[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.29 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk030-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk030-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk030.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.0 = CCGTTCACAGCTTCGG-1

using 10594 reads

====================================================================================

graph has 3676 edges initially, 50 edges after simplification

total ucounts = 358
nonsolo ucounts = 155[2^43, 3^27, 4^25, 5^3, 6^7, 7^2, 8^4, 9^4, 10, 14, 18, 90, 195, 197, 198, 199, 200, 209, 211, 220, 228, 231, 234, 235^2, 238, 245, 248, 253, 255^2, 259, 260, 261^2, 264, 268, 278, 289, 290, 298, 301, 305, 311, 340, 505^2, 572]
surviving nonsolo ucounts = 37[9, 195, 197, 198, 199, 200, 209, 211, 220, 228, 231, 234, 235^2, 238, 245, 248, 253, 255^2, 259, 260, 261^2, 264, 268, 278, 289, 290, 298, 301, 305, 311, 340, 505^2, 572]
ids = [181, 299, 242, 7, 246, 281, 165, 162, 277, 128, ...]

====================================================================================

UMI info for barcode CCGTTCACAGCTTCGG-1 contig 1 = GAGCTACAAC...
umi AAAGTCGCGC = 237 reads: +400 validated
umi AACTCCGCAG = 202 reads: +400 validated
umi AATTGTCCAG = 262 reads: +400 validated
umi AGGCCTTAAT = 310 reads: +400 validated
umi ATAGCAACGA = 291 reads: +400 validated
umi CACCCAACTC = 261 reads: +400 validated
umi CATTTGGAAG = 504 reads: +400 validated
umi CCGATTGATT = 231 reads: +400 validated
umi CGTCAGTTTG = 209 reads: +400 validated
umi CGTGGCGAGC = 207 reads: +400 validated
umi CGTGGTACCC = 289 reads: +400 validated
umi GACGATACTG = 294 reads: +400 validated
umi GATCCTGGTT = 261 reads: +400 validated
umi GCGATGACCA = 301 reads: +400 validated
umi GCGCGTGTCT = 238 reads: +400 validated
umi GTACCAGTCA = 255 reads: +400 validated
umi GTCCAACACA = 207 reads: +195 -1XX +204 invalidated
umi GTGGTGCTTC = 262 reads: +400 validated
umi TAGCATAGTA = 221 reads: +400 validated
umi TAGTTAAGTT = 200 reads: +400 validated
umi TAGTTCGGAC = 254 reads: +400 validated
umi TCATGTACAT = 192 reads: +400 validated
umi TCTCAGAGGC = 358 reads: +400 validated
umi TTCACTCATC = 248 reads: +400 validated

UMI info for barcode CCGTTCACAGCTTCGG-1 contig 2 = AAACCACACC...
umi CATAACCGTC = 240 reads: +412 validated
umi CCTTTAGAGT = 202 reads: +412 validated
umi CTGTACTCGG = 10 reads: -40 +56 -2 +2 -1 +82 -1 +24 -1 +98 -29 +56 -20 non-validated
umi GCAGTACCGT = 305 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 830 reads
cdr3 = CQQYYSTLWTF at 369, score = 9 + 8
umis assigned: [2, 7, 22, 53, 66, 96, 117, 128, 162, 165] and 14 others
of which 24 are surviving nonsolos
reads assigned: 6173
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=531]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=3)
414-460 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 65 reads
cdr3 = CARRVDSRGSDYW at 390, score = 8 + 7
umis assigned: [106, 144, 181, 211]
of which 4 are surviving nonsolos
reads assigned: 743
start codons at 48, 199, 246, 251, 268, 283, 312, 345
confident = true

