[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.28 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk031-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk031-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk031.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.0 = CCTAAAGGTATAATGG-1

using 226 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
0-61 ==> 18-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
0-61 ==> 5939-6000 on rc of segment after IGHV3-48 exon 1 [len=6000] (mis=0)
21-72 ==> 3150-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=9)
29-100 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
61-414 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=13)
420-465 ==> 0-45 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
cdr3 = CARDRIYAFDIW at 403, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 61, 217, 289, 338, 364, 422, 451
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.7 = CCTAAAGGTCCAGTGC-1

using 541 reads

====================================================================================

graph has 294 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[255, 281]
surviving nonsolo ucounts = 2[255, 281]
ids = [6, 2]

====================================================================================

UMI info for barcode CCTAAAGGTCCAGTGC-1 contig 1 = GGAGTCAGTC...
umi AGCAACCAGC = 284 reads: +388 validated
umi GATGCAGATT = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 81 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 523
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.11 = CCTAAAGGTCGGGTCT-1

using 312 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode CCTAAAGGTCGGGTCT-1 contig 1 = AGTCTCAGTC...
umi CAAAGGTATT = 306 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=550]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
383-414 ==> 7-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSYIFGFGPGF at 347, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 20, 26, 82, 95, 231, 252, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.15 = CCTAAAGGTGCACTTA-1

using 138 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 10, 120]
surviving nonsolo ucounts = 1[120]
ids = [7]

====================================================================================

UMI info for barcode CCTAAAGGTGCACTTA-1 contig 1 = GAGGCAGCGC...
umi TGCTTACCAA = 115 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=466]
28-381 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
416-466 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTLVF at 352, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 28, 185, 229, 236, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.21 = CCTAAAGGTGTCAATC-1

using 3794 reads

====================================================================================

graph has 3762 edges initially, 72 edges after simplification

total ucounts = 720
nonsolo ucounts = 533[2^94, 3^68, 4^60, 5^41, 6^54, 7^34, 8^27, 9^29, 10^22, 11^16, 12^17, 13^19, 14^12, 15^9, 16^9, 17^8, 18^4, 19^3, 20, 21, 22^2, 23, 27, 37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.28 = CCTAAAGGTTCCTCCA-1

using 18 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.35 = CCTAAAGTCACAGGCC-1

using 317 reads

====================================================================================

graph has 195 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 309]
surviving nonsolo ucounts = 1[309]
ids = [7]

====================================================================================

UMI info for barcode CCTAAAGTCACAGGCC-1 contig 1 = GTCAGTCTCA...
umi TTCGTGGGAC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-488 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.42 = CCTAAAGTCCACGTGG-1

using 291 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 286]
surviving nonsolo ucounts = 1[286]
ids = [2]

====================================================================================

UMI info for barcode CCTAAAGTCCACGTGG-1 contig 1 = GGGAGTCAGT...
umi CCGTAAATAG = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSSPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.48 = CCTAAAGTCCTATGTT-1

using 542 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 6, 523]
surviving nonsolo ucounts = 1[523]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=389]
4-216 ==> 151-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
216-253 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
253-389 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSTPLTF at 192, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 514
start codons at 175, 295
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.55 = CCTAAAGTCGCTTGTC-1

using 339 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 330]
surviving nonsolo ucounts = 1[330]
ids = [3]

====================================================================================

UMI info for barcode CCTAAAGTCGCTTGTC-1 contig 1 = GGGGAGGAAC...
umi CGGCTTTCTA = 331 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-61 ==> 0-25 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
61-378 ==> 28-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPPTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 36, 238, 241, 457
confident = false
see deletion of 3 bases at pos 25 on |279|IGKV3-11|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.64 = CCTAAAGTCTGAGGGA-1

using 8892 reads

====================================================================================

graph has 4338 edges initially, 36 edges after simplification

total ucounts = 656
nonsolo ucounts = 327[2^115, 3^59, 4^37, 5^19, 6^28, 7^10, 8^6, 9^5, 10^8, 11^3, 12^2, 13^2, 14^2, 15, 18, 31^2, 64, 77, 131, 142, 165, 205, 219, 226, 229, 238, 266, 271, 275, 283, 291, 300, 302, 303, 306, 312, 326, 353, 356, 366, 417, 434, 438]
surviving nonsolo ucounts = 27[64, 77, 131, 142, 165, 205, 219, 226, 229, 238, 266, 271, 275, 283, 291, 300, 302, 303, 306, 312, 326, 353, 356, 366, 417, 434, 438]
ids = [276, 357, 59, 308, 241, 230, 522, 51, 542, 253, ...]

