XX +1 -4XX +1 -65X invalidated
umi CAGCTTTAGT = 346 reads: +388 validated
umi CATAGGCCCT = 135 reads: +362 -26 non-validated
umi CATGTTCAGT = 194 reads: +388 validated
umi CCACAGCCAT = 251 reads: +388 validated
umi CCACCGATGG = 222 reads: +388 validated
umi CCCGATATCC = 221 reads: +388 validated
umi CCCGTTCGGT = 225 reads: +388 validated
umi CCCTACGTTG = 173 reads: +388 validated
umi CCCTTCTCAG = 221 reads: +388 validated
umi CGTTGTTCTG = 24 reads: -331X +2 -2X +1 -5X +1 -8XX +1 -1XX +36 invalidated
umi CTCAGGCCAT = 212 reads: +388 validated
umi CTCCCTTTAA = 191 reads: +388 validated
umi CTTATACTGT = 134 reads: +384 -2 +1 -1 non-validated
umi GCACTCAACA = 39 reads: -323X +1 -2XX +1 -4XX +2 -2XX +1 -5XX +1 -8XX +1 -1XX +36 invalidated
umi GCCACCCCGT = 194 reads: +388 validated
umi GCCCATCCTT = 177 reads: +388 validated
umi GCCGTCTTTG = 264 reads: +388 validated
umi GCGAGTTAGG = 247 reads: +388 validated
umi GCGCCCTAGG = 433 reads: +388 validated
umi GTACGTGGCA = 109 reads: +388 validated
umi TAGTCCCTCC = 147 reads: +388 validated
umi TATCATATGG = 186 reads: +388 validated
umi TCATAACCCC = 133 reads: +388 validated
umi TCGGAAGCTA = 112 reads: -388 non-validated
umi TCGTGTACCG = 96 reads: +388 validated
umi TCTTTTGTCA = 219 reads: +388 validated
umi TTCCGCAACC = 223 reads: +388 validated
umi TTCTCCTCTA = 17 reads: -341X +1 -8X +1 -1XX +36 invalidated
umi TTGTGCACTT = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=2)
408-459 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARLFHDYGDGRGWFDPW at 374, score = 9 + 7
umis assigned: [214, 402, 472, 576]
of which 4 are surviving nonsolos
reads assigned: 754
start codons at 35, 79, 390
confident = true

TIG 2[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 25 umis using 786 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [19, 50, 82, 136, 153, 167, 187, 190, 238, 245] and 22 others
of which 31 are surviving nonsolos
reads assigned: 6012
start codons at 46, 200, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=374]
2-121 ==> 234-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=5)
145-192 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
192-374 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 110, score = 9 + 7
umis assigned: [40]
of which 1 are surviving nonsolos
reads assigned: 477
start codons at 71, 149
confident = false
VJ delta = 23
not full
not full
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGACTGTTCCATGACTACGGTGACGGACGCGGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1448 = CGACCTTCATGGTAGG-1

using 56 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^3, 3^4, 5^2, 6, 8^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1454 = CGACCTTGTAAACCTC-1

using 127 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[125]
surviving nonsolo ucounts = 1[125]
ids = [0]

====================================================================================

UMI info for barcode CGACCTTGTAAACCTC-1 contig 1 = CAGCACTCAG...
umi ACAGGTGAAG = 119 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 28-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
23-379 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
417-486 ==> 0-69 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQSYDSSLSGLYVF at 347, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 23, 177, 180, 231, 330, 357, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1459 = CGACCTTGTACCGTAT-1

using 275 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 10, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=408]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
0-27 ==> 11702-11729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=0)
0-27 ==> 5973-6000 on rc of segment after IGKV1-13 exon 1 [len=6000] (mis=0)
15-84 ==> 8898-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
15-84 ==> 8907-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
15-84 ==> 8906-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=14)
377-400 ==> 0-23 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
cdr3 = CLQDYTYPW at 354, score = 9 + 4
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 27, 33, 89, 102, 184, 238
confident = false
not full
VJ delta = 8
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1463 = CGACCTTGTATTCGTG-1

using 213 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 203]
surviving nonsolo ucounts = 1[203]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1484 = CGACCTTGTGACGGTA-1

using 218 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

UMI info for barcode CGACCTTGTGACGGTA-1 contig 1 = TCTGGGAGAG...
umi GACCTCCTTT = 195 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=523]
0-77 ==> 3-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
77-436 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=5)
465-513 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 5 reads
cdr3 = CTYTDNLLEWLLIRIVDYW at 425, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 77, 233, 300, 357, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1485 = CGACCTTGTGAGGGAG-1

using 211 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 201]
surviving nonsolo ucounts = 1[201]
ids = [4]

====================================================================================

UMI info for barcode CGACCTTGTGAGGGAG-1 contig 1 = GTGTTTCCAT...
umi TCCAATCCCT = 189 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=494]
0-43 ==> 37-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
43-394 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
417-467 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
467-494 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CAKGDGSSWHLDAFDIW at 385, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 43, 194, 199, 257, 260, 278, 346, 419, 448, 485
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1487 = CGACCTTGTGCCTGCA-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1489 = CGACCTTGTGCGCTTG-1

using 140 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 135]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGACCTTGTGCGCTTG-1 contig 1 = AGGGTCCTGC...
umi ATCAGGTTGG = 133 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=547]
58-414 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=42)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
494-547 ==> 0-53 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGREYASGQDYYYGMDVW at 403, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 130
start codons at 14, 58, 102, 281, 422, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1493 = CGACCTTGTGTCGCTG-1

using 235 reads

====================================================================================

graph has 97 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 227]
surviving nonsolo ucounts = 1[227]
ids = [1]

====================================================================================

UMI info for barcode CGACCTTGTGTCGCTG-1 contig 1 = GCTGTGCTGT...
umi CGAATGTGCT = 218 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=566]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-566 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1494 = CGACCTTGTGTTGAGG-1

using 49 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1495 = CGACCTTGTTAAGAAC-1

using 303 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 298]
surviving nonsolo ucounts = 1[298]
ids = [3]

====================================================================================

UMI info for barcode CGACCTTGTTAAGAAC-1 contig 1 = AGGAGTCAGA...
umi GATCCCGGTA = 300 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1496 = CGACCTTGTTACGACT-1

using 94 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[94]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1502 = CGACCTTGTTGTCGCG-1

using 314 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4^2, 5, 8, 286]
surviving nonsolo ucounts = 1[286]
ids = [6]

====================================================================================

UMI info for barcode CGACCTTGTTGTCGCG-1 contig 1 = GGAGTCAGTC...
umi CTCGGTGTTC = 284 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=12)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQLNSYRF at 353, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 26, 32, 88, 134, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1509 = CGACCTTTCAAGGTAA-1

using 49 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 6, 13, 23]
surviving nonsolo ucounts = 2[13, 23]
ids = [5, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1517 = CGACCTTTCATGCATG-1

using 406 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 395]
surviving nonsolo ucounts = 1[395]
ids = [2]

====================================================================================

UMI info for barcode CGACCTTTCATGCATG-1 contig 1 = AGCTCTGAGA...
umi ATACGGCTCT = 392 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=568]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=3)
451-497 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAKSLSKYGYEGDYW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 382
start codons at 79, 230, 235, 382, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1520 = CGACCTTTCATGTCTT-1

using 19 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1524 = CGACCTTTCCACGAAT-1

using 61466 reads

====================================================================================

graph has 20623 edges initially, 212 edges after simplification

total ucounts = 3095
nonsolo ucounts = 1534[2^589, 3^302, 4^153, 5^89, 6^54, 7^28, 8^23, 9^9, 10^8, 11^7, 12^5, 13^7, 14^4, 15, 16^3, 17^2, 18^2, 19^3, 20, 21^2, 22, 24, 25, 32, 34, 37, 39, 41, 45, 46, 49^3, 51, 54, 63^2, 65, 68, 70, 78, 79, 80^2, 81^2, 85, 86, 88, 90, 91, 94, 97, 98, 99, 100^2, 101, 103, 106, 107, 112, 117, 119, 120, 122, 123, 124, 126, 129, 130, 132, 134, 137, 139^2, 140^2, 141^2, 147, 150, 154, 155, 157, 158^3, 160^2, 161^2, 166, 168, 170, 171, 177, 178^2, 179, 181, 182, 184, 185^2, 186^2, 189^3, 190^3, 192^3, 194, 195, 198, 199, 201^2, 203^4, 205^3, 206^2, 207, 210, 212^2, 213, 214^2, 215, 216^2, 217, 218, 219^2, 220^2, 221^2, 222, 223, 225, 227^2, 228^2, 229, 232^2, 233, 234^2, 235, 236, 237^2, 238^3, 240, 241, 242, 243, 245, 246^2, 247, 248, 249, 251, 254^2, 255, 256^2, 258, 259^2, 261, 262, 263^3, 264^2, 266^2, 267, 268^3, 269^2, 270^2, 273, 274^2, 275, 276, 280^3, 283, 284, 285^3, 286, 288, 289, 290^3, 294, 295, 296, 299, 300, 304, 307, 313, 315, 316, 322, 326, 329, 337, 339, 345, 360, 362, 377, 404, 406, 418, 465, 489, 492, 509, 529, 533, 543, 577, 589, 610, 635, 640, 707^2, 850, 1359]
surviving nonsolo ucounts = 227[4, 17, 37, 41, 45, 49^3, 63^2, 68, 70, 78, 79, 80, 81^2, 85, 86, 88, 90, 91, 97, 98, 99, 100, 103, 106, 107, 112, 117, 119, 120, 122, 123, 124, 126, 129, 130, 134, 137, 139, 140^2, 141^2, 147, 150, 154, 155, 157, 158^3, 160^2, 161^2, 166, 168, 170, 171, 177, 178^2, 179, 181, 182, 184, 185^2, 186^2, 189^3, 190^3, 192^3, 194, 195, 198, 199, 201^2, 203^4, 205^3, 206^2, 207, 210, 212^2, 213, 214^2, 215, 216^2, 217, 218, 219^2, 220^2, 221^2, 222, 223, 225, 227^2, 228^2, 229, 232^2, 233, 234^2, 235, 236, 237^2, 238^3, 240, 241, 242, 243, 245, 246^2, 247, 248, 249, 251, 254^2, 255, 256^2, 258, 259^2, 261, 262, 263^3, 264^2, 266^2, 267, 268^3, 269^2, 270^2, 273, 274^2, 276, 280^3, 283, 284, 285^3, 286, 288, 289, 290^3, 294, 295, 296, 299, 300, 304, 307, 313, 315, 316, 322, 326, 329, 337, 339, 345, 360, 362, 377, 404, 406, 418, 465, 489, 492, 509, 529, 533, 543, 577, 589, 610, 635, 640, 707^2, 850, 1359]
ids = [1777, 1442, 1207, 1605, 1459, 551, 559, 1036, 1040, 2180, ...]

====================================================================================

UMI info for barcode CGACCTTTCCACGAAT-1 contig 1 = TGGGGCTCCA...
umi AAAACAGCGG = 221 reads: +388 validated
umi AAACTCCGCG = 178 reads: +388 validated
umi AACGGTTCAA = 275 reads: +388 validated
umi AATCCTCACT = 270 reads: +388 validated
umi ACCACTGTCG = 505 reads: +23 -11XX +1 -3XX +1 -5XX +2 -342XX invalidated
umi ACCCTTTTCC = 227 reads: +388 validated
umi ACCGGTTCGA = 190 reads: +388 validated
umi ACCTTCCACA = 265 reads: +388 validated
umi ACGAATCCTT = 266 reads: +388 validated
umi ACTCCTCCGC = 148 reads: +351 -1 +36 non-validated
umi ACTCCTTTCC = 264 reads: +388 validated
umi AGATTGGGTC = 234 reads: +388 validated
umi AGCACGTTTC = 285 reads: +388 validated
umi AGCTCATTTA = 213 reads: +388 validated
umi AGTTCCCGCG = 263 reads: +388 validated
umi ATACTTGGTT = 144 reads: +388 validated
umi ATCCAGAATC = 321 reads: +388 validated
umi ATCCCTGTCC = 246 reads: +388 validated
umi ATCGCGTTAC = 266 reads: +388 validated
umi ATGAACCGCA = 295 reads: +388 validated
umi ATGTATAGGC = 140 reads: +388 validated
umi ATTCTTCCTA = 266 reads: +388 validated
umi ATTTCCTCTA = 184 reads: +388 validated
umi ATTTTTTACA = 224 reads: +388 validated
umi CAAAATTCCG = 244 reads: +388 validated
umi CACACGGGGT = 240 reads: +388 validated
umi CACGTTCCTT = 280 reads: +388 validated
umi CAGCTCGCTT = 213 reads: +388 validated
umi CAGGCATCTT = 706 reads: -191 +197 non-validated
umi CAGGTCCCTG = 203 reads: -388 non-validated
umi CAGTTATCTC = 260 reads: +388 validated
umi CATGTTGGCG = 288 reads: +388 validated
umi CATTTACCTT = 250 reads: +388 validated
umi CCACAAGCTC = 224 reads: +388 validated
umi CCAGCGTTCT = 138 reads: +388 validated
umi CCCCTGTCCG = 299 reads: +46 -1XX +341 invalidated
umi CCCCTTTACA = 231 reads: +388 validated
umi CCCGAACATC = 248 reads: +388 validated
umi CCCTGACGGC = 150 reads: +388 validated
umi CCCTGTCTGT = 257 reads: +388 validated
umi CCGCGAGCGA = 260 reads: +388 validated
umi CCTGATAACC = 214 reads: +388 validated
umi CCTTAGTCTC = 233 reads: +388 validated
umi CCTTCGCACC = 193 reads: +388 validated
umi CGAAACTTGC = 217 reads: +388 validated
umi CGAGCCCTCC = 126 reads: +29 -7X +1 -1XX +4 -1XX +345 invalidated
umi CGAGTCATGT = 262 reads: +388 validated
umi CGAGTTTGAA = 266 reads: +388 validated
umi CGCCAACCAA = 192 reads: +388 validated
umi CGGTATTGGC = 289 reads: +388 validated
umi CGTACCTCTC = 28 reads: -388 non-validated
umi CGTTGTTGGA = 711 reads: -192X +196 invalidated
umi CTAAGCCCTT = 126 reads: +388 validated
umi CTACCACCTG = 309 reads: +388 validated
umi CTAGAGACCC = 240 reads: +388 validated
umi CTATGTGGCA = 339 reads: +388 validated
umi CTGAACTCGG = 262 reads: +388 validated
umi CTGGGTTCTT = 179 reads: +388 validated
umi CTGTAGCTTC = 211 reads: +388 validated
umi CTTAAACTGT = 121 reads: +388 validated
umi CTTAAGAGCA = 248 reads: +388 validated
umi CTTAAGTCGC = 195 reads: +388 validated
umi CTTATACGCG = 196 reads: +388 validated
umi CTTCCAGGAC = 239 reads: +388 validated
umi CTTTCTCGCG = 219 reads: +388 validated
umi GATTGGAACT = 292 reads: +388 validated
umi GCACAAGCCC = 244 reads: +388 validated
umi GCACCTTAGC = 285 reads: +388 validated
umi GCCCCTTCTC = 259 reads: +388 validated
umi GCCGATTCGG = 278 reads: +388 validated
umi GCTTTTACTC = 183 reads: +388 validated
umi GGAACCGGAT = 208 reads: +388 validated
umi GGCGCACCTT = 210 reads: +388 validated
umi GGTTCTTCCC = 136 reads: +388 validated
umi GTCATATTCA = 270 reads: +388 validated
umi GTCCGCCTTT = 304 reads: +388 validated
umi GTTCCTACTG = 330 reads: +388 validated
umi TAACATTGAG = 291 reads: +388 validated
umi TAACTTTCAG = 241 reads: +388 validated
umi TAATCCTTCG = 160 reads: +388 validated
umi TACCTTATAC = 217 reads: +388 validated
umi TACGTTCTTC = 189 reads: +388 validated
umi TAGTAAACCG = 217 reads: +388 validated
umi TATCCGAGCA = 653 reads: +33 -7XX +2 -1XX +2 -5XX +1 -3X +1 -333X invalidated
umi TATTTATCGC = 212 reads: +388 validated
umi TCAAAGTCCC = 255 reads: +388 validated
umi TCACCCTCGT = 204 reads: +388 validated
umi TCACGCGCAG = 222 reads: +388 validated
umi TCCCACTTGT = 227 reads: +388 validated
umi TCGCAATCTC = 284 reads: +388 validated
umi TCTGCATCCC = 228 reads: +388 validated
umi TCTTGGTGTA = 220 reads: +388 validated
umi TGAACGATAT = 237 reads: +388 validated
umi TGATCATCTC = 132 reads: +388 validated
umi TGCAGCTTTC = 132 reads: +388 validated
umi TGCTTTGTCT = 232 reads: +388 validated
umi TGGACGAGCT = 261 reads: +388 validated
umi TGGCATAACC = 231 reads: +388 validated
umi TGTCCAGGGC = 205 reads: +388 validated
umi TTAATCTGAT = 158 reads: -15X +2 -7XX +1 -4XX +2 -9XX +1 -3XX +344 invalidated
umi TTCTCAAACA = 243 reads: +388 validated
umi TTTAGAAGTC = 261 reads: +388 validated
umi TTTGCATGGC = 169 reads: +388 validated

