[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.30 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk029-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk029-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk029.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.0 = CCGTACTCATCCAACA-1

using 444 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 435]
surviving nonsolo ucounts = 1[435]
ids = [2]

====================================================================================

UMI info for barcode CCGTACTCATCCAACA-1 contig 1 = AGCTTCAGCT...
umi AATCGTCCTG = 432 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=609]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
440-609 ==> 0-169 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CAAWDDSLSGPGWVF at 367, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 422
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.1 = CCGTACTCATCCCATC-1

using 427 reads

====================================================================================

graph has 495 edges initially, 6 edges after simplification

total ucounts = 245
nonsolo ucounts = 93[2^49, 3^22, 4^11, 5^5, 6^3, 8^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.3 = CCGTACTCATCGGGTC-1

using 157 reads

====================================================================================

graph has 62 edges initially, 10 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[33, 121]
surviving nonsolo ucounts = 2[33, 121]
ids = [3, 2]

====================================================================================

UMI info for barcode CCGTACTCATCGGGTC-1 contig 1 = GCTCTGCTTC...
umi GGCGGGTGGA = 118 reads: +394 validated
umi TAAAGTCCTC = 6 reads: -11 +2 -2XX +2 -1XX +8 -1XX +6 -1XX +4 -3XX +24 -2XX +4 -1XX +6 -1XX +4 -1X +9 -1X +1 -1X +2 -1X +1 -126 +10 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1X +1 -1X +3 -106 invalidated

GOOD CONTIGS

TIG 1[bases=456]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 123
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.19 = CCGTACTGTAGCGTAG-1

using 450 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3, 4, 27, 162, 245]
surviving nonsolo ucounts = 3[27, 162, 245]
ids = [9, 3, 1]

====================================================================================

UMI info for barcode CCGTACTGTAGCGTAG-1 contig 1 = GCTCTGCTTC...
umi AGTTTACACC = 160 reads: +391 validated
umi GTTCTGTTCG = 26 reads: -4 +1 -1 +6 -2 +4 -1 +266 -21 +85 non-validated

GOOD CONTIGS

TIG 1[bases=522]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-522 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [3, 9]
of which 2 are surviving nonsolos
reads assigned: 184
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.20 = CCGTACTGTATAGGTA-1

using 126 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 3[5, 9, 99]
surviving nonsolo ucounts = 1[99]
ids = [10]

====================================================================================

UMI info for barcode CCGTACTGTATAGGTA-1 contig 1 = GAGGAATCAG...
umi GGGCTAATAG = 100 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.21 = CCGTACTGTATCACCA-1

using 286 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 276]
surviving nonsolo ucounts = 1[276]
ids = [6]

====================================================================================

UMI info for barcode CCGTACTGTATCACCA-1 contig 1 = TCAGTCCCAC...
umi TCTAAAGCTA = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-22 ==> 5-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
22-373 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 22, 28, 97, 233, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.22 = CCGTACTGTCACACGC-1

using 224 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^3, 3, 206]
surviving nonsolo ucounts = 1[206]
ids = [7]

====================================================================================

UMI info for barcode CCGTACTGTCACACGC-1 contig 1 = AACCACACCC...
umi CCGAAATCTT = 197 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=561]
0-47 ==> 12-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
47-400 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
449-483 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
483-561 ==> 0-78 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 389, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 47, 245, 250, 267, 311, 344, 537
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.27 = CCGTACTGTCGAGATG-1

using 115 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 104]
surviving nonsolo ucounts = 1[104]
ids = [8]

====================================================================================

UMI info for barcode CCGTACTGTCGAGATG-1 contig 1 = AAAAACCACA...
umi TTAGTCTGCT = 100 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=539]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-539 ==> 0-53 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.39 = CCGTACTGTTAAGTAG-1

using 285 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 6, 274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

UMI info for barcode CCGTACTGTTAAGTAG-1 contig 1 = GAATCAGTCC...
umi GACGACATTA = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-474 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.48 = CCGTACTGTTTCCACC-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.58 = CCGTACTTCACGGTTA-1

using 308 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^5, 4, 291]
surviving nonsolo ucounts = 1[291]
ids = [5]

====================================================================================

UMI info for barcode CCGTACTTCACGGTTA-1 contig 1 = GAATCAGTCC...
umi CAAAGGAAGG = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.65 = CCGTACTTCAGTTGAC-1

using 29 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.72 = CCGTACTTCCATTCTA-1

using 693 reads

====================================================================================

graph has 746 edges initially, 50 edges after simplification

total ucounts = 348
nonsolo ucounts = 133[2^66, 3^34, 4^22, 5, 6^4, 7^2, 8^3, 89]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.75 = CCGTACTTCCCGGATG-1

using 243 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 233]
surviving nonsolo ucounts = 1[233]
ids = [5]

====================================================================================

