[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.30 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk028-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk028-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk028.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.0 = CATTATCTCTGCGACG-1

using 14519 reads

====================================================================================

graph has 12656 edges initially, 218 edges after simplification

total ucounts = 2177
nonsolo ucounts = 1628[2^294, 3^222, 4^194, 5^169, 6^123, 7^118, 8^105, 9^82, 10^62, 11^73, 12^37, 13^42, 14^28, 15^21, 16^14, 17^6, 18^8, 19^3, 20^2, 21, 22, 23^2, 24, 25, 26, 27, 31, 36, 64, 82, 92, 171, 176^2, 207, 237, 281, 285, 316, 338, 353, 508, 721]
surviving nonsolo ucounts = 16[7, 64, 82, 92, 171, 176^2, 207, 237, 281, 285, 316, 338, 353, 508, 721]
ids = [742, 960, 1055, 2153, 469, 144, 327, 2169, 1404, 1395, ...]

====================================================================================

UMI info for barcode CATTATCTCTGCGACG-1 contig 1 = GGGGCTGGTC...
umi AGCTTTTATC = 174 reads: +388 validated
umi CCAAGCGCTT = 351 reads: +388 validated
umi CGAGAAAGCA = 342 reads: +388 validated
umi CTCGACTACC = 311 reads: +388 validated
umi CTGATAGCCG = 79 reads: -388 non-validated
umi GTACGCACCA = 719 reads: -235 +153 non-validated
umi TAAGTAGTAT = 471 reads: -355X +1 -4XX +1 -2XX +1 -2XX +1 -2XX +1 -6XX +1 -8XX +2 -1XX invalidated
umi TTAGGCTAAC = 287 reads: +388 validated

UMI info for barcode CATTATCTCTGCGACG-1 contig 2 = GCTTAAATTC...
umi ACAATACGAC = 175 reads: +436 validated
umi ATCTTTCTAT = 169 reads: -123 +313 non-validated
umi CGTCCATGCA = 64 reads: +382 -22 +32 non-validated
umi TTTCTACTCG = 92 reads: +436 validated
umi TTTTGACCAT = 210 reads: -23X +413 invalidated

GOOD CONTIGS

TIG 1[bases=572]
48-401 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
399-436 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 361 reads
cdr3 = CQQSYTTLLTF at 375, score = 9 + 9
umis assigned: [327, 716, 894, 1037, 1055, 1453, 1612, 2034]
of which 8 are surviving nonsolos
reads assigned: 2694
start codons at 48, 54, 110, 123, 259, 478
confident = true

TIG 2[bases=665]
47-418 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
483-665 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 4 umis using 113 reads
cdr3 = CARAHGDYYTLLDCW at 407, score = 8 + 7
umis assigned: [144, 469, 960, 2153, 2169]
of which 5 are surviving nonsolos
reads assigned: 700
start codons at 24, 47, 68, 112, 198, 398
confident = true

REJECT CONTIGS

TIG 1[bases=553]
0-65 ==> 5927-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=4)
38-252 ==> 0-214 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
249-304 ==> 298-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
304-342 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
342-553 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLVVF at 275, score = 7 + 8
umis assigned: [1395, 1404]
of which 2 are surviving nonsolos
reads assigned: 301
start codons at 38, 195, 246
confident = false
not full
full length transcript of length 553
VJ delta = 114
delta too large
now this is a cell
paired!

GCCGCGGACACGGCTATGTATTACTGTGCGAGAGCACACGGTGACTACTACACCCTCCTTGACTGCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACACTACCCTCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.13 = CATTCGCAGAATTGTG-1

using 8465 reads

====================================================================================

graph has 4810 edges initially, 56 edges after simplification

total ucounts = 1004
nonsolo ucounts = 451[2^175, 3^96, 4^60, 5^36, 6^25, 7^9, 8^10, 9^7, 10^4, 11^3, 13^2, 14, 19, 24, 25, 53, 167, 182, 198, 221, 231, 269, 271, 287, 311, 332^2, 336, 339, 349, 364, 375, 419, 420, 861]
surviving nonsolo ucounts = 20[24, 167, 182, 198, 221, 231, 269, 271, 287, 311, 332^2, 336, 339, 349, 364, 375, 419, 420, 861]
ids = [72, 195, 143, 711, 736, 755, 957, 43, 908, 22, ...]

====================================================================================

UMI info for barcode CATTCGCAGAATTGTG-1 contig 1 = AGAGCTCTGG...
umi AACGTCTAGG = 313 reads: +388 validated
umi AATACTAGAG = 269 reads: +388 validated
umi ACCGACTGGA = 862 reads: +388 validated
umi ACGTAACAGG = 417 reads: +388 validated
umi AGCCTTTTAA = 330 reads: +388 validated
umi ATATCAGTAG = 420 reads: +388 validated
umi CAATACGACG = 341 reads: +388 validated
umi CAGCGTCTTT = 350 reads: +388 validated
umi GCGGCGGAAC = 369 reads: +388 validated
umi GTTTTTTTCC = 225 reads: +388 validated
umi TACACCCGAC = 231 reads: +388 validated
umi TAGGTTATCC = 336 reads: +388 validated
umi TGGTCTGTGT = 288 reads: +388 validated
umi TGTCATGTGT = 338 reads: +388 validated
umi TTCAGTCTCT = 272 reads: +388 validated
umi TTGAAATCGC = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 881 reads
cdr3 = CQQYGGSPPLTF at 368, score = 10 + 9
umis assigned: [22, 43, 92, 107, 157, 210, 276, 296, 621, 736] and 6 others
of which 16 are surviving nonsolos
reads assigned: 5649
start codons at 44, 378, 474
confident = true

REJECT CONTIGS

TIG 1[bases=641]
3-40 ==> 9445-9482 on rc of segment before IGHV1OR15-4 exon 2 [len=9482] (mis=0)
19-177 ==> 0-158 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=10)
218-394 ==> 195-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=21) [SHIFT!]
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
459-641 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=2)
cdr3 = CATRQRPPYYYLDNW at 383, score = 9 + 7
umis assigned: [72, 143, 195]
of which 3 are surviving nonsolos
reads assigned: 330
start codons at 19, 84, 305, 323, 344
confident = false
frameshifted full length stopped transcript of length 641
VJ delta = 4
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.14 = CATTCGCAGACAAGCC-1

using 325 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 10, 306]
surviving nonsolo ucounts = 1[306]
ids = [4]

====================================================================================

UMI info for barcode CATTCGCAGACAAGCC-1 contig 1 = GCCTGGGCCT...
umi TCGGTTTCAT = 304 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=626]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
39-379 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
415-626 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQAWDSSTVVF at 354, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 39, 44, 100, 187, 333, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.30 = CATTCGCAGCTGCGAA-1

using 312 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[307]
surviving nonsolo ucounts = 1[307]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCAGCTGCGAA-1 contig 1 = GAATCAGTCC...
umi ATAACGTCTG = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.32 = CATTCGCAGCTGTCTA-1

using 251 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 13, 234]
surviving nonsolo ucounts = 1[234]
ids = [3]

====================================================================================

UMI info for barcode CATTCGCAGCTGTCTA-1 contig 1 = GTCAGACTCA...
umi GGTACATTTG = 230 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CHQYNSYSTF at 350, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 23, 29, 85, 98, 234, 237, 330, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.38 = CATTCGCAGGATATAC-1

using 65 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 51]
surviving nonsolo ucounts = 1[51]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=359]
0-348 ==> 10-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=11)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 44
start codons at 34, 146, 213, 216, 296, 305
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.45 = CATTCGCAGTAACCCT-1

using 542 reads

====================================================================================

graph has 258 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[220, 315]
surviving nonsolo ucounts = 2[220, 315]
ids = [4, 0]

====================================================================================

UMI info for barcode CATTCGCAGTAACCCT-1 contig 1 = AGTCCCACTC...
umi AATCTCCTGC = 288 reads: +388 validated

UMI info for barcode CATTCGCAGTAACCCT-1 contig 2 = TCTGCTTCAG...
umi CCGCATCATA = 216 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=501]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-501 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 20, 26, 95, 231, 450
confident = false

TIG 2[bases=513]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-513 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 49, 203, 206, 257, 356, 383, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.52 = CATTCGCAGTCTTGCA-1

using 161 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 148]
surviving nonsolo ucounts = 1[148]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.57 = CATTCGCAGTGCCAGA-1

using 287 reads

====================================================================================

graph has 272 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 8, 77, 192]
surviving nonsolo ucounts = 1[77]
ids = [7]

====================================================================================

UMI info for barcode CATTCGCAGTGCCAGA-1 contig 1 = GGAGGCAGCG...
umi CTATACTTCT = 76 reads: +388 validated
umi GCATTAAACG = 2 reads: -35X +3 -2X +24 -3X +3 -2X +5 -2X +4 -1X +1 -1 +1 -1 +2 -268 +17 -1X +12 invalidated

GOOD CONTIGS

TIG 1[bases=487]
29-382 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-487 ==> 0-70 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSTLVF at 353, score = 8 + 9
umis assigned: [7, 9]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 29, 186, 230, 237, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.63 = CATTCGCAGTTAGCGG-1

using 53 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 9, 37]
surviving nonsolo ucounts = 1[37]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.67 = CATTCGCAGTTGTCGT-1

using 355 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 341]
surviving nonsolo ucounts = 1[341]
ids = [3]

====================================================================================

UMI info for barcode CATTCGCAGTTGTCGT-1 contig 1 = GGAGTCAGTC...
umi ATAACATCGT = 348 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=556]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYDNLPPQWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 26, 32, 88, 101, 240, 363, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.74 = CATTCGCCAACCGCCA-1

using 182 reads

====================================================================================

graph has 116 edges initially, 16 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 23, 154]
surviving nonsolo ucounts = 2[23, 154]
ids = [2, 3]

====================================================================================

UMI info for barcode CATTCGCCAACCGCCA-1 contig 1 = GAGTCAGTCC...
umi CATTCCTTGC = 12 reads: -9 +13 -1X +25 -1X +13 -1XX +4 -3X +1 -2 +2 -1X +4 -69X +5 -2XX +1 -1XX +1 -1XX +6 -1XX +5 -1XX +6 -1XX +1 -1XX +20 -1XX +3 -1XX +3 -1XX +12 -1XX +4 -1XX +29 -2XX +9 -1 +47 -1XX +13 -1X +4 -2X +1 -55X invalidated
umi CTGGGTTTTA = 140 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=444]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-444 ==> 0-25 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQLNSYPLLYTF at 352, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 150
start codons at 25, 31, 87, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.81 = CATTCGCCAAGCCTAT-1

using 360 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[360]
surviving nonsolo ucounts = 1[360]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCCAAGCCTAT-1 contig 1 = GGAGTCAGAC...
umi AAGTTGTGCA = 333 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=469]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-469 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNSYWTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 26, 32, 88, 101, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.82 = CATTCGCCAAGCTGAG-1

using 243 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [5]

====================================================================================

UMI info for barcode CATTCGCCAAGCTGAG-1 contig 1 = AGAGGAGCCT...
umi GTATCACTTC = 233 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=524]
0-70 ==> 9-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
70-423 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
447-494 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
494-524 ==> 0-30 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDRAATARLGGMDVW at 412, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 70, 221, 226, 373, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.88 = CATTCGCCACACTGCG-1

using 388 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[388]
surviving nonsolo ucounts = 1[388]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCCACACTGCG-1 contig 1 = GGGGAGGAAC...
umi TTATCAAGGG = 392 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQRSSWPPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 36, 241, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.96 = CATTCGCCACCAGCAC-1

using 1175 reads

====================================================================================

graph has 900 edges initially, 4 edges after simplification

total ucounts = 208
nonsolo ucounts = 68[2^26, 3^11, 4^12, 5^4, 6^3, 8^3, 9^2, 10^2, 13, 15^2, 205, 554]
surviving nonsolo ucounts = 2[205, 554]
ids = [81, 121]

====================================================================================

UMI info for barcode CATTCGCCACCAGCAC-1 contig 1 = ACTTTCTGAG...
umi CCGCCCAAGC = 206 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=0)
399-453 ==> 7-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CAREWTGDYYYMDVW at 377, score = 9 + 7
umis assigned: [81]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 14, 35, 79, 388, 410
confident = false

REJECT CONTIGS

TIG 1[bases=415]
0-245 ==> 103-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
241-279 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
279-415 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSRTF at 221, score = 9 + 8
umis assigned: [121]
of which 1 are surviving nonsolos
reads assigned: 449
start codons at 105, 231, 321
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.99 = CATTCGCCACCCAGTG-1

using 325 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode CATTCGCCACCCAGTG-1 contig 1 = GTCAGACTCA...
umi ATAGTTAACG = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.107 = CATTCGCCACGGCCAT-1

using 313 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[311]
surviving nonsolo ucounts = 1[311]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCCACGGCCAT-1 contig 1 = GTCAGTCCCA...
umi AAATATTACG = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-496 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDNLPRTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.115 = CATTCGCCAGCAGTTT-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.122 = CATTCGCCAGTATAAG-1

using 36 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 7, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.123 = CATTCGCCAGTCACTA-1

using 113 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 25
nonsolo ucounts = 19[2^4, 3^3, 4^3, 5, 6, 7^2, 8^2, 10, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.127 = CATTCGCCATACGCTA-1

using 328 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 26, 294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode CATTCGCCATACGCTA-1 contig 1 = ACTTTCTGAG...
umi GCTCGCCTCA = 282 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=494]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=2)
400-421 ==> 0-21 on |21|IGHD3-3|D-REGION| [len=31] (mis=3)
427-477 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 17 reads
cdr3 = CARISPPPLYDFWSGSENAFDIW at 377, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 14, 35, 79, 429, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.130 = CATTCGCCATCAGTCA-1

using 366 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 362]
surviving nonsolo ucounts = 1[362]
ids = [1]

====================================================================================

UMI info for barcode CATTCGCCATCAGTCA-1 contig 1 = TGGGGAGGAA...
umi GAATTACTTT = 334 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=501]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-501 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQRSNWLTF at 358, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 37, 242, 245, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.136 = CATTCGCCATGGATGG-1

using 5272 reads

====================================================================================

graph has 2535 edges initially, 36 edges after simplification

total ucounts = 440
nonsolo ucounts = 148[2^47, 3^33, 4^17, 5^17, 6^6, 7^4, 8, 9^2, 10, 11^3, 51, 104, 136, 142, 168^2, 169, 197, 232, 279, 288, 294, 305, 345, 346, 363, 914]
surviving nonsolo ucounts = 15[104, 136, 168^2, 169, 197, 232, 279, 288, 294, 305, 345, 346, 363, 914]
ids = [275, 231, 91, 103, 54, 132, 31, 238, 326, 69, ...]

====================================================================================

UMI info for barcode CATTCGCCATGGATGG-1 contig 1 = TGGGGGATCA...
umi ACTATTTGAT = 232 reads: +397 validated
umi ATACGCGGCA = 170 reads: +397 validated
umi ATGAGTCGGT = 298 reads: +397 validated
umi CAAATACAGA = 361 reads: +257 -1XX +1 -4XX +134 invalidated
umi CAACGCGGGA = 172 reads: +397 validated
umi CCTGGTTCTA = 350 reads: +397 validated
umi CGAGTCCTGT = 200 reads: +397 validated
umi CTCCCCGTTC = 308 reads: +397 validated
umi CTTTGGTTAT = 195 reads: -349 +1 -10XX +1 -2XX +2 -1XX +7 -2XX +8 -1XX +13 invalidated
umi GCGGTACGCT = 281 reads: +397 validated
umi TATTACTCGG = 291 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=9)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 385 reads
cdr3 = CMQALQTQFTF at 371, score = 9 + 8
umis assigned: [31, 54, 69, 89, 91, 124, 132, 174, 199, 238] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2781
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.141 = CATTCGCCATTAGGCT-1

using 279 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCCATTAGGCT-1 contig 1 = GATCACATAA...
umi TTCTTCTCTG = 279 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=643]
59-410 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
483-643 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CARLQVDAPLAHGGDYW at 401, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 59, 257, 420, 537
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.144 = CATTCGCCATTGAGCT-1

using 229 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 4, 217]
surviving nonsolo ucounts = 1[217]
ids = [4]

====================================================================================

UMI info for barcode CATTCGCCATTGAGCT-1 contig 1 = GCTGGGGTCT...
umi TGTCTATGAG = 217 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=562]
0-41 ==> 1-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
41-399 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=5)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-562 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CCSYAGSYTLYVF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 41, 180, 198, 242, 249, 252, 348, 375, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.147 = CATTCGCGTAAGGATT-1

using 13 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.148 = CATTCGCGTAAGTAGT-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.163 = CATTCGCGTAGTACCT-1

using 1437 reads

====================================================================================

graph has 1206 edges initially, 28 edges after simplification

total ucounts = 583
nonsolo ucounts = 154[2^92, 3^24, 4^10, 5^5, 6^4, 10, 12^2, 13^2, 15, 19, 20, 25, 27, 39, 42^2, 44, 51, 60, 65, 72, 82]
surviving nonsolo ucounts = 19[6, 10, 12^2, 13, 15, 19, 20, 25, 27, 39, 42^2, 44, 51, 60, 65, 72, 82]
ids = [292, 59, 83, 131, 278, 274, 194, 32, 171, 352, ...]

====================================================================================

UMI info for barcode CATTCGCGTAGTACCT-1 contig 1 = CAGCCCTGGG...
umi AGAGTGTCTG = 51 reads: +331 -1 +79 -1 +7 -1 +4 non-validated
umi AGATGGCCCC = 10 reads: +199 -6 +56 -56 +1 -4 +4 -1 +3 -1 +1 -1 +10 -2 +1 -1 +9 -1 +15 -52 non-validated
umi ATCGGTTCTT = 38 reads: +344 -80 non-validated
umi CAACCCCTTC = 13 reads: -10 +2 -1 +29 -1 +60 -3 +7 -71 +86 -16 +56 -82 non-validated
umi CGAGGTATGG = 23 reads: +35 -3 +285 -1 +5 -95 non-validated
umi CGTTTGTGCT = 40 reads: +342 -82 non-validated
umi CTCCGGTGCT = 21 reads: +135 -1 +95 -1 +3 -1 +16 -1 +2 -1 +68 -100 non-validated
umi CTTCAGCACT = 44 reads: +336 -7 +56 -25 non-validated
umi GCTTTGATGC = 13 reads: +22 -27 +92 -1X +114 -58 +17 -1 +15 -1 +56 -20 invalidated
umi GGCGCGATTA = 7 reads: -80 +11 -1 +2 -1X +10 -1 +30 -41 +56 -25 +1 -1 +1 -1 +4 -1 +1 -1 +6 -1 +5 -1 +2 -1X +2 -1 +16 -1 +2 -1 +3 -2 +1 -110 invalidated
umi GTCACGTCAT = 43 reads: +366 -6 +9 -1 +2 -1 +39 non-validated
umi TAAATCGGTG = 26 reads: +182 -5 +3 -1 +174 -27 +2 -1 +29 non-validated
umi TACCAGGGAC = 83 reads: +370 -1 +5 -1 +47 non-validated

UMI info for barcode CATTCGCGTAGTACCT-1 contig 2 = GCTACAACAG...
umi ACGATCGTCG = 20 reads: +3 -1 +194 -1 +4 -1 +196 non-validated
umi GCCAAAGGCA = 68 reads: -16 +378 -2X +2 -2 invalidated
umi GCTGCGTCTT = 14 reads: +210 -1 +17 -1 +7 -13 +56 -11 +56 -28 non-validated
umi GTCAAGGGTC = 57 reads: +1 -1 +1 -3X +1 -6X +2 -2X +1 -3X +1 -3X +375 invalidated

GOOD CONTIGS

TIG 1[bases=556]
0-61 ==> 175-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
61-414 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=9)
417-445 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=4)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 8 reads
cdr3 = CAREGAYCGGECYFDFW at 403, score = 9 + 7
umis assigned: [57, 59, 100, 131, 171, 184, 194, 206, 278, 292] and 3 others
of which 13 are surviving nonsolos
reads assigned: 401
start codons at 61, 217, 272, 278, 435
confident = true

TIG 2[bases=523]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=4)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
428-523 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 28 reads
cdr3 = CQQYYTTPRTF at 367, score = 9 + 8
umis assigned: [32, 250, 274, 328]
of which 4 are surviving nonsolos
reads assigned: 155
start codons at 28, 97, 350, 470
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCAAGAGAGGGGGCATATTGTGGTGGTGAATGCTATTTTGACTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATACTACTCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.165 = CATTCGCGTCACCCAG-1

using 3197 reads

====================================================================================

graph has 1613 edges initially, 18 edges after simplification

total ucounts = 306
nonsolo ucounts = 128[2^41, 3^23, 4^9, 5^7, 6^7, 7^3, 8, 9^4, 10^3, 13, 17, 29, 34, 40, 44, 46, 48, 69, 71, 72, 75, 84, 87, 89^2, 92, 98, 106, 110, 119, 121^2, 123, 128, 135, 137, 140, 144, 179]
surviving nonsolo ucounts = 27[9^2, 13, 17, 34, 44, 48, 71, 72, 75, 84, 87, 89^2, 92, 98, 106, 110, 119, 121, 123, 128, 135, 137, 140, 144, 179]
ids = [173, 269, 179, 259, 209, 45, 136, 115, 165, 44, ...]