UMI info for barcode CGACCTTTCCACGAAT-1 contig 2 = GAGCTCTGGG...
umi AAACGTAATC = 91 reads: +406 validated
umi AACAGCACCC = 123 reads: +350 -1 +10 -9 +7 -1 +11 -1 +16 non-validated
umi AACCCGATTG = 206 reads: +406 validated
umi AATGGTTACT = 524 reads: +49 -5XX +2 -2XX +1 -7XX +1 -1XX +1 -3XX +4 -5XX +1 -125XX +1 -1XX +1 -2XX +1 -2XX +1 -4XX +1 -1XX +1 -2XX +4 -1XX +1 -5XX +2 -3XX +165 invalidated
umi ACCCGTGTGT = 186 reads: +406 validated
umi ACTTGTTACT = 202 reads: +378 -1 +2 -2 +2 -1 +1 -1 +2 -1 +6 -1 +8 non-validated
umi AGATTGCCGC = 78 reads: +350 -8 +48 non-validated
umi AGTTCACAGG = 228 reads: +406 validated
umi ATATCCTCGG = 46 reads: +283 -1X +69 -53 invalidated
umi ATCCTGGGCG = 168 reads: +382 -24 non-validated
umi ATTAATGCTA = 250 reads: +406 validated
umi ATTATACGCA = 457 reads: +49 -5XX +2 -2XX +1 -7XX +1 -1XX +1 -3XX +4 -5XX +1 -125XX +1 -1XX +1 -2XX +1 -2XX +1 -4XX +1 -1XX +1 -2XX +4 -1XX +1 -5XX +2 -3XX +165 invalidated
umi ATTCAATTGC = 102 reads: +382 -1 +6 -1 +16 non-validated
umi ATTCTCCGCT = 119 reads: +392 -14 non-validated
umi ATTGTTATTA = 184 reads: +406 validated
umi ATTTCTAGCC = 195 reads: +406 validated
umi ATTTGTTGCC = 31 reads: -141 +3 -2XX +1 -4XX +1 -3XX +1 -2XX +1 -2XX +4 -1XX +8 -1XX +1 -1XX +21 -1XX +1 -1XX +1 -2XX +1 -2XX +2 -3XX +1 -2XX +3 -1XX +4 -2XX +1 -2XX +2 -2XX +2 -172 invalidated
umi CAACTCTTCA = 86 reads: +294 -1 +2 -1 +56 -52 non-validated
umi CACCGCAGCG = 563 reads: +49 -5XX +2 -2XX +1 -7XX +1 -1XX +1 -3XX +4 -5XX +1 -125X +1 -1XX +1 -2XX +1 -2XX +1 -4XX +1 -1XX +1 -2XX +4 -1XX +1 -5XX +2 -3XX +165 invalidated
umi CAGAAACCTC = 533 reads: +406 validated
umi CAGTCCATCG = 191 reads: +220 -1X +1 -3XX +1 -2XX +178 invalidated
umi CATGCGGTTC = 156 reads: +391 -15 non-validated
umi CCACTTAGTG = 49 reads: +406 validated
umi CCAGATGTTG = 65 reads: +354 -52 non-validated
umi CCGCAATGAG = 269 reads: +406 validated
umi CCGTGATGTC = 161 reads: +406 validated
umi CCTCATTATG = 125 reads: +406 validated
umi CCTTAATCGT = 106 reads: +399 -7 non-validated
umi CCTTTGTATC = 137 reads: +406 validated
umi CGTATTAACT = 174 reads: +393 -13 non-validated
umi CTGGTGCGGC = 188 reads: +392 -14 non-validated
umi CTGTTTTGCC = 42 reads: +368 -38 non-validated
umi CTTCACCAAT = 79 reads: +406 validated
umi CTTTACCGTA = 133 reads: +367 -39 non-validated
umi GAAAGCCTCT = 70 reads: +384 -22 non-validated
umi GAACTTCTTT = 235 reads: +406 validated
umi GACGTAATTG = 587 reads: +406 validated
umi GACTCGCGAT = 158 reads: +406 validated
umi GCCATTTCCA = 81 reads: +367 -33 +6 non-validated
umi GCCTCTGGTG = 640 reads: +60 -3XX +1 -1XX +1 -5XX +2 -4XX +1 -5XX +1 -128 +2 -4XX +1 -3XX +1 -2XX +1 -12XX +168 invalidated
umi GCCTGATATC = 206 reads: +406 validated
umi GCGTCATGTT = 156 reads: +406 validated
umi GGCGCGTTCA = 267 reads: +406 validated
umi GGGTCGGGAA = 190 reads: +406 validated
umi GGTGTCTCTG = 300 reads: +406 validated
umi GGTGTGTATG = 113 reads: +355 -1 +22 -1 +8 -1 +8 -10 non-validated
umi GTCATAATAG = 154 reads: +406 validated
umi GTCCGCCCAA = 89 reads: +404 -2 non-validated
umi GTTCCCATAG = 260 reads: +406 validated
umi TACGTATCTT = 299 reads: +46 -4XX +1 -2XX +1 -164XX +1 -8X +1 -4XX +1 -1XX +1 -4XX +167 invalidated
umi TACTTCAGCA = 209 reads: +406 validated
umi TCAATATACT = 104 reads: +46 -4XX +1 -2XX +1 -162XX +1 -1X +1 -8X +1 -4X +1 -1XX +1 -4XX +124 -1 +42 invalidated
umi TCACGGTCCT = 86 reads: +311 -5 +56 -34 non-validated
umi TCGTCAATGC = 235 reads: +341 -1 +3 -1 +7 -1 +52 non-validated
umi TGAACTTCAT = 199 reads: +361 -45 non-validated
umi TGAGGTTATC = 306 reads: +406 validated
umi TGGAGCCCTT = 200 reads: +401 -1 +4 non-validated
umi TGGCTAGGTT = 192 reads: +406 validated
umi TGTACACGGT = 191 reads: +391 -15 non-validated
umi TTAGTATGAC = 651 reads: +406 validated
umi TTCACGCCAT = 78 reads: +369 -37 non-validated
umi TTCTATCACT = 271 reads: +406 validated
umi TTGCATACCT = 81 reads: +346 -4 +56 non-validated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 99 umis using 3965 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [2, 28, 86, 140, 242, 269, 278, 297, 301, 353] and 93 others
of which 102 are surviving nonsolos
reads assigned: 24679
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=21)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 39 umis using 883 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [25, 57, 71, 155, 264, 388, 428, 503, 559, 604] and 53 others
of which 63 are surviving nonsolos
reads assigned: 12597
start codons at 80, 231, 236, 297, 315, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=571]
0-81 ==> 5527-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 356, score = 4 + 8
umis assigned: [24, 114, 157, 227, 275, 355, 380, 415, 627, 642] and 28 others
of which 37 are surviving nonsolos
reads assigned: 9042
start codons at 36, 69, 105, 193, 355, 375, 477
confident = false
not full
frameshifted full length transcript of length 571
VJ delta = 30
not full

TIG 2[bases=515]
4-335 ==> 2319-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
362-413 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
413-515 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [137, 292, 424, 551, 981, 1442]
of which 5 are surviving nonsolos
reads assigned: 482
start codons at 111, 236, 431, 492
confident = false
did not find CDR3

TIG 3[bases=340]
51-208 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
206-269 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
269-340 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [160, 875, 1086, 1519, 2108, 2137, 2180]
of which 7 are surviving nonsolos
reads assigned: 997
start codons at 58, 92, 131, 186, 226
confident = false
did not find CDR3
now this is a cell
paired!

AGCGGCCTGAGAGCTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGGTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1529 = CGACCTTTCCCAAGTA-1

using 314 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 118, 189]
surviving nonsolo ucounts = 2[118, 189]
ids = [1, 2]

====================================================================================

UMI info for barcode CGACCTTTCCCAAGTA-1 contig 1 = TGAGCGCAGA...
umi CCAAATGCCG = 108 reads: +382 -1 +5 non-validated

UMI info for barcode CGACCTTTCCCAAGTA-1 contig 2 = AGCTCTGAGA...
umi CTCTGCTAGT = 186 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=436]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=11)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 16 reads
cdr3 = CATWDRSLSEVVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 36, 190, 241, 365
confident = false

TIG 2[bases=549]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=30)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
515-549 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARVLDDYCLGGICSYYFDSW at 421, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 79, 382, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1536 = CGACCTTTCCTTTCTC-1

using 213 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 206]
surviving nonsolo ucounts = 1[206]
ids = [1]

====================================================================================

UMI info for barcode CGACCTTTCCTTTCTC-1 contig 1 = GAGCTCTGGG...
umi CACATTCTTT = 197 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=541]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=4)
439-455 ==> 0-16 on |24|IGHD4-11|D-REGION| [len=16] (mis=0)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
501-541 ==> 0-40 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CASGTHDYSNYVYDYW at 422, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 80, 231, 236, 289, 294, 297, 383, 438, 459, 519
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1546 = CGACCTTTCGCGCCAA-1

using 563 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4^2, 240, 311]
surviving nonsolo ucounts = 2[240, 311]
ids = [1, 4]

====================================================================================

UMI info for barcode CGACCTTTCGCGCCAA-1 contig 1 = AGGAGTCAGA...
umi CGACGGCTAG = 242 reads: +388 validated
umi GTATCGTCTC = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 79 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 546
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1552 = CGACCTTTCTAACTGG-1

using 380 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 367]
surviving nonsolo ucounts = 1[367]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=537]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-305 ==> 0-275 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
305-355 ==> 310-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0) [SHIFT!]
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPQKEWTF at 331, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 30, 63, 99, 187, 314, 334, 443
confident = false
not full
frameshifted full length stopped transcript of length 537
VJ delta = 49
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1556 = CGACCTTTCTCTTATG-1

using 309 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 297]
surviving nonsolo ucounts = 1[297]
ids = [4]

====================================================================================

UMI info for barcode CGACCTTTCTCTTATG-1 contig 1 = GGAGGAACTG...
umi TCATACCCGC = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=19)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
422-486 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRSSWPPDHTF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 34, 239, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1560 = CGACCTTTCTGGCGAC-1

using 353 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 4, 347]
surviving nonsolo ucounts = 1[347]
ids = [1]

====================================================================================

UMI info for barcode CGACCTTTCTGGCGAC-1 contig 1 = GTTTCCATTC...
umi CGTGACCATT = 304 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=516]
0-41 ==> 26-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
41-394 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
414-465 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
465-516 ==> 0-51 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARDRRGRPIVYWFDPW at 383, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 41, 192, 197, 255, 258, 344, 483
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1572 = CGACTTCAGAGTGACC-1

using 20566 reads

====================================================================================

graph has 6014 edges initially, 38 edges after simplification

total ucounts = 696
nonsolo ucounts = 340[2^104, 3^68, 4^35, 5^10, 6^17, 7^8, 8^6, 9^4, 10^4, 11^3, 12, 14, 15, 17, 19, 32, 35, 36, 44, 63, 67, 70, 89, 90, 115, 116, 117, 134^2, 135, 143, 145, 147, 152, 163, 166, 180, 184, 185, 200, 229, 236, 239, 255, 259, 262, 263, 269, 270, 273, 284, 285, 287, 296^2, 297^2, 299^2, 302^2, 303^2, 305, 308^2, 309^2, 310, 312, 313, 317, 319, 320, 322^3, 325, 326, 334^2, 338, 340, 344, 346, 360, 365, 366, 446, 604, 645]
surviving nonsolo ucounts = 69[17, 35, 44, 63, 89, 115, 116, 117, 134^2, 135, 143, 145, 147, 163, 180, 184, 185, 200, 229, 236, 239, 255, 259, 262, 263, 269, 270, 273, 284, 285, 287, 296^2, 297^2, 299^2, 302^2, 303^2, 305, 308^2, 309^2, 310, 312, 313, 317, 319, 320, 322^3, 325, 326, 334^2, 338, 340, 344, 346, 360, 365, 366, 446, 645]
ids = [378, 495, 92, 401, 184, 390, 400, 510, 627, 675, ...]

====================================================================================

UMI info for barcode CGACTTCAGAGTGACC-1 contig 1 = GGGAGAGCCC...
umi AAAAGAATGG = 143 reads: +382 validated
umi AAACAGGCGG = 312 reads: +382 validated
umi AAAGAATGCC = 303 reads: +382 validated
umi AAATCGATCC = 327 reads: -335 +1 -1XX +1 -1XX +2 -6XX +2 -1XX +3 -1XX +3 -3XX +9 -1XX +12 invalidated
umi AATCCATAGG = 240 reads: +382 validated
umi AATTAAAACT = 348 reads: +382 validated
umi AATTACATGT = 320 reads: +382 validated
umi ACATAGGATT = 302 reads: +382 validated
umi ACCGTTGGTA = 301 reads: +382 validated
umi ACGAAGCGCT = 296 reads: +382 validated
umi ACTGTTTCTT = 229 reads: +382 validated
umi ACTTCACCGT = 182 reads: +382 validated
umi AGAAATCCGG = 316 reads: +196 -1XX +185 invalidated
umi AGAGCTCGCC = 309 reads: +382 validated
umi AGTCAACCAC = 342 reads: +382 validated
umi AGTTTCACAG = 285 reads: +330 -1XX +51 invalidated
umi ATAAGCCCCT = 332 reads: +382 validated
umi ATAAGGCGGC = 145 reads: +382 validated
umi ATAGTTTATT = 295 reads: +382 validated
umi ATCATGACAA = 365 reads: +382 validated
umi ATGTCCATCG = 268 reads: +382 validated
umi CAACGGCGCG = 255 reads: +382 validated
umi CACGTGGCTT = 323 reads: +382 validated
umi CACTTTCGGC = 324 reads: +382 validated
umi CATGTGCGTC = 201 reads: +382 validated
umi CATGTGCTCT = 188 reads: +382 validated
umi CATGTGGGCT = 272 reads: +382 validated
umi CATTGACACT = 334 reads: +382 validated
umi CCAATAGGTC = 262 reads: +382 validated
umi CCCCCCTTCA = 240 reads: +382 validated
umi CCTCTATAGT = 330 reads: +382 validated
umi CGAGGTCCTG = 363 reads: +382 validated
umi CGATGCTGTC = 323 reads: +382 validated
umi CGCACACATC = 296 reads: +382 validated
umi CGGCGTCGCG = 132 reads: +382 validated
umi CGGCGTCGCT = 146 reads: +382 validated
umi CTAATAGCAA = 131 reads: -11 +1 -3X +2 -8XX +2 -4XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +36 -9XX +1 -1X +289 invalidated
umi CTTTCGCCTT = 285 reads: +382 validated
umi GAACCCTCTA = 316 reads: +382 validated
umi GAAGTCCAGC = 301 reads: +382 validated
umi GACATGGGAC = 304 reads: +382 validated
umi GCCCTTAAAC = 321 reads: +382 validated
umi GTAATACAGA = 270 reads: +382 validated
umi GTTAGACTAA = 309 reads: +382 validated
umi GTTCTACTGA = 305 reads: +382 validated
umi TACTGCGATA = 314 reads: +382 validated
umi TAGTGACTGG = 320 reads: +382 validated
umi TATCCACAGT = 293 reads: +382 validated
umi TCAAATTTGG = 310 reads: +382 validated
umi TCAATAGAGG = 340 reads: +382 validated
umi TCAGAACCGC = 264 reads: +382 validated
umi TGAAGTGGGC = 311 reads: +382 validated
umi TGCGAATTAG = 338 reads: +382 validated
umi TTACCCCCGT = 136 reads: +382 validated
umi TTATCAACCT = 255 reads: +382 validated
umi TTTTTGAGCG = 315 reads: +382 validated