UMI info for barcode CCGTACTTCCCGGATG-1 contig 1 = AGTCTCAGTC...
umi GTCTCACTCA = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-503 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSDSLPLTF at 347, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.79 = CCGTACTTCCTTGGTC-1

using 572 reads

====================================================================================

graph has 268 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 4^2, 555]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.83 = CCGTACTTCGAGAACG-1

using 124 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 6, 109]
surviving nonsolo ucounts = 1[109]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.91 = CCGTACTTCGTCACGG-1

using 484 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[5, 165, 307]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode CCGTACTTCGTCACGG-1 contig 1 = GACTTTCTGA...
umi CTGTTTTGGT = 250 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=502]
36-384 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=8)
394-425 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=6)
432-472 ==> 12-52 on |50|IGHJ2|J-REGION| [len=52] (mis=0)
472-502 ==> 0-30 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARTPNIVVVPAAILGVDLW at 381, score = 9 + 7
umis assigned: [5]
of which 0 are surviving nonsolos
reads assigned: 247
start codons at 36, 80
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.108 = CCGTGGAAGACAGACC-1

using 160 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 7, 144]
surviving nonsolo ucounts = 1[144]
ids = [1]

====================================================================================

UMI info for barcode CCGTGGAAGACAGACC-1 contig 1 = CTCTGCTTCA...
umi ACGGGGTATC = 133 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=505]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
406-444 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
444-505 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSYDSSLSGLYVF at 374, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 50, 204, 207, 258, 357, 384, 408
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.109 = CCGTGGAAGACCTAGG-1

using 11097 reads

====================================================================================

graph has 4443 edges initially, 40 edges after simplification

total ucounts = 513
nonsolo ucounts = 218[2^86, 3^44, 4^15, 5^8, 6^7, 7^3, 8^3, 9, 10^3, 11, 18, 20, 29, 65, 70, 71, 77, 95, 104, 107^2, 111^2, 116, 117, 128, 144, 192, 195^2, 200, 208, 214, 216, 217, 232, 233, 235, 236, 239, 246, 247, 256, 257, 258, 265, 267, 283, 300, 314, 367, 396, 411, 425, 526, 553, 588]
surviving nonsolo ucounts = 44[65, 70, 71, 77, 95, 104, 107^2, 111^2, 116, 117, 128, 144, 192, 195^2, 200, 208, 214, 216, 217, 232, 233, 235, 236, 239, 246, 247, 256, 257, 258, 265, 267, 283, 300, 314, 367, 396, 411, 425, 526, 553, 588]
ids = [341, 487, 486, 12, 360, 279, 91, 108, 56, 256, ...]

====================================================================================

UMI info for barcode CCGTGGAAGACCTAGG-1 contig 1 = AGAGCTCTGG...
umi AAACATTGGA = 283 reads: +391 validated
umi ACATTACATC = 261 reads: +391 validated
umi AGATGCGGCC = 215 reads: +391 validated
umi AGCAACGCTA = 218 reads: +391 validated
umi AGTATTACAG = 107 reads: +391 validated
umi ATACGTATAG = 531 reads: +391 validated
umi CAACAGCAAC = 314 reads: +391 validated
umi CAGATTTTAA = 266 reads: +391 validated
umi CCATAGCCCA = 299 reads: +391 validated
umi CCTGTACCGT = 232 reads: +391 validated
umi CGTTGCTGCA = 231 reads: -17X +1 -2X +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +345 invalidated
umi CTGGACGTGA = 117 reads: +391 validated
umi GAGTAGCTCG = 240 reads: +391 validated
umi TTCTCGTCTG = 230 reads: +391 validated
umi TTCTCGTTTG = 249 reads: +391 validated
umi TTTTAGGATG = 252 reads: +391 validated

UMI info for barcode CCGTGGAAGACCTAGG-1 contig 2 = AGATCTCAGA...
umi ACCATTCCAG = 207 reads: +421 validated
umi ACCTTCTCAA = 110 reads: -5 +391 -17 +8 non-validated
umi ATCGCACAGA = 194 reads: +421 validated
umi CAGCTCGAAT = 201 reads: +421 validated
umi CGCCCGACCA = 261 reads: +421 validated
umi CGCGTGCTTT = 113 reads: +322 -4 +95 non-validated
umi CTAATAGTCA = 102 reads: +421 validated
umi GACGTAACAG = 244 reads: +421 validated
umi GCGAGAGGCG = 119 reads: +411 -10 non-validated
umi GGGGCCTGCT = 216 reads: +421 validated
umi GGGTAGACAC = 144 reads: +403 -18 non-validated
umi TAACGTCTAA = 128 reads: +421 validated
umi TCCGCATGAC = 194 reads: +421 validated
umi TGTAATTCGC = 392 reads: -381X +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TGTGCTGTAT = 200 reads: +421 validated
umi TTAGCTTCCA = 66 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=571]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 643 reads
cdr3 = CQQYGSSPPMYTF at 368, score = 9 + 8
umis assigned: [1, 47, 74, 76, 91, 110, 154, 174, 206, 239] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3980
start codons at 44, 252, 378, 395, 477
confident = true

TIG 2[bases=571]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=7)
454-500 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 161 reads
cdr3 = CARDSRAVAGVKHDYW at 421, score = 8 + 7
umis assigned: [49, 56, 131, 177, 249, 256, 279, 321, 351, 371] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2828
start codons at 79, 235, 296, 314, 382, 458
confident = true