====================================================================================

UMI info for barcode CATTCGCGTCACCCAG-1 contig 1 = CGAGCCCAGC...
umi AACTGTGCCT = 140 reads: +409 validated
umi ACGGCACACG = 93 reads: +403 -1 +5 non-validated
umi ACTATCGCAT = 98 reads: +408 -1 non-validated
umi ATACCGCGGC = 131 reads: +409 validated
umi ATCGCGTGGC = 73 reads: +298 -9 +99 -3 non-validated
umi ATCGTGGCCA = 44 reads: -229 +104 -1XX +51 -24 invalidated
umi ATGCCGATCG = 132 reads: +383 -1 +25 non-validated
umi ATTTCACATC = 183 reads: +409 validated
umi CCAACTATAA = 90 reads: +409 validated
umi CGAATGTCCT = 120 reads: +409 validated
umi CGCTTTCACG = 135 reads: +409 validated
umi CGGCTAGTGT = 70 reads: +409 validated
umi CTCAGAGGTT = 118 reads: +409 validated
umi CTCGGGTCTG = 146 reads: +409 validated
umi CTGGAACCCG = 49 reads: +325 -84 non-validated
umi CTTGTAAGGC = 121 reads: +392 -1X +16 invalidated
umi GCATCAGTTG = 72 reads: +306 -23 +80 non-validated
umi GCGCGGAGTT = 9 reads: +35 -16 +3 -1 +6 -1 +45 -69 +10 -1 +45 -67 +86 -24 non-validated
umi GCGCGTAGTT = 86 reads: +394 -15 non-validated
umi GCGCGTTGTT = 13 reads: -50 +56 -1 +2 -8 +131 -50 +67 -44 non-validated
umi GGACCCAGGC = 3 reads: -366X +1 -1X +1 -2X +1 -2X +35 invalidated
umi GTCCAGTCAT = 34 reads: +277 -95 +2 -1 +19 -1 +14 non-validated
umi TAACCTGTCT = 107 reads: +409 validated
umi TGAATGCCGC = 9 reads: -6 +16 -1 +4 -1 +73 -90 +1 -2 +4 -1 +1 -2X +3 -1 +4 -2 +4 -3X +1 -1 +2 -2 +63 -6 +56 -59 invalidated

UMI info for barcode CATTCGCGTCACCCAG-1 contig 2 = AATTAGGACT...
umi CTAGCACTCC = 88 reads: +392 -1 +4 non-validated
umi TATAGGTCTT = 106 reads: +397 validated
umi TCGTCGGGAT = 17 reads: -1 +8 -1 +2 -1 +3 -1 +5 -2 +1 -33 +214 -19 +56 -34 +16 non-validated
umi TCGTCGGTAT = 88 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=547]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=8)
420-436 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=2)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 141 reads
cdr3 = CARDLYGDYSYW at 409, score = 9 + 7
umis assigned: [4, 17, 19, 37, 44, 45, 48, 52, 78, 100] and 14 others
of which 23 are surviving nonsolos
reads assigned: 2041
start codons at 67, 218, 223, 281, 284, 370
confident = true

TIG 2[bases=563]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=8)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 37 reads
cdr3 = CMQTTEFPHTF at 366, score = 9 + 8
umis assigned: [124, 232, 259, 260]
of which 4 are surviving nonsolos
reads assigned: 298
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = true
now this is a cell
paired!

AGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGCGAGATCTCTACGGTGACTACTCCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCAGCAGGGTGGAGGCTGAGGATGTCGGGGTTTATTACTGCATGCAAACTACAGAATTTCCTCACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.174 = CATTCGCGTCTCTTTA-1

using 169 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 166]
surviving nonsolo ucounts = 1[166]
ids = [2]

====================================================================================

UMI info for barcode CATTCGCGTCTCTTTA-1 contig 1 = ATCACATAAC...
umi CTTTCGACTT = 162 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=531]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
415-436 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=3)
447-497 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
497-531 ==> 0-34 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDSYYSSSWYFLGFYGMDVW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 58, 209, 256, 355, 454, 515
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.178 = CATTCGCGTGAGTGAC-1

using 31747 reads

====================================================================================

graph has 9842 edges initially, 160 edges after simplification

total ucounts = 1100
nonsolo ucounts = 469[2^158, 3^64, 4^33, 5^29, 6^17, 7^12, 8^16, 9^7, 10^3, 11^3, 12^2, 13^2, 14^2, 15^3, 16, 17, 24, 33, 37, 42, 69, 78, 95, 96, 99, 103, 114, 115, 117, 121, 129, 131, 145, 147, 151, 152, 155, 159^2, 160, 165^2, 169, 170, 172, 173, 179, 182, 183, 184, 189, 190, 193, 194, 196^2, 201, 203, 204, 208, 211, 217, 219, 220, 222, 224, 228, 229, 232, 234, 236, 241, 242^2, 243^2, 244, 246, 247, 248^2, 249^2, 264, 276, 277, 278, 282, 284, 286, 287, 293, 297, 303, 304^2, 305, 306, 307^2, 309, 316, 318, 323, 324, 325^3, 327^2, 335, 345^2, 350, 353^2, 357^2, 367, 376^2, 378, 385, 399, 413, 419, 491, 492, 653, 679, 680, 891]
surviving nonsolo ucounts = 109[78, 95, 96, 99, 114, 115, 117, 129, 131, 145, 147, 151, 152, 155, 159^2, 160, 165^2, 169, 170, 172, 173, 179, 182, 183, 184, 189, 190, 193, 194, 196^2, 201, 203, 204, 208, 211, 217, 219, 220, 222, 224, 228, 229, 232, 234, 236, 241, 242^2, 243^2, 244, 246, 247, 248^2, 249^2, 264, 276, 277, 278, 282, 284, 286, 287, 293, 297, 303, 304^2, 305, 306, 307^2, 309, 316, 318, 323, 324, 325^3, 327^2, 335, 345^2, 350, 353^2, 357^2, 367, 376^2, 378, 385, 399, 413, 419, 491, 492, 653, 679, 680, 891]
ids = [864, 474, 932, 147, 633, 174, 318, 722, 100, 378, ...]

====================================================================================

UMI info for barcode CATTCGCGTGAGTGAC-1 contig 1 = CATCACACAA...
umi AGAATGTGGT = 287 reads: +409 validated
umi AGACGTACAG = 112 reads: -366 +1 -1X +41 invalidated
umi ATTCTTCGCA = 391 reads: +409 validated
umi CCTCTCGGGA = 306 reads: +409 validated
umi CGTACCGCGC = 165 reads: +34 -6X +1 -1XX +367 invalidated
umi GCACACCTAA = 211 reads: +409 validated
umi GCATCGTCCG = 110 reads: -343 +1 -1X +1 -2X +5 -4XX +3 -6XX +1 -1XX +41 invalidated
umi TCTAAGTGCT = 315 reads: +409 validated
umi TTTGTCTTGC = 151 reads: -350 +3 -4X +3 -6X +1 -1X +41 invalidated

UMI info for barcode CATTCGCGTGAGTGAC-1 contig 2 = AGAGCTCTGG...
umi AAAGCGGTCT = 328 reads: +385 validated
umi AAAGGAATAT = 275 reads: +385 validated
umi AACTTTCGGT = 196 reads: +385 validated
umi AAGAAAAACC = 250 reads: +385 validated
umi AAGACATTAT = 279 reads: +385 validated
umi AATACTTTTT = 385 reads: +22 -1XX +362 invalidated
umi ACCCTCATCT = 244 reads: +385 validated
umi ACCCTTCGCA = 327 reads: +12 -1XX +372 invalidated
umi ACGCTAGCTT = 366 reads: +385 validated
umi ACGTCTCGTT = 186 reads: +385 validated
umi ATAGAAACAG = 249 reads: +385 validated
umi ATCATGCTGC = 281 reads: +385 validated
umi CACTAGAGTT = 325 reads: +385 validated
umi CAGATCCCAA = 210 reads: +385 validated
umi CAGATTTCTT = 325 reads: +385 validated
umi CAGGTTCCGT = 203 reads: +385 validated
umi CATATGGCCT = 155 reads: +385 validated
umi CCAAAGGCCG = 305 reads: +385 validated
umi CCCAAGCGGC = 306 reads: +385 validated
umi CCCATTAGCA = 267 reads: +385 validated
umi CCCCATCCAG = 329 reads: +385 validated
umi CCCGCTCTTT = 310 reads: +385 validated
umi CTATATTTCT = 487 reads: -122X +263 invalidated
umi CTCCTAACTC = 143 reads: +385 validated
umi CTCTGATTTT = 280 reads: +385 validated
umi CTCTTTCTCT = 361 reads: +385 validated
umi CTGGTGTGTA = 335 reads: +385 validated
umi CTTCTTCTAT = 254 reads: +151 -1XX +233 invalidated
umi CTTTGATTAT = 359 reads: +385 validated
umi GATATTGTCC = 301 reads: +385 validated
umi GATCATCAAG = 289 reads: +385 validated
umi GCACCCATCT = 344 reads: +385 validated
umi GCCGTATGTC = 325 reads: +385 validated
umi GGGCTACCTG = 421 reads: +385 validated
umi GTACATATTG = 355 reads: +385 validated
umi GTACATCGCC = 131 reads: +385 validated
umi GTATCCATGC = 328 reads: +385 validated
umi GTGACAGCAA = 313 reads: +385 validated
umi TAATATACCA = 347 reads: +385 validated
umi TACATTTCTT = 165 reads: +385 validated
umi TAGCAATCCT = 326 reads: +385 validated
umi TCCTGATACA = 312 reads: +385 validated
umi TCTATGCGTG = 377 reads: +308 -1XX +76 invalidated
umi TGATGTATCG = 150 reads: +385 validated
umi TGTAAAGACC = 282 reads: +385 validated
umi TTAACGTGGA = 217 reads: +385 validated
umi TTAATGGCGG = 402 reads: +385 validated
umi TTACTAAGCA = 297 reads: +385 validated
umi TTCAAACCGA = 374 reads: +385 validated

UMI info for barcode CATTCGCGTGAGTGAC-1 contig 3 = GGTGTTTCCA...
umi AGACCTGGAC = 190 reads: +445 validated
umi CACCAATCGT = 114 reads: +445 validated
umi CACCTCGTGC = 191 reads: +445 validated
umi CCCAGGCCGA = 284 reads: +445 validated
umi CGCGTCGTTG = 92 reads: +445 validated
umi TCAAGAGGTA = 79 reads: +431 -14 non-validated

UMI info for barcode CATTCGCGTGAGTGAC-1 contig 4 = CTTTCGCGTT...
umi AACAATCCTC = 222 reads: +388 validated
umi ACATGTGGAT = 132 reads: +388 validated
umi ACCCATTTCT = 248 reads: +388 validated
umi ACTACGTCTT = 98 reads: +383 -3 +2 non-validated
umi ACTATCTTTC = 240 reads: +388 validated
umi ACTGATATAT = 200 reads: +388 validated
umi AGCAATCCAT = 170 reads: +388 validated
umi AGCTGTTTTT = 213 reads: +388 validated
umi AGTAACTACC = 227 reads: +388 validated
umi ATGCGAGTAG = 219 reads: +388 validated
umi ATGGTTTTCG = 184 reads: +388 validated
umi ATGTAGGTCA = 238 reads: +388 validated
umi CAACTTTATT = 246 reads: +388 validated
umi CATGCCGCTA = 171 reads: +388 validated
umi CATTACTCGA = 167 reads: +388 validated
umi CCCGGGCTCT = 106 reads: +21 -1 +3 -6XX +2 -3XX +1 -7XX +301 -43 invalidated
umi CCGACTCATA = 189 reads: +388 validated
umi CCGCTTAGTG = 235 reads: +388 validated
umi CTCCATTCGT = 189 reads: +388 validated
umi GAAATGCCAG = 189 reads: +388 validated
umi GAATTAACAA = 307 reads: +388 validated
umi GACTTCGGGA = 221 reads: +388 validated
umi GCGTCTCTGT = 247 reads: +388 validated
umi GCTCCGTCTG = 257 reads: +247 -1XX +140 invalidated
umi GCTTCGAGGG = 181 reads: +388 validated
umi GGAGCGGACC = 170 reads: +388 validated
umi GTTACTTTGT = 243 reads: +388 validated
umi GTTCCGGTTA = 230 reads: +388 validated
umi TCCCTTTGGA = 234 reads: +388 validated
umi TCTCATACTA = 64 reads: +25 -6XX +2 -3XX +1 -7XX +248 -5 +56 -35 invalidated
umi TTTATATGCA = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-58 ==> 2-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=1)
58-411 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=1)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
467-569 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 175 reads
cdr3 = CATAPGWDFDYW at 400, score = 9 + 7
umis assigned: [171, 174, 278, 446, 495, 619, 633, 926, 1090]
of which 9 are surviving nonsolos
reads assigned: 2022
start codons at 58, 214, 256, 278, 322, 355, 485, 546
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 2198 reads
cdr3 = CQQYGSSPFTF at 368, score = 9 + 8
umis assigned: [11, 13, 43, 44, 47, 61, 111, 113, 131, 141] and 39 others
of which 49 are surviving nonsolos
reads assigned: 14142
start codons at 44, 252, 378, 471
confident = true

TIG 3[bases=591]
0-44 ==> 36-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
44-362 ==> 0-318 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=34)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
489-591 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 94 reads
cdr3 = CANLMYTIRGNPVSLGSPHYFDYW at 386, score = 8 + 7
umis assigned: [173, 318, 324, 401, 474, 864]
of which 6 are surviving nonsolos
reads assigned: 936
start codons at 44, 182, 238, 258, 261, 279, 347, 398, 507, 568
confident = true

TIG 4[bases=678]
79-378 ==> 0-299 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=25)
429-467 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
467-678 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 28 umis using 959 reads
cdr3 = CLSYSGTNSWVF at 403, score = 9 + 8
umis assigned: [26, 100, 108, 147, 151, 158, 178, 189, 200, 249] and 21 others
of which 31 are surviving nonsolos
reads assigned: 6110
start codons at 79, 287, 290
confident = true

REJECT CONTIGS

TIG 1[bases=629]
0-81 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
24-150 ==> 0-126 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=6)
umis assigned: [53, 97, 187, 378, 812]
of which 5 are surviving nonsolos
reads assigned: 887
start codons at 24, 30, 86, 99, 240, 296, 416, 493, 601
confident = false
did not find CDR3

TIG 2[bases=325]
4-144 ==> 346-486 on rc of segment before IGHD6-6 exon 1 [len=486] (mis=0)
160-223 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
223-325 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [702, 727, 862, 886]
of which 4 are surviving nonsolos
reads assigned: 2535
start codons at 161, 180, 241, 302
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.179 = CATTCGCGTGATGTCT-1

using 310 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[310]
surviving nonsolo ucounts = 1[310]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCGTGATGTCT-1 contig 1 = GGAGCCCCAG...
umi TATATGGGGG = 291 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=515]
0-68 ==> 168-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
68-421 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=9)
424-452 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=4)
444-492 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
492-515 ==> 0-23 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAREGAYCGGECYFDFW at 410, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 68, 224, 279, 285, 442, 510
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.184 = CATTCGCGTGGCTCCA-1

using 638 reads

====================================================================================

graph has 266 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2, 4, 7, 12, 272, 330]
surviving nonsolo ucounts = 3[12, 272, 330]
ids = [3, 6, 8]

====================================================================================

UMI info for barcode CATTCGCGTGGCTCCA-1 contig 1 = GGGAGAGCCC...
umi ACATAGGATA = 12 reads: -58 +109 -1X +5 -1X +31 -1XX +52 -1 +1 -1 +3 -1 +1 -1 +2 -1 +3 -20 +53 -33X +1 -1X +7 invalidated
umi AGTTTTCATA = 278 reads: +388 validated
umi AGTTTTTGTA = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CQQRSNWPPGWTF at 368, score = 9 + 8
umis assigned: [3, 6, 8]
of which 3 are surviving nonsolos
reads assigned: 610
start codons at 47, 252, 255, 477
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.185 = CATTCGCGTGTGACCC-1

using 333 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[4, 14, 20, 294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode CATTCGCGTGTGACCC-1 contig 1 = GAGGAATCAG...
umi TATTGTTCTG = 296 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHNSYLPF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 28, 34, 103, 185, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.189 = CATTCGCGTTAAGGGC-1

using 163 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode CATTCGCGTTAAGGGC-1 contig 1 = CTCACAATGA...
umi CACGCGTCGC = 157 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=444]
6-332 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
365-403 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
403-444 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMNTLPGGFTF at 342, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 6, 39, 75, 163, 325, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.195 = CATTCGCGTTGGTGGA-1

using 116 reads

====================================================================================

graph has 127 edges initially, 2 edges after simplification

total ucounts = 27
nonsolo ucounts = 21[2^7, 3^2, 4, 5, 6^4, 7^2, 8, 9, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.198 = CATTCGCTCAAACGGG-1

using 459 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[198, 260]
surviving nonsolo ucounts = 2[198, 260]
ids = [2, 1]

====================================================================================

UMI info for barcode CATTCGCTCAAACGGG-1 contig 1 = GGACTCCTGT...
umi CCGGAAGCTT = 241 reads: +418 validated

UMI info for barcode CATTCGCTCAAACGGG-1 contig 2 = GGGAGTCAGT...
umi TCTCTGTCCC = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-538 ==> 0-102 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 18, 174, 241, 333, 490
confident = false

TIG 2[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSSSTPYTF at 354, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.200 = CATTCGCTCAACCAAC-1

using 67 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.205 = CATTCGCTCACGGTTA-1

using 421 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 175, 236]
surviving nonsolo ucounts = 2[175, 236]
ids = [1, 8]

====================================================================================

UMI info for barcode CATTCGCTCACGGTTA-1 contig 1 = GGAGGAACTG...
umi TTCATCGGCT = 226 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-493 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPPTF at 355, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.214 = CATTCGCTCATCGCTC-1

using 24 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.217 = CATTCGCTCATTTGGG-1

using 192 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [4]

====================================================================================

UMI info for barcode CATTCGCTCATTTGGG-1 contig 1 = AAGAACCTGC...
umi GCAAGCGCAC = 182 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=503]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-398 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
434-503 ==> 0-69 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQAWDSSTASVVF at 367, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 52, 57, 113, 200, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.237 = CATTCGCTCGGTTCGG-1

using 104 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 25
nonsolo ucounts = 14[2^3, 3^2, 5, 7^5, 9, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.248 = CATTCGCTCTCTTATG-1

using 1574 reads

====================================================================================

graph has 2394 edges initially, 14 edges after simplification

total ucounts = 819
nonsolo ucounts = 343[2^168, 3^83, 4^42, 5^20, 6^3, 7^11, 8^8, 9, 10^4, 11^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.261 = CCAATCCAGAGCTGGT-1

using 376 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 9, 357]
surviving nonsolo ucounts = 1[357]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.264 = CCAATCCAGATATGGT-1

using 234 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 224]
surviving nonsolo ucounts = 1[224]
ids = [1]

====================================================================================

UMI info for barcode CCAATCCAGATATGGT-1 contig 1 = AGCTTCAGCT...
umi AGTTCAGTAG = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-540 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.270 = CCAATCCAGCGTTGCC-1

using 955 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 950]
surviving nonsolo ucounts = 1[950]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=401]
4-31 ==> 5785-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
26-92 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
45-192 ==> 0-147 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
190-401 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=10)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 937
start codons at 45, 322
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.279 = CCAATCCAGGAGTTGC-1

using 418 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 413]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.292 = CCAATCCAGGTGCTTT-1

using 257 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [1]

====================================================================================

UMI info for barcode CCAATCCAGGTGCTTT-1 contig 1 = ACCCAAAAAC...
umi TCAGGATGCT = 248 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=558]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-558 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.295 = CCAATCCAGTAGATGT-1

using 444 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 6^2, 8, 417]
surviving nonsolo ucounts = 2[6, 417]
ids = [0, 4]

====================================================================================

UMI info for barcode CCAATCCAGTAGATGT-1 contig 1 = AGGAATCAGT...
umi AACCCTACCC = 6 reads: -125 +85 -2 +9 -1 +105 -61 non-validated
umi AGGATGTAAC = 393 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-509 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 399
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.300 = CCAATCCAGTGAACAT-1

using 14725 reads

====================================================================================

graph has 6642 edges initially, 54 edges after simplification

total ucounts = 1022
nonsolo ucounts = 535[2^179, 3^100, 4^63, 5^51, 6^29, 7^24, 8^9, 9^5, 10^4, 11^6, 13^2, 15, 16, 23, 29, 46, 55, 58, 66, 84, 88, 91, 97, 101, 111, 115, 124, 127, 150, 152, 154^2, 156, 158^2, 159, 162, 163, 170, 188^2, 189^2, 191, 193, 200, 210, 217, 225, 239, 245, 249, 259, 260, 261, 267^3, 286^2, 289, 293, 300, 301, 311, 312, 324^2, 329, 343, 348, 369, 379, 402]
surviving nonsolo ucounts = 56[8, 46, 66, 84, 88, 91, 101, 111, 115, 124, 127, 150, 152, 154^2, 156, 158^2, 159, 162, 163, 170, 188, 189^2, 191, 193, 200, 210, 217, 225, 239, 245, 249, 259, 260, 261, 267^3, 286^2, 289, 293, 300, 301, 311, 312, 324^2, 329, 343, 348, 369, 379, 402]
ids = [62, 573, 189, 184, 901, 107, 756, 796, 272, 763, ...]