====================================================================================

UMI info for barcode CCTAAAGTCTGAGGGA-1 contig 1 = AGCTTCAGCT...
umi ATGATGCACA = 295 reads: +391 validated
umi CCCTTATTCT = 351 reads: -366 +25 non-validated
umi CCTTCATGTT = 200 reads: +391 validated
umi CGTAAAGTAT = 240 reads: +391 validated
umi CGTACTACGG = 270 reads: +391 validated
umi CTATTTTTTG = 63 reads: -391 non-validated
umi CTTCAATACT = 145 reads: +391 validated
umi TAGTGCAGGC = 267 reads: +391 validated
umi TCGGGCCCGT = 232 reads: +391 validated

UMI info for barcode CCTAAAGTCTGAGGGA-1 contig 2 = GGGGATGCTT...
umi ACTATCGGCA = 333 reads: +436 validated
umi AGAATCTCCG = 228 reads: +436 validated
umi AGCGTCTGCC = 128 reads: +436 validated
umi CAACTATAGT = 421 reads: +436 validated
umi CATGCCAATT = 294 reads: -294X +1 -1X +140 invalidated
umi CCAATGCGTC = 363 reads: +436 validated
umi CCACTGACGG = 308 reads: +419 -1 +16 non-validated
umi CCTGCGTACC = 433 reads: +436 validated
umi CGCTCACCTT = 121 reads: +396 -40 non-validated
umi CTACGCACGT = 299 reads: +436 validated
umi CTGGATTCTT = 289 reads: +436 validated
umi GAAATCCTGT = 276 reads: -13X +423 invalidated
umi GAATACCCAG = 269 reads: +436 validated
umi GATGTATTGG = 75 reads: +436 validated
umi TAGAAGTACT = 317 reads: +436 validated
umi TCATTGCGAA = 221 reads: +436 validated
umi TCCGATCCAC = 307 reads: +436 validated
umi TCGATTTTAC = 437 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=649]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
438-649 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 253 reads
cdr3 = CAAWDDSLNGHVVF at 368, score = 8 + 8
umis assigned: [102, 207, 230, 253, 257, 276, 308, 494, 542]
of which 9 are surviving nonsolos
reads assigned: 2030
start codons at 47, 351, 376, 381, 393, 399
confident = true

TIG 2[bases=527]
20-397 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 17 umis using 386 reads
cdr3 = CARSYSGSSFDYW at 386, score = 9 + 7
umis assigned: [36, 51, 59, 131, 170, 183, 189, 226, 241, 267] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5046
start codons at 4, 20, 29, 41, 85
confident = true
now this is a cell
paired!

GTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGGAGCTATAGTGGGAGCTCATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGCCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.73 = CCTACACAGACACTAA-1

using 317 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^2, 3^2, 4, 6, 14, 275]
surviving nonsolo ucounts = 1[275]
ids = [14]

====================================================================================

UMI info for barcode CCTACACAGACACTAA-1 contig 1 = GCTCTGCCTC...
umi TTTATACGTA = 272 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-554 ==> 0-109 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.80 = CCTACACAGAGTTGGC-1

using 338 reads

====================================================================================

graph has 436 edges initially, 4 edges after simplification

total ucounts = 65
nonsolo ucounts = 49[2^6, 3^9, 4^10, 5^4, 6^3, 7, 8^4, 10, 11^3, 12^4, 14, 18, 20, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.89 = CCTACACAGCCAGAAC-1

using 55 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 11[2^3, 3^4, 5, 6, 7, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.95 = CCTACACAGCTAACAA-1

using 1085 reads

====================================================================================

graph has 384 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[1084]
surviving nonsolo ucounts = 1[1084]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=362]
2-114 ==> 242-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
113-151 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
151-362 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYSSSSTLRVF at 84, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 1067
start codons at 
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.97 = CCTACACAGCTAGTCT-1

using 13 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.99 = CCTACACAGCTGAACG-1

using 673 reads

====================================================================================

graph has 882 edges initially, 16 edges after simplification

total ucounts = 130
nonsolo ucounts = 101[2^18, 3^14, 4^16, 5^6, 6^8, 7^5, 8^9, 9^4, 10^3, 11^5, 12^3, 13^3, 14, 15^2, 17, 18, 19, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.109 = CCTACACAGGGTCTCC-1

using 16993 reads

====================================================================================