REJECT CONTIGS

TIG 1[bases=559]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
20-83 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [31, 98, 189, 204, 221, 242, 260, 294, 328]
of which 9 are surviving nonsolos
reads assigned: 2783
start codons at 31, 37, 93, 106, 245, 368, 465
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGACGGGTTGATAGTAGAGGATCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCTGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.6 = CCGTTCACAGTTAACC-1

using 17 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.8 = CCGTTCACATACTACG-1

using 601 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 588]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.11 = CCGTTCACATCACCCT-1

using 228 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================

UMI info for barcode CCGTTCACATCACCCT-1 contig 1 = CTGGGCCTCA...
umi CCGATGGTTG = 207 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=526]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-373 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
413-526 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQAWDSSFWVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.15 = CCGTTCACATCGATTG-1

using 234 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 225]
surviving nonsolo ucounts = 1[225]
ids = [1]

====================================================================================

UMI info for barcode CCGTTCACATCGATTG-1 contig 1 = GACTGATCAG...
umi ATCCACGCGT = 220 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=495]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-360 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
431-495 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMNTLPGGFTF at 370, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.35 = CCGTTCAGTCAGGACA-1

using 252 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 243]
surviving nonsolo ucounts = 1[243]
ids = [5]

====================================================================================

UMI info for barcode CCGTTCAGTCAGGACA-1 contig 1 = CTGGGCCTAA...
umi GCAGATACGT = 237 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=534]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-382 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-534 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQVWDSSSDHVVF at 352, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 37, 98, 236, 239, 335, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.37 = CCGTTCAGTCCCTACT-1

using 250 reads

====================================================================================

graph has 86 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[86, 159]
surviving nonsolo ucounts = 2[86, 159]
ids = [2, 0]

====================================================================================

UMI info for barcode CCGTTCAGTCCCTACT-1 contig 1 = GAATCAGTCC...
umi CACGTCCTTT = 82 reads: +388 validated

UMI info for barcode CCGTTCAGTCCCTACT-1 contig 2 = GTCTCAGGAG...
umi ACAGCTGGGT = 155 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=488]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-488 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=547]
35-385 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-547 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSYTSSSTLVVF at 359, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 35, 192, 236, 243, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.39 = CCGTTCAGTCCGTGAC-1

using 508 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 232, 266]
surviving nonsolo ucounts = 2[232, 266]
ids = [5, 2]

====================================================================================

UMI info for barcode CCGTTCAGTCCGTGAC-1 contig 1 = TGGGAGGAGT...
umi ATCCACTGCT = 261 reads: +388 validated
umi CTTATTCACT = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 84 reads
cdr3 = CQQTYSTPLTF at 358, score = 9 + 9
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 490
start codons at 31, 37, 93, 106, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.53 = CCGTTCATCAAACCGT-1

using 506 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[180, 319]
surviving nonsolo ucounts = 2[180, 319]
ids = [5, 2]

====================================================================================

UMI info for barcode CCGTTCATCAAACCGT-1 contig 1 = TCAGCTTCAG...
umi CGGCAATCCT = 178 reads: +388 validated

UMI info for barcode CCGTTCATCAAACCGT-1 contig 2 = TGGGGAGGAA...
umi ATATCAAGGG = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=588]
0-49 ==> 65-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
49-402 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=16)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-588 ==> 0-151 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CASWDDSLRGRVF at 370, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 49, 203, 353, 378, 383
confident = false

TIG 2[bases=558]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQRSNWPPLTF at 358, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 37, 242, 245, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.59 = CCGTTCATCACTCCTG-1

using 1327 reads

====================================================================================

graph has 1125 edges initially, 50 edges after simplification

total ucounts = 786
nonsolo ucounts = 280[2^160, 3^66, 4^29, 5^5, 6^5, 7^5, 8^4, 9, 10^2, 12^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.62 = CCGTTCATCACTTATC-1

using 304 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 10, 12, 272]
surviving nonsolo ucounts = 1[272]
ids = [8]

====================================================================================

UMI info for barcode CCGTTCATCACTTATC-1 contig 1 = GCTCCAAACA...
umi TCAATCATCT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=641]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSAWDSSLNVWVL at 363, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.69 = CCGTTCATCAGTACGT-1

using 167 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 66
nonsolo ucounts = 35[2^11, 3^9, 4^5, 5^4, 6^2, 7, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.74 = CCGTTCATCCAGAGGA-1

using 308 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 296]
surviving nonsolo ucounts = 1[296]
ids = [6]