====================================================================================

UMI info for barcode CCAATCCAGTGAACAT-1 contig 1 = TGGGGGATCA...
umi AAACCATTCT = 257 reads: +403 validated
umi ACCCCACCCT = 247 reads: +403 validated
umi ACGATCGTGG = 298 reads: +403 validated
umi AGCGGTTTAG = 269 reads: +403 validated
umi AGTTGTCGGG = 292 reads: +403 validated
umi ATTAGCCATC = 288 reads: +403 validated
umi CACTCTGTGT = 183 reads: -403 non-validated
umi CCTTATGATC = 270 reads: +403 validated
umi GCATTTTCCC = 158 reads: -386 +3 -1XX +5 -1XX +7 invalidated
umi GGACTTCCAT = 163 reads: -366X +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi GTATAAGGTT = 158 reads: +403 validated
umi GTTAAGCGGG = 326 reads: +403 validated
umi TCCACTAGGT = 164 reads: +403 validated
umi TCCCGCATCT = 316 reads: +403 validated
umi TCTCTCTCAA = 150 reads: +403 validated
umi TGCCCGGTCC = 379 reads: +403 validated

UMI info for barcode CCAATCCAGTGAACAT-1 contig 2 = GGGAGCATCA...
umi AAACTGGCTT = 249 reads: +436 validated
umi AATCAGCTAC = 128 reads: +436 validated
umi ACCATCTATG = 230 reads: +436 validated
umi ACGTTAATGC = 216 reads: +421 -1 +14 non-validated
umi ACTCTAGTTA = 150 reads: +418 -18 non-validated
umi AGGCTACAGC = 64 reads: +436 validated
umi AGTAACCCTT = 267 reads: +436 validated
umi ATAACCGCTC = 300 reads: +436 validated
umi ATCACAGGGC = 210 reads: +436 validated
umi ATCATCCCGT = 188 reads: +432 -4 non-validated
umi ATCGGTCCTG = 284 reads: +436 validated
umi ATGCGAGTAC = 154 reads: +434 -2 non-validated
umi ATTCTGCGTT = 152 reads: +436 validated
umi CAAACGCTAA = 113 reads: +427 -9 non-validated
umi CAGGGCGTAC = 182 reads: +436 validated
umi CATTCGGGGG = 146 reads: +436 validated
umi CATTTTCGCA = 269 reads: +436 validated
umi CCAGCACGTA = 168 reads: +427 -9 non-validated
umi CCAGCTATAC = 152 reads: +434 -1X +1 invalidated
umi CCATAACCCT = 190 reads: +318 -1XX +117 invalidated
umi CCCCTGCACA = 238 reads: +436 validated
umi CCTTAGGCGA = 312 reads: +436 validated
umi GATTGCCCTC = 274 reads: +436 validated
umi GGTGCCACCC = 347 reads: +436 validated
umi GTTAAGCTCT = 327 reads: +436 validated
umi TACGCGATTG = 326 reads: +436 validated
umi TCACCTGCTC = 107 reads: +140 -1XX +276 -19 invalidated
umi TGGGCCGCGA = 86 reads: +436 validated
umi TTACGCGCCT = 155 reads: +436 validated
umi TTCGATGTCG = 329 reads: +436 validated
umi TTGATAACAA = 191 reads: +395 -1 +9 -31 non-validated
umi TTTTCATTGG = 265 reads: +422 -14 non-validated

GOOD CONTIGS

TIG 1[bases=574]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
400-438 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
438-574 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 504 reads
cdr3 = CMQALQTPPIFTF at 371, score = 9 + 8
umis assigned: [10, 103, 135, 181, 205, 258, 298, 410, 596, 627] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3856
start codons at 35, 68, 104, 192, 354, 374, 480
confident = true

TIG 2[bases=571]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
445-500 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 23 umis using 326 reads
cdr3 = CARGGRYSSSPWRYYYGMDVW at 406, score = 8 + 7
umis assigned: [15, 63, 98, 140, 150, 189, 196, 208, 228, 230] and 22 others
of which 32 are surviving nonsolos
reads assigned: 6652
start codons at 64, 220, 262, 267, 299, 328, 361, 457
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGGCGGGAGGTATAGCAGCTCGCCTTGGAGGTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCCTATATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.308 = CCAATCCAGTTCGCAT-1

using 238 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^4, 3^2, 222]
surviving nonsolo ucounts = 1[222]
ids = [3]

====================================================================================

UMI info for barcode CCAATCCAGTTCGCAT-1 contig 1 = AGAGCTGCTC...
umi AGTTCCCCCC = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-496 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSPPWSF at 355, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 31, 239, 365, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.313 = CCAATCCCAAGACACG-1

using 56 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 52]
surviving nonsolo ucounts = 1[52]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.316 = CCAATCCCAAGCGATG-1

using 197 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 12, 176]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=472]
9-61 ==> 5948-6000 on rc of segment after IGHV1OR15-1 exon 1 [len=6000] (mis=5)
38-79 ==> 10099-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
61-414 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=35)
cdr3 = CVRRFLGFDSW at 403, score = 8 + 8
umis assigned: [2, 3]
of which 0 are surviving nonsolos
reads assigned: 175
start codons at 61, 259, 264, 358
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.319 = CCAATCCCAATAGCAA-1

using 220 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 4, 214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=495]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
0-73 ==> 6470-6543 on rc of segment before IGHVII-53-1 exon 1 [len=6543] (mis=0)
42-112 ==> 6507-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=10)
447-495 ==> 0-48 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
cdr3 = CARDILTGPNRGDAFDIW at 412, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 73, 229, 373, 382, 449, 478
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.336 = CCAATCCCACGCGAAA-1

using 612 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[289, 322]
surviving nonsolo ucounts = 2[289, 322]
ids = [0, 1]

====================================================================================

UMI info for barcode CCAATCCCACGCGAAA-1 contig 1 = ACAAGAGGCA...
umi ATACCTTAGG = 284 reads: +391 validated

UMI info for barcode CCAATCCCACGCGAAA-1 contig 2 = GAGGAATCAG...
umi ATTCGACGTC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-550 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 31, 115, 188, 338, 365
confident = false

TIG 2[bases=497]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-497 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.350 = CCAATCCCAGGCGATA-1

using 9335 reads

====================================================================================

graph has 4389 edges initially, 58 edges after simplification

total ucounts = 890
nonsolo ucounts = 400[2^158, 3^80, 4^51, 5^32, 6^15, 7^13, 8^8, 9^6, 10, 11, 12, 13, 14, 52, 53, 60, 71, 74, 112, 135, 150, 160, 165, 168, 172, 213, 227, 229, 254, 258, 259, 284, 296, 300^2, 303, 307, 320, 321, 332, 345, 349, 391, 395, 511]
surviving nonsolo ucounts = 27[53, 60, 71, 112, 135, 150, 160, 165, 213, 227, 254, 258, 259, 284, 296, 300^2, 303, 307, 320, 321, 332, 345, 349, 391, 395, 511]
ids = [401, 874, 77, 304, 232, 734, 852, 275, 164, 319, ...]

====================================================================================

UMI info for barcode CCAATCCCAGGCGATA-1 contig 1 = CCACATCCCT...
umi ACCCGTTCGG = 71 reads: +381 -37 non-validated
umi AGCCCTTCGT = 301 reads: +418 validated
umi ATATCTGGAG = 331 reads: +418 validated
umi ATCAGCCCAC = 211 reads: +418 validated
umi CACATCTCTT = 126 reads: -351X +1 -3X +1 -1XX +4 -7XX +50 invalidated
umi CCAAGCTTGT = 169 reads: +416 -1 +1 non-validated
umi CCCGGCTCAT = 326 reads: +418 validated
umi CCGGTGCGTT = 12 reads: -333 +1 -2XX +1 -5XX +1 -8XX +1 -3XX +1 -1XX +4 -7XX +50 invalidated
umi CCTGAGCAAC = 229 reads: +418 validated
umi GTAGTCTTAC = 254 reads: +418 validated

UMI info for barcode CCAATCCCAGGCGATA-1 contig 2 = AGAGCTCTGG...
umi AAATATTCCG = 351 reads: +385 validated
umi ACAACAGCCC = 345 reads: +385 validated
umi ATGAACGCAA = 283 reads: +385 validated
umi CATGCGCAAT = 297 reads: +385 validated
umi CCAGTCATCG = 309 reads: +385 validated
umi CGTAGTGTCT = 295 reads: +385 validated
umi CTCCCCATTT = 52 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +322 -1 +7 -1 +5 -2X +1 invalidated
umi CTTGAAGTTC = 264 reads: +385 validated
umi GCCATATCAC = 398 reads: +385 validated
umi GGAACTTCTC = 302 reads: +385 validated
umi GGATCCTGTG = 304 reads: +385 validated
umi GGCTTGCACA = 515 reads: +385 validated
umi GTCCATTCGT = 320 reads: +385 validated
umi TCATGCTGTA = 263 reads: +385 validated
umi TGATATTCTA = 150 reads: +364 -9 +12 non-validated
umi TTTAACGGCT = 136 reads: +366 -1 +13 -5 non-validated
umi TTTCTTACCC = 61 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=531]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=2)
410-460 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 157 reads
cdr3 = CARSHYLLLYGMDVW at 384, score = 9 + 7
umis assigned: [77, 122, 156, 164, 232, 275, 296, 304, 319, 556]
of which 10 are surviving nonsolos
reads assigned: 2002
start codons at 42, 193, 198, 240, 245, 262, 339, 417
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
397-429 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 730 reads
cdr3 = CQQYGSSPQTF at 368, score = 9 + 8
umis assigned: [7, 56, 185, 265, 284, 365, 401, 441, 502, 518] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4580
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

TCTGAAGACACGGCTGTGTATTACTGTGCGAGATCGCACTACTTACTTCTCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCAAACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.351 = CCAATCCCAGGCTCAC-1

using 86 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 80]
surviving nonsolo ucounts = 1[80]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.354 = CCAATCCCAGTCACTA-1

using 322 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [0]

====================================================================================

UMI info for barcode CCAATCCCAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi ATCTCTATAG = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=588]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-588 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.357 = CCAATCCCATACCATG-1

using 338 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 334]
surviving nonsolo ucounts = 1[334]
ids = [1]

====================================================================================

UMI info for barcode CCAATCCCATACCATG-1 contig 1 = GAGTCAGTCT...
umi ACCATGCTCT = 323 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=491]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
416-491 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYSTSAVTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 25, 31, 87, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.363 = CCAATCCCATTAGGCT-1

using 329 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 323]
surviving nonsolo ucounts = 1[323]
ids = [2]

====================================================================================

UMI info for barcode CCAATCCCATTAGGCT-1 contig 1 = GGAGTCAGTC...
umi CACTACTCGC = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
414-477 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.366 = CCAATCCGTAAGTGTA-1

using 28283 reads

====================================================================================

graph has 11979 edges initially, 148 edges after simplification

total ucounts = 1542
nonsolo ucounts = 728[2^227, 3^149, 4^90, 5^55, 6^38, 7^25, 8^11, 9^8, 10^6, 11^2, 12, 13, 14^2, 15^2, 16, 18, 19, 20, 22, 23, 24, 26, 30, 33, 42, 45, 48, 49, 50, 53, 55, 59, 65, 68, 73, 74, 78, 82, 83, 89, 90, 107, 117, 118, 130, 133, 136, 138, 144, 151, 156, 157^2, 159, 160, 163, 166, 173, 176, 177, 180, 189, 194, 195, 206^3, 209, 213, 221, 222, 225, 226^2, 227, 228, 229^2, 232, 234, 237, 240, 241, 244, 246, 248, 251^2, 253, 255, 257, 266, 267, 270, 271, 274^3, 280, 281, 283, 285, 286, 288, 291, 294, 296, 318, 319, 320, 323, 332, 339, 346, 409, 412, 425, 460, 469, 473, 697, 739, 934, 1083, 1155]
surviving nonsolo ucounts = 97[42, 45, 48, 50, 53, 59, 68, 73, 74, 78, 82, 83, 90, 107, 117, 118, 130, 133, 136, 138, 144, 151, 156, 157^2, 159, 160, 163, 166, 173, 176, 177, 180, 189, 194, 195, 206^3, 209, 213, 221, 222, 225, 226^2, 227, 228, 229^2, 232, 234, 237, 240, 241, 244, 246, 248, 251^2, 253, 255, 257, 266, 267, 270, 271, 274^3, 280, 281, 283, 285, 286, 288, 291, 294, 296, 318, 319, 320, 323, 332, 339, 346, 409, 412, 425, 460, 469, 473, 697, 739, 934, 1083, 1155]
ids = [845, 634, 761, 823, 301, 711, 1076, 580, 898, 737, ...]

====================================================================================

UMI info for barcode CCAATCCGTAAGTGTA-1 contig 1 = TGGGGAGCAG...
umi AAAACTCCAT = 4 reads: -333X +1 -2XX +1 -3XX +1 -7XX +1 -6XX +1 -3XX +1 -2XX +35 invalidated
umi AAATTTACGC = 320 reads: +397 validated
umi AAGAACTCGG = 471 reads: +397 validated
umi ACCCATTCTG = 49 reads: +17 -3XX +1 -1XX +2 -18XX +1 -2XX +1 -3XX +348 invalidated
umi AGGAGATCGG = 312 reads: +397 validated
umi AGTTGTACCA = 707 reads: -347 +2 -6XX +1 -3XX +1 -2XX +35 invalidated
umi AGTTTCCCTC = 260 reads: +397 validated
umi ATATGACGGT = 323 reads: +397 validated
umi CAATATGTTA = 174 reads: +397 validated
umi CATGGGGCGG = 236 reads: +397 validated
umi CCAAAATTGG = 415 reads: +397 validated
umi CCAGCATAAG = 199 reads: +275 -1XX +121 invalidated
umi CCCTCTCCCA = 278 reads: +397 validated
umi CCCTTCCACG = 154 reads: +397 validated
umi CGCATATTTC = 285 reads: +397 validated
umi CGGCGTGACA = 755 reads: -352X +1 -2XX +1 -3XX +1 -2XX +35 invalidated
umi CGGTATGGGA = 223 reads: +397 validated
umi CGTAAAGGTT = 338 reads: -359 +1 -2XX +35 invalidated
umi CGTGTAGGTC = 115 reads: +397 validated
umi CGTTGTCCAT = 251 reads: +397 validated
umi CTACTGTGCT = 961 reads: -337X +1 -2XX +1 -7XX +1 -6XX +1 -3XX +1 -2XX +35 invalidated
umi CTATATCGGG = 102 reads: +26 -1XX +1 -14X +1 -2XX +1 -3XX +284 -1 +1 -1 +2 -59 invalidated
umi CTGCCTTTAT = 79 reads: +397 validated
umi CTTGTAAATG = 171 reads: +397 validated
umi CTTGTATGCA = 478 reads: +397 validated
umi GAGTCGCCTG = 160 reads: +397 validated
umi GAGTCGTCAT = 52 reads: -347 +2 -6X +1 -3X +1 -2X +35 invalidated
umi GAGTCGTGAT = 133 reads: -359X +1 -2XX +35 invalidated
umi GAGTCGTGCT = 305 reads: -367 +30 non-validated
umi GAGTCGTGGT = 83 reads: -347 +2 -6XX +1 -3XX +1 -2XX +35 invalidated
umi GGTCTTGGTC = 286 reads: +397 validated
umi TACCTGTTTA = 195 reads: +397 validated
umi TATCGCTCCG = 279 reads: +397 validated
umi TCACAGTTCG = 432 reads: -79X +318 invalidated
umi TCAGAATTAG = 1097 reads: -347 +2 -6XX +1 -3XX +1 -2XX +35 invalidated
umi TCATTTCTAT = 343 reads: +397 validated
umi TCCCATGGCA = 227 reads: +397 validated
umi TGGCACCACC = 266 reads: +397 validated
umi TGGGACCCAC = 322 reads: +397 validated
umi TGTTTCTTTA = 82 reads: +44 -1 +1 -3XX +314 -34 invalidated
umi TTGTCATGTG = 271 reads: +397 validated
umi TTTCCTAGTC = 223 reads: +397 validated