UMI info for barcode CGACTTCAGAGTGACC-1 contig 2 = AGCTCTGGGA...
umi ACTATTCTAT = 43 reads: +306 -23 +56 -36 non-validated
umi GCAACAAGGA = 115 reads: +421 validated
umi GCATCTTATC = 116 reads: +401 -1 +19 non-validated
umi GCATTCCTCG = 63 reads: +317 -1 +1 -3 +4 -2 +2 -1 +1 -1 +4 -1 +16 -1 +2 -1 +1 -3 +12 -1 +10 -1 +35 non-validated
umi TACACTGCTT = 35 reads: +392 -29 non-validated
umi TAGAGACCTG = 118 reads: +392 -1 +1 -1 +7 -19 non-validated
umi TATTCGAACG = 311 reads: +421 validated
umi TTAGCCTGCG = 164 reads: +421 validated
umi TTTACAATCG = 133 reads: +408 -13 non-validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 55 umis using 2354 reads
cdr3 = CQQRSNWPLTF at 368, score = 9 + 9
umis assigned: [1, 3, 9, 12, 47, 53, 54, 64, 78, 81] and 46 others
of which 55 are surviving nonsolos
reads assigned: 15443
start codons at 47, 252, 255, 471
confident = true

TIG 2[bases=572]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=21)
467-501 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 50 reads
cdr3 = CAITRGSGPGGHFNFW at 422, score = 8 + 7
umis assigned: [92, 390, 400, 401, 495, 510, 527, 629, 675]
of which 9 are surviving nonsolos
reads assigned: 1083
start codons at 80, 236, 312, 383
confident = true

REJECT CONTIGS

TIG 1[bases=787]
0-556 ==> 1751-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=2)
552-714 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
714-752 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
752-787 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=2)
umis assigned: [184, 642]
of which 2 are surviving nonsolos
reads assigned: 360
start codons at 35, 84, 91, 151, 236, 301, 333, 368, 392, 469, 522, 526, 577, 582, 695
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCGATAACTCGGGGCTCTGGTCCAGGGGGTCATTTCAACTTTTGGGGCCAGGGGACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1586 = CGACTTCAGGAGCGAG-1

using 2287 reads

====================================================================================

graph has 3118 edges initially, 36 edges after simplification

total ucounts = 990
nonsolo ucounts = 428[2^155, 3^113, 4^51, 5^36, 6^23, 7^16, 8^15, 9^6, 10^4, 11^2, 12, 13, 15, 16^2, 24, 109]
surviving nonsolo ucounts = 1[109]
ids = [844]

====================================================================================

UMI info for barcode CGACTTCAGGAGCGAG-1 contig 1 = TGATCAGGAC...
umi TGATCATCCG = 103 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=498]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
428-498 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CMQALQTPRTF at 367, score = 9 + 8
umis assigned: [844]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1593 = CGACTTCAGGGCTTCC-1

using 90 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 8, 74]
surviving nonsolo ucounts = 1[74]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1594 = CGACTTCAGGTAGCTG-1

using 219 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 211]
surviving nonsolo ucounts = 1[211]
ids = [2]

====================================================================================

UMI info for barcode CGACTTCAGGTAGCTG-1 contig 1 = ATCATCCAAC...
umi ACTCAATACA = 208 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=561]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-561 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 58, 214, 256, 322, 355, 445, 542
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1600 = CGACTTCAGTATGACA-1

using 217 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 205]
surviving nonsolo ucounts = 1[205]
ids = [3]

====================================================================================

UMI info for barcode CGACTTCAGTATGACA-1 contig 1 = ACCCAAAAAC...
umi TCAATGTACC = 194 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=521]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-521 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1609 = CGACTTCAGTGTTGAA-1

using 407 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 32
nonsolo ucounts = 20[2, 3^7, 4^3, 5, 6^2, 7, 8, 10^2, 12, 296]
surviving nonsolo ucounts = 1[296]
ids = [31]

====================================================================================

UMI info for barcode CGACTTCAGTGTTGAA-1 contig 1 = ATCAGTCCCA...
umi TTTCCAGGGC = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-488 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [31]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1613 = CGACTTCCAAAGCGGT-1

using 47 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^2, 3^2, 4, 5, 10^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1618 = CGACTTCCAAGGTTTC-1

using 225 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 4, 215]
surviving nonsolo ucounts = 1[215]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1619 = CGACTTCCAAGTTCTG-1

using 224 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode CGACTTCCAAGTTCTG-1 contig 1 = GAGGAATCAG...
umi ATAATGCCGG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=451]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-451 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1620 = CGACTTCCAATCTGCA-1

using 253 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 5, 6, 234]
surviving nonsolo ucounts = 1[234]
ids = [5]

====================================================================================

UMI info for barcode CGACTTCCAATCTGCA-1 contig 1 = AGGAGTCAGA...
umi GTCTATGATA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=2)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=33)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-486 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYHSYSPTF at 354, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1622 = CGACTTCCAATGGACG-1

using 170 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

UMI info for barcode CGACTTCCAATGGACG-1 contig 1 = AGCTCAGCTT...
umi CGAGTCAGGG = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
440-579 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAAWDDSLKGYVF at 373, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 52, 356, 381, 386, 404, 572
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1632 = CGACTTCCACGTCAGC-1

using 197 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [0]

====================================================================================

UMI info for barcode CGACTTCCACGTCAGC-1 contig 1 = CTCTGCCTCA...
umi CAGCATACGG = 186 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=495]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
406-444 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
444-495 ==> 0-51 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDTSLSGSNVF at 374, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 50, 204, 207, 258, 357, 384, 408
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1633 = CGACTTCCACGTGAGA-1

using 5696 reads

====================================================================================

graph has 5881 edges initially, 132 edges after simplification

total ucounts = 1073
nonsolo ucounts = 798[2^129, 3^84, 4^91, 5^83, 6^71, 7^66, 8^47, 9^46, 10^42, 11^25, 12^24, 13^17, 14^19, 15^12, 16^7, 17^11, 18^7, 19^7, 20^3, 21^2, 22^3, 27, 51]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1643 = CGACTTCCAGCTCGAC-1

using 308 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 7, 125, 169]
surviving nonsolo ucounts = 2[125, 169]
ids = [5, 1]

====================================================================================

UMI info for barcode CGACTTCCAGCTCGAC-1 contig 1 = GCTCTGCTTC...
umi ATATGGTGTC = 165 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=561]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-561 ==> 0-116 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1647 = CGACTTCCAGTGAGTG-1

using 364 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[11, 349]
surviving nonsolo ucounts = 1[349]
ids = [0]

====================================================================================

UMI info for barcode CGACTTCCAGTGAGTG-1 contig 1 = GGAGGAACTG...
umi CCTCAACTCT = 315 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=469]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-469 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYNDWPPLTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 34, 103, 130, 239, 242, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1662 = CGACTTCGTAAACCTC-1

using 415 reads

====================================================================================

graph has 236 edges initially, 18 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^2, 4, 9, 28, 130, 233]
surviving nonsolo ucounts = 3[28, 130, 233]
ids = [13, 8, 9]

====================================================================================

UMI info for barcode CGACTTCGTAAACCTC-1 contig 1 = GGGGTCTCAG...
umi CACCGTTCTT = 124 reads: +388 validated
umi TTCTACCATC = 12 reads: +17 -1XX +7 -1XX +14 -1XX +6 -1XX +8 -1XX +21 -2XX +3 -1XX +5 -1XX +17 -2XX +21 -1XX +1 -1XX +7 -1XX +5 -3XX +2 -1XX +3 -3XX +3 -1XX +1 -225X invalidated

UMI info for barcode CGACTTCGTAAACCTC-1 contig 2 = GCTGCTCAGT...
umi CTGACTCAAT = 221 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=438]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-366 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=14)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 19 reads
cdr3 = CSSEAGSYTLLF at 362, score = 8 + 9
umis assigned: [8, 13]
of which 2 are surviving nonsolos
reads assigned: 133
start codons at 38, 189, 195, 246, 249, 345
confident = false

TIG 2[bases=509]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-364 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
410-509 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYRNSITF at 352, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 28, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1667 = CGACTTCGTAGCAAAT-1

using 205 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 6, 188]
surviving nonsolo ucounts = 1[188]
ids = [3]

====================================================================================

UMI info for barcode CGACTTCGTAGCAAAT-1 contig 1 = GCTCTGCTTC...
umi CTAAACATAA = 186 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-535 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1678 = CGACTTCGTCTTTCAT-1

using 387 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 4, 377]
surviving nonsolo ucounts = 1[377]
ids = [2]

====================================================================================

UMI info for barcode CGACTTCGTCTTTCAT-1 contig 1 = GGAATCAGTC...
umi CCCGTGCTCT = 376 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1692 = CGACTTCTCACGCGGT-1

using 271 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 6, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode CGACTTCTCACGCGGT-1 contig 1 = TGGGGTCACA...
umi TCATAACCAC = 252 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=578]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
396-424 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-578 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CFSYGTSGRTF at 363, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 39, 247, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1693 = CGACTTCTCACGGTTA-1

using 240 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 230]
surviving nonsolo ucounts = 1[230]
ids = [5]

====================================================================================

UMI info for barcode CGACTTCTCACGGTTA-1 contig 1 = AGTGCTTTCT...
umi TACTTCCAGG = 222 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=553]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=7)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
453-553 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARAHGDYYTLLDCW at 377, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 17, 38, 82, 168, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1695 = CGACTTCTCACTCTTA-1

using 35 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 23]
surviving nonsolo ucounts = 1[23]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1710 = CGACTTCTCCAATGGT-1

using 234 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3^2, 220]
surviving nonsolo ucounts = 1[220]
ids = [8]

====================================================================================

UMI info for barcode CGACTTCTCCAATGGT-1 contig 1 = GCAAACAGAG...
umi CAACTGTACT = 1 reads: -379 +8 -1X invalidated
umi TAGGCTATTT = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
427-539 ==> 0-112 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSAWDSSLNVWVF at 360, score = 7 + 8
umis assigned: [2, 8]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 39, 178, 368, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1711 = CGACTTCTCCAGAAGG-1

using 442 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 7, 426]
surviving nonsolo ucounts = 1[426]
ids = [3]

====================================================================================

UMI info for barcode CGACTTCTCCAGAAGG-1 contig 1 = AATGGGGGGG...
umi GTGGTCTTTG = 417 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=578]
45-406 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
401-439 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
439-578 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CSSYTSSSTLFYVF at 369, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 1, 45, 202, 246, 253, 256, 403, 571
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1714 = CGACTTCTCCATTCTA-1

using 65 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 5, 8, 48]
surviving nonsolo ucounts = 1[48]
ids = [4]

====================================================================================

UMI info for barcode CGACTTCTCCATTCTA-1 contig 1 = GATCAGGACT...
umi TTACAATCAT = 45 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=439]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 4 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1715 = CGACTTCTCCCAACGG-1

using 6841 reads

====================================================================================

graph has 4236 edges initially, 84 edges after simplification

total ucounts = 882
nonsolo ucounts = 417[2^155, 3^97, 4^52, 5^43, 6^20, 7^9, 8^10, 9^2, 11^3, 12, 15, 16, 20, 21, 22, 24, 104, 144, 161, 179, 187, 197, 222^2, 236, 273, 287, 288, 295, 304, 306, 318, 334, 346, 505]
surviving nonsolo ucounts = 20[24, 104, 144, 161, 179, 187, 197, 222^2, 236, 273, 287, 288, 295, 304, 306, 318, 334, 346, 505]
ids = [820, 72, 721, 519, 68, 14, 180, 832, 857, 385, ...]

====================================================================================

UMI info for barcode CGACTTCTCCCAACGG-1 contig 1 = GGATCACTCA...
umi AACGGCCTTT = 189 reads: +427 validated
umi ACCTTGCCGG = 104 reads: +427 validated
umi ATTATTCGGT = 201 reads: +357 -5 +18 -1 +8 -1 +28 -5 +4 non-validated
umi TTAGAATGCA = 23 reads: +19 -1 +225 -3 +3 -1 +57 -3 +78 -37 non-validated
umi TTCAATTCTC = 226 reads: +427 validated

UMI info for barcode CGACTTCTCCCAACGG-1 contig 2 = TGGGGGATCA...
umi ACCGTCTGAA = 181 reads: +397 validated
umi ACCTCTTGGG = 345 reads: +397 validated
umi AGGCTTCCAA = 288 reads: +397 validated
umi ATTGTGCATC = 303 reads: -322 +2 -3XX +3 -1XX +1 -2XX +1 -3XX +2 -4XX +2 -2XX +2 -3XX +1 -4XX +39 invalidated
umi CCTTTATCTT = 328 reads: +397 validated
umi CTCACCCCAG = 226 reads: +397 validated
umi GAGGCCCCGT = 310 reads: +397 validated
umi GCTGTGGGTC = 291 reads: +397 validated
umi GGACGTTCCT = 301 reads: +397 validated
umi GTATTTGTGT = 277 reads: +397 validated
umi TTGGGCCACA = 223 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=558]
60-413 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
424-487 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
487-558 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 36 reads
cdr3 = CARGLSNYGYYYYGMDVW at 402, score = 9 + 7
umis assigned: [14, 72, 180, 820, 832]
of which 5 are surviving nonsolos
reads assigned: 724
start codons at 60, 211, 258, 263, 267, 295, 324, 357, 444
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 385 reads
cdr3 = CMQALQTRWTF at 371, score = 9 + 8
umis assigned: [68, 71, 126, 190, 329, 385, 462, 532, 539, 586] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3028
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true

REJECT CONTIGS

TIG 1[bases=563]
0-49 ==> 0-49 on |208|IGHV7-4-1|5'UTR| [len=49] (mis=0)
0-49 ==> 5951-6000 on rc of segment after IGHV7-4-1 exon 1 [len=6000] (mis=0)
35-67 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
49-402 ==> 0-353 on |209|IGHV7-4-1|L-REGION+V-REGION| [len=353] (mis=1)
429-492 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [243, 264, 519, 721]
of which 4 are surviving nonsolos
reads assigned: 870
start codons at 49, 200, 205, 247, 252, 284, 419, 449
confident = false
frameshifted full length transcript of length 563
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGGGCTCAGTAACTACGGCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1716 = CGACTTCTCCCATTAT-1

using 206 reads

====================================================================================

graph has 134 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 7, 196]
surviving nonsolo ucounts = 2[7, 196]
ids = [0, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1723 = CGACTTCTCCTCGCAT-1

using 212 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 203]
surviving nonsolo ucounts = 1[203]
ids = [6]

====================================================================================

UMI info for barcode CGACTTCTCCTCGCAT-1 contig 1 = ATACTTTCTG...
umi TACAGATCTT = 204 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=513]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=24)
407-470 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
470-513 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARVFKSSWNSYIYYYGMDVW at 376, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 37, 81, 161, 182, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1725 = CGACTTCTCCTGTAGA-1

using 401 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 4, 385]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGACTTCTCCTGTAGA-1 contig 1 = GATACTTTCT...
umi CCACGAGTTC = 381 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=530]
38-386 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAGRRDSGSYSGYW at 383, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 379
start codons at 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1737 = CGACTTCTCTCCGGTT-1

using 13232 reads

====================================================================================

graph has 4626 edges initially, 44 edges after simplification

total ucounts = 825
nonsolo ucounts = 392[2^163, 3^75, 4^46, 5^24, 6^13, 7^10, 8^5, 11, 14, 16, 23, 30, 49, 54, 64, 78, 87^2, 102, 109, 119, 133, 150, 153^2, 155, 156, 172, 181, 188, 194, 199, 220^2, 222, 223, 229, 231, 232, 233, 234, 243, 247^2, 248, 257, 261^2, 265, 278, 285, 287, 288, 292, 299, 308, 311^2, 326, 469, 475, 476, 601]
surviving nonsolo ucounts = 50[54, 64, 78, 87^2, 102, 109, 119, 133, 150, 153^2, 155, 156, 172, 181, 188, 194, 199, 220^2, 222, 223, 229, 231, 232, 233, 234, 243, 247^2, 248, 257, 261^2, 265, 278, 285, 287, 288, 292, 299, 308, 311^2, 326, 469, 475, 476, 601]
ids = [25, 64, 529, 168, 369, 670, 820, 500, 291, 39, ...]