====================================================================================

UMI info for barcode CCGTTCATCCAGAGGA-1 contig 1 = GGGCAGAAGT...
umi TACGTAACAG = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=1)
31-382 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=4)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-510 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQKYNSVPLTF at 358, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 31, 37, 93, 106, 242, 341, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.87 = CCGTTCATCGCTAGCG-1

using 72 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 66]
surviving nonsolo ucounts = 1[66]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.90 = CCGTTCATCTACTCAT-1

using 338 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[337]
surviving nonsolo ucounts = 1[337]
ids = [1]

====================================================================================

UMI info for barcode CCGTTCATCTACTCAT-1 contig 1 = GGAATCAGTC...
umi TACACTACCA = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-500 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQHKSYPFTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.103 = CCGTTCATCTTCGGTC-1

using 308 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [0]

====================================================================================

UMI info for barcode CCGTTCATCTTCGGTC-1 contig 1 = GGGAGGAACT...
umi ATCAATCTGA = 277 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-512 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSDWPRTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.106 = CCGTTCATCTTGCATT-1

using 9883 reads

====================================================================================

graph has 8032 edges initially, 146 edges after simplification

total ucounts = 2626
nonsolo ucounts = 1083[2^538, 3^258, 4^116, 5^70, 6^25, 7^21, 8^14, 9^4, 10^6, 11, 12, 13^3, 14^3, 16, 19, 26, 32, 99, 127, 157, 166, 180, 184, 195, 212, 226, 228, 230, 272, 278, 296, 303, 315, 377, 403, 724]
surviving nonsolo ucounts = 20[32, 99, 127, 157, 166, 180, 184, 195, 212, 226, 228, 230, 272, 278, 296, 303, 315, 377, 403, 724]
ids = [321, 1119, 188, 2348, 1428, 361, 1804, 1243, 1452, 308, ...]

====================================================================================

UMI info for barcode CCGTTCATCTTGCATT-1 contig 1 = TCTGGCGCCA...
umi ACATGGGGGC = 124 reads: +388 validated
umi ACTTACTTCC = 23 reads: -324 +1 -3X +2 -4XX +1 -3XX +2 -8XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi ACTTTGACAA = 32 reads: -6 +382 non-validated
umi AGCTACCGCG = 182 reads: +388 validated
umi CCGGCAGCTT = 388 reads: -339X +2 -7XX +1 -1XX +1 -2XX +3 -1XX +31 invalidated
umi GCACTAAGTT = 165 reads: +388 validated
umi GCCCGCGGTA = 214 reads: +388 validated
umi TAACCCTCCT = 185 reads: +18 -1XX +369 invalidated
umi TCCCACACCG = 404 reads: -354 +2 -1XX +31 invalidated
umi TGTTAACGAG = 157 reads: +388 validated

UMI info for barcode CCGTTCATCTTGCATT-1 contig 2 = GTCAGAGCCC...
umi AATCACGCTC = 276 reads: +385 validated
umi CACGTTCGTT = 321 reads: -11X +20 -1XX +1 -1XX +1 -5XX +1 -6XX +338 invalidated
umi CTACCCCGAC = 99 reads: +385 validated
umi CTCTTTCGAT = 226 reads: +385 validated
umi CTGGTTTGTG = 297 reads: +385 validated
umi GTAGATACAA = 269 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=633]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=8)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 165 reads
cdr3 = CLLYYGGASWVF at 358, score = 8 + 8
umis assigned: [188, 308, 321, 361, 912, 1428, 1452, 1804, 2069, 2348]
of which 10 are surviving nonsolos
reads assigned: 1829
start codons at 34, 371
confident = true