UMI info for barcode CCAATCCGTAAGTGTA-1 contig 2 = AGCTCTGGGA...
umi AACAAGAGTC = 482 reads: +140 -2XX +2 -3XX +1 -2XX +1 -8XX +1 -87XX +1 -4XX +1 -9XX +156 invalidated
umi ACAAGATGCT = 134 reads: +418 validated
umi ACCCTCAATT = 249 reads: +418 validated
umi AGCAGACTGT = 242 reads: +418 validated
umi AGTAAACCCG = 226 reads: +418 validated
umi AGTGCGCATA = 295 reads: +418 validated
umi AGTGTTCGTT = 264 reads: +418 validated
umi ATATAGTCTT = 179 reads: +418 validated
umi ATTATATTTG = 47 reads: +335 -10 +56 -17 non-validated
umi CAATAAACGG = 276 reads: +418 validated
umi CATCATTGTA = 256 reads: +418 validated
umi CCCATACCGG = 278 reads: +418 validated
umi CCCTTTACAG = 255 reads: +418 validated
umi CCTAAAGCGT = 154 reads: +21 -1XX +7 -1XX +1 -1XX +4 -1XX +6 -1XX +13 -1XX +29 -1XX +4 -2XX +8 -1XX +7 -2XX +8 -7X +13 -1XX +4 -1XX +2 -1XX +1 -4XX +1 -1XX +3 -2XX +21 -1XX +17 -1XX +1 -4XX +3 -3XX +1 -45X +3 -1XX +13 -1XX +5 -2XX +4 -1XX +2 -1XX +22 -1XX +8 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +9 -5X +1 -2X +1 -1X +3 -5X +1 -8X +1 -3XX +2 -4XX +33 invalidated
umi CGAAAGAGTA = 74 reads: +98 -1X +319 invalidated
umi CGACAAAGAT = 184 reads: +418 validated
umi CGCCATCGAC = 200 reads: +418 validated
umi CGGCCTCTGT = 94 reads: +384 -34 non-validated
umi CGGTCGGGTT = 45 reads: +375 -1 +9 -1 +9 -23 non-validated
umi CGGTCGGTTT = 242 reads: +418 validated
umi CTAACTACTG = 140 reads: +418 validated
umi CTCGATGTAT = 24 reads: +21 -1XX +7 -1XX +1 -1XX +4 -1XX +6 -1XX +13 -1XX +29 -1XX +4 -2XX +8 -1XX +7 -2XX +4 -27 +2 -1X +2 -1XX +1 -4XX +1 -1XX +3 -2XX +21 -1XX +17 -1XX +1 -4XX +3 -3XX +1 -49X +13 -2X +4 -2X +4 -1X +2 -1X +22 -1X +2 -1 +1 -61X +2 -4X +33 invalidated
umi CTGGAATTCA = 237 reads: +418 validated
umi CTTAATATTC = 213 reads: +418 validated
umi CTTCGTGTAT = 48 reads: +369 -49 non-validated
umi GAAGTAAGGA = 146 reads: +400 -18 non-validated
umi GAGGCAATTG = 120 reads: +370 -1X +18 -28 +1 invalidated
umi GAGTCTCGTG = 100 reads: +409 -9 non-validated
umi GATCTATGAT = 42 reads: +317 -4 +94 -3 non-validated
umi GCCTACCTAA = 153 reads: +418 validated
umi GCTAGTCAGT = 75 reads: -95 +323 non-validated
umi GGACTTCTGT = 202 reads: +418 validated
umi GGCGTTGCGG = 221 reads: +418 validated
umi GGGTGGGTGG = 226 reads: +418 validated
umi GTATTTATAG = 244 reads: +418 validated
umi GTCGCCCTTC = 199 reads: +409 -9 non-validated
umi GTGATTCTTT = 229 reads: +418 validated
umi GTGCTATCCC = 205 reads: +230 -3XX +1 -3XX +101 -80 invalidated
umi GTTCATAATG = 272 reads: +418 validated
umi TACCGACGCT = 68 reads: +380 -38 non-validated
umi TATCTATCAC = 223 reads: +418 validated
umi TCAAATACTT = 219 reads: +418 validated
umi TCCGGCCCTT = 92 reads: +21 -1XX +7 -1XX +1 -1XX +4 -1XX +6 -1XX +13 -1XX +29 -1XX +4 -2XX +8 -1XX +7 -2XX +10 -8 +10 -1XX +4 -1XX +2 -1XX +1 -4XX +1 -1XX +3 -2XX +21 -1XX +17 -1XX +1 -4XX +3 -49 +3 -1XX +13 -1XX +5 -2XX +4 -1XX +2 -1XX +22 -1XX +8 -1XX +1 -1XX +1 -1XX +4 -22X +1 -2X +1 -1X +3 -5X +1 -8X +1 -3X +2 -4X +22 -11 invalidated
umi TCCTGTTTCC = 116 reads: +21 -1XX +7 -1XX +1 -1XX +4 -1XX +6 -1XX +13 -1XX +29 -1XX +4 -2XX +8 -1XX +7 -2XX +9 -6 +13 -1XX +4 -1XX +2 -1XX +1 -4XX +1 -1XX +3 -2XX +21 -1XX +17 -1XX +1 -4XX +3 -3XX +1 -46XX +2 -1XX +13 -1XX +5 -2XX +4 -1XX +2 -1XX +22 -1XX +8 -1XX +1 -1XX +1 -1XX +8 -1X +1 -81 invalidated
umi TCGGGCTACC = 161 reads: +407 -11 non-validated
umi TCTACGAGTC = 153 reads: -252X +166 invalidated
umi TGGTGCCTTC = 347 reads: +418 validated
umi TGTCTCCCTA = 295 reads: +198 -1XX +219 invalidated
umi TTAAACCTGA = 109 reads: +21 -1XX +7 -1XX +1 -1XX +4 -1XX +6 -1XX +13 -1XX +29 -1XX +4 -2XX +8 -1XX +7 -2XX +10 -5X +13 -1XX +4 -1XX +2 -1XX +1 -4XX +1 -1XX +3 -2XX +21 -1XX +17 -1XX +1 -4XX +3 -3XX +1 -45 +3 -1XX +13 -1XX +5 -2XX +4 -1XX +2 -1XX +22 -1XX +8 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1X +7 -7X +1 -2X +1 -1X +3 -5X +1 -8X +1 -3XX +2 -4XX +33 invalidated
umi TTAGCAGCGG = 153 reads: +418 validated
umi TTCCAACATG = 225 reads: +418 validated
umi TTCCAAGCTC = 163 reads: +418 validated
umi TTCCTCAGCA = 345 reads: +24 -1XX +4 -8XX +1 -1XX +1 -2XX +1 -6XX +1 -31X +1 -2XX +1 -1XX +2 -4XX +1 -2XX +1 -2XX +1 -2XX +3 -1XX +1 -4XX +1 -1XX +2 -1XX +303 invalidated
umi TTGTTAATAT = 292 reads: +418 validated
umi TTTCGCCCTT = 156 reads: +376 -1 +28 -13 non-validated

GOOD CONTIGS

TIG 1[bases=638]
30-392 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=2)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 30 umis using 1316 reads
cdr3 = CETWDSNTQVF at 366, score = 8 + 8
umis assigned: [0, 28, 48, 129, 197, 219, 221, 249, 360, 429] and 32 others
of which 42 are surviving nonsolos
reads assigned: 12125
start codons at 30, 194, 234, 349
confident = true

TIG 2[bases=569]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=2)
462-498 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 37 umis using 795 reads
cdr3 = CTTGGLRYFAPHW at 428, score = 8 + 7
umis assigned: [29, 98, 135, 185, 204, 213, 216, 245, 301, 353] and 45 others
of which 55 are surviving nonsolos
reads assigned: 10103
start codons at 80, 236, 303, 360, 389
confident = true
now this is a cell
paired!

CTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGGGGGATTACGATATTTTGCTCCTCACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCCAACCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.367 = CCAATCCGTACAAGTA-1

using 328 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode CCAATCCGTACAAGTA-1 contig 1 = ACAACAGGCA...
umi TTAGGTCGCA = 311 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
425-509 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYYGSPRTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 22, 25, 80, 94, 347, 377, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.371 = CCAATCCGTACCGTAT-1

using 222 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode CCAATCCGTACCGTAT-1 contig 1 = GGGGGTCTCA...
umi ATCGCCCTGC = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
39-375 ==> 0-336 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYSSNSAEVF at 363, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 39, 196, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.383 = CCAATCCGTCACAAGG-1

using 208 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode CCAATCCGTCACAAGG-1 contig 1 = AGCTTCAGCT...
umi TTATTTAAAG = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-488 ==> 0-53 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.388 = CCAATCCGTCTAAACC-1

using 429 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 3, 9, 412]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=428]
0-267 ==> 2169-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=2)
304-357 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
357-428 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 405
start codons at 22, 28, 69, 314
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.396 = CCAATCCGTGAACCTT-1

using 26 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.401 = CCAATCCGTGATGTCT-1

using 9353 reads

====================================================================================

graph has 13292 edges initially, 116 edges after simplification

total ucounts = 4145
nonsolo ucounts = 1913[2^838, 3^421, 4^286, 5^154, 6^75, 7^48, 8^29, 9^21, 10^8, 11^12, 12^7, 13, 14^3, 15^2, 18^3, 19, 22, 23, 222, 339]
surviving nonsolo ucounts = 3[2, 222, 339]
ids = [3550, 801, 3335]

====================================================================================

UMI info for barcode CCAATCCGTGATGTCT-1 contig 1 = GGGGATCTCA...
umi ATCTCACGTA = 213 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=508]
39-377 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
430-508 ==> 0-78 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTNSTTPGVF at 363, score = 8 + 8
umis assigned: [801]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 39, 175, 247
confident = false

REJECT CONTIGS

TIG 1[bases=553]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-34 ==> 5966-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
7-48 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
34-350 ==> 0-316 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=30)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [881, 2215, 3190, 3335]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 34, 103, 239, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.407 = CCAATCCGTGTGAAAT-1

using 471 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[469]
surviving nonsolo ucounts = 1[469]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=376]
11-206 ==> 150-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
208-240 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
240-376 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNNGATF at 182, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 466
start codons at 282
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.409 = CCAATCCGTTACGACT-1

using 259 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=473]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
0-20 ==> 789-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=0)
0-20 ==> 9990-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=0)
0-20 ==> 793-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=0)
5-77 ==> 5674-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
369-406 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
406-473 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 20, 26, 82, 95, 231, 448
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.424 = CCAATCCTCACAACGT-1

using 289 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 22, 261]
surviving nonsolo ucounts = 1[261]
ids = [3]

====================================================================================

UMI info for barcode CCAATCCTCACAACGT-1 contig 1 = GCTTCAGCTG...
umi CTTTTACCCG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-46 ==> 68-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
46-399 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-527 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 367, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.425 = CCAATCCTCACCAGGC-1

using 503 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 6, 221, 268]
surviving nonsolo ucounts = 2[221, 268]
ids = [3, 6]

====================================================================================

UMI info for barcode CCAATCCTCACCAGGC-1 contig 1 = ACCCAAAAAC...
umi GCAACATGTA = 267 reads: +436 validated

UMI info for barcode CCAATCCTCACCAGGC-1 contig 2 = TGGGGTCTCA...
umi CCCCTCCACC = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-554 ==> 0-64 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 2[bases=588]
0-39 ==> 3-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
39-383 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-588 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CCSYAGRYSWVF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 39, 178, 196, 247, 250, 346, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.439 = CCAATCCTCATAGCAC-1

using 40 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[40]
surviving nonsolo ucounts = 1[40]
ids = [0]

====================================================================================

UMI info for barcode CCAATCCTCATAGCAC-1 contig 1 = GAGGAACTGC...
umi CCCCTAACCG = 38 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=427]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 7 reads
cdr3 = CLQYSDWPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 38
start codons at 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.446 = CCAATCCTCCACGAAT-1

using 157 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 152]
surviving nonsolo ucounts = 1[152]
ids = [1]

====================================================================================

UMI info for barcode CCAATCCTCCACGAAT-1 contig 1 = GAGGAGTCAG...
umi TATGACAATC = 144 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
416-469 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYSTPCSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.451 = CCAATCCTCCCATTTA-1

using 319 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [1]

====================================================================================

UMI info for barcode CCAATCCTCCCATTTA-1 contig 1 = AGGAGTCAGA...
umi ACCTGTCCCC = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQHYDGFSRTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 27, 33, 102, 292, 334, 364, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.452 = CCAATCCTCCCTAATT-1

using 8950 reads

====================================================================================

graph has 3855 edges initially, 32 edges after simplification

total ucounts = 658
nonsolo ucounts = 317[2^105, 3^70, 4^42, 5^25, 6^22, 7^7, 8^6, 9^7, 12^2, 13, 16, 20, 23, 25, 37, 44, 45, 97, 168, 213, 280, 282^2, 302, 303, 304, 318, 320, 321, 324, 329, 363, 364, 369, 380, 387, 388, 408, 422, 432]
surviving nonsolo ucounts = 25[44, 45, 97, 168, 213, 280, 282^2, 302, 303, 304, 318, 320, 321, 324, 329, 363, 364, 369, 380, 387, 388, 408, 422, 432]
ids = [540, 289, 513, 512, 376, 136, 73, 386, 571, 129, ...]

====================================================================================

UMI info for barcode CCAATCCTCCCTAATT-1 contig 1 = GGAGTCTCCC...
umi TCATTTTCTG = 167 reads: +433 validated
umi TCCAAGATGT = 98 reads: +373 -2 +58 non-validated
umi TGCTTATGCA = 303 reads: +433 validated

UMI info for barcode CCAATCCTCCCTAATT-1 contig 2 = GGGGAGGAAC...
umi AAAACAGGGA = 318 reads: +385 validated
umi AAGTCCCTTA = 321 reads: +385 validated
umi ACCATATGAG = 423 reads: +385 validated
umi ACTTCTTCAT = 284 reads: +385 validated
umi ATTTAACCAG = 303 reads: +385 validated
umi CAATTAGAAG = 278 reads: +385 validated
umi CGCTTCTGCT = 428 reads: +385 validated
umi CGTTGCCCCT = 42 reads: -2 +187 -14 +182 non-validated
umi CTATCACGAG = 378 reads: +385 validated
umi CTCCTCATTC = 324 reads: +385 validated
umi CTTCACTCTC = 325 reads: +385 validated
umi GCCCCGGTGG = 209 reads: +385 validated
umi GCCTTCCTTT = 279 reads: +385 validated
umi GCTTATCGTA = 368 reads: +385 validated
umi GTTCCTTTTC = 411 reads: +385 validated
umi TACCGGCCAT = 367 reads: +385 validated
umi TATACGACTA = 330 reads: +385 validated
umi TCATGCCCCA = 387 reads: +385 validated
umi TCGTATACTG = 38 reads: +385 validated
umi TTATTCCTCG = 296 reads: +385 validated
umi TTCTTATCTG = 388 reads: +385 validated
umi TTTTCCCTCG = 370 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=569]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=22)
429-492 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=6)
492-569 ==> 0-77 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 39 reads
cdr3 = CARFRGDYDTDYYFYFMDVW at 401, score = 8 + 7
umis assigned: [512, 513, 571]
of which 3 are surviving nonsolos
reads assigned: 559
start codons at 59, 182, 257, 392, 449
confident = true

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=13)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1113 reads
cdr3 = CQQYNNWPLYTF at 357, score = 9 + 8
umis assigned: [0, 16, 49, 73, 129, 136, 270, 289, 302, 311] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6770
start codons at 36, 105, 241, 463
confident = true
now this is a cell
paired!

ATGTATTACTGTGCGAGATTTCGCGGTGACTACGACACTGACTATTACTTCTACTTCATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCTTCAG <==> AGCAGCCTGCAGTCTGAGGATTTTGCAGTTTATTACTGTCAGCAGTATAATAATTGGCCCTTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.466 = CCAATCCTCTCCAACC-1

using 34 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3^2, 7, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.490 = CCACCTAAGCCGCCTA-1

using 602 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 14[2^4, 3^4, 4^2, 5, 10, 11, 543]
surviving nonsolo ucounts = 1[543]
ids = [5]

====================================================================================

UMI info for barcode CCACCTAAGCCGCCTA-1 contig 1 = GGAGGAATCA...
umi CACAAGTCTG = 551 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 92 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 539
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.497 = CCACCTAAGGCATGGT-1

using 309 reads

====================================================================================

graph has 145 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 8[2^4, 4^3, 279]
surviving nonsolo ucounts = 1[279]
ids = [17]

====================================================================================

UMI info for barcode CCACCTAAGGCATGGT-1 contig 1 = GGCTGGGGTC...
umi TTATGAAGCA = 273 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=570]
42-364 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-570 ==> 0-137 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CCSFTVNTRSYVF at 366, score = 7 + 8
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 42, 199, 243, 253, 397, 565
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.508 = CCACCTAAGTAGTGCG-1

using 121 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 21[2^5, 3^3, 5^2, 6^4, 7, 8^4, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.512 = CCACCTAAGTGACATA-1

using 338 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 12, 316]
surviving nonsolo ucounts = 1[316]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=568]
0-81 ==> 5527-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNSYSF at 356, score = 4 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 36, 69, 105, 193, 355, 375, 474
confident = false
not full
frameshifted full length transcript of length 568
VJ delta = 31
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.519 = CCACCTAAGTTGAGAT-1

using 2279 reads

====================================================================================

graph has 2173 edges initially, 34 edges after simplification

total ucounts = 603
nonsolo ucounts = 319[2^122, 3^66, 4^46, 5^36, 6^18, 7^7, 8^6, 9^3, 10^3, 11^2, 12^4, 13, 17, 27, 231, 252, 316]
surviving nonsolo ucounts = 3[231, 252, 316]
ids = [110, 487, 540]

====================================================================================

UMI info for barcode CCACCTAAGTTGAGAT-1 contig 1 = CAGTCCCAGT...
umi TGGGGTGATG = 303 reads: +394 validated

UMI info for barcode CCACCTAAGTTGAGAT-1 contig 2 = GCTGTGCTGT...
umi TCACACTACG = 240 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=501]
0-21 ==> 37-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
21-372 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQLNSYPRRITF at 348, score = 8 + 8
umis assigned: [540]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 21, 27, 83, 232, 457
confident = false

TIG 2[bases=450]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-450 ==> 0-25 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [487]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 43, 104, 173, 191, 386
confident = false

REJECT CONTIGS

TIG 1[bases=423]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=9)
389-423 ==> 0-34 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
cdr3 = CLHSIQLPWTF at 366, score = 9 + 8
umis assigned: [110]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 30, 63, 99, 187, 250, 349
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.524 = CCACCTACAAAGCGGT-1

using 196 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^3, 3, 5, 9, 17, 149]
surviving nonsolo ucounts = 5[2^2, 9, 17, 149]
ids = [1, 3, 4, 8, 6]

====================================================================================

UMI info for barcode CCACCTACAAAGCGGT-1 contig 1 = GTGGGTCCAG...
umi CGCGTACATT = 2 reads: -194 +13 -2 +5 -1 +1 -1 +32 -70 +2 -2 +1 -1 +4 -1 +1 -2 +2 -2 +1 -2 +1 -1 +2 -1 +4 -3X +1 -2X +1 -2 +2 -1 +7 -1X +3 -1 +1 -8X invalidated
umi CGCGTTATTT = 2 reads: -102 +58 -222 non-validated
umi CGCGTTCTTT = 9 reads: -29 +141 -1 +20 -43 +1 -1 +118 -28 non-validated
umi CGCTTACTTT = 141 reads: +382 validated
umi CGCTTTAGTT = 1 reads: -233 +5 -1 +10 -3 +1 -1 +4 -1 +1 -1 +2 -1 +1 -1 +5 -1 +1 -1 +2 -1 +1 -2 +1 -1 +2 -1 +1 -96 non-validated
umi CGCTTTCTTT = 17 reads: +6 -1 +253 -49 +36 -1 +19 -17 non-validated

GOOD CONTIGS

TIG 1[bases=532]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=12)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
417-532 ==> 0-115 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSADSSGSYYVF at 350, score = 8 + 8
umis assigned: [1, 3, 4, 6, 7, 8]
of which 5 are surviving nonsolos
reads assigned: 172
start codons at 35, 96, 165, 183, 227, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.528 = CCACCTACAAGGACTG-1

using 4523 reads

====================================================================================

graph has 4967 edges initially, 113 edges after simplification

total ucounts = 2107
nonsolo ucounts = 1024[2^448, 3^242, 4^153, 5^76, 6^41, 7^26, 8^9, 9^11, 10^4, 11^3, 12^2, 13^3, 14^3, 16^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.535 = CCACCTACACAGCCCA-1

using 296 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5^2, 284]
surviving nonsolo ucounts = 1[284]
ids = [4]

====================================================================================

UMI info for barcode CCACCTACACAGCCCA-1 contig 1 = GGAACTGCTC...
umi TCAAATATCC = 265 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 31, 236, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.545 = CCACCTACACTGTCGG-1

using 346 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 338]
surviving nonsolo ucounts = 1[338]
ids = [6]