====================================================================================

UMI info for barcode CGACTTCTCTCCGGTT-1 contig 1 = AGACCCAGTC...
umi AATTCCGCTC = 247 reads: +388 validated
umi ATTTGAGTTA = 153 reads: +388 validated
umi CCACAGTCGT = 247 reads: +388 validated
umi CCCTCACTGC = 184 reads: +388 validated
umi CTGGCTTAGA = 219 reads: +388 validated

UMI info for barcode CGACTTCTCTCCGGTT-1 contig 2 = AGTGCTTTCT...
umi AAATAGTGGT = 286 reads: +445 validated
umi AACATTATAG = 289 reads: +445 validated
umi AACTTCCTTA = 53 reads: +395 -50 non-validated
umi AAGCACTTTG = 265 reads: +445 validated
umi AAGTTTCCAT = 249 reads: +230 -13 +5 -1 +8 -2 +4 -1X +1 -4X +3 -15X +1 -2X +2 -3X +3 -147X invalidated
umi ACAATTATCT = 224 reads: +445 validated
umi ACACCGTTAT = 312 reads: +445 validated
umi ACACTTTGGT = 65 reads: -26 +387 -1 +25 -6 non-validated
umi ACATTTCACT = 234 reads: +445 validated
umi ACCCCTTTGG = 224 reads: +445 validated
umi ATAGCAATTT = 472 reads: -286 +159 non-validated
umi ATCACGACAC = 230 reads: +445 validated
umi ATCTCATTAT = 87 reads: +20 -1X +1 -2 +1 -3X +410 -7 invalidated
umi ATGGGCTCAG = 259 reads: +445 validated
umi ATTATTCAGC = 158 reads: +445 validated
umi ATTGATACAC = 195 reads: +438 -7 non-validated
umi CACATCTTCT = 234 reads: +445 validated
umi CCACGTAAGT = 158 reads: +445 validated
umi CCCTTTTATT = 288 reads: +445 validated
umi CCGGTTGGGG = 134 reads: +425 -20 non-validated
umi CCTAACATGA = 231 reads: +408 -8 +4 -1 +24 non-validated
umi CTCCCCCCAC = 305 reads: +445 validated
umi CTCGTGCGTA = 90 reads: +430 -15 non-validated
umi CTGGGCGCAC = 209 reads: +445 validated
umi CTTTACCAAT = 282 reads: +445 validated
umi GCCTAAGGTA = 312 reads: +445 validated
umi GCTTCGACTT = 327 reads: +445 validated
umi GGGGAGTTCT = 118 reads: +445 validated
umi GTACATGTGC = 597 reads: -178X +267 invalidated
umi GTCCAACCCG = 76 reads: +376 -1X +68 invalidated
umi GTGTACACAG = 153 reads: +445 validated
umi GTTCATTCCT = 233 reads: +445 validated
umi TAGTCGTGCA = 171 reads: +445 validated
umi TCATCGTAGT = 244 reads: +445 validated
umi TCGTCTTTCC = 101 reads: -21 +424 non-validated
umi TCGTGCGGTC = 263 reads: +445 validated
umi TCGTGGTCAC = 223 reads: +445 validated
umi TGCACTTTGG = 291 reads: +445 validated
umi TGTAATTCCG = 293 reads: +445 validated
umi TGTATAATTA = 264 reads: +370 -1XX +74 invalidated
umi TTCAAGTATG = 190 reads: +445 validated
umi TTTTAGGTGG = 110 reads: +395 -45 +5 non-validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 155 reads
cdr3 = CQQANSFPLTF at 347, score = 9 + 9
umis assigned: [55, 196, 255, 276, 379]
of which 5 are surviving nonsolos
reads assigned: 1034
start codons at 20, 26, 82, 95, 231, 450
confident = true

TIG 2[bases=533]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
387-418 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
414-462 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 30 umis using 614 reads
cdr3 = CARGGIVVVPAAPHFDYW at 377, score = 9 + 7
umis assigned: [8, 17, 25, 31, 39, 60, 61, 64, 77, 80] and 32 others
of which 42 are surviving nonsolos
reads assigned: 9258
start codons at 17, 38, 82, 168
confident = true
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCGAGAGGCGGTATTGTAGTAGTACCAGCTGCTCCTCACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1738 = CGACTTCTCTCGAGTA-1

using 283 reads

====================================================================================

graph has 81 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 277]
surviving nonsolo ucounts = 1[277]
ids = [3]

====================================================================================

UMI info for barcode CGACTTCTCTCGAGTA-1 contig 1 = GAGAAGAGCT...
umi GACACTTTAC = 277 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQCGSFPRTF at 359, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 35, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1745 = CGACTTCTCTGTCAAG-1

using 305 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2^2, 293]
surviving nonsolo ucounts = 1[293]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
8-80 ==> 5674-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
409-474 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 23, 29, 85, 98, 234, 451
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1747 = CGACTTCTCTTACCTA-1

using 20 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1748 = CGACTTCTCTTGACGA-1

using 206 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================

UMI info for barcode CGACTTCTCTTGACGA-1 contig 1 = AGGAGTCAGT...
umi ATTCAACACT = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYDDLPITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 27, 33, 89, 102, 364, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1752 = CGACTTCTCTTTAGTC-1

using 252 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[5, 239]
surviving nonsolo ucounts = 1[239]
ids = [5]

====================================================================================

UMI info for barcode CGACTTCTCTTTAGTC-1 contig 1 = GTCAGTCTCA...
umi GTTCTCAGGC = 235 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1753 = CGAGAAGAGAACAACT-1

using 1190 reads

====================================================================================

graph has 1722 edges initially, 2 edges after simplification

total ucounts = 495
nonsolo ucounts = 252[2^95, 3^56, 4^42, 5^22, 6^16, 7^4, 8^8, 9^2, 10^2, 12, 15^2, 17, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1757 = CGAGAAGAGAGGTAGA-1

using 896 reads

====================================================================================

graph has 376 edges initially, 8 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[188, 295, 409]
surviving nonsolo ucounts = 3[188, 295, 409]
ids = [3, 4, 6]

====================================================================================

UMI info for barcode CGAGAAGAGAGGTAGA-1 contig 1 = GAATCAGTCC...
umi TGCTTGTTGC = 298 reads: +388 validated

UMI info for barcode CGAGAAGAGAGGTAGA-1 contig 2 = ACCCAAAAAC...
umi CCCTAAGGCT = 186 reads: +436 validated

UMI info for barcode CGAGAAGAGAGGTAGA-1 contig 3 = GGAACTGCTC...
umi TTTTACAGTC = 412 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=548]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-548 ==> 0-58 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 3[bases=555]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRSNWPPIFTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 403
start codons at 31, 236, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1760 = CGAGAAGAGATGGCGT-1

using 232 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 228]
surviving nonsolo ucounts = 2[3, 228]
ids = [1, 0]

====================================================================================

UMI info for barcode CGAGAAGAGATGGCGT-1 contig 1 = GTGGGCTCAG...
umi AAAACTGGGG = 224 reads: +385 validated
umi AAACTGGGGT = 3 reads: -88 +56 -241 non-validated

GOOD CONTIGS

TIG 1[bases=528]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-528 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 222
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1762 = CGAGAAGAGATGTGGC-1

using 768 reads

====================================================================================

graph has 310 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^2, 94, 664]
surviving nonsolo ucounts = 2[94, 664]
ids = [2, 0]

====================================================================================

UMI info for barcode CGAGAAGAGATGTGGC-1 contig 1 = AGAAGAGCTG...
umi AAAAACTTGC = 674 reads: +385 validated

UMI info for barcode CGAGAAGAGATGTGGC-1 contig 2 = AGGAGGCAGC...
umi AACCTTTGTC = 92 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 101 reads
cdr3 = CQQYGSSRGTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 659
start codons at 34, 242, 368, 461
confident = false

TIG 2[bases=572]
0-30 ==> 11-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
30-381 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
380-418 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
418-572 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CSSYTSSSTYVF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 30, 187, 231, 238, 382, 550
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1765 = CGAGAAGAGGACAGAA-1

using 763 reads

====================================================================================

graph has 330 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 160, 598]
surviving nonsolo ucounts = 2[160, 598]
ids = [0, 2]

====================================================================================

UMI info for barcode CGAGAAGAGGACAGAA-1 contig 1 = GCACTAGAAG...
umi CATCTGGCTA = 158 reads: +421 validated

UMI info for barcode CGAGAAGAGGACAGAA-1 contig 2 = TGGGAGGAAT...
umi GAATGCTTGA = 609 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
0-59 ==> 21-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=2)
59-410 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=40)
444-480 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CATAPPSLIWFGLQSW at 401, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 59, 161, 215, 268, 276, 294, 362
confident = false

TIG 2[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 96 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 588
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1769 = CGAGAAGAGGCAGGTT-1

using 241 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 232]
surviving nonsolo ucounts = 1[232]
ids = [6]

====================================================================================

UMI info for barcode CGAGAAGAGGCAGGTT-1 contig 1 = GTCAGTCTCA...
umi TTCTATACCT = 212 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=481]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-481 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTLSYTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1770 = CGAGAAGAGGCCGAAT-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1773 = CGAGAAGAGGTCATCT-1

using 47 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 42]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1781 = CGAGAAGAGTTAGCGG-1

using 20167 reads

====================================================================================

graph has 10174 edges initially, 166 edges after simplification

total ucounts = 1313
nonsolo ucounts = 599[2^203, 3^110, 4^78, 5^40, 6^24, 7^17, 8^12, 9^5, 10^5, 11^6, 12, 13^4, 14^2, 15, 16^2, 18^3, 19^2, 20, 21^2, 22, 31, 33, 39, 42, 82, 89, 92, 94, 117, 119, 123, 124, 125, 126, 144^2, 148^2, 154^2, 156, 157^2, 158, 159, 164, 169^5, 170, 171, 177^2, 182, 192, 194, 195, 197, 205, 207, 210^2, 215, 222, 225, 226, 228, 231, 240, 244, 247, 249, 250, 252, 260, 261, 268, 272, 278, 281, 287, 289^2, 293, 302, 305, 310, 317, 320, 327, 332, 338, 363, 366, 416, 499, 515, 642]
surviving nonsolo ucounts = 76[31, 42, 82, 89, 92, 94, 117, 119, 123, 124, 125, 126, 144^2, 148^2, 154^2, 156, 157, 158, 159, 164, 169^5, 170, 171, 177^2, 182, 192, 194, 195, 197, 207, 210^2, 215, 222, 225, 226, 228, 231, 240, 244, 247, 249, 250, 252, 260, 261, 268, 272, 278, 281, 287, 289^2, 293, 302, 305, 310, 317, 320, 327, 332, 338, 363, 366, 416, 499, 515, 642]
ids = [1099, 620, 929, 954, 316, 1266, 1026, 350, 970, 281, ...]

====================================================================================

UMI info for barcode CGAGAAGAGTTAGCGG-1 contig 1 = GAGCTCTGGG...
umi AATCTAGGTC = 168 reads: +430 validated
umi ATCATGTAAT = 165 reads: +430 validated
umi ATCGCGATTG = 95 reads: +321 -1 +3 -1 +9 -13 +82 non-validated
umi ATCGTAGTCG = 277 reads: +430 validated
umi CTATCTACGG = 42 reads: +241 -2 +46 -1XX +69 -1 +9 -1X +25 -1 +2 -3X +2 -1 +2 -24 invalidated
umi CTGGGGCTCA = 315 reads: +26 -1XX +403 invalidated
umi GTAATGAGCG = 286 reads: +430 validated
umi TAAGTATCTC = 89 reads: +417 -9 +3 -1 non-validated
umi TACCACTCCC = 366 reads: +430 validated
umi TATTTACGTG = 116 reads: +430 validated
umi TTGGCTTCCT = 87 reads: +412 -18 non-validated

UMI info for barcode CGAGAAGAGTTAGCGG-1 contig 2 = ACTGGTTGTT...
umi AACGATAGTA = 268 reads: +403 validated
umi AAGAGTATAC = 180 reads: +403 validated
umi ATTACATGTT = 217 reads: +403 validated
umi ATTCTCGGGA = 369 reads: +403 validated
umi CACGACACTA = 242 reads: +403 validated
umi CGATACCATC = 294 reads: +403 validated
umi CTCATTGTAG = 291 reads: +144 -1XX +3 -1X +254 invalidated
umi GTTGCACTAC = 82 reads: +403 validated
umi TAACTGTCGT = 319 reads: +403 validated
umi TAGTAATATT = 339 reads: +403 validated
umi TCTAGTACCT = 31 reads: +378 -25 non-validated

UMI info for barcode CGAGAAGAGTTAGCGG-1 contig 3 = AGCTCTGGGA...
umi AAGCCAGGCC = 290 reads: +439 validated
umi CAAAAATGCG = 293 reads: +439 validated
umi CACAGTCTCT = 236 reads: +423 -16 non-validated
umi CGGTATGGAT = 251 reads: +428 -11 non-validated
umi GGCTTCCTCT = 160 reads: +435 -4 non-validated
umi GTCAAACGGA = 246 reads: +439 validated
umi GTCCGACAAA = 322 reads: +419 -20 non-validated
umi TCACTATGCA = 170 reads: +439 validated

UMI info for barcode CGAGAAGAGTTAGCGG-1 contig 4 = GGGGGCTGGG...
umi AAGGTACTGC = 224 reads: +391 validated
umi AGAAATTCGT = 498 reads: +391 validated
umi ATAAGCAACC = 123 reads: +391 validated
umi ATTAGCCTAC = 181 reads: +391 validated
umi ATTCGAACGT = 119 reads: +391 validated
umi CAATGTTTGC = 206 reads: +391 validated
umi CACTGATCAT = 213 reads: +194 -1XX +196 invalidated
umi CCACCTTTGT = 229 reads: +391 validated
umi CCGGCCATCA = 219 reads: +391 validated
umi CTGATCGTCA = 170 reads: +391 validated
umi GATAAGCCTT = 239 reads: +391 validated
umi GATATTTCTT = 248 reads: +391 validated
umi GCCATTATTA = 178 reads: +391 validated
umi TAACTGTTCG = 303 reads: +391 validated
umi TACCCGTACC = 120 reads: +391 validated
umi TACCGCCGTC = 167 reads: +391 validated
umi TATCTTAGGA = 271 reads: +391 validated
umi TCAATATGAT = 146 reads: +391 validated
umi TCGACTTGCT = 641 reads: -369 +22 non-validated
umi TGCATAAGGC = 209 reads: +391 validated
umi TTTGCCACAG = 293 reads: +391 validated
umi TTTTACGTTT = 518 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=581]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
510-581 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 131 reads
cdr3 = CAKDLMARWGLVDYYFDYW at 422, score = 9 + 7
umis assigned: [106, 313, 316, 319, 620, 656, 868, 954, 968, 1026] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1971
start codons at 80, 231, 236, 294, 297, 315, 383, 437
confident = true