TIG 2[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
47-93 ==> 0-46 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
99-370 ==> 46-317 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=18)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 207 reads
cdr3 = CQQRTGSITF at 374, score = 9 + 8
umis assigned: [112, 695, 1119, 1187, 1227, 1662]
of which 6 are surviving nonsolos
reads assigned: 1462
start codons at 47, 261, 474
confident = true
see insertion of CAGTTT at pos 46 on |279|IGKV3-11|L-REGION+V-REGION|

REJECT CONTIGS

TIG 1[bases=641]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=1)
12-33 ==> 1207-1228 on segment before IGLV5-48 exon 1 [len=9210] (mis=1)
24-44 ==> 1493-1513 on rc of segment before IGLV10-54 exon 1 [len=5448] (mis=0)
28-397 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=14)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
430-641 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
cdr3 = CMIWHSSAMSSELGP at 370, score = 7 + 4
umis assigned: [942, 1243, 1357]
of which 3 are surviving nonsolos
reads assigned: 721
start codons at 28, 170, 187, 195, 302, 314, 353, 373, 394
confident = false
not full
frameshifted full length stopped transcript of length 641
VJ delta = 30
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.111 = CCTAAAGAGACAGACC-1

using 283 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[282]
surviving nonsolo ucounts = 1[282]
ids = [0]

====================================================================================

UMI info for barcode CCTAAAGAGACAGACC-1 contig 1 = GTCAGACCCT...
umi ATTATACCGT = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=481]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-481 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.115 = CCTAAAGAGAGTAAGG-1

using 607 reads

====================================================================================

graph has 229 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^5, 4, 587]
surviving nonsolo ucounts = 1[587]
ids = [0]

====================================================================================

UMI info for barcode CCTAAAGAGAGTAAGG-1 contig 1 = GTCAGACCCA...
umi ACAATCGGAT = 543 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-503 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 94 reads
cdr3 = CQQANSFPITF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 537
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.124 = CCTAAAGAGGCCCTTG-1

using 339 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 54, 280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode CCTAAAGAGGCCCTTG-1 contig 1 = GAATCAGTCC...
umi GACGTAGTAT = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.126 = CCTAAAGAGGGCTCTC-1

using 264 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 6, 52, 199]
surviving nonsolo ucounts = 2[52, 199]
ids = [4, 5]

====================================================================================

UMI info for barcode CCTAAAGAGGGCTCTC-1 contig 1 = AGTGCTTTCT...
umi TATAAGGACC = 192 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=538]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-538 ==> 0-70 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 17, 38, 82, 168, 255, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.129 = CCTAAAGAGTAGGCCA-1

using 267 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 259]
surviving nonsolo ucounts = 1[259]
ids = [1]

====================================================================================

UMI info for barcode CCTAAAGAGTAGGCCA-1 contig 1 = GCTCTGCTTC...
umi ATACTTTAAT = 249 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=503]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=24)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-503 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDSTLSGSVF at 375, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.137 = CCTAAAGAGTTACGGG-1

using 299 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[297]
surviving nonsolo ucounts = 1[297]
ids = [2]

====================================================================================

UMI info for barcode CCTAAAGAGTTACGGG-1 contig 1 = GGAGTCAGAC...
umi TTGTACTGAA = 286 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=497]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
408-497 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQAKSFSF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 26, 32, 88, 101, 237, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.144 = CCTAAAGCAAGCCCAC-1

using 17 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.146 = CCTAAAGCAATGTAAG-1

using 385 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 375]
surviving nonsolo ucounts = 1[375]
ids = [2]

====================================================================================

UMI info for barcode CCTAAAGCAATGTAAG-1 contig 1 = AGTCAGTCTC...
umi CCAAGGGGTT = 332 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-505 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.149 = CCTAAAGCACACATGT-1

using 341 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [2]

====================================================================================