====================================================================================

UMI info for barcode CCACCTACACTGTCGG-1 contig 1 = GGGGAGGGAC...
umi TATGGGCCCT = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=456]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=1)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=23)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-456 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYKSWPVYTF at 357, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 36, 105, 241, 265
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.567 = CCACCTACATTGGCGC-1

using 228 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^5, 4, 6, 205]
surviving nonsolo ucounts = 1[205]
ids = [5]

====================================================================================

UMI info for barcode CCACCTACATTGGCGC-1 contig 1 = AAGAACCTGC...
umi GTTCTGTCTG = 196 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=502]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-390 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
431-502 ==> 0-71 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQAWDSSTHVVF at 367, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 52, 57, 113, 200, 346, 350, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.570 = CCACCTAGTAACGCGA-1

using 293 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 284]
surviving nonsolo ucounts = 1[284]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=482]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-278 ==> 0-248 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
273-309 ==> 324-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
309-346 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
346-482 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQVLQTPPTF at 285, score = 5 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 30, 63, 99, 187, 288, 388
confident = false
not full
full length transcript of length 482
VJ delta = 94
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.577 = CCACCTAGTACGACCC-1

using 51 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 10[2^4, 3^2, 5, 7, 9, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.579 = CCACCTAGTACGCTGC-1

using 12 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.585 = CCACCTAGTATTCGTG-1

using 555 reads

====================================================================================

graph has 298 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 11[2^4, 3^2, 4, 7, 18, 195, 305]
surviving nonsolo ucounts = 2[195, 305]
ids = [20, 8]

====================================================================================

UMI info for barcode CCACCTAGTATTCGTG-1 contig 1 = AGCTCTGAGA...
umi TATTGTTTTG = 186 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=508]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [20]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 79, 230, 235, 382, 460
confident = false

REJECT CONTIGS

TIG 1[bases=500]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-92 ==> 0-46 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=0)
88-226 ==> 170-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
251-289 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
289-500 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 46, 129, 222
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.587 = CCACCTAGTCAACATC-1

using 348 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^4, 335]
surviving nonsolo ucounts = 1[335]
ids = [2]

====================================================================================

UMI info for barcode CCACCTAGTCAACATC-1 contig 1 = GAAGAGCTGC...
umi CCCGTGGGAA = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQHYDSSPMYTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 33, 241, 367, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.591 = CCACCTAGTCATACTG-1

using 27 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.594 = CCACCTAGTCCTAGCG-1

using 1809 reads

====================================================================================

graph has 2212 edges initially, 85 edges after simplification

total ucounts = 887
nonsolo ucounts = 420[2^210, 3^95, 4^43, 5^36, 6^17, 7^7, 8^5, 9^5, 19, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.595 = CCACCTAGTCGATTGT-1

using 271 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[5, 258]
surviving nonsolo ucounts = 1[258]
ids = [9]

====================================================================================

UMI info for barcode CCACCTAGTCGATTGT-1 contig 1 = AGCTTCAGCT...
umi TTCGTTGTTC = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-501 ==> 0-66 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.596 = CCACCTAGTCGCATAT-1

using 45 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 34]
surviving nonsolo ucounts = 1[34]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=377]
7-352 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
351-377 ==> 0-26 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 30
start codons at 7, 76, 212
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.609 = CCACCTAGTGATGCCC-1

using 35 reads

====================================================================================

graph has 44 edges initially, 6 edges after simplification

total ucounts = 18
nonsolo ucounts = 9[2^5, 3^2, 4, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.613 = CCACCTAGTGCCTTGG-1

using 165 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 161]
surviving nonsolo ucounts = 1[161]
ids = [1]

====================================================================================

UMI info for barcode CCACCTAGTGCCTTGG-1 contig 1 = ATCATCCAAC...
umi GAACTAGGGT = 153 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=493]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.621 = CCACCTAGTTACCAGT-1

using 522 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 130, 383]
surviving nonsolo ucounts = 2[130, 383]
ids = [4, 1]

====================================================================================

UMI info for barcode CCACCTAGTTACCAGT-1 contig 1 = GATCAGGACT...
umi CCTGAGCAGG = 386 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.662 = CCACCTATCCAGTAGT-1

using 4175 reads

====================================================================================

graph has 4568 edges initially, 96 edges after simplification

total ucounts = 1997
nonsolo ucounts = 938[2^426, 3^222, 4^120, 5^76, 6^39, 7^23, 8^7, 9^9, 10^4, 11^3, 12^2, 13^2, 14^2, 15, 19, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.665 = CCACCTATCCGCGCAA-1

using 232 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CCACCTATCCGCGCAA-1 contig 1 = CTGGGCCTCA...
umi CTTCACTCCG = 226 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=528]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-528 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.666 = CCACCTATCCGGCACA-1

using 241 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2, 3, 4^5, 6, 12, 192]
surviving nonsolo ucounts = 1[192]
ids = [11]

====================================================================================

UMI info for barcode CCACCTATCCGGCACA-1 contig 1 = GTCAGACCCA...
umi CTTTCCTGGG = 185 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=461]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-180 ==> 0-157 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
180-371 ==> 160-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
405-461 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQHYNSYGTF at 347, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 23, 29, 85, 98, 327, 366, 447
confident = false
see deletion of 3 bases at pos 157 on |233|IGKV1-5|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.675 = CCACCTATCGATCCCT-1

using 437 reads

====================================================================================

graph has 186 edges initially, 38 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^2, 3, 6, 8, 129, 280]
surviving nonsolo ucounts = 2[129, 280]
ids = [0, 13]

====================================================================================

UMI info for barcode CCACCTATCGATCCCT-1 contig 1 = CTGCTCAGTT...
umi AACCAACTCT = 118 reads: +385 validated

UMI info for barcode CCACCTATCGATCCCT-1 contig 2 = GAGCTGCTCA...
umi TACTTCCATG = 256 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=497]
0-27 ==> 70-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
27-372 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-497 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNNWPPITF at 348, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 27, 96, 232, 454
confident = false

TIG 2[bases=500]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYGSSPVTF at 354, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 30, 238, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.678 = CCACCTATCGCTAGCG-1

using 242 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^3, 4, 223]
surviving nonsolo ucounts = 1[223]
ids = [8]

====================================================================================

UMI info for barcode CCACCTATCGCTAGCG-1 contig 1 = CAGGAGGCAG...
umi CCCGCGTACG = 217 reads: +147 -4XX +234 invalidated

GOOD CONTIGS

TIG 1[bases=464]
0-28 ==> 7-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
28-375 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=1)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
413-464 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CYSTDSSGNHRGVF at 343, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 28, 89, 158, 176, 227, 289, 326
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.684 = CCACCTATCTCGCTTG-1

using 475 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 198, 265]
surviving nonsolo ucounts = 2[198, 265]
ids = [4, 1]

====================================================================================

UMI info for barcode CCACCTATCTCGCTTG-1 contig 1 = GAGGAATCAG...
umi ATATTTGTGA = 267 reads: +388 validated
umi CCTGTCGGGC = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 77 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 460
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.690 = CCACCTATCTTACCGC-1

using 309 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 295]
surviving nonsolo ucounts = 1[295]
ids = [5]

====================================================================================

UMI info for barcode CCACCTATCTTACCGC-1 contig 1 = TGGGGAGACT...
umi GTCACCCGTT = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-506 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.691 = CCACCTATCTTCCTTC-1

using 22 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.705 = CCACGGAAGCCCGAAA-1

using 251 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[249]
surviving nonsolo ucounts = 1[249]
ids = [2]

====================================================================================

UMI info for barcode CCACGGAAGCCCGAAA-1 contig 1 = ACCCAAAAAC...
umi CGTAAAGCGC = 237 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=536]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-536 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.706 = CCACGGAAGCCGGTAA-1

using 94 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[93]
surviving nonsolo ucounts = 1[93]
ids = [0]

====================================================================================

UMI info for barcode CCACGGAAGCCGGTAA-1 contig 1 = GGGAAGTGCT...
umi ACACCCGAAA = 89 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=470]
0-21 ==> 10-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 19 reads
cdr3 = CARYFAFVNYYFDKW at 381, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 21, 42, 86
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.707 = CCACGGAAGCGAGAAA-1

using 81 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[81]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.714 = CCACGGAAGGATGGTC-1

using 46 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 42]
surviving nonsolo ucounts = 1[42]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=411]
0-341 ==> 15-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
357-376 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
376-411 ==> 0-35 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGYVF at 309, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 35
start codons at 139, 193, 292, 319, 340
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.735 = CCACGGACAAGCCTAT-1

using 23735 reads

====================================================================================

graph has 8675 edges initially, 98 edges after simplification

total ucounts = 818
nonsolo ucounts = 372[2^125, 3^70, 4^39, 5^27, 6^15, 7^13, 8^4, 9, 11, 15, 16, 17, 36, 37, 61, 91, 109, 113, 139, 140, 141, 142, 149, 160, 174, 178, 193, 196, 199, 217, 228, 233, 238, 250, 251, 259, 260, 262^2, 264, 265, 272, 274, 278, 279, 280, 288, 290, 293, 300, 303, 310, 315^3, 318^2, 323, 327, 334, 336, 337, 338, 344, 345, 350, 356, 360, 362, 365, 367, 376, 381, 385, 386, 395, 406, 408, 411, 427, 432, 450, 477, 669, 688, 1127]
surviving nonsolo ucounts = 67[113, 139, 140, 141, 149, 160, 174, 178, 193, 196, 199, 217, 228, 233, 250, 251, 259, 260, 262^2, 264, 265, 272, 274, 278, 279, 280, 288, 290, 293, 300, 303, 310, 315^3, 318^2, 323, 327, 334, 336, 337, 338, 344, 345, 350, 356, 360, 362, 365, 367, 376, 381, 385, 386, 395, 406, 408, 411, 427, 432, 450, 477, 669, 688, 1127]
ids = [232, 728, 542, 565, 76, 113, 296, 97, 275, 69, ...]

====================================================================================

UMI info for barcode CCACGGACAAGCCTAT-1 contig 1 = GAGCTCTGGG...
umi ACATATAGTG = 277 reads: +436 validated
umi ACCGTTAGTC = 191 reads: +414 -1 +1 -1 +19 non-validated
umi AGATCTGGGT = 176 reads: +390 -1 +45 non-validated
umi AGTCTATGGC = 151 reads: +436 validated
umi CAAGCTAGCT = 231 reads: +436 validated
umi CACGTGGACT = 281 reads: +436 validated
umi CCTTTCCCGT = 176 reads: +436 validated
umi CGCGAGGGAC = 243 reads: +436 validated
umi CTCCCCACTA = 228 reads: +436 validated
umi CTGGTTCATG = 263 reads: +436 validated
umi GACCGTTATG = 199 reads: +436 validated
umi GAGTCCCCTT = 317 reads: +436 validated
umi GCGTGCTTTG = 264 reads: +426 -10 non-validated
umi TTCAAGCCCG = 251 reads: +436 validated
umi TTGAAGACAG = 288 reads: +436 validated
umi TTGCCGCTTG = 199 reads: +436 validated

UMI info for barcode CCACGGACAAGCCTAT-1 contig 2 = TGGGGAGGAG...
umi AAACTTGTCT = 395 reads: +388 validated
umi AACAGTCCGT = 360 reads: +388 validated
umi AACCACATCG = 316 reads: +388 validated
umi AATCACCATG = 362 reads: +388 validated
umi AATCCATTTA = 389 reads: +388 validated
umi AATCGCCTAC = 409 reads: +388 validated
umi ACCTCTCGTT = 338 reads: +47 -2XX +2 -2XX +335 invalidated
umi ACGCGTGCAA = 148 reads: +388 validated
umi ACGTAAGACG = 362 reads: +388 validated
umi ACTCGTCCTT = 228 reads: +388 validated
umi ATTTTACTAA = 481 reads: +388 validated
umi CATATTATCC = 322 reads: +388 validated
umi CATGCTCGTC = 264 reads: +388 validated
umi CCACCATCGG = 113 reads: +388 validated
umi CCCTACAGCT = 336 reads: +388 validated
umi CCCTGGCTTT = 321 reads: +388 validated
umi CCGATTAGTT = 300 reads: +388 validated
umi CCTACCATGC = 311 reads: +388 validated
umi CCTCTAGACA = 337 reads: +388 validated
umi CCTTGGAGCT = 322 reads: +388 validated
umi CGCTACTTCC = 355 reads: +388 validated
umi CGCTCGCCAG = 446 reads: +388 validated
umi CGTATACCTT = 433 reads: +388 validated
umi CGTCTGTTAG = 343 reads: +388 validated
umi CTACCACGTA = 296 reads: +388 validated
umi CTCCTGCCCG = 409 reads: +388 validated
umi CTCCTGTATC = 311 reads: +388 validated
umi GATCTAGCCT = 260 reads: +388 validated
umi GATTCTTGCC = 388 reads: +388 validated
umi GGTCACCCGC = 141 reads: +388 validated
umi GTCCCCGCAT = 139 reads: +388 validated
umi GTCTTCTGTG = 377 reads: -8X +1 -1X +378 invalidated
umi TACTGCCCGC = 685 reads: +388 validated
umi TATAACCTGC = 278 reads: +388 validated
umi TCATATCTGT = 365 reads: +388 validated
umi TCCTCTGCAA = 271 reads: +388 validated
umi TGACCGAGCT = 404 reads: +388 validated
umi TGATCTGCGA = 344 reads: +388 validated
umi TGCGGGCACA = 338 reads: +388 validated
umi TGGCCTAGTG = 430 reads: +388 validated
umi TGTGAATGAA = 380 reads: +388 validated
umi TGTTCTTATG = 283 reads: +388 validated
umi TTATCTACGC = 276 reads: +388 validated
umi TTCATACAAA = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=587]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
453-516 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=2)
516-587 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 248 reads
cdr3 = CAKEGGTVTQNDYYYYYMDVW at 422, score = 9 + 7
umis assigned: [57, 69, 97, 113, 166, 184, 296, 315, 362, 387] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3667
start codons at 80, 231, 236, 294, 297, 315, 383, 473
confident = true

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 44 umis using 2287 reads
cdr3 = CQQSYSTFWTF at 359, score = 9 + 8
umis assigned: [7, 15, 19, 33, 34, 36, 71, 76, 78, 84] and 34 others
of which 44 are surviving nonsolos
reads assigned: 14443
start codons at 32, 38, 94, 107, 243, 462
confident = true

REJECT CONTIGS

TIG 1[bases=303]
6-31 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
54-92 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
90-138 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
92-303 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [32, 275, 312, 550, 569, 728, 813]
of which 7 are surviving nonsolos
reads assigned: 1695
start codons at 56, 224
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAAAGAGGGAGGTACGGTGACTCAGAACGACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCTTCTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.739 = CCACGGACACAACGTT-1

using 57 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2^3, 3, 39]
surviving nonsolo ucounts = 1[39]
ids = [11]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.742 = CCACGGACACGAAGCA-1

using 552 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 4^2, 541]
surviving nonsolo ucounts = 1[541]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.744 = CCACGGACACTAGTAC-1

using 253 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 248]
surviving nonsolo ucounts = 1[248]
ids = [1]

====================================================================================

UMI info for barcode CCACGGACACTAGTAC-1 contig 1 = GGGGACTGAT...
umi AATACAGCCG = 235 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=459]
37-397 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
396-434 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
434-459 ==> 0-25 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQGTHWPPTF at 373, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 37, 70, 98, 106, 194, 356, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.753 = CCACGGACAGCTCGAC-1

using 422 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[420]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=433]
0-266 ==> 2170-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
283-331 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
331-433 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 415
start codons at 21, 27, 68, 349, 410
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.754 = CCACGGACAGGATCGA-1

using 228 reads

====================================================================================

graph has 132 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 13, 204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode CCACGGACAGGATCGA-1 contig 1 = AAAAACCACA...
umi CACTCTGTTC = 199 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=520]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-520 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.762 = CCACGGACATCCCACT-1

using 379 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 5^2, 13, 18, 330]
surviving nonsolo ucounts = 1[330]
ids = [4]

====================================================================================

UMI info for barcode CCACGGACATCCCACT-1 contig 1 = AAAAACCACA...
umi GCATCATGAG = 314 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=528]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-528 ==> 0-42 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.766 = CCACGGACATGCTGGC-1

using 281 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 278]
surviving nonsolo ucounts = 1[278]
ids = [2]

====================================================================================

UMI info for barcode CCACGGACATGCTGGC-1 contig 1 = TGGGGAGGAG...
umi TTTTAAACCA = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPYTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.772 = CCACGGAGTAAGGGCT-1

using 674 reads

====================================================================================

graph has 207 edges initially, 24 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[294, 373]
surviving nonsolo ucounts = 2[294, 373]
ids = [4, 7]

====================================================================================

UMI info for barcode CCACGGAGTAAGGGCT-1 contig 1 = GTCAGTCTCA...
umi TCAACACCGT = 377 reads: +55 -1XX +332 invalidated

UMI info for barcode CCACGGAGTAAGGGCT-1 contig 2 = TGGGGGGAGT...
umi CGTATTAGCA = 309 reads: +110 -1XX +2 -1XX +31 -1XX +2 -1XX +4 -2XX +233 invalidated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 367
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false

TIG 2[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYTTPRTF at 358, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 31, 37, 93, 106, 238, 263, 338, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.774 = CCACGGAGTACCCAAT-1

using 664 reads

====================================================================================

graph has 746 edges initially, 22 edges after simplification

total ucounts = 312
nonsolo ucounts = 135[2^58, 3^27, 4^16, 5^15, 6^6, 7^6, 8^3, 9, 11, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.779 = CCACGGAGTATAGGGC-1

using 325 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 313]
surviving nonsolo ucounts = 1[313]
ids = [9]

====================================================================================

UMI info for barcode CCACGGAGTATAGGGC-1 contig 1 = GGGGTCTCCC...
umi TCTCCACCCT = 321 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=559]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=26)
430-480 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=6)
480-559 ==> 0-79 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CARSQRLNWGGGFHIG at 401, score = 8 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 59, 233, 257, 323, 392, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.805 = CCACGGAGTGGCTCCA-1

using 15 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.809 = CCACGGAGTTCCGTCT-1

using 629 reads

====================================================================================

graph has 207 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 279, 346]
surviving nonsolo ucounts = 2[279, 346]
ids = [2, 4]

====================================================================================

UMI info for barcode CCACGGAGTTCCGTCT-1 contig 1 = GTGGGTCCAG...
umi GTGATGTGGT = 277 reads: +379 validated
umi TCCCAATTGC = 350 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
414-625 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CQSADSSGTWVF at 350, score = 8 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 617
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.811 = CCACGGAGTTCGTCTC-1

using 23 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2^2, 6, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.815 = CCACGGATCAAACAAG-1

using 124 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 119]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.821 = CCACGGATCAGTCCCT-1

using 345 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[345]
surviving nonsolo ucounts = 1[345]
ids = [0]

====================================================================================

UMI info for barcode CCACGGATCAGTCCCT-1 contig 1 = GTCAGTCCCA...
umi GCTACTCGTA = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=27)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSFDNLPYIF at 350, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 23, 29, 404, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.825 = CCACGGATCCAAGTAC-1

using 180 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 4, 165]
surviving nonsolo ucounts = 2[4, 165]
ids = [0, 1]

====================================================================================

UMI info for barcode CCACGGATCCAAGTAC-1 contig 1 = GGACTCCTGT...
umi AATAGCTTCG = 4 reads: -184 +10 -1X +116 -122 invalidated
umi ACAAAAACTC = 158 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=492]
18-368 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
399-451 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
451-492 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 363, score = 8 + 6
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 159
start codons at 18, 62, 241, 324
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.830 = CCACGGATCCCTAACC-1

using 367 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[12, 351]
surviving nonsolo ucounts = 1[351]
ids = [0]

====================================================================================