TIG 2[bases=649]
0-110 ==> 65-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
110-473 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=8)
475-513 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
513-649 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 320 reads
cdr3 = CQQYYNVLPITF at 449, score = 9 + 8
umis assigned: [48, 66, 341, 351, 389, 530, 630, 929, 948, 995] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2587
start codons at 110, 179, 432, 465, 555
confident = true

TIG 3[bases=589]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=1)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=10)
455-518 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=1)
518-589 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 56 reads
cdr3 = CARVLGEHTHGPKYYYYYYMDVW at 418, score = 8 + 7
umis assigned: [72, 359, 383, 572, 832, 891, 898, 1039]
of which 8 are surviving nonsolos
reads assigned: 1919
start codons at 79, 235, 475
confident = true

TIG 4[bases=647]
45-399 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
436-647 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 782 reads
cdr3 = CSSYTSSSTLVVF at 369, score = 8 + 8
umis assigned: [81, 205, 281, 344, 350, 377, 396, 443, 484, 649] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5420
start codons at 45, 202, 246, 253, 256
confident = true

REJECT CONTIGS

TIG 1[bases=811]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
0-86 ==> 5914-6000 on segment before IGLV6-57 exon 1 [len=6000] (mis=0)
86-129 ==> 0-43 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=0)
89-257 ==> 0-168 on segment before IGLV6-57 exon 2 [len=168] (mis=0)
254-564 ==> 43-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=1) [SHIFT!]
562-600 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
600-811 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [254, 270, 458, 473, 481, 505, 531, 573, 579, 637] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3682
start codons at 86, 168, 183, 274, 365, 416, 548
confident = false
did not find CDR3

TIG 2[bases=368]
48-205 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
203-266 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
266-368 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [75]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 55, 89, 128, 183, 223, 284, 345
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1788 = CGAGAAGCACAGATTC-1

using 284 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode CGAGAAGCACAGATTC-1 contig 1 = GTCAGACTCA...
umi AAACAAGATC = 270 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=482]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
408-482 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CHQYNSYSTF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 23, 29, 85, 98, 234, 237, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1792 = CGAGAAGCACGAGGTA-1

using 496 reads

====================================================================================

graph has 196 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[4, 6, 19, 205, 260]
surviving nonsolo ucounts = 3[19, 205, 260]
ids = [1, 6, 4]

====================================================================================

UMI info for barcode CGAGAAGCACGAGGTA-1 contig 1 = AGGAGTCAGA...
umi AAACGGCTAT = 2 reads: -299 +4 -1 +3 -1 +4 -2 +10 -1 +3 -1X +7 -1 +4 -3 +3 -1 +1 -1X +4 -34 invalidated
umi AACGGAATTT = 3 reads: -355X +1 -4X +2 -1X +1 -2X +3 -1 +4 -1X +5 -1XX +7 invalidated
umi ACCCGGCTAT = 242 reads: +388 validated

UMI info for barcode CGAGAAGCACGAGGTA-1 contig 2 = AGCTGTGGGC...
umi GAACTCTCCC = 195 reads: +367 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [0, 1, 4]
of which 2 are surviving nonsolos
reads assigned: 243
start codons at 27, 33, 89, 102, 457
confident = false

TIG 2[bases=476]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-369 ==> 0-329 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
369-407 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
407-476 ==> 0-69 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CNSREEVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1793 = CGAGAAGCACGGCTAC-1

using 21 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1796 = CGAGAAGCAGCATGAG-1

using 215 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 212]
surviving nonsolo ucounts = 1[212]
ids = [0]

====================================================================================

UMI info for barcode CGAGAAGCAGCATGAG-1 contig 1 = AGTGCTTTCT...
umi GTTGAAAATC = 212 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=564]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-564 ==> 0-87 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1801 = CGAGAAGCAGCTGTTA-1

using 261 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[261]
surviving nonsolo ucounts = 1[261]
ids = [0]

====================================================================================

UMI info for barcode CGAGAAGCAGCTGTTA-1 contig 1 = ACCCAAAAAC...
umi ATGGTCTCTT = 231 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=509]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
433-481 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
481-509 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDVEWLQLLTPSYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 406, 413
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1805 = CGAGAAGCATCACGAT-1

using 218 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1806 = CGAGAAGCATCCTTGC-1

using 84 reads

====================================================================================

graph has 88 edges initially, 4 edges after simplification

total ucounts = 20
nonsolo ucounts = 10[2, 3, 4, 5, 6, 7, 9, 10, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1810 = CGAGAAGCATTAGGCT-1

using 207 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode CGAGAAGCATTAGGCT-1 contig 1 = GGGGATCACA...
umi ATCGTCTCAG = 192 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=558]
62-413 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
486-558 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARLQVDAPLAHGGDYW at 404, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 62, 260, 423, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1811 = CGAGAAGCATTGTGCA-1

using 273 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [1]

====================================================================================

UMI info for barcode CGAGAAGCATTGTGCA-1 contig 1 = AGTCAGACCC...
umi TCCATCATGG = 254 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=484]
0-30 ==> 23-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
30-375 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-484 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYSYPRTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 30, 86, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1813 = CGAGAAGGTCCATCCT-1

using 403 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[149, 252]
surviving nonsolo ucounts = 2[149, 252]
ids = [2, 3]

====================================================================================

UMI info for barcode CGAGAAGGTCCATCCT-1 contig 1 = AATCAGTCCC...
umi TATCTGCTCC = 131 reads: +388 validated

UMI info for barcode CGAGAAGGTCCATCCT-1 contig 2 = GCTGGGGTCT...
umi TCTTTGGCGA = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=428]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 24, 30, 99, 235
confident = false

TIG 2[bases=575]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-575 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1815 = CGAGAAGTCAAACCAC-1

using 611 reads

====================================================================================

graph has 202 edges initially, 8 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 278, 324]
surviving nonsolo ucounts = 2[278, 324]
ids = [4, 8]

====================================================================================

UMI info for barcode CGAGAAGTCAAACCAC-1 contig 1 = AGAACTCTGG...
umi CCCAGGCGCC = 281 reads: +382 validated
umi TCGTCTCGAC = 328 reads: -379 +3 non-validated

GOOD CONTIGS

TIG 1[bases=613]
0-20 ==> 23-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
20-357 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
364-402 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
402-613 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSADSSGTYRVF at 335, score = 8 + 8
umis assigned: [4, 8]
of which 2 are surviving nonsolos
reads assigned: 597
start codons at 20, 81, 150, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1820 = CGAGAAGTCACCGTAA-1

using 273 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode CGAGAAGTCACCGTAA-1 contig 1 = AGCTCTGAGA...
umi ATACACTAGT = 271 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=569]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=19)
459-485 ==> 20-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-569 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CAKNSGWFGYW at 421, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 79, 235, 382, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1828 = CGAGAAGTCCTCGCAT-1

using 928 reads

====================================================================================

graph has 308 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[3, 4^2, 246, 292, 376]
surviving nonsolo ucounts = 3[246, 292, 376]
ids = [3, 8, 4]

====================================================================================

UMI info for barcode CGAGAAGTCCTCGCAT-1 contig 1 = GAAGAGCTGC...
umi TTTTCGGGCT = 275 reads: +388 validated

UMI info for barcode CGAGAAGTCCTCGCAT-1 contig 2 = GGGGTGCTTT...
umi CCCTTAGTTC = 371 reads: +460 validated

UMI info for barcode CGAGAAGTCCTCGCAT-1 contig 3 = GGGGTCTCCC...
umi CACTGACTTG = 239 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=473]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-473 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 33, 82, 241, 340, 381, 463
confident = false

TIG 2[bases=616]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
428-479 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
479-616 ==> 0-137 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 43 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 379, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 19, 40, 84, 170
confident = false

TIG 3[bases=531]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-531 ==> 0-54 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 59, 233
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1832 = CGAGAAGTCGCGCCAA-1

using 83 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[81]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1836 = CGAGAAGTCGTTTAGG-1

using 50 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 45]
surviving nonsolo ucounts = 1[45]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1843 = CGAGAAGTCTGCCAGG-1

using 521 reads

====================================================================================

graph has 816 edges initially, 2 edges after simplification

total ucounts = 279
nonsolo ucounts = 101[2^47, 3^31, 4^8, 5^4, 6^4, 7, 8^3, 11, 15, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1846 = CGAGAAGTCTTCCTTC-1

using 213 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 3, 198]
surviving nonsolo ucounts = 1[198]
ids = [10]

====================================================================================

UMI info for barcode CGAGAAGTCTTCCTTC-1 contig 1 = AGAAGCAGAG...
umi TCTCGGGCTA = 190 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=514]
0-28 ==> 12-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-365 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
413-514 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CNSRDSSGNHLEVF at 343, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 28, 147, 176, 227, 326
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1848 = CGAGAAGTCTTGTTTG-1

using 220 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 214]
surviving nonsolo ucounts = 1[214]
ids = [2]

====================================================================================

UMI info for barcode CGAGAAGTCTTGTTTG-1 contig 1 = AGCTCTGAGA...
umi CACGCAAGCA = 211 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=552]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-552 ==> 0-49 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1849 = CGAGCACAGAAACGAG-1

using 227 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 219]
surviving nonsolo ucounts = 1[219]
ids = [4]

====================================================================================

UMI info for barcode CGAGCACAGAAACGAG-1 contig 1 = GCTACAACAG...
umi GTCCAAGGCT = 208 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=3)
391-428 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
428-509 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYSTRLTF at 367, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1854 = CGAGCACAGAATCTCC-1

using 2494 reads

====================================================================================

graph has 776 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 9, 462, 2012]
surviving nonsolo ucounts = 2[462, 2012]
ids = [7, 10]

====================================================================================

UMI info for barcode CGAGCACAGAATCTCC-1 contig 1 = ACTCAACAAC...
umi GCCTGTTAGG = 467 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=535]
55-408 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=12)
430-464 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CATGLLAGPIYW at 397, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 458
start codons at 55, 206, 253, 258, 262, 290, 319, 337, 352
confident = false

REJECT CONTIGS

TIG 1[bases=328]
4-79 ==> 281-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
79-117 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
117-328 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 47, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 1977
start codons at 30, 57, 81, 249
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1861 = CGAGCACAGCAATATG-1

using 216 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 211]
surviving nonsolo ucounts = 1[211]
ids = [2]

====================================================================================

UMI info for barcode CGAGCACAGCAATATG-1 contig 1 = GAAGAGCTGC...
umi TAGTGGATTA = 188 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=422]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=20)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CQQYGSSPLTF at 357, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 33, 241, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1862 = CGAGCACAGCACCGTC-1

using 1022 reads

====================================================================================

graph has 354 edges initially, 32 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 5, 57, 320, 636]
surviving nonsolo ucounts = 3[57, 320, 636]
ids = [5, 4, 1]

====================================================================================

UMI info for barcode CGAGCACAGCACCGTC-1 contig 1 = GAGTCAGTCC...
umi TCTTTGGTGA = 338 reads: +104 -3XX +281 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDILPLTF at 352, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 25, 31, 87, 100, 362, 455
confident = false

REJECT CONTIGS

TIG 1[bases=300]
2-70 ==> 5665-5733 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-165 ==> 0-139 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=4)
164-300 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 626
start codons at 26, 32, 88, 206
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1872 = CGAGCACAGGCTCATT-1

using 132 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[125]
surviving nonsolo ucounts = 1[125]
ids = [2]

====================================================================================

UMI info for barcode CGAGCACAGGCTCATT-1 contig 1 = TCACCATGGA...
umi CAAAGGGCAC = 94 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=442]
5-356 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
361-392 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=5)
387-435 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 7 reads
cdr3 = CAKVTGYCSGGSCPDLDYW at 347, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 5, 156, 161, 219, 222, 240, 308
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1873 = CGAGCACAGGGTGTGT-1

using 11 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1879 = CGAGCACAGTATCGAA-1

using 123 reads

====================================================================================

graph has 120 edges initially, 8 edges after simplification

total ucounts = 38
nonsolo ucounts = 22[2^4, 3^4, 4^5, 5^4, 6, 8, 10^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1880 = CGAGCACAGTCGCCGT-1

using 250 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode CGAGCACAGTCGCCGT-1 contig 1 = GAGTCAGTCT...
umi AGCACCACTC = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1882 = CGAGCACAGTGTTAGA-1

using 244 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACAGTGTTAGA-1 contig 1 = ATCAGTCCCA...
umi CTGTCAAGCG = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1885 = CGAGCACCAACACCTA-1

using 134 reads

====================================================================================

graph has 129 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 15[2^3, 3^2, 4^3, 6^2, 7, 9, 11, 13, 49]
surviving nonsolo ucounts = 1[49]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=360]
13-360 ==> 0-347 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 40
start codons at 13, 57, 236, 239, 319, 328
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1887 = CGAGCACCAAGGTTCT-1

using 677 reads

====================================================================================

graph has 283 edges initially, 26 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 155, 216, 302]
surviving nonsolo ucounts = 3[155, 216, 302]
ids = [0, 2, 1]

====================================================================================

UMI info for barcode CGAGCACCAAGGTTCT-1 contig 1 = GGGGTCTCAG...
umi TCCCTCCTTT = 206 reads: +391 validated

UMI info for barcode CGAGCACCAAGGTTCT-1 contig 2 = GCAGGAGTCA...
umi CCCTCGGCTA = 73 reads: +41 -1XX +6 -1XX +3 -1XX +9 -1XX +7 -1XX +39 -1XX +9 -1XX +9 -1XX +12 -127 +5 -1XX +11 -1XX +6 -1XX +1 -1XX +2 -1XX +2 -1XX +20 -1XX +2 -1XX +4 -1XX +3 -3XX +1 -1XX +1 -3XX +1 -5XX +34 -1XX invalidated
umi CTCTCAGCAG = 305 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-385 ==> 0-347 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-546 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSRTHVVF at 362, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 38, 195, 239, 246, 390
confident = false

TIG 2[bases=550]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-372 ==> 0-343 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYNMWTF at 356, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 369
start codons at 29, 35, 91, 104, 240, 374, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1893 = CGAGCACCACCACGTG-1

using 225 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=558]
3-84 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-297 ==> 0-270 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=36)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=7)
437-469 ==> 22-54 on rc of segment before IGKJ1 exon 1 [len=322] (mis=1)
490-558 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQTFGPPQTF at 354, score = 5 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 27, 33, 89, 238, 476, 532
confident = false
not full
full length stopped transcript of length 558
frameshifted full length stopped transcript of length 558
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1897 = CGAGCACCACGGTAAG-1

using 4113 reads

====================================================================================

graph has 2568 edges initially, 30 edges after simplification

total ucounts = 560
nonsolo ucounts = 211[2^107, 3^45, 4^14, 5^13, 6^2, 7^5, 8^4, 9, 10, 13, 20, 40, 63, 107, 113, 151, 169, 185, 196, 200, 203, 209, 220, 228, 230, 267, 279, 303]
surviving nonsolo ucounts = 17[2, 40, 63, 107, 113, 151, 169, 185, 196, 200, 203, 209, 220, 228, 267, 279, 303]
ids = [269, 492, 136, 368, 311, 389, 458, 514, 395, 78, ...]