REJECT CONTIGS

TIG 1[bases=563]
5-82 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=3)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [12, 95, 108, 341, 360, 369, 486]
of which 7 are surviving nonsolos
reads assigned: 684
start codons at 35, 68, 96, 104, 192, 354, 374, 469
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGGGATAGTCGAGCAGTAGCTGGAGTTAAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGACTGGAGCCTGAAGATTTTGCAGTATATTACTGTCAGCAGTATGGTAGCTCACCTCCCATGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.110 = CCGTGGAAGAGACTTA-1

using 168 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[167]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.119 = CCGTGGAAGCTAGTGG-1

using 664 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[182, 481]
surviving nonsolo ucounts = 2[182, 481]
ids = [0, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=510]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=1)
56-102 ==> 0-46 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=0)
98-236 ==> 170-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
261-299 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
299-510 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 651
start codons at 56, 139, 232
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.121 = CCGTGGAAGGACAGAA-1

using 828 reads

====================================================================================

graph has 320 edges initially, 22 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[4, 7, 150, 192, 233^2]
surviving nonsolo ucounts = 5[7, 150, 192, 233^2]
ids = [13, 1, 3, 6, 8]

====================================================================================

UMI info for barcode CCGTGGAAGGACAGAA-1 contig 1 = AGAAGAGCTG...
umi ATAGCTTCTC = 31 reads: -244 +1 -1XX +11 -1XX +14 -1XX +20 -1XX +3 -1XX +2 -1XX +8 -1XX +1 -1XX +5 -1XX +11 -29 +2 -3X +8 -1XX +5 -1XX +7 invalidated
umi CTTCAAGGGC = 233 reads: +385 validated

UMI info for barcode CCGTGGAAGGACAGAA-1 contig 2 = ACTTTCTGAG...
umi CCACATACGG = 182 reads: +424 validated

UMI info for barcode CCGTGGAAGGACAGAA-1 contig 3 = GAGGAATCAG...
umi CGCTATATAT = 234 reads: +388 validated
umi TAGCTCAAAA = 5 reads: -23X +2 -1X +17 -1 +4 -2X +12 -1XX +4 -1XX +5 -1XX +21 -2XX +1 -1XX +9 -3XX +13 -1X +6 -19X +4 -2X +1 -1X +1 -1X +6 -1X +5 -1X +6 -1X +1 -1X +20 -1X +2 -183 invalidated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSPWTF at 358, score = 9 + 8
umis assigned: [1, 8]
of which 2 are surviving nonsolos
reads assigned: 261
start codons at 34, 242, 368, 461
confident = false

TIG 2[bases=571]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-571 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 14, 35, 79
confident = false

TIG 3[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [6, 13]
of which 2 are surviving nonsolos
reads assigned: 237
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.123 = CCGTGGAAGGACTGGT-1

using 254 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2, 3^2, 4, 5^2, 6, 12, 208]
surviving nonsolo ucounts = 1[208]
ids = [6]

====================================================================================

UMI info for barcode CCGTGGAAGGACTGGT-1 contig 1 = AGTCTGGGCC...
umi CGCACTTGTG = 194 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=540]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=10)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-540 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQVWDSRNDVVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 40, 101, 239, 338, 377, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.125 = CCGTGGAAGGCTCATT-1

using 982 reads

====================================================================================

graph has 314 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[185, 793]
surviving nonsolo ucounts = 2[185, 793]
ids = [1, 5]

====================================================================================

UMI info for barcode CCGTGGAAGGCTCATT-1 contig 1 = GAGTCAGTCC...
umi ACATCACTCT = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=413]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
junction support: 1 umis using 26 reads
cdr3 = CHQYESVPYTF at 352, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 25, 31, 87, 100, 239, 335, 362
confident = false

REJECT CONTIGS

TIG 1[bases=322]
46-77 ==> 3884-3915 on segment before IGLJ4 exon 1 [len=3915] (mis=6)
53-82 ==> 4604-4633 on segment before IGLCOR22-1 exon 1 [len=6000] (mis=1)
73-111 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
111-322 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 782
start codons at 54
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.144 = CCGTGGACAAGAAGAG-1

using 10110 reads

====================================================================================

graph has 4852 edges initially, 120 edges after simplification

total ucounts = 359
nonsolo ucounts = 174[2^49, 3^28, 4^21, 5^7, 6^6, 8^4, 9, 10, 18, 19^2, 31, 62, 70, 72^2, 75, 76, 77, 80, 84, 85, 87, 89, 92, 98, 99, 101, 103, 121^2, 127^2, 130, 137, 144, 145^2, 146, 149, 152, 153^2, 154, 157, 159, 160, 166, 171, 176, 177, 178, 179, 185, 191, 213, 225, 235, 313, 371, 442, 466, 512, 597, 651]
surviving nonsolo ucounts = 51[31, 70, 72^2, 75, 76, 77, 80, 84, 85, 87, 89, 92, 98, 99, 101, 121^2, 127^2, 137, 144, 145^2, 146, 149, 152, 153^2, 154, 157, 159, 160, 166, 171, 176, 177, 178, 179, 185, 191, 213, 225, 235, 313, 371, 442, 466, 512, 597, 651]
ids = [138, 164, 201, 232, 298, 274, 282, 70, 281, 144, ...]