UMI info for barcode CCTAAAGCACACATGT-1 contig 1 = TGATCAGGAC...
umi CGTGGGATCG = 333 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=564]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CMQALQTRETF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.157 = CCTAAAGCAGACAAGC-1

using 176 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 4, 161]
surviving nonsolo ucounts = 1[161]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=545]
0-81 ==> 11262-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
35-310 ==> 0-275 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=11)
311-383 ==> 275-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=5) [SHIFT!]
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
421-545 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CYSTDNSGRHSGMF at 351, score = 6 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 35, 96, 183, 230, 234, 334, 387
confident = false
not full
frameshifted full length stopped transcript of length 545
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.165 = CCTAAAGCAGGCGATA-1

using 160 reads

====================================================================================

graph has 226 edges initially, 6 edges after simplification

total ucounts = 35
nonsolo ucounts = 24[2, 3^2, 4^8, 5^3, 6^2, 7^3, 8, 10^2, 14, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.167 = CCTAAAGCAGTCAGAG-1

using 8671 reads

====================================================================================

graph has 5149 edges initially, 46 edges after simplification

total ucounts = 626
nonsolo ucounts = 310[2^108, 3^66, 4^23, 5^25, 6^14, 7^15, 8^8, 9^6, 10^4, 11^2, 12^3, 13^2, 14^2, 15^2, 27, 30, 39, 49, 53, 59, 104, 120, 122, 157, 159, 172, 190, 200, 202, 203, 215, 225, 233, 273, 290, 300, 351, 354, 358, 374, 402, 432, 552, 990]
surviving nonsolo ucounts = 33[8, 10, 12, 14, 15^2, 27, 39, 49, 53, 59, 104, 120, 122, 157, 159, 172, 190, 202, 203, 215, 225, 233, 273, 300, 351, 354, 358, 374, 402, 432, 552, 990]
ids = [212, 215, 208, 217, 139, 211, 292, 210, 472, 258, ...]

====================================================================================

UMI info for barcode CCTAAAGCAGTCAGAG-1 contig 1 = AGAGCTCTGG...
umi ATTATGGCAA = 17 reads: -35 +12 -1 +49 -1 +3 -1 +8 -1 +175 -5 +56 -47 non-validated
umi CCATTAACGC = 304 reads: +394 validated
umi CCGTGGAAGT = 13 reads: -36 +54 -1 +9 -1 +2 -1 +18 -48 +182 -9 +2 -1 +30 non-validated
umi CCGTGGTAGT = 38 reads: +2 -1 +15 -4 +6 -2 +2 -25 +337 non-validated
umi CCGTGGTATT = 14 reads: -40 +182 -2X +2 -1 +1 -125 +8 -1 +32 invalidated
umi CCGTGGTTGT = 8 reads: -170 +181 -43 non-validated
umi CCGTGTAAGT = 11 reads: +1 -1 +3 -1 +21 -1 +7 -1 +2 -1 +4 -1 +1 -2 +2 -1 +4 -1 +16 -8 +56 -49 +73 -1 +51 -1 +5 -79 non-validated
umi CCGTGTTAGT = 13 reads: +19 -6 +182 -2 +79 -27 +56 -12 +11 non-validated
umi CCTACGGGCT = 124 reads: +394 validated
umi CGTATGTGAG = 56 reads: +386 -8 non-validated
umi GGATTATCAC = 204 reads: +394 validated
umi TGTATGTACC = 341 reads: +394 validated

UMI info for barcode CCTAAAGCAGTCAGAG-1 contig 2 = AGCTCTGGGA...
umi ACAGGGCTTT = 184 reads: +418 validated
umi ACCGTACTTT = 141 reads: +418 validated
umi ATACTAAGTG = 126 reads: +9 -1XX +11 -1XX +9 -1XX +8 -1XX +34 -1XX +4 -1XX +9 -1XX +1 -2XX +16 -1XX +23 -1XX +5 -2XX +6 -1XX +1 -2XX +2 -2XX +44 -6XX +4 -1XX +1 -1XX +3 -5XX +1 -161XX +15 -1 +10 -1 +6 -1 +1 invalidated
umi ATACTACAAT = 159 reads: +418 validated
umi ATCTGCCAGT = 117 reads: +418 validated
umi CCCTTTGGTT = 223 reads: +418 validated
umi CCTTTACGTC = 234 reads: +418 validated
umi CGTTCCTGCC = 178 reads: +405 -13 non-validated
umi CTTCCTCTAC = 27 reads: +294 -54 +64 -1 +5 non-validated
umi GGAAGGAGCA = 180 reads: +418 validated
umi GTTTAGGTGA = 269 reads: +418 validated
umi TAAAATACAA = 371 reads: +418 validated
umi TCACTACACA = 45 reads: +98 -1 +186 -1 +11 -1 +5 -1 +4 -1 +1 -1 +4 -1 +97 -5 non-validated
umi TCAGTAAGCT = 425 reads: +418 validated
umi TGCGGCCTTT = 357 reads: +418 validated
umi TTATGACTAC = 232 reads: +411 -7 non-validated
umi TTCGAGGAAT = 91 reads: -418 non-validated