====================================================================================

UMI info for barcode CGAGCACCACGGTAAG-1 contig 1 = AGGAGTCAGA...
umi AGGGAATATC = 226 reads: +388 validated
umi ATCCCGCCGT = 198 reads: +388 validated
umi CACTCGCTCG = 269 reads: +388 validated
umi CGATCGACCG = 220 reads: +388 validated
umi GACACCGTCC = 304 reads: +388 validated
umi GTCCGACCAG = 200 reads: +388 validated
umi TACCGTTGAG = 298 reads: +254 -1XX +133 invalidated
umi TCTACTTTCT = 167 reads: +388 validated
umi TGGCGTGAAC = 44 reads: +129 -1X +212 -1 +11 -6 +1 -1 +3 -1 +22 invalidated
umi TTATGTTTTC = 184 reads: +388 validated

UMI info for barcode CGAGCACCACGGTAAG-1 contig 2 = GGGAGAGGAG...
umi CATATCTACT = 61 reads: +409 validated
umi GCTACTTAGC = 114 reads: +409 validated
umi GTGTTACCTT = 105 reads: +409 validated
umi TACTCGCTTA = 148 reads: -380 +29 non-validated
umi TAGAATGTCA = 193 reads: +409 validated
umi TTCTAAACCA = 206 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 276 reads
cdr3 = CQQANSFPITF at 354, score = 9 + 8
umis assigned: [56, 78, 125, 190, 264, 360, 386, 458, 492, 514]
of which 10 are surviving nonsolos
reads assigned: 2046
start codons at 27, 33, 89, 102, 238, 292, 457
confident = true

TIG 2[bases=664]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=24)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
482-664 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 77 reads
cdr3 = CARDAGDYAFVSW at 412, score = 8 + 7
umis assigned: [136, 311, 368, 389, 395, 524]
of which 6 are surviving nonsolos
reads assigned: 818
start codons at 73, 229, 256, 373
confident = true
now this is a cell
paired!

CTGAGAGCCGACGACACGGCCGTCTATTACTGTGCGAGAGACGCCGGTGACTACGCTTTTGTCTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGACTTTGCAACTTATTATTGTCAACAGGCTAACAGTTTTCCGATCACCTTCGGCCAAGGGACACGACTGGAGGTTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1912 = CGAGCACCATCGGACC-1

using 66 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[63]
surviving nonsolo ucounts = 1[63]
ids = [0]

====================================================================================

UMI info for barcode CGAGCACCATCGGACC-1 contig 1 = TCAGTCAGGA...
umi AGCGCTTTTG = 55 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=437]
16-367 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
404-437 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CQQYNSYSRTF at 343, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 54
start codons at 16, 22, 78, 91, 227, 230, 323
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1920 = CGAGCACGTAATCACC-1

using 41 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2^2, 7, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1921 = CGAGCACGTAATCGTC-1

using 226 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode CGAGCACGTAATCGTC-1 contig 1 = GTGGGCTCAG...
umi ACGTCCCCCA = 219 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=571]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=8)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-571 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CYSTDSNVDHRVF at 350, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 35, 96, 165, 183, 234, 296, 333, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1923 = CGAGCACGTACCGCTG-1

using 214 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACGTACCGCTG-1 contig 1 = GGGAGGAACT...
umi GTTCCAAGTG = 197 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-507 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQRDIWPWTF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 35, 240, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1928 = CGAGCACGTAGCACGA-1

using 7965 reads

====================================================================================

graph has 3180 edges initially, 54 edges after simplification

total ucounts = 263
nonsolo ucounts = 114[2^41, 3^14, 4^8, 5, 6^6, 7^3, 8^2, 9^2, 14^2, 34, 53, 101, 104, 115, 144, 161, 168, 169, 172, 175, 187, 202, 203, 208^2, 210^2, 214, 215, 221, 224, 237, 247, 258, 273, 277, 281, 297, 307, 310, 312, 313, 333, 393]
surviving nonsolo ucounts = 35[34, 53, 101, 104, 115, 144, 161, 168, 169, 172, 175, 187, 202, 203, 208^2, 210^2, 214, 215, 221, 224, 237, 247, 258, 273, 277, 281, 297, 307, 310, 312, 313, 333, 393]
ids = [134, 201, 41, 225, 141, 124, 145, 10, 68, 6, ...]

====================================================================================

UMI info for barcode CGAGCACGTAGCACGA-1 contig 1 = CACATGGGAA...
umi ACTATACGCA = 185 reads: +430 validated
umi AGCACGTCGT = 160 reads: +430 validated
umi AGCGCGCTTT = 213 reads: +430 validated
umi AGGAATTTAC = 314 reads: +430 validated
umi AGGTACCTCA = 98 reads: +430 validated
umi ATAAGATCCG = 299 reads: +430 validated
umi ATCAACGCCT = 211 reads: +430 validated
umi CACCCAACCA = 138 reads: +430 validated
umi CGCAGAGCTC = 206 reads: +430 validated
umi CTTTTTCTTA = 163 reads: +430 validated
umi GGTTCTTTCC = 309 reads: +430 validated
umi TACAATTACG = 205 reads: +430 validated
umi TACTGTTGGG = 221 reads: +430 validated
umi TATCTATGGT = 43 reads: +17 -9 +404 non-validated
umi TCAGTCAGTT = 228 reads: +430 validated
umi TGATCAATAA = 178 reads: +430 validated
umi TTATGTGGGT = 215 reads: +430 validated

UMI info for barcode CGAGCACGTAGCACGA-1 contig 2 = GGGAGAGCCC...
umi AATCTCTAGC = 168 reads: +385 validated
umi ACGTTACCAG = 260 reads: +385 validated
umi ATAGTTACGC = 228 reads: +385 validated
umi ATGCATTCTG = 249 reads: +385 validated
umi CGAAATCTAA = 93 reads: +19 -2X +1 -1X +1 -1 +1 -5X +1 -2XX +2 -1XX +1 -5XX +1 -2XX +339 invalidated
umi CTAGAATATG = 313 reads: +385 validated
umi CTCTTACTTT = 276 reads: +385 validated
umi GAGCCCGCTT = 34 reads: +119 -1XX +217 -1 +9 -1X +2 -10 +2 -1X +5 -4X +8 -1X +4 invalidated
umi GCACAGGCGC = 385 reads: +385 validated
umi GCCCCGCAGC = 162 reads: +385 validated
umi TAAGGGCCAA = 289 reads: +385 validated
umi TGACTTCTTT = 62 reads: +42 -1X +1 -2X +293 -1 +4 -1 +5 -1 +7 -27 invalidated
umi TTTATCTACG = 325 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-26 ==> 5-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
26-397 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 16 umis using 296 reads
cdr3 = CARGAAARRFDYW at 386, score = 9 + 7
umis assigned: [23, 33, 35, 38, 41, 47, 53, 68, 94, 127] and 7 others
of which 17 are surviving nonsolos
reads assigned: 3340
start codons at 3, 26, 47, 91, 177
confident = true

TIG 2[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 413 reads
cdr3 = CQQRSNWPPITF at 368, score = 9 + 8
umis assigned: [10, 22, 51, 58, 89, 108, 117, 134, 140, 145] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2790
start codons at 47, 252, 255, 474
confident = true

REJECT CONTIGS

TIG 1[bases=643]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
0-73 ==> 6470-6543 on rc of segment before IGHVII-53-1 exon 1 [len=6543] (mis=0)
42-112 ==> 6507-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
73-408 ==> 0-335 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=0)
504-541 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
541-643 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [6, 124, 141]
of which 3 are surviving nonsolos
reads assigned: 416
start codons at 73, 229, 373, 422, 475, 559, 620
confident = false
frameshifted full length stopped transcript of length 643
did not find CDR3
now this is a cell
paired!

GTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGCGCAGCAGCTCGTCGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCCATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1929 = CGAGCACGTATCACCA-1

using 156 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 1[155]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACGTATCACCA-1 contig 1 = AGTCAGACTC...
umi TGATCCTCGG = 148 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=482]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=24)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=6)
409-482 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CHQYNSYSSF at 351, score = 8 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 24, 30, 86, 99, 235, 238, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1931 = CGAGCACGTCAAAGAT-1

using 258 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi TTATTGTTGG = 252 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1938 = CGAGCACGTCGAGATG-1

using 278 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode CGAGCACGTCGAGATG-1 contig 1 = GGAACTGCTC...
umi ACTTATTTGC = 274 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 31, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1947 = CGAGCACGTTAAGGGC-1

using 1193 reads

====================================================================================

graph has 656 edges initially, 2 edges after simplification

total ucounts = 145
nonsolo ucounts = 43[2^18, 3^8, 4^4, 5^6, 6^3, 7, 8, 9, 943]
surviving nonsolo ucounts = 1[943]
ids = [54]

====================================================================================

REJECT CONTIGS

TIG 1[bases=358]
0-112 ==> 241-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=6)
109-147 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
147-358 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 80, score = 8 + 8
umis assigned: [54]
of which 1 are surviving nonsolos
reads assigned: 928
start codons at 63, 88, 93
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1950 = CGAGCACGTTATCACG-1

using 204 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[3, 4^2, 5, 7, 9, 169]
surviving nonsolo ucounts = 1[169]
ids = [8]

====================================================================================

UMI info for barcode CGAGCACGTTATCACG-1 contig 1 = TTAGCCCTGG...
umi TAGCGCTGTC = 166 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=512]
0-61 ==> 18-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
61-414 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
438-485 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
485-512 ==> 0-27 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDRAATARLGGMDVW at 403, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 61, 212, 217, 364, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1959 = CGAGCACTCACATGCA-1

using 287 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACTCACATGCA-1 contig 1 = GGGGGGGTCT...
umi CAATACTGTC = 286 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=643]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-384 ==> 0-343 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 43 reads
cdr3 = CSSYTSNNTPVVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 41, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1960 = CGAGCACTCACTCTTA-1

using 167 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[167]
surviving nonsolo ucounts = 1[167]
ids = [0]

====================================================================================

UMI info for barcode CGAGCACTCACTCTTA-1 contig 1 = GACACAGCAT...
umi GCAAACGATT = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
8-361 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=19)
358-396 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
396-491 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQTHSPPRTF at 335, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 8, 14, 70, 83, 219, 261, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1964 = CGAGCACTCATAACCG-1

using 236 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[235]
surviving nonsolo ucounts = 1[235]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACTCATAACCG-1 contig 1 = TGAGCGCAGA...
umi GCTCCCCGAC = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1980 = CGAGCACTCGAGGTAG-1

using 212 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 204]
surviving nonsolo ucounts = 1[204]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACTCGAGGTAG-1 contig 1 = AATCAGTCCC...
umi ACAGGTTGCC = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1981 = CGAGCACTCGATAGAA-1

using 1615 reads

====================================================================================

graph has 2270 edges initially, 14 edges after simplification

total ucounts = 690
nonsolo ucounts = 296[2^138, 3^69, 4^35, 5^21, 6^8, 7^7, 8^6, 9^3, 10, 11^3, 12, 16^2, 21, 213]
surviving nonsolo ucounts = 1[213]
ids = [74]

====================================================================================

UMI info for barcode CGAGCACTCGATAGAA-1 contig 1 = GCAGGAGTCA...
umi CATCATATGT = 213 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [74]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1984 = CGAGCACTCGGTTCGG-1

using 311 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 11, 294]
surviving nonsolo ucounts = 1[294]
ids = [4]

====================================================================================

UMI info for barcode CGAGCACTCGGTTCGG-1 contig 1 = GCAGGAGTCA...
umi TAAACTGAGT = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-29 ==> 2-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-492 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDDLPITF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 29, 35, 91, 104, 366, 369, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1987 = CGAGCACTCGTTTATC-1

using 309 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[9, 300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode CGAGCACTCGTTTATC-1 contig 1 = GGGGAGGAAC...
umi TGTTATGACA = 305 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRSNRLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 36, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1994 = CGAGCACTCTTACCTA-1

using 48 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1995 = CGAGCACTCTTCAACT-1

using 2079 reads

====================================================================================

graph has 1853 edges initially, 18 edges after simplification

total ucounts = 442
nonsolo ucounts = 202[2^100, 3^40, 4^23, 5^13, 6^7, 7^3, 8^3, 9, 10, 12^2, 13, 17, 70, 92, 128, 151, 163, 175, 423]
surviving nonsolo ucounts = 7[70, 92, 128, 151, 163, 175, 423]
ids = [279, 50, 142, 212, 224, 77, 273]

====================================================================================

UMI info for barcode CGAGCACTCTTCAACT-1 contig 1 = TCTGGAGAAG...
umi ATAGCACGCA = 175 reads: +376 validated
umi CCGGCCGGCC = 129 reads: +376 validated
umi GTATTCGCAA = 401 reads: -337X +1 -3XX +1 -1XX +1 -4XX +3 -3XX +9 -1XX +12 invalidated
umi GTGATACCAC = 15 reads: -223X +5 -1X +1 -1X +2 -2X +4 -1XX +20 -1XX +2 -1XX +2 -1XX +5 -1XX +2 -1XX +2 -1XX +2 -1XX +1 -2XX +9 -1X +1 -45 +1 -1X +1 -4X +3 -3X +9 -1XX +12 invalidated

UMI info for barcode CGAGCACTCTTCAACT-1 contig 2 = ATCACATAAC...
umi ACTCCAACGT = 94 reads: +415 validated
umi GACATTGGCG = 151 reads: +298 -1XX +116 invalidated
umi GATAACGTCC = 157 reads: +383 -1 +31 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-39 ==> 13-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
39-387 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
386-415 ==> 10-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 53 reads
cdr3 = CQQYGSSP at 363, score = 9 + 6
umis assigned: [77, 142, 273, 279]
of which 4 are surviving nonsolos
reads assigned: 706
start codons at 39, 247, 373, 457
confident = true

TIG 2[bases=544]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
413-433 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=0)
435-473 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 23 reads
cdr3 = CARKRGYSYGYSYW at 400, score = 9 + 7
umis assigned: [50, 212, 224]
of which 3 are surviving nonsolos
reads assigned: 399
start codons at 58, 209, 256, 355, 425
confident = true
now this is a cell
paired!

AGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAAAACGTGGATACAGCTATGGTTACTCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.1996 = CGAGCACTCTTGCAAG-1

using 434 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[432]
surviving nonsolo ucounts = 1[432]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=403]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-37 ==> 5963-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
10-62 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
37-83 ==> 0-46 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
77-229 ==> 193-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
230-267 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
267-403 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 426
start codons at 37, 89, 92, 309
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2003 = CGAGCCAAGACTCGGA-1

using 8250 reads

====================================================================================

graph has 6842 edges initially, 142 edges after simplification

total ucounts = 1319
nonsolo ucounts = 971[2^170, 3^145, 4^107, 5^84, 6^60, 7^77, 8^61, 9^53, 10^54, 11^38, 12^28, 13^14, 14^22, 15^15, 16^13, 17^6, 18^5, 19^2, 20^4, 21^2, 22, 25^2, 121, 140, 153, 179, 256, 298, 309, 318]
surviving nonsolo ucounts = 6[140, 179, 256, 298, 309, 318]
ids = [799, 1239, 247, 557, 404, 41]

====================================================================================

UMI info for barcode CGAGCCAAGACTCGGA-1 contig 1 = CCTGGGTCAG...
umi AAGGCCTCTT = 323 reads: +388 validated
umi ATATAAGTAG = 259 reads: +388 validated
umi CATCGTAATC = 313 reads: +388 validated
umi CGCTGACCTT = 298 reads: +388 validated
umi GCGGTACTCT = 140 reads: +388 validated
umi TTATACCTAG = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=576]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
402-440 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 203 reads
cdr3 = CQQYGSSPGWTF at 376, score = 9 + 8
umis assigned: [41, 247, 404, 557, 799, 1239]
of which 6 are surviving nonsolos
reads assigned: 1481
start codons at 52, 260, 386, 482
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2007 = CGAGCCAAGAGTAAGG-1

using 219 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 210]
surviving nonsolo ucounts = 1[210]
ids = [0]

====================================================================================

UMI info for barcode CGAGCCAAGAGTAAGG-1 contig 1 = GCTCTGCTTC...
umi ACTCATGCAA = 203 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=595]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-595 ==> 0-150 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2008 = CGAGCCAAGATAGGAG-1

using 1795 reads

====================================================================================

graph has 1783 edges initially, 24 edges after simplification

total ucounts = 405
nonsolo ucounts = 264[2^46, 3^33, 4^38, 5^34, 6^29, 7^25, 8^23, 9^15, 10^9, 11^2, 12^3, 13, 15^2, 17^2, 121, 127]
surviving nonsolo ucounts = 1[121]
ids = [148]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2009 = CGAGCCAAGATGGCGT-1

using 8635 reads

====================================================================================

graph has 4206 edges initially, 58 edges after simplification

total ucounts = 713
nonsolo ucounts = 290[2^118, 3^58, 4^33, 5^20, 6^6, 7^9, 8^9, 9^3, 11, 12, 13^2, 14, 17, 78, 94, 100, 135, 147, 163, 186, 191, 203, 206, 245, 246, 247, 249, 253, 259, 262, 268, 274, 275, 297, 309, 334, 344, 346, 355, 495, 731]
surviving nonsolo ucounts = 25[94, 100, 163, 186, 191, 203, 206, 245, 246, 247, 249, 253, 259, 262, 268, 274, 275, 297, 309, 334, 344, 346, 355, 495, 731]
ids = [703, 314, 366, 299, 604, 607, 60, 89, 668, 472, ...]