====================================================================================

UMI info for barcode CCGTGGACAAGAAGAG-1 contig 1 = GGGGTCACAA...
umi ACCAGTTCCA = 154 reads: +388 validated
umi ACTCCTTACG = 240 reads: +388 validated
umi AGCCTACATC = 99 reads: +388 validated
umi ATCCGCCATT = 191 reads: +388 validated
umi CAACCCCCCC = 139 reads: +388 validated
umi CAAGTATTTC = 157 reads: +388 validated
umi CAAGTGAGTT = 148 reads: +388 validated
umi CACTATTTGT = 81 reads: +388 validated
umi CCAATTATTG = 176 reads: +388 validated
umi CCTACAAATA = 316 reads: +388 validated
umi CGATCTATGG = 82 reads: +388 validated
umi CTACTCTATA = 119 reads: +388 validated
umi CTCGGACTTT = 93 reads: +12 -3X +2 -6XX +2 -6XX +2 -1XX +1 -1XX +1 -6XX +248 -1 +6 -1 +89 invalidated
umi CTGGAGATTA = 129 reads: +388 validated
umi CTTCTCTCTG = 185 reads: +388 validated
umi GACAAACAAT = 149 reads: +388 validated
umi GACCATAGCG = 225 reads: +388 validated
umi GACTTTTTCG = 145 reads: +388 validated
umi GCACTCCATG = 174 reads: +388 validated
umi GGGCCCCGGT = 127 reads: +388 validated
umi GGTAGGCTAA = 162 reads: +388 validated
umi GGTAGGCTGA = 171 reads: +388 validated
umi TATTATGGGA = 79 reads: +388 validated
umi TCCAGCACGG = 151 reads: +388 validated
umi TCGATGCCAG = 73 reads: +388 validated

UMI info for barcode CCGTGGACAAGAAGAG-1 contig 2 = ACTCTGCTGA...
umi ATCCTACGTA = 147 reads: +395 -15 +17 non-validated
umi CCCATCCCAT = 176 reads: +410 -1 +4 -1 +2 -1 +8 non-validated
umi CCCTATCCCT = 141 reads: +427 validated
umi CCTCGTAGAA = 27 reads: +89 -1 +4 -1X +184 -6 +57 -27 +1 -1X +54 -2 invalidated
umi CTTATTTGGT = 144 reads: +94 -1 +310 -1 +2 -1 +18 non-validated
umi GATAATATTC = 149 reads: +94 -1X +315 -11 +6 invalidated
umi GATCGCCTTC = 71 reads: +350 -10 +67 non-validated
umi TATAAATAAC = 404 reads: +105 -1XX +321 invalidated
umi TCACATGGCA = 80 reads: +383 -1 +43 non-validated
umi TGCCACTCTA = 132 reads: +94 -2X +7 -3XX +319 -1 +1 invalidated
umi TTACTTTTGT = 84 reads: +103 -1 +1 -1 +304 -1 +10 -1 +2 -2 +1 non-validated
umi TTGGCCGCAT = 155 reads: +395 -4 +2 -1 +25 non-validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=9)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-637 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 24 umis using 641 reads
cdr3 = CCSYASGSTWVF at 362, score = 8 + 8
umis assigned: [17, 26, 32, 41, 56, 60, 61, 70, 102, 130] and 15 others
of which 25 are surviving nonsolos
reads assigned: 3704
start codons at 38, 177, 239, 246, 372, 558
confident = true

TIG 2[bases=604]
0-106 ==> 130-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
106-459 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=19)
470-533 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=4)
533-604 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 49 reads
cdr3 = CARGAGVPSYYYYYMDVW at 448, score = 9 + 7
umis assigned: [42, 112, 120, 138, 182, 199, 201, 264, 281, 310] and 2 others
of which 12 are surviving nonsolos
reads assigned: 1672
start codons at 106, 262, 300, 323, 409, 490, 494
confident = true

REJECT CONTIGS

TIG 1[bases=491]
0-104 ==> 3682-3786 on segment before IGLJ2 exon 1 [len=3786] (mis=1)
121-206 ==> 3076-3161 on segment before IGLJ5 exon 1 [len=3161] (mis=11)
242-280 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
280-491 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [83, 92, 94, 100, 108, 216]
of which 6 are surviving nonsolos
reads assigned: 2655
start codons at 115, 129, 137, 223
confident = false
did not find CDR3

TIG 2[bases=699]
0-96 ==> 5514-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
49-373 ==> 0-324 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=6)
374-410 ==> 324-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
413-450 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
450-699 ==> 0-249 on rc of segment before IGKJ4 exon 1 [len=280] (mis=2)
cdr3 = CMQGTHWPPLTF at 386, score = 4 + 9
umis assigned: [76, 164, 232, 251, 282, 314]
of which 6 are surviving nonsolos
reads assigned: 492
start codons at 49, 82, 118, 206, 368, 389, 467, 566
confident = false
not full
frameshifted full length transcript of length 699
VJ delta = 12
not full
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCAAGAGGGGCTGGAGTGCCATCCTACTACTACTACTACATGGATGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAAGACGAGGCTGATTATTACTGCTGCTCATATGCAAGTGGTAGTACTTGGGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.146 = CCGTGGACAAGCTGAG-1

using 202 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode CCGTGGACAAGCTGAG-1 contig 1 = AGAGCTGCTC...
umi GATAAGAGAG = 199 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYGNSRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 31, 239, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.147 = CCGTGGACAATAGAGT-1

using 204 reads

====================================================================================

graph has 318 edges initially, 2 edges after simplification

total ucounts = 123
nonsolo ucounts = 42[2^26, 3^7, 4^4, 5, 6, 7^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.156 = CCGTGGACAGCATGAG-1

using 257 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 249]
surviving nonsolo ucounts = 1[249]
ids = [5]

====================================================================================