UMI info for barcode CCACGGATCCCTAACC-1 contig 1 = CGAGCCCAGC...
umi AACATCCGTC = 350 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=553]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.836 = CCACGGATCCTTCAAT-1

using 347 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 340]
surviving nonsolo ucounts = 1[340]
ids = [5]

====================================================================================

UMI info for barcode CCACGGATCCTTCAAT-1 contig 1 = GGAGTCAGAC...
umi GCAGTCTCAG = 336 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSNSYWTF at 353, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 32, 86, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.838 = CCACGGATCGAGAGCA-1

using 57662 reads

====================================================================================

graph has 22983 edges initially, 186 edges after simplification

total ucounts = 2916
nonsolo ucounts = 1384[2^463, 3^243, 4^172, 5^85, 6^60, 7^36, 8^29, 9^32, 10^13, 11^11, 12^7, 13^7, 14^6, 15^5, 16^3, 17, 18^2, 19, 20, 22, 23, 24, 25, 26, 27, 30, 31, 33, 41, 44^2, 45, 47, 48, 53, 57, 61, 65, 69, 71, 74, 82^2, 83, 85, 87, 92, 101, 102, 103^2, 104, 106, 120, 121, 124, 129^2, 131, 136, 140, 142, 144, 147^2, 148, 151^2, 152, 154^2, 158, 159, 160, 163, 166, 168^2, 170, 175, 180^3, 182^2, 186, 187, 191, 192^2, 194, 195, 199, 201, 203^3, 208, 215, 217, 218, 219^2, 223, 227, 228, 230, 233^2, 234^2, 235, 236, 237^2, 239^2, 240^2, 241, 245^3, 248, 249^2, 250^2, 251, 252^3, 254, 256, 257^2, 258, 259^2, 262, 263^3, 264^2, 265, 268, 269, 270^2, 272^2, 273, 276^3, 278, 280^2, 281^2, 284, 286, 287, 290^2, 291, 292, 293, 295, 296, 297, 298, 299, 300^2, 302^2, 308, 309, 310, 311, 312, 315^2, 316^2, 320, 321, 324, 327, 329, 332, 333, 334, 336, 340, 345, 349, 351, 354, 361, 364, 365, 369^2, 373, 377, 384, 390, 394, 405, 432, 450, 452, 547, 554, 602, 631, 653, 660, 705, 763, 905, 939, 1169]
surviving nonsolo ucounts = 196[2^4, 3, 4, 33, 41, 47, 48, 57, 61, 65, 71, 82^2, 83, 87, 92, 101, 103^2, 104, 106, 120, 121, 124, 129^2, 131, 136, 140, 142, 144, 147^2, 148, 151^2, 152, 154^2, 158, 159, 160, 163, 166, 168, 170, 175, 180^3, 182^2, 186, 187, 191, 192^2, 194, 195, 199, 201, 203^3, 208, 215, 217, 218, 219^2, 223, 227, 228, 230, 233^2, 234^2, 235, 236, 237^2, 239^2, 240^2, 241, 245^3, 248, 249^2, 250^2, 251, 252^3, 254, 256, 257^2, 258, 259^2, 262, 263^3, 264^2, 265, 268, 269, 270^2, 272^2, 273, 276^3, 278, 280^2, 281^2, 284, 286, 287, 290^2, 291, 292, 293, 295, 296, 297, 298, 299, 300^2, 302^2, 308, 309, 310, 311, 312, 315^2, 316^2, 320, 321, 324, 327, 329, 332, 333, 334, 336, 340, 345, 349, 351, 354, 361, 364, 365, 369^2, 373, 377, 384, 390, 394, 405, 432, 450, 452, 547, 554, 602, 631, 653, 660, 705, 763, 905, 939, 1169]
ids = [216, 1427, 1675, 2472, 2805, 568, 1945, 1610, 2689, 810, ...]

====================================================================================

UMI info for barcode CCACGGATCGAGAGCA-1 contig 1 = AGCCCTCAGA...
umi AACCAGTATC = 174 reads: +430 validated
umi AAGATTCCAA = 205 reads: +430 validated
umi AATCTTCCCG = 83 reads: +430 validated
umi ACAAGGGCCC = 193 reads: +221 -1XX +208 invalidated
umi ACAGTGCAGC = 63 reads: +383 -1 +1 -45 non-validated
umi ACCGGATACC = 207 reads: +430 validated
umi ACGGTGGTCT = 196 reads: +95 -1 +334 non-validated
umi ACGTTTACTC = 135 reads: +430 validated
umi AGAATCTCTA = 127 reads: +430 validated
umi AGACCTTTAG = 70 reads: +105 -1 +324 non-validated
umi AGGCCTGGAC = 168 reads: +430 validated
umi AGTATGTGAC = 117 reads: +421 -1 +8 non-validated
umi AGTCTTCCGG = 139 reads: +95 -1 +334 non-validated
umi AGTGTTTGGC = 177 reads: +95 -1 +334 non-validated
umi ATGCATGTGT = 193 reads: +430 validated
umi CAAAATCACA = 110 reads: +36 -1XX +1 -1XX +2 -1XX +1 -1XX +308 -78 invalidated
umi CAATAAGAGT = 67 reads: +36 -1 +1 -1XX +2 -1XX +1 -1XX +241 -145 invalidated
umi CAATGTAGGG = 36 reads: -430 non-validated
umi CACGTACCCC = 233 reads: +430 validated
umi CACGTCGGCT = 925 reads: +46 -4XX +2 -1XX +1 -13XX +1 -2XX +1 -333XX +2 -4XX +3 -1XX +3 -1XX +1 -2XX +1 -1XX +1 -4XX +2 invalidated
umi CAGTTTGGAC = 146 reads: +430 validated
umi CATCTTTACC = 276 reads: +430 validated
umi CATGGTCAAT = 966 reads: +46 -4XX +2 -1XX +1 -13XX +1 -2XX +1 -333XX +2 -4XX +3 -1XX +3 -1XX +1 -2XX +1 -1XX +1 -4XX +2 invalidated
umi CCCGACTGGG = 135 reads: +430 validated
umi CCTATCTACA = 196 reads: +430 validated
umi CGTGAACAAT = 102 reads: +105 -1X +324 invalidated
umi CTATTACAGT = 245 reads: +430 validated
umi CTGTCCCGCT = 761 reads: -305X +125 invalidated
umi CTTACGCGTA = 197 reads: +430 validated
umi CTTCATCCAT = 105 reads: +430 validated
umi CTTGCCCTTT = 177 reads: +430 validated
umi GACTCAACCC = 63 reads: +410 -20 non-validated
umi GAGCGTCAGT = 40 reads: +430 validated
umi GATAGACATA = 252 reads: +430 validated
umi GCCAGTGGAA = 227 reads: +430 validated
umi GCCGTGAGGG = 155 reads: -390X +3 -2X +6 -2XX +1 -1XX +2 -1XX +3 -2XX +8 -1XX +8 invalidated
umi GCGAGGATTG = 548 reads: +1 -1XX +6 -1XX +6 -1XX +2 -385X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi GGTAGGGGTC = 201 reads: +416 -1 +2 -1 +2 -1 +1 -2 +3 -1 non-validated
umi GGTCTTACAT = 26 reads: -430 non-validated
umi GTACGCCACA = 626 reads: -380X +1 -5XX +1 -3XX +3 -2XX +6 -1XX +2 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GTAGTGATCC = 254 reads: +430 validated
umi GTGAGACGTT = 557 reads: +46 -4XX +2 -1XX +1 -356XX +3 -1XX +3 -1XX +1 -2XX +1 -1XX +1 -4XX +2 invalidated
umi GTTAATATCC = 396 reads: -314 +1 -1X +1 -1 +3 -1 +108 invalidated
umi TAATCGTGGG = 153 reads: +430 validated
umi TACGGTTACC = 585 reads: +1 -1XX +6 -1XX +6 -1X +2 -385X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi TAGGTGTTGT = 238 reads: +430 validated
umi TATGTTAGTA = 57 reads: +380 -50 non-validated
umi TATTTCCATT = 177 reads: +430 validated
umi TCACTTTGGT = 234 reads: +430 validated
umi TCCGTATTCA = 250 reads: +430 validated
umi TCTAGGCCGT = 92 reads: +406 -24 non-validated
umi TCTATATGTA = 159 reads: +430 validated
umi TGCGCTGGCG = 228 reads: +430 validated
umi TGGACATCGA = 180 reads: +430 validated
umi TGGTCGCTAA = 1168 reads: -308 +122 non-validated
umi TGTCAGATCA = 688 reads: -386X +1 -3X +3 -2XX +6 -1XX +2 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TGTCCTGGTT = 81 reads: +430 validated
umi TGTTCGACGG = 38 reads: -430 non-validated
umi TTAACAATTA = 196 reads: +430 validated
umi TTCTGGCCAA = 312 reads: +430 validated
umi TTGAAAGTCA = 129 reads: +430 validated

UMI info for barcode CCACGGATCGAGAGCA-1 contig 2 = TGGGGAGGAG...
umi AAACAGCGCC = 305 reads: +157 -3XX +222 invalidated
umi AAAGCGCCAC = 446 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi AACAACTGTA = 313 reads: +382 validated
umi AACATTAAAT = 247 reads: +382 validated
umi AACGTTATGC = 153 reads: +382 validated
umi AAGGATGAGT = 235 reads: +382 validated
umi AAGGTTCCTC = 250 reads: +382 validated
umi AAGTACGCGA = 319 reads: +382 validated
umi AAGTATAGGC = 253 reads: +382 validated
umi AATACTGTTG = 255 reads: +382 validated
umi AATAGAAGCG = 279 reads: +382 validated
umi AATGACCTCG = 89 reads: +382 validated
umi AATGCCTGGC = 294 reads: +382 validated
umi AATGTATGGC = 371 reads: +382 validated
umi AATTACATGC = 279 reads: +382 validated
umi AATTTCCCGT = 254 reads: +382 validated
umi ACAAGAACAT = 164 reads: +382 validated
umi ACACCAGATT = 263 reads: +382 validated
umi ACACCGCCTT = 352 reads: +382 validated
umi ACACGCAAAC = 263 reads: +382 validated
umi ACCTCAGACA = 317 reads: +382 validated
umi ACTCCCTATG = 258 reads: +382 validated
umi AGAATTTCCA = 228 reads: +382 validated
umi AGAGTCTATT = 406 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -53X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi AGGTCCACAA = 121 reads: +382 validated
umi AGTACTTAAC = 306 reads: +382 validated
umi AGTAGTTTAA = 266 reads: +382 validated
umi AGTCAGCATC = 228 reads: +382 validated
umi AGTCGTCTAT = 168 reads: +382 validated
umi AGTTCTGCGC = 288 reads: +382 validated
umi AGTTGTTCGG = 330 reads: +382 validated
umi AGTTTTAGTT = 315 reads: +382 validated
umi ATAATACTCA = 661 reads: +382 validated
umi ATCAATCAGG = 292 reads: +382 validated
umi ATCAATCATA = 471 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50XX +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi ATCACGAGGC = 160 reads: +382 validated
umi ATCATCATGG = 311 reads: +382 validated
umi ATCATTCCTT = 215 reads: +382 validated
umi ATGTCGGGCG = 232 reads: +382 validated
umi ATGTTACTGG = 218 reads: +382 validated
umi ATTAATTTAC = 361 reads: +382 validated
umi ATTACCTAGC = 293 reads: +382 validated
umi ATTTCGTTGG = 636 reads: -250X +1 -2X +129 invalidated
umi ATTTGGCTCA = 330 reads: +382 validated
umi ATTTTTCTGT = 344 reads: +382 validated
umi CACATCTCCG = 335 reads: +382 validated
umi CACTTAGCGG = 204 reads: +382 validated
umi CAGCCAACAA = 242 reads: +382 validated
umi CAGTAAAGGT = 271 reads: +382 validated
umi CATTTGCAGC = 168 reads: +382 validated
umi CCAATTCTAG = 275 reads: +382 validated
umi CCAGCGTAAG = 314 reads: +382 validated
umi CCAGTAGCAT = 389 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -53X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi CCATAACTGG = 146 reads: +382 validated
umi CCATTCCTTA = 258 reads: +382 validated
umi CCCCCCCTGA = 289 reads: +382 validated
umi CCCCTGCTTA = 139 reads: +382 validated
umi CCGTACACTT = 280 reads: +382 validated
umi CGACTTCATG = 308 reads: +382 validated
umi CGATAGTTAT = 323 reads: +382 validated
umi CGCCGTCTTC = 371 reads: +382 validated
umi CTACTTTGGG = 373 reads: +382 validated
umi CTAGCACCGG = 250 reads: +382 validated
umi CTCCAACACA = 132 reads: +382 validated
umi CTCTATTGTC = 280 reads: +382 validated
umi CTGTGCCGTC = 301 reads: +382 validated
umi CTGTTGACCT = 307 reads: +382 validated
umi CTTAACCCGA = 280 reads: +382 validated
umi CTTCAATGTG = 244 reads: +382 validated
umi CTTGCAGGCA = 191 reads: +382 validated
umi GAAAGACTCG = 298 reads: +382 validated
umi GAAGTCTGTT = 236 reads: -329X +53 invalidated
umi GACTAAAGGG = 97 reads: +339 -1 +4 -1 +8 -1 +3 -1 +24 non-validated
umi GAGCCCCTTT = 262 reads: +382 validated
umi GAGCTATCCC = 249 reads: +382 validated
umi GCATATGTAT = 273 reads: +382 validated
umi GCCATCAATA = 221 reads: +382 validated
umi GCGTAAATGA = 330 reads: +382 validated
umi GCGTACCGAC = 259 reads: +382 validated
umi GCGTATTGCC = 269 reads: +382 validated
umi GCGTTCATAG = 268 reads: +382 validated
umi GCTATGGACA = 238 reads: +382 validated
umi GCTCGTCGGG = 287 reads: +382 validated
umi GCTGTGGGGG = 144 reads: +309 -1XX +72 invalidated
umi GCTTCGTGTG = 151 reads: +382 validated
umi GGAAGATCTC = 239 reads: +382 validated
umi GGATCTATCA = 338 reads: +382 validated
umi GGCAATACGT = 294 reads: +382 validated
umi GGCAGAACTA = 371 reads: +382 validated
umi GGCCCGTAGC = 277 reads: +382 validated
umi GGCCGTTCAT = 290 reads: +382 validated
umi GGCTCAGGCA = 154 reads: +382 validated
umi GGTAATGAAG = 192 reads: +382 validated
umi GGTCGTTGTA = 246 reads: +382 validated
umi GGTGCCACAG = 380 reads: +382 validated
umi GTAATTGCCG = 348 reads: +382 validated
umi GTATACCACA = 357 reads: +382 validated
umi GTCAACATAT = 150 reads: +382 validated
umi GTGTTACGGC = 352 reads: +309 -2XX +1 -2XX +1 -3X +64 invalidated
umi GTTAACCGTC = 257 reads: +382 validated
umi GTTCCCCGGA = 226 reads: +382 validated
umi GTTTAAGGGC = 266 reads: +382 validated
umi TAATTGTCAG = 301 reads: +382 validated
umi TACAATTTGT = 335 reads: +382 validated
umi TAGTTAGATT = 314 reads: +382 validated
umi TATATTCGTC = 224 reads: +382 validated
umi TATGATAAGA = 283 reads: +382 validated
umi TATTATATTA = 243 reads: +382 validated
umi TCACAATTCC = 182 reads: +382 validated
umi TCATTATCAC = 242 reads: +382 validated
umi TCATTTATTG = 216 reads: +382 validated
umi TCCACTTGTG = 454 reads: +3 -1XX +378 invalidated
umi TCTCATAGTA = 190 reads: +382 validated
umi TCTGATACAC = 272 reads: +382 validated
umi TCTTATTCGC = 298 reads: +382 validated
umi TGGTATGTTC = 235 reads: +382 validated
umi TGTCATGTAA = 100 reads: +382 validated
umi TGTCTAGCCC = 373 reads: +382 validated
umi TGTGACAATG = 315 reads: +382 validated
umi TGTGGATTTG = 451 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50XX +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi TGTGTCTCAC = 288 reads: +382 validated
umi TTCTGACAGC = 244 reads: +382 validated
umi TTCTTAAGCG = 300 reads: +382 validated
umi TTGCCTACGA = 220 reads: +382 validated
umi TTGTTCTCAT = 277 reads: +382 validated
umi TTTCACATAC = 299 reads: +382 validated
umi TTTTCTGCAG = 265 reads: +382 validated
umi TTTTGATAGT = 103 reads: +382 validated
umi TTTTTATTGT = 256 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=37)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 43 umis using 849 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [63, 110, 185, 220, 247, 287, 320, 332, 383, 397] and 51 others
of which 59 are surviving nonsolos
reads assigned: 14895
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

TIG 2[bases=556]
38-286 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 124 umis using 5782 reads
cdr3 = CLHYDNRRRTF at 359, score = 9 + 8
umis assigned: [12, 21, 47, 58, 87, 124, 134, 137, 140, 154] and 119 others
of which 129 are surviving nonsolos
reads assigned: 34680
start codons at 38, 94, 107, 246, 369, 462
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.843 = CCACGGATCGTATCAG-1

using 319 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[4, 307]
surviving nonsolo ucounts = 1[307]
ids = [4]

====================================================================================

UMI info for barcode CCACGGATCGTATCAG-1 contig 1 = AGCTCTCAGA...
umi GTACTTTGGG = 288 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=557]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
443-470 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=4)
466-527 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=4)
527-557 ==> 0-30 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARVGRARITMVRGVPNYYYYMDVW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 79, 235, 356, 382, 451, 484
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.863 = CCACTACAGACGCAAC-1

using 1081 reads

====================================================================================

graph has 402 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[1077]
surviving nonsolo ucounts = 1[1077]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=328]
4-79 ==> 281-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
79-117 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
117-328 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 47, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 1062
start codons at 30, 57, 81, 249
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.866 = CCACTACAGAGAACAG-1

using 147 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 140]
surviving nonsolo ucounts = 1[140]
ids = [0]

====================================================================================

UMI info for barcode CCACTACAGAGAACAG-1 contig 1 = GGGGTCACAA...
umi CACCGACATT = 132 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=492]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-492 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.872 = CCACTACAGATCCCGC-1

using 131 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 16[2^2, 3^2, 4^2, 7^2, 8, 9^2, 11, 12^2, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.877 = CCACTACAGCACCGCT-1

using 55 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2, 3^3, 6^2, 7, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.883 = CCACTACAGGACAGCT-1

using 582 reads

====================================================================================

graph has 196 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 46, 212, 321]
surviving nonsolo ucounts = 3[46, 212, 321]
ids = [0, 2, 1]

====================================================================================

UMI info for barcode CCACTACAGGACAGCT-1 contig 1 = ACCCAAAAAC...
umi CCTACGAGTC = 206 reads: +436 validated

UMI info for barcode CCACTACAGGACAGCT-1 contig 2 = GGAATCAGTC...
umi CAACATTTCG = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-529 ==> 0-39 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=467]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-467 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 26, 32, 101, 237, 456
confident = false

REJECT CONTIGS

TIG 1[bases=314]
18-302 ==> 0-284 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=11)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 36
start codons at 18, 62, 241, 244, 247
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.884 = CCACTACAGGACCACA-1

using 163 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 160]
surviving nonsolo ucounts = 1[160]
ids = [1]

====================================================================================

UMI info for barcode CCACTACAGGACCACA-1 contig 1 = GTCTCAGTCA...
umi TACAATTGCT = 162 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQSYTTLLTF at 346, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.890 = CCACTACAGGGTGTGT-1

using 247 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [2]

====================================================================================

UMI info for barcode CCACTACAGGGTGTGT-1 contig 1 = CAAACAGAGC...
umi GCGCATGACG = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=595]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-595 ==> 0-169 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSWDSSLSAWVF at 359, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 38, 177, 249, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.897 = CCACTACAGTTATCGC-1

using 436 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 430]
surviving nonsolo ucounts = 1[430]
ids = [1]

====================================================================================