====================================================================================

UMI info for barcode CGAGCCAAGATGGCGT-1 contig 1 = GAGAGAGGAG...
umi CGCTCACCTA = 159 reads: +433 validated
umi TCTTGCTTCC = 194 reads: +433 validated
umi TTTGTACTCC = 96 reads: -18 +381 -9 +25 non-validated

UMI info for barcode CGAGCCAAGATGGCGT-1 contig 2 = TGGGGAGGAA...
umi AATTCAATCA = 345 reads: +391 validated
umi ACAGCTGTGG = 204 reads: +391 validated
umi ACGCTTATGA = 243 reads: +391 validated
umi CCAGCACCAT = 277 reads: +391 validated
umi CCCACCTCCT = 261 reads: +391 validated
umi CGTGATGGTC = 101 reads: +391 validated
umi CTGGATCTAA = 248 reads: +391 validated
umi CTTCAGTATG = 162 reads: +391 validated
umi CTTTATTTGC = 252 reads: +391 validated
umi GATAATCATT = 356 reads: +391 validated
umi GATATTATTC = 298 reads: +391 validated
umi GTACTAGTTT = 345 reads: +391 validated
umi GTACTGGTGG = 247 reads: +391 validated
umi GTCTTTCTAT = 264 reads: +391 validated
umi GTTACGGGCA = 353 reads: +316 -4XX +1 -4XX +66 invalidated
umi TACCTGCAAC = 306 reads: +391 validated
umi TATCAGGGGA = 273 reads: +391 validated
umi TCCCTATGGA = 269 reads: +391 validated
umi TGAACATTCG = 200 reads: +391 validated
umi TGGTCTTCCC = 491 reads: -279X +112 invalidated
umi TTCACCTCAT = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
460-506 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
506-577 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 25 reads
cdr3 = CARDNFDWLLFSTTGGMDVW at 415, score = 9 + 7
umis assigned: [299, 604, 703]
of which 3 are surviving nonsolos
reads assigned: 434
start codons at 73, 229, 376, 463
confident = true

TIG 2[bases=559]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 873 reads
cdr3 = CLQHNSYPLLTF at 359, score = 9 + 9
umis assigned: [48, 60, 89, 247, 258, 314, 355, 366, 373, 389] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5632
start codons at 32, 38, 107, 189, 243, 465
confident = true

REJECT CONTIGS

TIG 1[bases=340]
0-189 ==> 163-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=4)
187-238 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
238-340 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [605]
of which 1 are surviving nonsolos
reads assigned: 724
start codons at 8, 80, 182, 256, 317
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATAATTTTGACTGGTTATTATTTTCCACTACGGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCCTTGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2015 = CGAGCCAAGCCCAACC-1

using 843 reads

====================================================================================

graph has 948 edges initially, 6 edges after simplification

total ucounts = 255
nonsolo ucounts = 90[2^28, 3^26, 4^11, 5^6, 6^5, 7^2, 8^3, 9^3, 12, 13, 16^2, 56, 262]
surviving nonsolo ucounts = 2[56, 262]
ids = [251, 82]

====================================================================================

UMI info for barcode CGAGCCAAGCCCAACC-1 contig 1 = ACCCAAAAAC...
umi CACTCGTCGC = 244 reads: +436 validated
umi TTTCTCTCTA = 56 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=596]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-596 ==> 0-106 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 32 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [82, 251]
of which 2 are surviving nonsolos
reads assigned: 297
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2018 = CGAGCCAAGCGTTTAC-1

using 6869 reads

====================================================================================

graph has 3301 edges initially, 38 edges after simplification

total ucounts = 628
nonsolo ucounts = 255[2^103, 3^52, 4^25, 5^22, 6^6, 7^7, 8^5, 9^2, 10, 11^2, 12, 13^2, 15^2, 17, 73, 115, 117, 164, 191, 195, 199, 201, 208, 213, 226, 227, 238, 243, 251, 274, 275, 286, 287, 294, 311, 312, 355, 408]
surviving nonsolo ucounts = 24[15, 73, 117, 164, 191, 195, 199, 201, 208, 213, 226, 227, 238, 243, 251, 274, 275, 286, 287, 294, 311, 312, 355, 408]
ids = [284, 408, 345, 293, 116, 33, 43, 603, 357, 435, ...]

====================================================================================

UMI info for barcode CGAGCCAAGCGTTTAC-1 contig 1 = GGGGGCTTTC...
umi ACAACCAGCA = 204 reads: +448 validated
umi CTGGCACCCT = 562 reads: +345 -2XX +1 -1XX +2 -4XX +1 -92X invalidated
umi GAGATTCCTG = 216 reads: +448 validated
umi GTAAGTCTTA = 73 reads: -1 +445 -1 +1 non-validated
umi TAAATCATCC = 212 reads: +448 validated
umi TTCAGAAATG = 230 reads: +448 validated
umi TTCATCGTCC = 278 reads: +448 validated
umi TTCTAACCCT = 203 reads: +448 validated

UMI info for barcode CGAGCCAAGCGTTTAC-1 contig 2 = GGGGAGGAAC...
umi ACGACACTCC = 240 reads: +382 validated
umi ATAAATGTAG = 192 reads: +382 validated
umi CTATCCGCTG = 169 reads: +382 validated
umi CTGCCGCACT = 252 reads: +382 validated
umi GAATGGTCCT = 104 reads: +382 validated
umi GGTAATATAT = 291 reads: +382 validated
umi GTATGATCAT = 300 reads: +382 validated
umi TAAGGCCGCG = 353 reads: +382 validated
umi TAGGTTACGG = 316 reads: +382 validated
umi TATACCCGCC = 276 reads: +382 validated
umi TATCTGCGGA = 286 reads: +382 validated
umi TCACACACTG = 245 reads: +382 validated
umi TGTCCTAATG = 313 reads: +382 validated
umi TTAACAGGGG = 226 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=626]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=24)
403-423 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=1)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
466-626 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 7 umis using 154 reads
cdr3 = CARRRGGGYSYGYVDYW at 384, score = 9 + 7
umis assigned: [33, 314, 357, 408, 435, 592, 593, 603]
of which 8 are surviving nonsolos
reads assigned: 1776
start codons at 18, 27, 39, 83, 180, 415, 421, 520
confident = true

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 560 reads
cdr3 = CQQRSNWLWTF at 357, score = 10 + 8
umis assigned: [50, 116, 293, 308, 345, 397, 414, 444, 465, 470] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3493
start codons at 36, 241, 460
confident = true

REJECT CONTIGS

TIG 1[bases=361]
1-24 ==> 325-348 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
74-196 ==> 0-122 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
193-229 ==> 121-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
227-290 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
290-361 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [43, 284]
of which 2 are surviving nonsolos
reads assigned: 208
start codons at 81, 115, 154, 207, 247
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTCTATATTACTGTGCGAGACGACGGGGTGGTGGATACAGCTATGGTTATGTTGACTATTGGGGCCAGGGAACCCAGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTCTGCCGTTTATTACTGTCAGCAGCGTAGCAACTGGCTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2019 = CGAGCCAAGCTATGCT-1

using 479 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[119, 357]
surviving nonsolo ucounts = 2[119, 357]
ids = [2, 0]

====================================================================================

UMI info for barcode CGAGCCAAGCTATGCT-1 contig 1 = ATCATCCAAC...
umi AGTCATGACT = 286 reads: +436 validated

UMI info for barcode CGAGCCAAGCTATGCT-1 contig 2 = TAGAGAAGAC...
umi CTGACCATCT = 109 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=1)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAREKILTGSTPGPLYYFDYW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 58, 214, 256, 322, 355
confident = false

TIG 2[bases=543]
0-32 ==> 82-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
32-385 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
420-543 ==> 0-123 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CASWDDSLRGRVF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 32, 186, 336, 361, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2032 = CGAGCCAAGGTGTTAA-1

using 109 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 96]
surviving nonsolo ucounts = 1[96]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=410]
0-324 ==> 24-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
326-364 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
364-410 ==> 0-46 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQKYGSSPPWTF at 300, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 184, 310, 406
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2036 = CGAGCCAAGTCTCCTC-1

using 351 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 348]
surviving nonsolo ucounts = 1[348]
ids = [0]

====================================================================================

UMI info for barcode CGAGCCAAGTCTCCTC-1 contig 1 = GGGAATCAGT...
umi CACGACCAGC = 351 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2051 = CGAGCCACAAGGACTG-1

using 6621 reads

====================================================================================

graph has 3188 edges initially, 40 edges after simplification

total ucounts = 523
nonsolo ucounts = 212[2^102, 3^40, 4^17, 5^10, 6^10, 7, 8^4, 10^2, 11, 12, 13, 15, 17, 24, 147, 168, 197, 206, 207, 210, 214, 216, 217, 232, 263, 275, 291, 293, 304, 305, 307, 392, 600, 613]
surviving nonsolo ucounts = 20[147, 168, 197, 206, 207, 210, 214, 216, 217, 232, 263, 275, 291, 293, 304, 305, 307, 392, 600, 613]
ids = [348, 522, 492, 150, 29, 400, 63, 5, 191, 90, ...]

====================================================================================

UMI info for barcode CGAGCCACAAGGACTG-1 contig 1 = GAGCTACAAC...
umi AAACGGTCTA = 220 reads: +400 validated
umi ACACATCACC = 217 reads: +149 -3XX +248 invalidated
umi AGACATGCAT = 215 reads: +400 validated
umi AGGTCAACTG = 263 reads: +400 validated
umi ATAAGCCTGT = 233 reads: +400 validated
umi ATCTCTAATG = 591 reads: +400 validated
umi CCCTCTCCAA = 293 reads: +400 validated
umi CCGCTGCCAA = 222 reads: +400 validated
umi GAAACGGTGT = 620 reads: +400 validated
umi GAGAGCTGGC = 274 reads: +400 validated
umi GCTGGTCTTA = 307 reads: +400 validated
umi GCTTCTACTA = 309 reads: +400 validated
umi GGTAGATGCG = 138 reads: +400 validated
umi TCACAGCCCC = 209 reads: +400 validated
umi TTCGGTGCGC = 195 reads: +400 validated
umi TTGCCATTAG = 300 reads: +400 validated
umi TTTTTTTGCA = 168 reads: +400 validated

UMI info for barcode CGAGCCACAAGGACTG-1 contig 2 = GATACTTTCT...
umi GCCAACTGAA = 307 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 624 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [5, 29, 63, 78, 90, 104, 183, 191, 275, 287] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4687
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=569]
38-386 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
400-431 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=4)
435-498 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGQTYYDFWSGYSDTEYYYYYGMDVW at 383, score = 9 + 7
umis assigned: [305]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 38, 82, 455
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-80 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-239 ==> 0-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
240-391 ==> 209-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [148, 150]
of which 2 are surviving nonsolos
reads assigned: 588
start codons at 30, 63, 99, 150, 187, 251, 350, 370, 377, 471
confident = false
did not find CDR3
now this is a cell
paired!

ACGTATTACGATTTTTGGAGTGGTTATTCTGATACGGAATACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2056 = CGAGCCACACATCCAA-1

using 222 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode CGAGCCACACATCCAA-1 contig 1 = AGCTCAGCTT...
umi ACACAGTATC = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
440-567 ==> 0-127 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAAWDDSLNGPVF at 373, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 52, 356, 381, 386, 398
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2057 = CGAGCCACACCAGTTA-1

using 22117 reads

====================================================================================

graph has 7062 edges initially, 70 edges after simplification

total ucounts = 782
nonsolo ucounts = 336[2^122, 3^52, 4^28, 5^15, 6^6, 7^8, 8^4, 9, 10, 11^7, 12^3, 14, 16, 34, 35, 47, 58, 88, 98, 110, 130, 136, 140, 145, 149, 151, 152, 170, 182, 183, 185, 186, 197, 200, 204, 208^3, 212, 213, 214, 216, 219, 225, 230, 232, 233, 234, 235, 237^2, 239, 241, 245, 248, 249^2, 250, 252, 253, 254, 255, 256, 258, 259, 261, 262, 263, 265, 266, 268, 272^2, 274, 275, 276^2, 284, 287, 289, 290, 291, 292^2, 293, 294, 295, 297, 299^2, 306, 318, 327, 328^2, 329, 331, 346, 509, 594]
surviving nonsolo ucounts = 83[34, 35, 47, 58, 98, 110, 140, 145, 149, 151, 152, 182, 183, 185, 186, 197, 200, 204, 208^3, 212, 213, 214, 216, 219, 225, 230, 232, 233, 234, 235, 237^2, 239, 241, 245, 248, 249^2, 250, 252, 253, 254, 255, 256, 258, 259, 261, 262, 263, 265, 266, 268, 272^2, 274, 275, 276^2, 284, 287, 289, 290, 291, 292^2, 293, 294, 295, 297, 299^2, 306, 318, 327, 328^2, 329, 331, 346, 509, 594]
ids = [770, 426, 702, 732, 778, 490, 524, 58, 329, 659, ...]

====================================================================================

UMI info for barcode CGAGCCACACCAGTTA-1 contig 1 = TGGGGAGGAA...
umi AATATACATG = 204 reads: +388 validated
umi ACAAACCTGA = 208 reads: +388 validated
umi ACCCCTCCCG = 332 reads: +388 validated
umi ACCGATAGCG = 273 reads: +388 validated
umi ACCTTTTCTT = 148 reads: +388 validated
umi ACGGAGTCCA = 270 reads: +388 validated
umi ACGGTTTCCC = 253 reads: +388 validated
umi ACGTACTCAG = 278 reads: +388 validated
umi AGCCCACGAG = 217 reads: +388 validated
umi AGCGCTCACG = 331 reads: +388 validated
umi AGCTTTGCCG = 232 reads: +388 validated
umi ATACATCGCT = 296 reads: +388 validated
umi ATCATCTCCT = 216 reads: +388 validated
umi ATGACTCCTT = 345 reads: +388 validated
umi ATTAATAAGG = 302 reads: +388 validated
umi ATTCTTTATC = 236 reads: +388 validated
umi CAACAATTCT = 253 reads: +388 validated
umi CAATGTTCTG = 208 reads: +388 validated
umi CACTTCATGG = 181 reads: +388 validated
umi CAGGCCACAG = 602 reads: +388 validated
umi CATCCTTCTA = 329 reads: +388 validated
umi CATTGAAGCC = 180 reads: +388 validated
umi CCACGGCACA = 290 reads: +388 validated
umi CCATTCAGCC = 234 reads: +388 validated
umi CCATTCATCT = 330 reads: +388 validated
umi CCCTAACTGT = 295 reads: +388 validated
umi CCCTTATTGG = 212 reads: +388 validated
umi CGGCTTGTAA = 273 reads: +388 validated
umi CGGTGAGTTT = 257 reads: +388 validated
umi CGTCCTTTCC = 508 reads: +388 validated
umi CTATCATTTG = 267 reads: +388 validated
umi CTCACACCTT = 152 reads: +388 validated
umi CTGAGTAACC = 236 reads: +388 validated
umi CTGGCGTCGT = 216 reads: +388 validated
umi CTTATTATCA = 212 reads: +388 validated
umi GCATCGCCTC = 293 reads: +388 validated
umi GCATGTTCAT = 259 reads: +388 validated
umi GCGCTTACCC = 259 reads: +388 validated
umi GCTTTCAGAC = 272 reads: +388 validated
umi GGGATGAAGC = 271 reads: +388 validated
umi GGGCCGCACG = 264 reads: +388 validated
umi GGGCTGGCGC = 288 reads: +388 validated
umi GTCATCACTA = 263 reads: +388 validated
umi GTTCTCCATT = 138 reads: +388 validated
umi TAAGATGGCT = 323 reads: +388 validated
umi TAATCGCCGC = 153 reads: +388 validated
umi TACATAATAC = 291 reads: +388 validated
umi TACTCTGGCT = 258 reads: +388 validated
umi TAGGGCACCT = 237 reads: +388 validated
umi TATACTCTCA = 294 reads: +388 validated
umi TATGAGCAGC = 221 reads: +388 validated
umi TCAATTTGTA = 291 reads: +388 validated
umi TCAGATCATA = 229 reads: +388 validated
umi TCCCAAATGT = 241 reads: +388 validated
umi TCCGAATGCC = 256 reads: +388 validated
umi TCCTCCATTG = 270 reads: +388 validated
umi TCGAACACGG = 202 reads: +388 validated
umi TCGTGTTAAC = 268 reads: +388 validated
umi TCTATTGCTC = 255 reads: +388 validated
umi TGCTGCGGCG = 250 reads: +388 validated
umi TGTGACGGTT = 249 reads: +388 validated
umi TTATACACGG = 287 reads: +388 validated
umi TTCGCGAACC = 334 reads: +388 validated
umi TTCGTCGACG = 259 reads: +388 validated
umi TTCGTTACTT = 299 reads: +388 validated
umi TTGATAGGGA = 238 reads: +388 validated
umi TTGTAACTGT = 291 reads: +388 validated