UMI info for barcode CCGTGGACAGCATGAG-1 contig 1 = GAGAAGAGCT...
umi TTTTTCTGGA = 247 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYGSSLTTF at 359, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.157 = CCGTGGACAGCCAGAA-1

using 16 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.162 = CCGTGGACATAGTAAG-1

using 191 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 6, 182]
surviving nonsolo ucounts = 1[182]
ids = [2]

====================================================================================

UMI info for barcode CCGTGGACATAGTAAG-1 contig 1 = GGACTCCTGT...
umi TGCTCTCTCT = 162 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=540]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-540 ==> 0-104 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 18, 174, 241, 333, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.163 = CCGTGGACATCAGTAC-1

using 883 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 206, 274, 397]
surviving nonsolo ucounts = 3[206, 274, 397]
ids = [5, 2, 6]

====================================================================================

UMI info for barcode CCGTGGACATCAGTAC-1 contig 1 = ATCAGTCCCA...
umi GTTCGACCGC = 206 reads: +388 validated
umi TAGTACACTG = 398 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 597
start codons at 23, 29, 98, 234, 453
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.164 = CCGTGGACATCCAACA-1

using 482 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 235, 240]
surviving nonsolo ucounts = 2[235, 240]
ids = [5, 0]

====================================================================================

UMI info for barcode CCGTGGACATCCAACA-1 contig 1 = TATGGTGATC...
umi AGTTGACTAC = 227 reads: +397 validated

UMI info for barcode CCGTGGACATCCAACA-1 contig 2 = CTAGATCACA...
umi GCCCGGTACG = 188 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=530]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=4)
36-362 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
433-530 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMNTLPGGFTF at 372, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 1, 36, 69, 105, 193, 355, 375, 475
confident = false

TIG 2[bases=474]
0-20 ==> 39-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
20-373 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
372-403 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=3)
405-459 ==> 9-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDDIVVVPAAMDDYYGMDVW at 362, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 20, 171, 218, 223, 240, 255, 284, 317, 372, 398, 416
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.165 = CCGTGGACATCCGCGA-1

using 201 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 196]
surviving nonsolo ucounts = 1[196]
ids = [2]

====================================================================================

UMI info for barcode CCGTGGACATCCGCGA-1 contig 1 = GAAGAGCTGC...
umi TACCCGGTTT = 194 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGSSLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.170 = CCGTGGACATTGCGGC-1

using 249 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 243]
surviving nonsolo ucounts = 1[243]
ids = [4]

====================================================================================

UMI info for barcode CCGTGGACATTGCGGC-1 contig 1 = AGGAATCAGA...
umi TCCACTTTCC = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.173 = CCGTGGAGTACAAGTA-1

using 2084 reads

====================================================================================

graph has 1714 edges initially, 38 edges after simplification

total ucounts = 454
nonsolo ucounts = 157[2^81, 3^30, 4^19, 5^5, 6^4, 7^5, 10, 13, 42, 63, 86, 114, 123, 124, 130, 140, 156, 161, 213]
surviving nonsolo ucounts = 9[86, 114, 123, 124, 130, 140, 156, 161, 213]
ids = [31, 266, 386, 208, 74, 433, 89, 299, 173]

====================================================================================

UMI info for barcode CCGTGGAGTACAAGTA-1 contig 1 = ACTTTCTGAG...
umi CTCTCTTTTC = 172 reads: +436 validated
umi GTACTCTCTG = 100 reads: +436 validated

UMI info for barcode CCGTGGAGTACAAGTA-1 contig 2 = GGGCCTCAGG...
umi ACCTCGGTAG = 77 reads: +379 validated
umi ATCTTGTCTT = 125 reads: +379 validated
umi ATTTTTGTGT = 35 reads: -266X +1 -3XX +2 -1XX +6 -2XX +1 -1XX +1 -3XX +4 -1XX +2 -2XX +25 -1XX +1 -1XX +4 -9XX +2 -4XX +1 -1XX +34 invalidated
umi GATGATCTGC = 23 reads: -266X +1 -3X +2 -1X +6 -2XX +1 -1XX +1 -3XX +4 -1XX +2 -2XX +25 -1X +1 -2X +3 -9X +2 -4XX +1 -1XX +34 invalidated
umi TGCCCTCTGC = 92 reads: -10 +1 -2X +1 -3XX +1 -1XX +1 -2XX +2 -5XX +1 -1XX +2 -3XX +1 -7XX +335 invalidated
umi TTGCACTGCT = 24 reads: -266X +1 -3XX +2 -1XX +6 -2XX +1 -1XX +1 -3XX +4 -1XX +2 -2XX +24 -2X +1 -2XX +3 -9XX +2 -4XX +1 -1XX +34 invalidated

GOOD CONTIGS

TIG 1[bases=517]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=2)
391-422 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
420-471 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
471-517 ==> 0-46 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 25 reads
cdr3 = CARGADCSGGSCYSGWFDPW at 380, score = 9 + 7
umis assigned: [173, 266]
of which 2 are surviving nonsolos
reads assigned: 266
start codons at 35, 79, 489
confident = true

TIG 2[bases=558]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
414-558 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 56 reads
cdr3 = CQAWDSSTGGVF at 350, score = 6 + 8
umis assigned: [31, 74, 89, 208, 386, 433]
of which 6 are surviving nonsolos
reads assigned: 369
start codons at 35, 40, 96, 183, 329, 333
confident = true