graph has 6208 edges initially, 76 edges after simplification

total ucounts = 983
nonsolo ucounts = 476[2^179, 3^101, 4^51, 5^34, 6^11, 7^21, 8^8, 9^7, 10^4, 12^3, 14, 18^2, 35, 41, 42, 45, 49, 80, 81, 84, 95, 104, 105, 135, 152, 155, 159, 169, 210, 223, 226, 228, 235, 239, 247, 250, 256, 258, 272^2, 276, 281, 290^2, 305, 308, 309, 311, 320, 322, 326, 332, 337, 342, 345, 355, 386^2, 393, 395, 408, 583, 684, 727, 763^2]
surviving nonsolo ucounts = 49[49, 81, 84, 95, 104, 105, 135, 152, 155, 159, 169, 210, 223, 226, 228, 235, 239, 247, 250, 256, 258, 272^2, 276, 281, 290^2, 305, 308, 309, 311, 320, 322, 326, 332, 337, 342, 345, 355, 386^2, 393, 395, 408, 583, 684, 727, 763^2]
ids = [456, 843, 66, 965, 131, 77, 635, 187, 479, 404, ...]

====================================================================================

UMI info for barcode CCTACACAGGGTCTCC-1 contig 1 = AACAACCAGA...
umi CTTATGCCAT = 45 reads: +344 -1 +9 -12 +76 non-validated
umi GGGGTGCCGC = 1 reads: -400 +1 -1X +3 -2X +3 -1 +3 -1X +1 -1X +2 -1X +3 -2X +17 invalidated
umi GTCACGGCCC = 134 reads: +442 validated
umi TTTATCGGTC = 93 reads: +442 validated

UMI info for barcode CCTACACAGGGTCTCC-1 contig 2 = GGGAGAGCCC...
umi AAGGCTCCCC = 258 reads: +388 validated
umi AATAATTAAT = 385 reads: +388 validated
umi AATGCAGGGG = 232 reads: +388 validated
umi ACACCTTCGG = 88 reads: +388 validated
umi ACATCAGGCT = 105 reads: +388 validated
umi ACATCTCCGG = 235 reads: +388 validated
umi ACGGATTGCC = 310 reads: +388 validated
umi ACTTCACTTT = 104 reads: +388 validated
umi AGTTACCTGC = 152 reads: +388 validated
umi ATTCCGAGCG = 317 reads: +388 validated
umi CACGCAATTC = 341 reads: +388 validated
umi CAGGGCGCCT = 241 reads: +388 validated
umi CAGTTGGTAG = 269 reads: +388 validated
umi CCCAACGTAG = 411 reads: +388 validated
umi CGGTTCTAGT = 157 reads: +388 validated
umi CGTCTATTAC = 326 reads: +388 validated
umi CTCGTAACTA = 210 reads: +388 validated
umi CTCTTGTAGA = 346 reads: +388 validated
umi CTGCCATCTT = 248 reads: +388 validated
umi GAACCCAGAA = 170 reads: +388 validated
umi GACGTGTGCG = 157 reads: +388 validated
umi GATTAGTTTG = 258 reads: +388 validated
umi GCATGAGTAG = 331 reads: +388 validated
umi GCGAATACGA = 225 reads: +388 validated
umi GCTAACAATA = 291 reads: +388 validated
umi GCTACGTGAC = 253 reads: +388 validated
umi GCTTTTGGCA = 391 reads: +388 validated
umi GGAACGAGTA = 291 reads: +388 validated
umi GGAGAGGGGG = 344 reads: +388 validated
umi GGTGCTACAG = 321 reads: +388 validated
umi GTAAAAACAC = 355 reads: +388 validated
umi GTATGATCTG = 278 reads: +68 -1XX +319 invalidated
umi GTCTGGTACG = 390 reads: +388 validated
umi GTTCATCTCT = 564 reads: -350X +3 -1XX +1 -2XX +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi TAATAGCCCA = 310 reads: +388 validated
umi TACGTTAGGA = 225 reads: +388 validated
umi TACTTCCTCA = 312 reads: +388 validated
umi TATAACCCGT = 305 reads: +388 validated
umi TCGTATGTAT = 400 reads: +388 validated
umi TCTGTCGGCG = 718 reads: -246 +142 non-validated
umi TGATCAGTCA = 275 reads: +388 validated
umi TGCTGGTCTT = 80 reads: +348 -1 +39 non-validated
umi TTACGGCGGA = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-51 ==> 7-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
51-404 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=28)
432-493 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=5)
493-560 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 19 reads
cdr3 = CARLSFDHSGYDSVYHYYYMDVW at 393, score = 9 + 7
umis assigned: [456, 592, 635, 965]
of which 4 are surviving nonsolos
reads assigned: 271
start codons at 51, 249, 348, 450
confident = true

TIG 2[bases=571]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 42 umis using 1846 reads
cdr3 = CQQRTNWPQVCSF at 368, score = 9 + 7
umis assigned: [39, 45, 52, 66, 77, 79, 109, 131, 187, 264] and 33 others
of which 43 are surviving nonsolos
reads assigned: 12058
start codons at 47, 252, 255, 477
confident = true
now this is a cell
paired!