UMI info for barcode CGAGCCACACCAGTTA-1 contig 2 = AGCTCTGAGA...
umi AGTCTTCACG = 237 reads: +451 validated
umi CCGCCTTCCC = 239 reads: +451 validated
umi CGCTCAATTG = 186 reads: +442 -9 non-validated
umi GTATGTTTCG = 111 reads: +426 -25 non-validated
umi GTTGTATATA = 220 reads: +451 validated
umi TCTCTTTCTA = 154 reads: +451 validated
umi TGTTAACGGC = 48 reads: +419 -4X +2 -1X +8 -1 +4 -1 +3 -1 +1 -1 +1 -4 invalidated
umi TTCGAACCTC = 58 reads: +391 -1 +1 -1 +1 -1 +4 -4 +19 -24 +2 -1 +1 non-validated
umi TTTATTTGGG = 189 reads: +424 -1 +26 non-validated
umi TTTGCCCCCC = 35 reads: +313 -8 +74 -1 +9 -46 non-validated
umi TTTTCTCCAT = 99 reads: +419 -32 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 67 umis using 2910 reads
cdr3 = CLQHNSYPLTF at 359, score = 9 + 9
umis assigned: [26, 34, 49, 51, 58, 62, 63, 64, 83, 87] and 57 others
of which 67 are surviving nonsolos
reads assigned: 17401
start codons at 32, 38, 107, 189, 243, 462
confident = true

TIG 2[bases=601]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=6)
437-468 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=5)
482-530 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
530-601 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 66 reads
cdr3 = CASKGRITMIVVVTNGEGANHENDYW at 421, score = 9 + 7
umis assigned: [100, 242, 283, 490, 526, 659, 702, 732, 761, 770] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1541
start codons at 79, 230, 235, 382, 445, 488
confident = true

REJECT CONTIGS

TIG 1[bases=589]
0-80 ==> 5920-6000 on rc of segment after IGHV3-20 exon 1 [len=6000] (mis=2)
80-419 ==> 0-339 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=24)
442-473 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
470-518 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
518-589 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [30, 546]
of which 2 are surviving nonsolos
reads assigned: 482
start codons at 80, 225, 231, 236, 315, 383
confident = false
frameshifted full length transcript of length 589
did not find CDR3
now this is a cell
paired!

AAGGGTCGTATTACTATGATAGTAGTGGTTACTAACGGGGAGGGGGCAAACCACGAAAATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2064 = CGAGCCACAGAGCCAA-1

using 313 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 301]
surviving nonsolo ucounts = 1[301]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2066 = CGAGCCACAGATGAGC-1

using 196 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[196]
surviving nonsolo ucounts = 1[196]
ids = [0]

====================================================================================

UMI info for barcode CGAGCCACAGATGAGC-1 contig 1 = GGGGAGGAAC...
umi GCTTGAGGGA = 180 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=475]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-475 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQRSNRLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 36, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2077 = CGAGCCACATACTCTT-1

using 1029 reads

====================================================================================

graph has 390 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 10, 347, 665]
surviving nonsolo ucounts = 2[347, 665]
ids = [0, 4]

====================================================================================

UMI info for barcode CGAGCCACATACTCTT-1 contig 1 = GGGAGGAGTC...
umi CAACCCGTGT = 356 reads: +388 validated
umi GCCTCAGCTC = 665 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 155 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 1001
start codons at 30, 36, 92, 105, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2086 = CGAGCCACATTTCACT-1

using 9291 reads

====================================================================================

graph has 6223 edges initially, 72 edges after simplification

total ucounts = 1585
nonsolo ucounts = 650[2^306, 3^156, 4^57, 5^37, 6^24, 7^15, 8^11, 9^2, 10^4, 11^2, 12, 14, 15, 19^2, 20, 25, 27^2, 81, 84, 88, 91, 104, 129, 139, 145, 147, 151, 182, 206, 207, 216, 235, 253, 261, 267, 298, 306, 317^2, 322, 359, 381^2, 601]
surviving nonsolo ucounts = 29[25, 27^2, 81, 88, 91, 104, 129, 139, 145, 147, 151, 182, 206, 207, 216, 235, 253, 261, 267, 298, 306, 317^2, 322, 359, 381^2, 601]
ids = [828, 1148, 1249, 83, 765, 1140, 326, 1578, 107, 276, ...]

====================================================================================

UMI info for barcode CGAGCCACATTTCACT-1 contig 1 = AGCTCTGGGA...
umi ACAAATAGGT = 134 reads: +439 validated
umi AGTCTGTCAA = 140 reads: +439 validated
umi CCTTCCACCC = 223 reads: +439 validated
umi TACTACAAGC = 217 reads: +439 validated
umi TAGAAACCAA = 88 reads: +377 -62 non-validated
umi TCACATGGAT = 210 reads: +439 validated
umi TCATCTGGGC = 25 reads: +305 -3 +59 -72 non-validated

UMI info for barcode CGAGCCACATTTCACT-1 contig 2 = GGAGAAGAGC...
umi AGGAGATCAG = 384 reads: +385 validated
umi ATCGCTGCAC = 105 reads: +385 validated
umi CCTTCGCCGT = 352 reads: +385 validated
umi GCATTGCCCG = 267 reads: +385 validated
umi GGGCGCGGCT = 327 reads: +385 validated
umi GTATACCCTA = 297 reads: +385 validated
umi GTGTACGGCG = 603 reads: +385 validated
umi TGCACACTGT = 266 reads: +385 validated
umi TGGTCGTCGC = 323 reads: +385 validated
umi TTAACTCGGC = 377 reads: +385 validated
umi TTCTTACAGT = 320 reads: +385 validated
umi TTTTCATGGG = 128 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=590]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=32)
439-470 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=3)
468-519 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
519-590 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 68 reads
cdr3 = CAKGPSYYDFWSGYYVGWFDPW at 422, score = 9 + 7
umis assigned: [107, 276, 587, 1128, 1140, 1223, 1249]
of which 7 are surviving nonsolos
reads assigned: 1016
start codons at 80, 225, 231, 236, 306, 315, 383, 465
confident = true

TIG 2[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 597 reads
cdr3 = CQQYGSSPITF at 360, score = 9 + 8
umis assigned: [253, 326, 588, 854, 944, 993, 1047, 1363, 1412, 1449] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3694
start codons at 36, 244, 370, 463
confident = true
now this is a cell
paired!

TACTGTGCAAAAGGTCCCTCGTATTACGATTTTTGGAGTGGTTATTATGTGGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2088 = CGAGCCAGTAAACGCG-1

using 442 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 432]
surviving nonsolo ucounts = 1[432]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=479]
1-233 ==> 121-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
230-268 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
268-479 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 201, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 34, 184, 209, 214
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2093 = CGAGCCAGTAGCTTGT-1

using 378 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 18, 357]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2098 = CGAGCCAGTCATCCCT-1

using 269 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[269]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2102 = CGAGCCAGTCGCATAT-1

using 992 reads

====================================================================================

graph has 314 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[3^2, 4, 11, 181, 786]
surviving nonsolo ucounts = 2[181, 786]
ids = [4, 9]

====================================================================================

UMI info for barcode CGAGCCAGTCGCATAT-1 contig 1 = GAATCAGTCC...
umi GAGGGAATAA = 1 reads: -238 +1 -2 +3 -1 +2 -2 +2 -1 +2 -1 +1 -1 +2 -4X +1 -1 +2 -1 +1 -1 +4 -2X +2 -2 +5 -4X +2 -97 invalidated
umi GAGGGATTCA = 157 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-476 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 25, 31, 100, 236, 455
confident = false

REJECT CONTIGS

TIG 1[bases=311]
14-39 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
62-100 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
98-146 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
100-311 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 779
start codons at 64, 232
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2120 = CGAGCCAGTGTGCGTC-1

using 328 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[144, 184]
surviving nonsolo ucounts = 2[144, 184]
ids = [1, 0]

====================================================================================

UMI info for barcode CGAGCCAGTGTGCGTC-1 contig 1 = AGGCAGGCAG...
umi GCTATCAGGG = 139 reads: +400 validated

UMI info for barcode CGAGCCAGTGTGCGTC-1 contig 2 = AAGGGGGGGG...
umi ATAATGGCAT = 175 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=460]
0-20 ==> 155-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
20-383 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-460 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYYSTPYTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 20, 89, 342
confident = false

TIG 2[bases=530]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=5)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=6)
455-504 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
504-530 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CAKDSLGWFGEYGMDVW at 422, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 80, 231, 236, 294, 297, 315, 383, 442, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2131 = CGAGCCAGTTGACGTT-1

using 1161 reads

====================================================================================

graph has 436 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[1158]
surviving nonsolo ucounts = 1[1158]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=306]
1-71 ==> 252-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
1-89 ==> 252-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=8)
95-306 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 1134
start codons at 227
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2142 = CGAGCCATCACGCGGT-1

using 321 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[319]
surviving nonsolo ucounts = 1[319]
ids = [2]

====================================================================================

UMI info for barcode CGAGCCATCACGCGGT-1 contig 1 = GAGGAACTGC...
umi TTCGCTTCCT = 315 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNSYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 33, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2148 = CGAGCCATCATCTGTT-1

using 12 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2162 = CGAGCCATCCTTTCGG-1

using 191 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 5, 184]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2164 = CGAGCCATCGGCTTGG-1

using 420 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 144, 272]
surviving nonsolo ucounts = 2[144, 272]
ids = [2, 0]

====================================================================================

UMI info for barcode CGAGCCATCGGCTTGG-1 contig 1 = AGCTCAGCTT...
umi AGTGATTACC = 141 reads: +388 validated

UMI info for barcode CGAGCCATCGGCTTGG-1 contig 2 = GAGTCAGTCC...
umi ACGACACGTC = 276 reads: +394 validated
umi GAACTTTCAA = 3 reads: -394 non-validated

GOOD CONTIGS

TIG 1[bases=513]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-513 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 373, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 52, 206, 356, 381, 386
confident = false

TIG 2[bases=555]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQLNSYPRRITF at 352, score = 8 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 25, 31, 87, 236, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2167 = CGAGCCATCTCATTCA-1

using 253 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2168 = CGAGCCATCTCCAACC-1

using 626 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[308, 315]
surviving nonsolo ucounts = 2[308, 315]
ids = [1, 3]

====================================================================================

UMI info for barcode CGAGCCATCTCCAACC-1 contig 1 = GGGAGATCAC...
umi GGGTCATTCA = 290 reads: +436 validated

UMI info for barcode CGAGCCATCTCCAACC-1 contig 2 = GGGAATCAGT...
umi CGAGGACCGC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=533]
21-374 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
423-457 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-533 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 363, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 21, 219, 224, 241, 285, 318, 511
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2172 = CGAGCCATCTCGTTTA-1

using 272 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 265]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CGAGCCATCTCGTTTA-1 contig 1 = GGACTCAACA...
umi TACATATATA = 221 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=490]
57-410 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=12)
432-466 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
466-490 ==> 0-24 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CATGLLGGPIYW at 399, score = 9 + 7
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 219
start codons at 57, 208, 255, 260, 264, 292, 321, 339, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2183 = CGATCGGAGACAGACC-1

using 60 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[60]
surviving nonsolo ucounts = 1[60]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2184 = CGATCGGAGACCCACC-1

using 215 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================

UMI info for barcode CGATCGGAGACCCACC-1 contig 1 = GTGGGCTCAG...
umi TGCGCCGTAT = 195 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=577]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=8)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
418-577 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CNSRDSSGNHVVF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 36, 155, 235, 334, 379
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 34.2197 = CGATCGGAGCTGTCTA-1

using 3799 reads

====================================================================================

graph has 2066 edges initially, 34 edges after simplification

total ucounts = 397
nonsolo ucounts = 162[2^74, 3^31, 4^20, 5^12, 6^5, 8^2, 9, 10, 11, 14, 34, 55, 78, 105, 134, 139, 158, 230, 262, 272, 333, 345, 454, 494]
surviving nonsolo ucounts = 10[78, 105, 134, 139, 158, 230, 272, 333, 345, 454]
ids = [317, 318, 209, 8, 393, 370, 100, 364, 169, 66]

====================================================================================

UMI info for barcode CGATCGGAGCTGTCTA-1 contig 1 = AGTGCTTTCT...
umi AAATTCCGCC = 138 reads: +448 validated
umi AGTTCGAGAG = 370 reads: -415 +1 -3XX +1 -1XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CACCTGCAGG = 622 reads: -415X +1 -5XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CGTACTCACG = 266 reads: -415 +1 -3XX +1 -1XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi GAATGGGTCT = 133 reads: +448 validated
umi TCTACCTGAG = 79 reads: +448 validated
umi TCTATATCGT = 100 reads: +448 validated

UMI info for barcode CGATCGGAGCTGTCTA-1 contig 2 = CTTTCTCTGG...
umi CAAGCACCTC = 272 reads: +379 validated
umi CCACTTACAG = 55 reads: -312X +1 -2X +8 -1XX +2 -2XX +4 -1XX +1 -2XX +1 -2XX +2 -2XX +1 -1XX +34 invalidated
umi TTCCCTCGGT = 279 reads: -337 +1 -3X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TTCTTAAGAG = 232 reads: +379 validated
umi TTTTGAATTG = 157 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=647]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
465-647 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=2)
junction support: 4 umis using 50 reads
cdr3 = CARGRALRVRRGDSYFDYW at 377, score = 9 + 7
umis assigned: [8, 66, 106, 169, 209, 317, 318]
of which 6 are surviving nonsolos
reads assigned: 1471
start codons at 17, 38, 82, 168, 183
confident = true

TIG 2[bases=564]
0-49 ==> 18-67 on |301|IGKV6D-21|5'UTR| [len=67] (mis=0)
49-391 ==> 0-342 on |302|IGKV6D-21|L-REGION+V-REGION| [len=342] (mis=4)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 102 reads
cdr3 = CHQSSSLPYTF at 367, score = 9 + 8
umis assigned: [100, 135, 364, 370, 393]
of which 4 are surviving nonsolos
reads assigned: 978
start codons at 11, 18, 49, 350, 470
confident = true
now this is a cell
paired!

GCTGTGTACTACTGTGCGAGAGGTCGGGCTTTGAGAGTACGAAGAGGCGACTCTTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCCATAGCCTGGAAGCTGAAGATGCTGCAGCGTATTACTGTCATCAAAGTAGTAGTTTACCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC
sorting bam, mem = 0.13
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk034-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk034-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

122.101 seconds used processing barcodes, peak mem = 0.28