REJECT CONTIGS

TIG 1[bases=513]
0-25 ==> 8087-8112 on segment before IGKV1D-27 exon 1 [len=8112] (mis=1)
27-261 ==> 0-234 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=3)
262-379 ==> 234-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0) [SHIFT!]
385-423 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
423-513 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [299]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 27, 33, 89, 102, 238, 338, 465
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCCAGAGGGGCAGATTGTAGTGGTGGTAGCTGCTACTCTGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGGAGGAGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.175 = CCGTGGAGTAGCCTCG-1

using 118 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 1[115]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=468]
0-221 ==> 150-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
238-286 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
286-468 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
cdr3 = CARAHGDYYTLLDFW at 210, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 1, 201
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.176 = CCGTGGAGTAGGCATG-1

using 301 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=434]
2-186 ==> 163-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
185-223 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
223-434 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 38, 100, 137
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.184 = CCGTGGAGTCGACTGC-1

using 133 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[132]
surviving nonsolo ucounts = 1[132]
ids = [1]

====================================================================================

UMI info for barcode CCGTGGAGTCGACTGC-1 contig 1 = CTGTGCCCCA...
umi GAGTTCTTGC = 131 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=544]
12-370 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
395-445 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
445-544 ==> 0-99 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 357, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 12, 56, 235, 238, 241, 327, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.186 = CCGTGGAGTCTAGCCG-1

using 68 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 66]
surviving nonsolo ucounts = 1[66]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.189 = CCGTGGAGTCTTGATG-1

using 25 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.196 = CCGTGGAGTGTGACCC-1

using 118 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 114]
surviving nonsolo ucounts = 1[114]
ids = [2]

====================================================================================

UMI info for barcode CCGTGGAGTGTGACCC-1 contig 1 = GGGGAGGAAC...
umi TGAATGTCGG = 107 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=478]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-478 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.203 = CCGTGGAGTTCCACTC-1

using 141 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 42, 94]
surviving nonsolo ucounts = 1[94]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.205 = CCGTGGAGTTCGGCAC-1

using 138 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[138]
surviving nonsolo ucounts = 1[138]
ids = [0]

====================================================================================

UMI info for barcode CCGTGGAGTTCGGCAC-1 contig 1 = GGAGAAGAGC...
umi GGCATATCAT = 121 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=465]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-465 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYGSSPLTF at 360, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 36, 244, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.208 = CCGTGGATCAATCTCT-1

using 207 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 6, 193]
surviving nonsolo ucounts = 1[193]
ids = [3]

====================================================================================

UMI info for barcode CCGTGGATCAATCTCT-1 contig 1 = GATCAGGACT...
umi AGCGGCCCGT = 190 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=484]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
430-484 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CMQGTHWPPWTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 30, 63, 91, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.214 = CCGTGGATCAGTGCAT-1

using 197 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 189]
surviving nonsolo ucounts = 1[189]
ids = [3]

====================================================================================

UMI info for barcode CCGTGGATCAGTGCAT-1 contig 1 = GAGAAGAGCT...
umi GTCATTCCTT = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
423-487 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPPYTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.216 = CCGTGGATCCAAAGTC-1

using 45 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[44]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.217 = CCGTGGATCCACGACG-1

using 213 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[213]
surviving nonsolo ucounts = 1[213]
ids = [0]

====================================================================================

UMI info for barcode CCGTGGATCCACGACG-1 contig 1 = GGGGTCTCAG...
umi CACTTGTTAT = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-391 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-524 ==> 0-98 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTSSSTLVF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.226 = CCGTGGATCCTTTCTC-1

using 265 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 7, 251]
surviving nonsolo ucounts = 1[251]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=458]
17-274 ==> 94-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=12)
276-314 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
314-458 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CATWDDSLKGPYVF at 244, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 77, 227, 252, 257, 278, 446
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.227 = CCGTGGATCGAGAACG-1

using 142 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 135]
surviving nonsolo ucounts = 1[135]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.233 = CCGTGGATCGGCGGTT-1

using 6595 reads

====================================================================================

graph has 2383 edges initially, 40 edges after simplification

total ucounts = 258
nonsolo ucounts = 106[2^34, 3^13, 4^3, 5^7, 6^2, 7^5, 8, 9, 11^5, 13, 15, 16, 58, 99, 107, 110, 133, 137, 141, 144, 152, 164, 168, 177, 179, 187, 189, 193, 196, 198, 201, 202, 205, 208, 213, 219, 223, 226, 227, 233, 250, 297, 308, 382]
surviving nonsolo ucounts = 32[11, 58, 99, 110, 133, 137, 141, 144, 152, 164, 168, 177, 179, 187, 189, 193, 196, 198, 201, 202, 205, 208, 213, 219, 223, 226, 227, 233, 250, 297, 308, 382]
ids = [139, 158, 69, 13, 234, 46, 110, 133, 148, 85, ...]