GOOD CONTIGS

TIG 1[bases=627]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=3)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
416-627 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 183 reads
cdr3 = CQTWGTGFWVF at 355, score = 8 + 8
umis assigned: [139, 196, 208, 210, 211, 212, 215, 217, 223, 258] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1115
start codons at 22, 183, 223, 239, 338
confident = true

TIG 2[bases=569]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 179 reads
cdr3 = CTTETGLYSVDYW at 428, score = 8 + 7
umis assigned: [26, 44, 107, 108, 129, 204, 233, 265, 292, 364] and 7 others
of which 16 are surviving nonsolos
reads assigned: 3260
start codons at 80, 236, 303, 360, 389
confident = true

REJECT CONTIGS

TIG 1[bases=464]
5-289 ==> 38-322 on rc of segment before IGKJ1 exon 1 [len=322] (mis=1)
289-328 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
328-464 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [17, 77, 138, 228, 254, 408]
of which 5 are surviving nonsolos
reads assigned: 2321
start codons at 25, 193, 212, 370
confident = false
did not find CDR3
now this is a cell
paired!

CTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGAAACCGGGCTATACTCCGTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCTTTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.170 = CCTAAAGCATCACGTA-1

using 337 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [1]

====================================================================================

UMI info for barcode CCTAAAGCATCACGTA-1 contig 1 = GGAGTCAGAC...
umi AGTTACACCG = 327 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.173 = CCTAAAGCATGCCTAA-1

using 883 reads

====================================================================================

graph has 308 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 240, 631]
surviving nonsolo ucounts = 2[240, 631]
ids = [10, 3]

====================================================================================

UMI info for barcode CCTAAAGCATGCCTAA-1 contig 1 = TGGGGAGGAG...
umi CCGGTCACGC = 631 reads: +388 validated
umi TTGGATATTG = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 136 reads
cdr3 = CQQSYSTPKTF at 359, score = 9 + 8
umis assigned: [3, 10]
of which 2 are surviving nonsolos
reads assigned: 858
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 30.176 = CCTAAAGGTACCAGTT-1

using 1498 reads

====================================================================================

graph has 1210 edges initially, 6 edges after simplification

total ucounts = 281
nonsolo ucounts = 121[2^44, 3^26, 4^12, 5^14, 6^6, 7^4, 8^2, 9^2, 10^4, 17, 18, 53, 98, 179, 253, 298]
surviving nonsolo ucounts = 5[53, 98, 179, 253, 298]
ids = [116, 181, 91, 234, 218]

====================================================================================

UMI info for barcode CCTAAAGGTACCAGTT-1 contig 1 = GCTGCGGGTA...
umi TCGAGCACCG = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=2)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
428-563 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CAAWDDSLNGWVF at 361, score = 8 + 8
umis assigned: [234]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 40, 191, 248, 251, 344, 369, 374, 386
confident = true

REJECT CONTIGS

TIG 1[bases=555]
6-87 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [91, 116, 181, 218]
of which 4 are surviving nonsolos
reads assigned: 608
start codons at 30, 36, 92, 105, 241, 461
confident = false
did not find CDR3
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk030-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk030-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

8.169 seconds used processing barcodes, peak mem = 0.23