UMI info for barcode CCACTACAGTTATCGC-1 contig 1 = AAGAGCTGCT...
umi AGGAACCTCA = 408 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=503]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-368 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
414-503 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYRNSITF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 403
start codons at 32, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.903 = CCACTACCAACTGCTA-1

using 453 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[216, 235]
surviving nonsolo ucounts = 2[216, 235]
ids = [1, 0]

====================================================================================

UMI info for barcode CCACTACCAACTGCTA-1 contig 1 = GGGGTGCAGG...
umi CCCAAAAATC = 231 reads: +394 validated

UMI info for barcode CCACTACCAACTGCTA-1 contig 2 = AGCTTCAGCT...
umi CTATAAGGAG = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
428-481 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYSTPPIFTF at 361, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 34, 40, 96, 109, 245, 470
confident = false

TIG 2[bases=582]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-582 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CAAWDDTLNGWVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 47, 261, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.909 = CCACTACCAATCCAAC-1

using 399 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 4, 7, 381]
surviving nonsolo ucounts = 2[4, 381]
ids = [5, 0]

====================================================================================

UMI info for barcode CCACTACCAATCCAAC-1 contig 1 = GGGGAGGAAC...
umi ACCTGCGGGT = 349 reads: +382 validated
umi TGCAAGACTG = 5 reads: -82 +62 -1X +6 -1X +2 -2X +2 -1X +7 -1X +11 -4 +26 -1X +4 -3X +62 -104 invalidated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNNWPLTF at 357, score = 9 + 9
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 348
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.920 = CCACTACCACTGCCAG-1

using 298 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 7, 285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode CCACTACCACTGCCAG-1 contig 1 = GGGGTCACAA...
umi AACTTCGAGT = 281 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=497]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=7)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-497 ==> 0-65 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSYAGSSTVPYVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 38, 239, 246, 372, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.923 = CCACTACCAGACACTT-1

using 271 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode CCACTACCAGACACTT-1 contig 1 = GGGGTCACAA...
umi TACAAATTCC = 275 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.927 = CCACTACCAGCGAACA-1

using 357 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 3^2, 7, 335]
surviving nonsolo ucounts = 1[335]
ids = [9]

====================================================================================

UMI info for barcode CCACTACCAGCGAACA-1 contig 1 = GCTGGGGTCT...
umi TCGTATTCGG = 327 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=14)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-570 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.928 = CCACTACCAGCGTAAG-1

using 272 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [2]

====================================================================================

UMI info for barcode CCACTACCAGCGTAAG-1 contig 1 = GCTCTGCTTC...
umi CTAGTGTTCC = 271 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.938 = CCACTACCATAAGACA-1

using 942 reads

====================================================================================

graph has 1341 edges initially, 14 edges after simplification

total ucounts = 383
nonsolo ucounts = 187[2^61, 3^35, 4^35, 5^26, 6^13, 7^3, 8^4, 9^3, 10, 11^2, 12^2, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.942 = CCACTACCATCACAAC-1

using 81 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 11[2^2, 3, 4, 5^2, 7, 8, 11, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.943 = CCACTACCATCACCCT-1

using 949 reads

====================================================================================

graph has 870 edges initially, 4 edges after simplification

total ucounts = 251
nonsolo ucounts = 70[2^28, 3^16, 4^6, 5^7, 6, 7, 8^2, 9^2, 10, 12, 13, 14, 23, 29, 457]
surviving nonsolo ucounts = 1[457]
ids = [3]

====================================================================================

UMI info for barcode CCACTACCATCACCCT-1 contig 1 = CTGGGCCTAA...
umi AACAACTTTC = 439 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-370 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=13)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
425-546 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQVWDSHSDHRDVVF at 352, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 431
start codons at 37, 98, 185, 236, 335, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.948 = CCACTACCATGAAGTA-1

using 173 reads

====================================================================================

graph has 166 edges initially, 6 edges after simplification

total ucounts = 40
nonsolo ucounts = 30[2^5, 3^4, 4^5, 5^5, 6^4, 7^2, 8, 9^2, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.958 = CCACTACGTAAATGTG-1

using 274 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 267]
surviving nonsolo ucounts = 1[267]
ids = [4]

====================================================================================

UMI info for barcode CCACTACGTAAATGTG-1 contig 1 = GCTCTGCTTC...
umi CTTTCACTCT = 259 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=593]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-593 ==> 0-151 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.969 = CCACTACGTCAGATAA-1

using 70 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^3, 3^2, 4^2, 5, 6, 8, 11, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.972 = CCACTACGTCATATGC-1

using 466 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[461]
surviving nonsolo ucounts = 1[461]
ids = [5]

====================================================================================

UMI info for barcode CCACTACGTCATATGC-1 contig 1 = GCTCTGCTTC...
umi TAACTCCTAT = 456 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 452
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.973 = CCACTACGTCCAGTAT-1

using 749 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[5, 19, 715]
surviving nonsolo ucounts = 1[715]
ids = [8]

====================================================================================

UMI info for barcode CCACTACGTCCAGTAT-1 contig 1 = GCTACAACAG...
umi GGGAACTTAT = 718 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=561]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=3)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 113 reads
cdr3 = CQQYYSTGTF at 367, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 707
start codons at 28, 97, 350, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.981 = CCACTACGTGAGGGTT-1

using 20 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.986 = CCACTACGTGGTGTAG-1

using 235 reads

====================================================================================

graph has 70 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 11, 218]
surviving nonsolo ucounts = 1[218]
ids = [4]

====================================================================================

UMI info for barcode CCACTACGTGGTGTAG-1 contig 1 = TGCTGGGGTC...
umi TGCATCTAGT = 196 reads: +20 -1X +1 -4XX +368 invalidated

GOOD CONTIGS

TIG 1[bases=454]
42-360 ==> 0-318 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=38)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CCSYTTSATSYVVI at 366, score = 5 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 42, 181, 199, 253, 358, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.998 = CCACTACTCACCACCT-1

using 269 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [5]

====================================================================================

UMI info for barcode CCACTACTCACCACCT-1 contig 1 = AGAGCTCTGG...
umi ATCTCGCTTT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
432-503 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYGSSPPWSF at 368, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 44, 252, 378, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.999 = CCACTACTCACTCTTA-1

using 371 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^3, 3, 4^2, 10, 336]
surviving nonsolo ucounts = 1[336]
ids = [13]

====================================================================================

UMI info for barcode CCACTACTCACTCTTA-1 contig 1 = AGGAGTCAGA...
umi TCTAACATTT = 327 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1002 = CCACTACTCATCTGCC-1

using 223 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[219]
surviving nonsolo ucounts = 1[219]
ids = [1]

====================================================================================

UMI info for barcode CCACTACTCATCTGCC-1 contig 1 = GAAAGCATCA...
umi ATGCAGTTTG = 218 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=493]
0-64 ==> 240-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
64-417 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
410-437 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 15 reads
cdr3 = CARIMVRGVIMAPFDIW at 406, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 64, 151, 262, 328, 361, 391, 418, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1005 = CCACTACTCCAAGTAC-1

using 268 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 257]
surviving nonsolo ucounts = 1[257]
ids = [2]

====================================================================================

UMI info for barcode CCACTACTCCAAGTAC-1 contig 1 = ATCACATAAC...
umi GAACTTATGC = 263 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=578]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
479-578 ==> 0-99 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARSGVMIAIQRFDYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 58, 209, 256, 355, 418
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1015 = CCACTACTCCGGCACA-1

using 250 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 242]
surviving nonsolo ucounts = 1[242]
ids = [5]

====================================================================================

UMI info for barcode CCACTACTCCGGCACA-1 contig 1 = GGCAGAACTC...
umi TGTCAATCAT = 234 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=533]
0-23 ==> 20-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
23-360 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
367-405 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
405-533 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSADSSGTYVVF at 338, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 23, 84, 153, 171, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1016 = CCACTACTCCGTCATC-1

using 26 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1017 = CCACTACTCCTGCAGG-1

using 34 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 9, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1020 = CCACTACTCGTATCAG-1

using 34 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 5, 7, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1023 = CCACTACTCGTTACGA-1

using 516 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[161, 351]
surviving nonsolo ucounts = 2[161, 351]
ids = [3, 2]

====================================================================================

UMI info for barcode CCACTACTCGTTACGA-1 contig 1 = AGGAGTCAGA...
umi TCGTCGCCGT = 154 reads: +394 validated

UMI info for barcode CCACTACTCGTTACGA-1 contig 2 = AGCTCTGAGA...
umi TCATCCTGTC = 338 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=516]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-516 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQHYNSFFLRYIF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 27, 33, 89, 102, 238, 334, 463
confident = false

TIG 2[bases=499]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CANLAVQYYFDYW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 79, 230, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1028 = CCACTACTCTCGGACG-1

using 835 reads

====================================================================================

graph has 274 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[4, 220, 295, 310]
surviving nonsolo ucounts = 3[220, 295, 310]
ids = [5, 4, 3]

====================================================================================

UMI info for barcode CCACTACTCTCGGACG-1 contig 1 = GGGAATCAGT...
umi ATTGTATCGC = 299 reads: +388 validated
umi ATTTGTCACT = 224 reads: +388 validated

UMI info for barcode CCACTACTCTCGGACG-1 contig 2 = GCTCTGCTTC...
umi ATGTACATGT = 305 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 80 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 511
start codons at 27, 33, 102, 238, 457
confident = true

TIG 2[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-579 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 51, 205, 208, 259, 358, 385, 409
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1037 = CCACTACTCTTGTATC-1

using 164 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 1[155]
ids = [6]

====================================================================================

UMI info for barcode CCACTACTCTTGTATC-1 contig 1 = GCTGTGCTGT...
umi TATCGTGTTT = 148 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=495]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=18)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
425-495 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSADYDGAYSVF at 358, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 43, 104, 173, 191, 251, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1038 = CCACTACTCTTGTCAT-1

using 280 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [4]

====================================================================================

UMI info for barcode CCACTACTCTTGTCAT-1 contig 1 = GATCAGGACT...
umi GGCTATTACA = 267 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=460]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-460 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1040 = CCAGCGAAGAAGATTC-1

using 766 reads

====================================================================================

graph has 1176 edges initially, 2 edges after simplification

total ucounts = 308
nonsolo ucounts = 152[2^58, 3^24, 4^19, 5^18, 6^14, 7^7, 8^2, 9^3, 10^2, 11^4, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1042 = CCAGCGAAGACAAAGG-1

using 297 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode CCAGCGAAGACAAAGG-1 contig 1 = TCTGAGAGAG...
umi GGTTGCCCAT = 284 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=574]
0-76 ==> 3-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
76-429 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
453-500 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
500-574 ==> 0-74 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CARDRAATARLGGMDVW at 418, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 76, 227, 232, 379, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1051 = CCAGCGAAGCGATATA-1

using 361 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[12, 345]
surviving nonsolo ucounts = 2[12, 345]
ids = [3, 1]

====================================================================================

UMI info for barcode CCAGCGAAGCGATATA-1 contig 1 = GGGAGGAATC...
umi ATACGATGGG = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1056 = CCAGCGAAGGACTGGT-1

using 207 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode CCAGCGAAGGACTGGT-1 contig 1 = CACAAGAGGC...
umi ATTTGGTGAA = 199 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=522]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
398-424 ==> 12-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-522 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 38 reads
cdr3 = CCSEAGGGVPGLL at 357, score = 7 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 33, 187
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1058 = CCAGCGAAGGATGTAT-1

using 111 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3^2, 6^2, 7, 82]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1063 = CCAGCGAAGGCTCAGA-1

using 1198 reads

====================================================================================

graph has 396 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[287, 327, 582]
surviving nonsolo ucounts = 3[287, 327, 582]
ids = [0, 3, 2]

====================================================================================

UMI info for barcode CCAGCGAAGGCTCAGA-1 contig 1 = ACAAGAGGCA...
umi CATGAACTTC = 579 reads: +391 validated
umi GCACTACAAT = 331 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=633]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 157 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 894
start codons at 31, 115, 188, 338, 365
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1066 = CCAGCGAAGGTAAACT-1

using 120 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 114]
surviving nonsolo ucounts = 1[114]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1067 = CCAGCGAAGTAAGTAC-1

using 572 reads

====================================================================================

graph has 838 edges initially, 6 edges after simplification

total ucounts = 267
nonsolo ucounts = 111[2^49, 3^25, 4^12, 5^8, 6^5, 7^2, 8^4, 10^2, 12, 13^2, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1071 = CCAGCGAAGTGCTGCC-1

using 151 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================

UMI info for barcode CCAGCGAAGTGCTGCC-1 contig 1 = AGTCTGGGCC...
umi AAGGTAGCCG = 124 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=453]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-453 ==> 0-31 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1080 = CCAGCGACAATGAATG-1

using 315 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 305]
surviving nonsolo ucounts = 1[305]
ids = [8]

====================================================================================

UMI info for barcode CCAGCGACAATGAATG-1 contig 1 = ACCCAAAAAC...
umi TTCCTATTGA = 293 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=501]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1082 = CCAGCGACACACAGAG-1

using 17 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1085 = CCAGCGACAGATCGGA-1

using 138 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 1[135]
ids = [0]

====================================================================================

UMI info for barcode CCAGCGACAGATCGGA-1 contig 1 = GAATCAGTCC...
umi AGACCTCCCC = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1087 = CCAGCGACAGCCTTGG-1

using 480 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[475]
surviving nonsolo ucounts = 1[475]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=488]
5-317 ==> 41-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
313-352 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
352-488 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTPRTF at 291, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 471
start codons at 26, 39, 175, 394
confident = false
not full
VJ delta = 17
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1091 = CCAGCGACAGGGAGAG-1

using 20 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1100 = CCAGCGACATCCTTGC-1

using 525 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[7, 152, 365]
surviving nonsolo ucounts = 2[152, 365]
ids = [1, 0]

====================================================================================

UMI info for barcode CCAGCGACATCCTTGC-1 contig 1 = GCTCTGCTTC...
umi AGTCGTATGC = 367 reads: +391 validated
umi GTGTTCAATT = 151 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 95 reads
cdr3 = CQSYDSSLSGSVF at 375, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 507
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1104 = CCAGCGACATTCACTT-1

using 262 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode CCAGCGACATTCACTT-1 contig 1 = GAGTCTCCCT...
umi CCACGCTGGA = 249 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=505]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=13)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
junction support: 1 umis using 26 reads
cdr3 = CARPGYSGAWSRRDTFNIW at 400, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 58, 232, 256, 391, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1107 = CCAGCGAGTACCGGCT-1

using 32 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 5, 9, 11]
surviving nonsolo ucounts = 1[11]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1113 = CCAGCGAGTCGAACAG-1

using 282 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode CCAGCGAGTCGAACAG-1 contig 1 = ACCCAAAAAC...
umi CGTTATCGTT = 269 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-564 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1118 = CCAGCGAGTCTCTCTG-1

using 281 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 274]
surviving nonsolo ucounts = 1[274]
ids = [6]

====================================================================================

UMI info for barcode CCAGCGAGTCTCTCTG-1 contig 1 = GTCAGTCTCA...
umi TGCCCGGTCT = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1122 = CCAGCGAGTGGGTATG-1

using 546 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[5, 6, 206, 328]
surviving nonsolo ucounts = 2[206, 328]
ids = [4, 3]

====================================================================================

UMI info for barcode CCAGCGAGTGGGTATG-1 contig 1 = GAGCTGCTCA...
umi TCCGGCCCTG = 189 reads: +385 validated

UMI info for barcode CCAGCGAGTGGGTATG-1 contig 2 = GAGTGCTTTC...
umi GTATAGGACG = 315 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=475]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=22)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-475 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYSSASYTF at 354, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 30, 238, 345, 457
confident = false

TIG 2[bases=554]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=6)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
454-554 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CARAHGDYYTLLDYW at 378, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 18, 39, 83, 169
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1124 = CCAGCGAGTGTCTGAT-1

using 878 reads

====================================================================================

graph has 264 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[3^2, 11, 12, 243, 258, 345]
surviving nonsolo ucounts = 2[258, 345]
ids = [7, 8]

====================================================================================

UMI info for barcode CCAGCGAGTGTCTGAT-1 contig 1 = GGTCTGCTTC...
umi TCCTCATCGA = 46 reads: -352X +1 -2XX +1 -1XX +1 -1XX +3 -1XX +17 -1XX +13 invalidated
umi TCTCACCGTC = 255 reads: +394 validated
umi TCTCACCGTG = 346 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
445-656 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CQSYDSSLSGYVVF at 375, score = 8 + 8
umis assigned: [6, 7, 8]
of which 2 are surviving nonsolos
reads assigned: 635
start codons at 51, 205, 208, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1127 = CCAGCGAGTTACTGAC-1

using 430 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 425]
surviving nonsolo ucounts = 1[425]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=484]
14-235 ==> 135-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
235-273 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
273-484 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 203, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 33, 36, 87, 186, 213, 237, 405
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1134 = CCAGCGATCAACGGGA-1

using 64 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 59]
surviving nonsolo ucounts = 1[59]
ids = [0]

====================================================================================

UMI info for barcode CCAGCGATCAACGGGA-1 contig 1 = AGTCTCAGTC...
umi CATAACCACT = 61 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=479]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
405-479 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQSYSTPSF at 347, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 58
start codons at 20, 26, 82, 95, 231, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1137 = CCAGCGATCAGCATGT-1

using 285 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 281]
surviving nonsolo ucounts = 1[281]
ids = [3]

====================================================================================

UMI info for barcode CCAGCGATCAGCATGT-1 contig 1 = GATCAGGACT...
umi CTAATAGGCC = 278 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTPPTF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1147 = CCAGCGATCCTCGCAT-1

using 20 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1149 = CCAGCGATCGAGCCCA-1

using 286 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 281]
surviving nonsolo ucounts = 1[281]
ids = [2]

====================================================================================

UMI info for barcode CCAGCGATCGAGCCCA-1 contig 1 = GGGGGGGTCT...
umi GTGATACCAT = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-569 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 41, 198, 242, 249, 252, 561
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1156 = CCAGCGATCGGCTTGG-1

using 452 reads

====================================================================================

graph has 194 edges initially, 30 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 6, 146, 295]
surviving nonsolo ucounts = 2[146, 295]
ids = [3, 2]

====================================================================================

UMI info for barcode CCAGCGATCGGCTTGG-1 contig 1 = GAGTCAGACT...
umi CCTGGTGGGT = 297 reads: +388 validated

UMI info for barcode CCAGCGATCGGCTTGG-1 contig 2 = GGAATCAGTC...
umi GGATGACTTT = 147 reads: +22 -1XX +365 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false

TIG 2[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1159 = CCAGCGATCTAACTGG-1

using 254 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 249]
surviving nonsolo ucounts = 1[249]
ids = [2]

====================================================================================

UMI info for barcode CCAGCGATCTAACTGG-1 contig 1 = AGGAATCAGT...
umi CCCGTCGGTG = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1165 = CCAGCGATCTTGACGA-1

using 209 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[5, 198]
surviving nonsolo ucounts = 1[198]
ids = [7]

====================================================================================

UMI info for barcode CCAGCGATCTTGACGA-1 contig 1 = TCAGCTGTGG...
umi TCGCCATCCT = 187 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=574]
0-43 ==> 8-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
43-399 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
437-574 ==> 0-137 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDTSLSGSNVF at 367, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 43, 197, 200, 251, 350, 377, 401, 569
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1171 = CCATGTCAGACATAAC-1

using 204 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=402]
3-217 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
217-255 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
255-402 ==> 0-147 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 185, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 15, 18, 69, 168, 195, 219, 387
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1174 = CCATGTCAGATCTGCT-1

using 341 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode CCATGTCAGATCTGCT-1 contig 1 = GGAGAAGAGC...
umi CCACAATTTG = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-482 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPMYTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 36, 85, 244, 343, 384, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1179 = CCATGTCAGCTAGTTC-1

using 1057 reads

====================================================================================

graph has 332 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 315, 733]
surviving nonsolo ucounts = 2[315, 733]
ids = [2, 7]

====================================================================================

UMI info for barcode CCATGTCAGCTAGTTC-1 contig 1 = GAATCAGTCC...
umi GTAACTCCGT = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-490 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1212 = CCATGTCCACATTAGC-1

using 366 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[46, 318]
surviving nonsolo ucounts = 2[46, 318]
ids = [0, 1]

====================================================================================

UMI info for barcode CCATGTCCACATTAGC-1 contig 1 = GAACTGCTCA...
umi CCCGCAGCGA = 316 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-30 ==> 67-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
30-375 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
380-412 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNNWPKTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1221 = CCATGTCCACTTAAGC-1

using 28 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1224 = CCATGTCCAGACTCGC-1

using 179 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[6^2, 165]
surviving nonsolo ucounts = 1[165]
ids = [4]

====================================================================================

UMI info for barcode CCATGTCCAGACTCGC-1 contig 1 = GATACTTTCT...
umi TTGACCTACA = 161 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=552]
38-386 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=43)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=7)
486-552 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CTREVRSSYVWGTHIRAEHCFDIW at 383, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 38, 82, 305, 467, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1226 = CCATGTCCAGCATGAG-1

using 208 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode CCATGTCCAGCATGAG-1 contig 1 = GGAACTGCTC...
umi TCCCCAGTCT = 188 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=492]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-413 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
413-492 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNWPQTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 31, 236, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1238 = CCATGTCCATAGAAAC-1

using 1203 reads

====================================================================================

graph has 1728 edges initially, 6 edges after simplification

total ucounts = 524
nonsolo ucounts = 243[2^101, 3^46, 4^30, 5^26, 6^13, 7^10, 8^5, 9^2, 10^2, 11^2, 12^3, 13, 16, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1243 = CCATGTCCATCGGTTA-1

using 86 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 24
nonsolo ucounts = 18[2^5, 3^3, 4^3, 5, 6^3, 8, 9^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1247 = CCATGTCCATTCCTGC-1

using 30 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1257 = CCATGTCGTAGTGAAT-1

using 199 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^3, 4, 5, 6, 9, 164]
surviving nonsolo ucounts = 1[164]
ids = [7]

====================================================================================

UMI info for barcode CCATGTCGTAGTGAAT-1 contig 1 = GATCAGGACT...
umi GATACGGAGG = 164 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=16)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CMQDLQTPYTF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 30, 63, 99, 292, 334, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1269 = CCATGTCGTCGCTTCT-1

using 3822 reads

====================================================================================

graph has 1787 edges initially, 32 edges after simplification

total ucounts = 438
nonsolo ucounts = 177[2^68, 3^33, 4^22, 5^11, 6^10, 7^4, 8^3, 9^2, 10^2, 12, 26, 47, 59, 70, 75, 84, 97, 123, 148, 151^2, 161, 162, 164, 173, 189, 191, 208, 219, 252, 270]
surviving nonsolo ucounts = 19[26, 59, 70, 75, 84, 123, 148, 151^2, 161, 162, 164, 173, 189, 191, 208, 219, 252, 270]
ids = [433, 159, 94, 178, 412, 434, 36, 162, 381, 301, ...]