====================================================================================

UMI info for barcode CCGTGGATCGGCGGTT-1 contig 1 = TGGGGATGCT...
umi ATATGTCTCC = 194 reads: +448 validated
umi ATTAGGTTGC = 183 reads: +448 validated
umi ATTATAGACA = 134 reads: +448 validated
umi CAGTCTCACG = 296 reads: +448 validated
umi CCACAAGTCT = 87 reads: +416 -32 non-validated
umi CCTATCCAAG = 167 reads: +448 validated
umi CGGAAGAGAT = 242 reads: +448 validated
umi CTCACAGTTT = 157 reads: +448 validated
umi CTCCTCAGGG = 201 reads: +448 validated
umi GACGTAGGCG = 145 reads: +448 validated
umi GGATTCGATT = 205 reads: +448 validated
umi TGATAACATC = 234 reads: +448 validated
umi TGCCTCTACA = 206 reads: +448 validated
umi TTCATGTTCT = 131 reads: +448 validated
umi TTCCACGCCC = 185 reads: +448 validated
umi TTTAAGTAAC = 226 reads: +448 validated

UMI info for barcode CCGTGGATCGGCGGTT-1 contig 2 = AGAGCTCTGG...
umi AAGTAGCCTA = 251 reads: +388 validated
umi AATGGCGCTT = 176 reads: +388 validated
umi ACACGCCTAT = 107 reads: +388 validated
umi CATTCGGATA = 188 reads: +388 validated
umi CCCTTCCCAA = 225 reads: +388 validated
umi CCTGGGCTTT = 164 reads: +388 validated
umi CTATTCTCGG = 142 reads: +388 validated
umi GACCACCAGG = 222 reads: +388 validated
umi GATCCCTTGC = 195 reads: +388 validated
umi GCAAATCCAA = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 229 reads
cdr3 = CARQVYSYGPKYYFDYW at 387, score = 9 + 7
umis assigned: [32, 45, 46, 60, 69, 79, 96, 112, 116, 133] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2971
start codons at 5, 21, 30, 42, 86, 409
confident = true

TIG 2[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 296 reads
cdr3 = CQQYGSSPALTF at 368, score = 9 + 9
umis assigned: [3, 8, 13, 64, 77, 85, 110, 130, 137, 141]
of which 10 are surviving nonsolos
reads assigned: 1866
start codons at 44, 252, 378, 474
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGACAGGTATACAGCTATGGTCCAAAGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCCGCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.237 = CCGTGGATCTATCCCG-1

using 21 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.239 = CCGTGGATCTCAAGTG-1

using 55 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 12[2^5, 3^2, 6, 7^3, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.252 = CCGTTCAAGATATGGT-1

using 293 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [1]

====================================================================================

UMI info for barcode CCGTTCAAGATATGGT-1 contig 1 = GATCAGGACT...
umi TATGCGTCTC = 287 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.254 = CCGTTCAAGCAATCTC-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.258 = CCGTTCAAGCGGATCA-1

using 39 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 32]
surviving nonsolo ucounts = 1[32]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.265 = CCGTTCAAGGACTGGT-1

using 170 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[170]
surviving nonsolo ucounts = 1[170]
ids = [0]

====================================================================================

UMI info for barcode CCGTTCAAGGACTGGT-1 contig 1 = CTCGGGACGT...
umi TATATGATCA = 162 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=567]
17-357 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
411-567 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 31 reads
cdr3 = CCSEAGGGVPGLLF at 341, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 17, 171
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.275 = CCGTTCAAGTACGCCC-1

using 223 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=567]
0-21 ==> 30-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
21-181 ==> 0-160 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
182-362 ==> 160-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=19) [SHIFT!]
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-567 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDKSLRGAVF at 346, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 21, 105, 178, 329, 356
confident = false
not full
frameshifted full length stopped transcript of length 567
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.281 = CCGTTCAAGTGCTGCC-1

using 15659 reads

====================================================================================

graph has 5642 edges initially, 96 edges after simplification

total ucounts = 877
nonsolo ucounts = 318[2^136, 3^50, 4^30, 5^15, 6^14, 7^4, 8^4, 9, 10, 12^3, 13^2, 14, 15, 16, 18, 24, 28, 33, 34, 44, 79, 90, 108, 113, 118, 119, 120, 121, 130, 150, 182, 190, 191, 196, 198^2, 201, 206, 225^2, 228, 235, 239, 243, 248, 249^2, 251, 263, 266, 274, 287, 290^2, 293, 295, 297, 300, 310^2, 330, 339, 376, 539, 631, 729, 733, 881, 897]
surviving nonsolo ucounts = 45[24, 79, 108, 118, 121, 130, 150, 182, 190, 191, 196, 198^2, 201, 206, 225^2, 235, 239, 243, 248, 249^2, 251, 263, 266, 274, 287, 290^2, 293, 295, 297, 300, 310^2, 330, 339, 376, 539, 631, 729, 733, 881, 897]
ids = [76, 482, 85, 807, 566, 356, 535, 2, 34, 818, ...]