TGTGCGAGACTGTCCTTTGACCATAGTGGCTACGATTCGGTCTACCATTACTACTATATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCCTAGAGCCTGAAGATTTCGCAGTATATTACTGTCAGCAGCGTACCAACTGGCCTCAAGTGTGCAGTTTTGGCCAGGGGACCAAACTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.111 = CCTACACAGGTGACCA-1

using 199 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 43
nonsolo ucounts = 30[2^6, 3^4, 4^3, 5^3, 6, 7, 8^3, 9^3, 10, 11^3, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.123 = CCTACACAGTGCCAGA-1

using 31 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.138 = CCTACACCAATCGAAA-1

using 286 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[282]
surviving nonsolo ucounts = 1[282]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.142 = CCTACACCACAGAGGT-1

using 503 reads

====================================================================================

graph has 192 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 192, 301]
surviving nonsolo ucounts = 2[192, 301]
ids = [0, 5]

====================================================================================

UMI info for barcode CCTACACCACAGAGGT-1 contig 1 = AGCTTCAGCT...
umi TAGGAGGGTT = 295 reads: +388 validated

UMI info for barcode CCTACACCACAGAGGT-1 contig 2 = ACCCAAAAAC...
umi ATAACTTTGC = 184 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=521]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-521 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=579]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=45)
432-481 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=8)
481-579 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDLFENAITSRWFDSW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 54, 141, 190, 274, 289, 360, 418, 434, 535
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.147 = CCTACACCACCCTATC-1

using 197 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 192]
surviving nonsolo ucounts = 1[192]
ids = [3]

====================================================================================

UMI info for barcode CCTACACCACCCTATC-1 contig 1 = GAGTCAGTCC...
umi GTACTTCGTA = 193 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.156 = CCTACACCACTATCTT-1

using 408 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^3, 3, 7, 8, 13, 362]
surviving nonsolo ucounts = 1[362]
ids = [4]

====================================================================================

UMI info for barcode CCTACACCACTATCTT-1 contig 1 = AGGAGTCAGA...
umi CATGCTTCTT = 362 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.158 = CCTACACCAGATAATG-1

using 856 reads

====================================================================================

graph has 300 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 248, 597]
surviving nonsolo ucounts = 2[248, 597]
ids = [7, 6]

====================================================================================

UMI info for barcode CCTACACCAGATAATG-1 contig 1 = GGAACTGCTC...
umi TTATGAGGCT = 227 reads: +379 validated
umi TTGGACTATC = 1 reads: -206 +1 -2X +2 -1X +1 -3X +1 -2 +3 -1 +3 -2 +3 -1 +3 -2 +10 -3X +1 -3 +1 -2X +1 -1 +3 -117 invalidated

GOOD CONTIGS

TIG 1[bases=496]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=23)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-496 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDNWWTF at 352, score = 8 + 8
umis assigned: [7, 8]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 31, 100, 236, 239, 362, 452
confident = false

REJECT CONTIGS

TIG 1[bases=379]
4-130 ==> 230-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
130-168 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
168-379 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 98, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 590
start codons at 81, 108, 132, 300
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.163 = CCTACACCAGCTTCGG-1

using 180 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 9, 157]
surviving nonsolo ucounts = 1[157]
ids = [3]

====================================================================================

UMI info for barcode CCTACACCAGCTTCGG-1 contig 1 = ACCCAAAAAC...
umi CTCGTCACCC = 153 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=517]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-517 ==> 0-27 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.178 = CCTACACCATGGAATA-1

using 47 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 6, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 31.186 = CCTACACGTAAACGCG-1

using 210 reads

====================================================================================

graph has 297 edges initially, 2 edges after simplification

total ucounts = 128
nonsolo ucounts = 43[2^28, 3^7, 4, 5^3, 6^2, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk031-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk031-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.332 seconds used processing barcodes, peak mem = 0.23