====================================================================================

UMI info for barcode CCGTTCAAGTGCTGCC-1 contig 1 = ATACTTTCTG...
umi AAAAATTGGC = 156 reads: +424 validated
umi AACGACGAGT = 254 reads: +241 -1XX +182 invalidated
umi AAGAGGCTAT = 189 reads: +424 validated
umi ACCCGTTAGG = 24 reads: +301 -47 +56 -20 non-validated
umi ACCTATGCCG = 91 reads: +424 validated
umi AGACGTTAGC = 244 reads: +424 validated
umi CTCAGATCCC = 255 reads: +424 validated
umi GCGAATAACC = 75 reads: +424 validated
umi GCTTCACGGG = 293 reads: +424 validated
umi GGTAGACGCA = 148 reads: +394 -30 non-validated
umi GTCGCGCCTC = 240 reads: +424 validated
umi TGTATGAATG = 271 reads: +424 validated
umi TTATTGGGTT = 119 reads: +402 -22 non-validated

UMI info for barcode CCGTTCAAGTGCTGCC-1 contig 2 = AGAGCTCTGG...
umi AAAGGGGGAT = 246 reads: +382 validated
umi AACTCTGTGA = 309 reads: +382 validated
umi ACTACTGGGC = 225 reads: +382 validated
umi AGTACAGTAT = 281 reads: +382 validated
umi AGTGGTGAAC = 250 reads: +382 validated
umi ATCTTAATTC = 299 reads: +382 validated
umi CCCCAATGCG = 206 reads: +382 validated
umi CCTGTACCGA = 200 reads: +382 validated
umi CGCTATCAAA = 366 reads: +176 -1XX +134 -4XX +1 -2X +64 invalidated
umi CTAGACGGGG = 8 reads: -348X +2 -1X +6 -2XX +15 -1XX +7 invalidated
umi CTGATCCGGG = 311 reads: +382 validated
umi CTTCTCTGAG = 197 reads: +382 validated
umi CTTGGACCTT = 296 reads: +382 validated
umi GATCCCTTTT = 380 reads: +382 validated
umi GCCTCATCCT = 282 reads: +382 validated
umi GCTACTAGCC = 610 reads: -334 +1 -3X +1 -1XX +1 -4XX +1 -1XX +6 -1XX +3 -3XX +9 -1XX +12 invalidated
umi GGACTGTCCA = 296 reads: +382 validated
umi GGCAAGTCTA = 288 reads: +382 validated
umi GGGGAGATTG = 289 reads: +382 validated
umi GTCCTATCCT = 122 reads: +382 validated
umi GTGTCTTATA = 199 reads: +382 validated
umi TCGTTGGGAG = 260 reads: +382 validated
umi TGCCTCATCA = 196 reads: +382 validated
umi TGTCACCTCC = 223 reads: +382 validated
umi TGTTGACCGT = 331 reads: +382 validated
umi TTCCTTGGTT = 191 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=532]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=5)
411-461 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
461-532 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 167 reads
cdr3 = CARSSTYYFDSSYAFDIW at 376, score = 10 + 8
umis assigned: [2, 28, 34, 76, 85, 126, 371, 482, 505, 535] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2311
start codons at 37, 81, 413, 442
confident = true

TIG 2[bases=562]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 928 reads
cdr3 = CQQYGSPFTF at 368, score = 9 + 8
umis assigned: [13, 30, 111, 165, 171, 201, 295, 319, 331, 359] and 16 others
of which 25 are surviving nonsolos
reads assigned: 6740
start codons at 44, 252, 378, 468
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGATCGTCTACATATTATTTTGATAGTAGTTATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCCCTTTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.283 = CCGTTCAAGTTAGCGG-1

using 386 reads

====================================================================================

graph has 190 edges initially, 44 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 155, 222]
surviving nonsolo ucounts = 2[155, 222]
ids = [6, 0]

====================================================================================

UMI info for barcode CCGTTCAAGTTAGCGG-1 contig 1 = GGGGAGGAGT...
umi GTTAGGTCAC = 148 reads: +388 validated

UMI info for barcode CCGTTCAAGTTAGCGG-1 contig 2 = AGGAGTCAGA...
umi AAGTAACCGT = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
31-382 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
387-419 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
419-505 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYNSYPPTF at 358, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 31, 37, 93, 106, 242, 461
confident = false

TIG 2[bases=501]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYDSYPLTF at 354, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 89, 102, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.289 = CCGTTCACAACTTGAC-1

using 275 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 4^2, 254]
surviving nonsolo ucounts = 1[254]
ids = [2]

====================================================================================

UMI info for barcode CCGTTCACAACTTGAC-1 contig 1 = GGGGTCTCAG...
umi GAGCAATTGT = 254 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=513]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-381 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
423-513 ==> 0-90 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CCSYAGTFYVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 38, 177, 195, 239, 249, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.292 = CCGTTCACAAGGACTG-1

using 10 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.295 = CCGTTCACAATAGAGT-1

using 233 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CCGTTCACAATAGAGT-1 contig 1 = AGGAGTCAGA...
umi CTGACTTCCA = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.300 = CCGTTCACACAGATTC-1

using 263 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [0]

====================================================================================

UMI info for barcode CCGTTCACACAGATTC-1 contig 1 = GAGCTGCTCA...
umi AAACATTCCT = 238 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=489]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-489 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQHATSPFTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 29.310 = CCGTTCACAGCTCGAC-1

using 250 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^6, 4, 6, 8^2, 10, 198]
surviving nonsolo ucounts = 1[198]
ids = [7]

====================================================================================

UMI info for barcode CCGTTCACAGCTCGAC-1 contig 1 = GGGGGTCTCA...
umi ATTCTCAGTA = 1 reads: -370 +2 -1X +2 -2X +5 -1 +3 -2X invalidated
umi CGAATTAGCC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=586]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-586 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CSSYTSSSTWVF at 363, score = 7 + 8
umis assigned: [5, 7]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk029-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk029-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

11.910 seconds used processing barcodes, peak mem = 0.23