====================================================================================

UMI info for barcode CCATGTCGTCGCTTCT-1 contig 1 = ATACTTTCTG...
umi CCGTGCATCT = 140 reads: +424 validated
umi CTATTATCTC = 183 reads: +424 validated
umi TCTATGAGTG = 144 reads: +424 validated

UMI info for barcode CCATGTCGTCGCTTCT-1 contig 2 = CTGGGCCTCA...
umi AACAAACCGC = 266 reads: -20 +356 non-validated
umi ACATGATCAG = 207 reads: +376 validated
umi ACATGCGTAT = 149 reads: +376 validated
umi ACCTAAGCCG = 191 reads: +376 validated
umi AGTCGTGCCC = 162 reads: +376 validated
umi ATGCATAGAG = 175 reads: +376 validated
umi ATGTAAACAC = 72 reads: +376 validated
umi CCGGGCTGGG = 59 reads: +376 validated
umi CGAGTTCGCA = 74 reads: +376 validated
umi CGGTTTCGAA = 164 reads: +376 validated
umi GCAATATTTT = 248 reads: +376 validated
umi GTCACTGTAC = 162 reads: +376 validated
umi TACCAGGTTT = 219 reads: +376 validated
umi TTAATATCGG = 83 reads: +376 validated
umi TTTATACCTT = 26 reads: -1 +375 non-validated
umi TTTATCCCTT = 122 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=567]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=18)
410-461 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
461-567 ==> 0-106 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 3 umis using 59 reads
cdr3 = CARGGYFGSGDGWFDPW at 379, score = 8 + 7
umis assigned: [162, 203, 381]
of which 3 are surviving nonsolos
reads assigned: 460
start codons at 16, 37, 81, 410, 515
confident = true

TIG 2[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-369 ==> 0-332 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=8)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 470 reads
cdr3 = CQAWDSNTGVF at 352, score = 6 + 8
umis assigned: [7, 35, 36, 41, 70, 90, 94, 159, 178, 186] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2359
start codons at 37, 42, 98, 185, 236, 331, 335
confident = true
now this is a cell
paired!

GACACGGCCATTTATTATTGTGCGAGAGGAGGATACTTTGGTTCGGGAGATGGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCGGGCCCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGTAACACTGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1273 = CCATGTCGTGAGTGAC-1

using 164 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [2]

====================================================================================

UMI info for barcode CCATGTCGTGAGTGAC-1 contig 1 = GAGGAATCAG...
umi AGTAGCCCAA = 1 reads: -246X +5 -1 +1 -4X +4 -2 +4 -1 +3 -1 +1 -1 +3 -2X +2 -1 +1 -2X +1 -4X +1 -2X +2 -1 +1 -1 +2 -88 invalidated
umi AGTAGCGCAT = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-474 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1278 = CCATGTCGTGGTAACG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1280 = CCATGTCGTGTGACGA-1

using 173 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[170]
surviving nonsolo ucounts = 1[170]
ids = [0]

====================================================================================

UMI info for barcode CCATGTCGTGTGACGA-1 contig 1 = AGGTTCCAGC...
umi CAGTGAGTGC = 162 reads: +415 validated
umi CAGTTAGAGC = 1 reads: +2 -1 +2 -1 +2 -2 +1 -1 +2 -3 +4 -1X +8 -1 +2 -1X +2 -379 invalidated

GOOD CONTIGS

TIG 1[bases=574]
0-58 ==> 87-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
58-408 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
423-473 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
473-574 ==> 0-101 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CARDFPGNYFTFDIW at 397, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 14, 58, 102, 182, 252, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1284 = CCATGTCGTTAGTGGG-1

using 537 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 534]
surviving nonsolo ucounts = 1[534]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1297 = CCATGTCTCAAGAAGT-1

using 401 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[400]
surviving nonsolo ucounts = 1[400]
ids = [1]

====================================================================================

UMI info for barcode CCATGTCTCAAGAAGT-1 contig 1 = AGCATCACAT...
umi TCTATGGGAG = 371 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=536]
0-61 ==> 0-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
61-414 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=2)
442-497 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
497-536 ==> 0-39 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARSQGYSSGWITYYYGMDVW at 403, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 61, 212, 259, 358, 454, 515
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1306 = CCATGTCTCAGGATCT-1

using 239 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [3]

====================================================================================

UMI info for barcode CCATGTCTCAGGATCT-1 contig 1 = AGCTCTGAGA...
umi GATACAATCT = 234 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=638]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-638 ==> 0-135 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1318 = CCATGTCTCCTTTCGG-1

using 283 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 277]
surviving nonsolo ucounts = 1[277]
ids = [1]

====================================================================================

UMI info for barcode CCATGTCTCCTTTCGG-1 contig 1 = GGGCTGCTTC...
umi CTTGGATTTA = 272 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=594]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=2)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-594 ==> 0-152 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 54 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 51, 205, 259, 358, 385, 406, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1319 = CCATGTCTCGAATGGG-1

using 329 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [3]

====================================================================================

UMI info for barcode CCATGTCTCGAATGGG-1 contig 1 = GGGAGAGCCC...
umi TAAGGTCCTT = 307 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=516]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
429-516 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CEQRNNWPLSF at 368, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 47, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1322 = CCATGTCTCGCGTAGC-1

using 166 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1333 = CCATGTCTCTCAAACG-1

using 568 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 6, 550]
surviving nonsolo ucounts = 1[550]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1349 = CCATTCGAGAGTAAGG-1

using 330 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [0]

====================================================================================

UMI info for barcode CCATTCGAGAGTAAGG-1 contig 1 = AGCTCTACCC...
umi CTCCTACATC = 330 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=587]
51-411 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
413-451 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
451-587 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQGTHWPPITF at 387, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 51, 84, 112, 120, 208, 370, 390, 493
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1351 = CCATTCGAGATGTGGC-1

using 440 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[437]
surviving nonsolo ucounts = 1[437]
ids = [1]

====================================================================================

UMI info for barcode CCATTCGAGATGTGGC-1 contig 1 = GGGAGGAACT...
umi CTGAAACCAG = 448 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=544]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-364 ==> 0-329 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQRGNTF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 436
start codons at 35, 240, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1359 = CCATTCGAGGACTGGT-1

using 221 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================

UMI info for barcode CCATTCGAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi GTGTTCGATA = 209 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=482]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-482 ==> 0-50 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1367 = CCATTCGAGTACGCGA-1

using 266 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 259]
surviving nonsolo ucounts = 1[259]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=484]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-484 ==> 12-40 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 54, 252, 257, 274, 318, 351
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1371 = CCATTCGAGTGCCAGA-1

using 540 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 213, 321]
surviving nonsolo ucounts = 3[3, 213, 321]
ids = [4, 1, 2]

====================================================================================

UMI info for barcode CCATTCGAGTGCCAGA-1 contig 1 = GAGCTGCTCA...
umi CCCACTTCTT = 305 reads: +388 validated
umi TGTCGTCACC = 3 reads: -146 +1 -3X +3 -1X +2 -1X +57 -161 +1 -1 +3 -1X +7 invalidated

UMI info for barcode CCATTCGAGTGCCAGA-1 contig 2 = GGGGGGTCTC...
umi AGAATAACGA = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPPATF at 354, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 304
start codons at 30, 238, 364, 460
confident = false

TIG 2[bases=460]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-460 ==> 0-32 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1378 = CCATTCGAGTTTGCGT-1

using 242 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 6, 228]
surviving nonsolo ucounts = 1[228]
ids = [8]

====================================================================================

UMI info for barcode CCATTCGAGTTTGCGT-1 contig 1 = AGCTTCAGCT...
umi TGCCGTAGCC = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-556 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1389 = CCATTCGCACTCAGGC-1

using 267 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [2]

====================================================================================

UMI info for barcode CCATTCGCACTCAGGC-1 contig 1 = GAAGAGCTGC...
umi CTCTCGTGTT = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-512 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQRYGGSPPSSF at 357, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 33, 244, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1390 = CCATTCGCACTTCTGC-1

using 17 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1394 = CCATTCGCAGCTCCGA-1

using 406 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[405]
surviving nonsolo ucounts = 1[405]
ids = [1]

====================================================================================

UMI info for barcode CCATTCGCAGCTCCGA-1 contig 1 = TGGAGAAGAG...
umi TGCACACAGG = 351 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-37 ==> 15-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
37-385 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
422-495 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQHYGSLPLTF at 361, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 37, 245, 371, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1404 = CCATTCGCATCAGTCA-1

using 263 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=452]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
419-452 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 33, 241, 367
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1416 = CCATTCGGTACAGTGG-1

using 582 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[574]
surviving nonsolo ucounts = 1[574]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=344]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-208 ==> 0-178 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
208-344 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 568
start codons at 30, 99, 195, 250
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1423 = CCATTCGGTCGCCATG-1

using 428 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 167, 256]
surviving nonsolo ucounts = 2[167, 256]
ids = [5, 3]

====================================================================================

UMI info for barcode CCATTCGGTCGCCATG-1 contig 1 = GGGACTGATC...
umi CTTCACAGGG = 256 reads: +394 validated
umi CTTTCACTGA = 169 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=13)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 52 reads
cdr3 = CMQAVQTRTF at 372, score = 9 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 417
start codons at 36, 69, 105, 193, 355, 375, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1426 = CCATTCGGTCTACCTC-1

using 109 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 11[2, 4^2, 6^2, 7, 10^2, 14, 21, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1429 = CCATTCGGTGCAGTAG-1

using 6 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1431 = CCATTCGGTTAAGAAC-1

using 241 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 229]
surviving nonsolo ucounts = 1[229]
ids = [2]

====================================================================================

UMI info for barcode CCATTCGGTTAAGAAC-1 contig 1 = ATCAGTCCCA...
umi CCCGGATATC = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1440 = CCATTCGTCACAATGC-1

using 548 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[6, 232, 304]
surviving nonsolo ucounts = 2[232, 304]
ids = [5, 2]

====================================================================================

UMI info for barcode CCATTCGTCACAATGC-1 contig 1 = ATATCAATGC...
umi GATCACCTAA = 302 reads: +385 validated

UMI info for barcode CCATTCGTCACAATGC-1 contig 2 = GCTGGGGTCT...
umi TGAATTGGAT = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=582]
0-61 ==> 36-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
61-406 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
407-446 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
446-582 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNNWPPDTF at 382, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 6, 61, 130, 266, 488
confident = false

TIG 2[bases=571]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=23)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-571 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYAGNNNLLF at 365, score = 6 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 41, 177, 198, 249, 345, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1453 = CCATTCGTCCCTAATT-1

using 865 reads

====================================================================================

graph has 332 edges initially, 12 edges after simplification

total ucounts = 266
nonsolo ucounts = 175[2^62, 3^48, 4^31, 5^18, 6^9, 7^3, 8, 9, 12, 188]
surviving nonsolo ucounts = 1[188]
ids = [196]

====================================================================================

UMI info for barcode CCATTCGTCCCTAATT-1 contig 1 = ACTTTCTGAG...
umi TAGCTAACGG = 186 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=489]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-489 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [196]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 35, 79, 159, 229, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1458 = CCATTCGTCCGGGTGT-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1460 = CCATTCGTCCTCATTA-1

using 293 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 277]
surviving nonsolo ucounts = 1[277]
ids = [8]

====================================================================================

UMI info for barcode CCATTCGTCCTCATTA-1 contig 1 = ATAACAACCA...
umi TTATACGCTG = 234 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=486]
0-53 ==> 5-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
53-406 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
410-430 ==> 0-20 on |30|IGHD5-24|D-REGION| [len=20] (mis=3)
429-477 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 21 reads
cdr3 = CARDSMEMATIPFFDYW at 395, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 53, 204, 251, 350, 410, 416
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1463 = CCATTCGTCGACCAGC-1

using 3431 reads

====================================================================================

graph has 2161 edges initially, 16 edges after simplification

total ucounts = 468
nonsolo ucounts = 179[2^73, 3^38, 4^14, 5^10, 6^13, 7^6, 8^4, 9^2, 10, 11, 12, 14^2, 17, 75, 76, 128, 132, 141, 150, 153, 218, 234, 250, 279, 345, 347]
surviving nonsolo ucounts = 11[76, 132, 141, 150, 153, 218, 234, 250, 279, 345, 347]
ids = [262, 205, 302, 301, 128, 149, 445, 381, 52, 389, ...]

====================================================================================

UMI info for barcode CCATTCGTCGACCAGC-1 contig 1 = GATCAGGACT...
umi GTCCAGGTAC = 143 reads: +397 validated

UMI info for barcode CCATTCGTCGACCAGC-1 contig 2 = TTGGGACCCA...
umi ACTAGTTTGT = 286 reads: +418 validated
umi CAAGACCACA = 153 reads: +418 validated
umi CAGTTCACCT = 218 reads: +418 validated
umi CTAGAATACA = 132 reads: +418 validated
umi GAGTATGAGC = 354 reads: +418 validated
umi GCAACCACTG = 78 reads: +402 -1 +1 -14 non-validated
umi GTCCCTTAAC = 142 reads: +365 -1 +52 non-validated
umi TCGTGCGCCC = 252 reads: +418 validated
umi TCTTGTGCTT = 349 reads: +418 validated
umi TTCTTCAGCA = 231 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=469]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
427-469 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQGLQSPRTF at 366, score = 9 + 8
umis assigned: [301]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 30, 63, 99, 187, 349, 369
confident = true

TIG 2[bases=548]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=21)
409-429 ==> 0-20 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
442-477 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 163 reads
cdr3 = CARTYCSGGTCYDGW at 401, score = 8 + 7
umis assigned: [52, 128, 149, 205, 253, 262, 302, 381, 389, 445]
of which 10 are surviving nonsolos
reads assigned: 2154
start codons at 59, 210, 257, 262, 279, 323, 356, 435, 438
confident = true
now this is a cell
paired!

TCTGACGACACGGCCGTATATTACTGTGCGAGGACATATTGTAGTGGTGGTACCTGTTATGATGGCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAA <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTCTACAAAGCCCTCGCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1466 = CCATTCGTCGCGGATC-1

using 576 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 566]
surviving nonsolo ucounts = 1[566]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1468 = CCATTCGTCTCTGCTG-1

using 1067 reads

====================================================================================

graph has 316 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 449, 611]
surviving nonsolo ucounts = 2[449, 611]
ids = [0, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=422]
5-169 ==> 189-353 on |174|IGHV3/OR16-12|L-REGION+V-REGION| [len=353] (mis=29)
47-169 ==> 231-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=5)
193-240 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
240-422 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 158, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 606
start codons at 119, 197
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1473 = CCATTCGTCTGGGCCA-1

using 64 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 55]
surviving nonsolo ucounts = 1[55]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1474 = CCATTCGTCTTACCTA-1

using 158 reads

====================================================================================

graph has 63 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

UMI info for barcode CCATTCGTCTTACCTA-1 contig 1 = TGAGCGCAGA...
umi CTCCCCCCAC = 149 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-509 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1476 = CCATTCGTCTTCTGGC-1

using 210 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 206]
surviving nonsolo ucounts = 1[206]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1481 = CCCAATCAGACAAGCC-1

using 318 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================

UMI info for barcode CCCAATCAGACAAGCC-1 contig 1 = GGGACTGATC...
umi TGTTTCATCA = 311 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
433-510 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CMQALQTPPTF at 372, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1483 = CCCAATCAGATCCCAT-1

using 608 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 598]
surviving nonsolo ucounts = 1[598]
ids = [5]

====================================================================================

UMI info for barcode CCCAATCAGATCCCAT-1 contig 1 = GTCAGTCCCA...
umi TCCCGTTTTT = 600 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CQQYDDLPITF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 594
start codons at 23, 29, 85, 98, 360, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1485 = CCCAATCAGATCTGAA-1

using 201 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 198]
surviving nonsolo ucounts = 1[198]
ids = [1]

====================================================================================

UMI info for barcode CCCAATCAGATCTGAA-1 contig 1 = GCTCTGCTTC...
umi TTGGTCGTTG = 188 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=498]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-498 ==> 0-53 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1487 = CCCAATCAGCAGCGTA-1

using 85 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 77]
surviving nonsolo ucounts = 1[77]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=448]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=16)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 70
start codons at 47, 201, 351, 376, 381
confident = false
not full
full length stopped transcript of length 448
frameshifted full length stopped transcript of length 448
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1503 = CCCAATCAGGGTCGAT-1

using 210 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 202]
surviving nonsolo ucounts = 1[202]
ids = [5]

====================================================================================

UMI info for barcode CCCAATCAGGGTCGAT-1 contig 1 = GCTCTGCTTC...
umi GAGCTGGTTT = 1 reads: +3 -1 +1 -1 +1 -1 +5 -1X +3 -2 +1 -1 +8 -4X +4 -1 +2 -354 invalidated
umi GCGCTGGTTG = 203 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=541]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-541 ==> 0-96 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3, 5]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1504 = CCCAATCAGGTGTTAA-1

using 307 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode CCCAATCAGGTGTTAA-1 contig 1 = GAGCTGCTCA...
umi ACTATTTCTT = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-502 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 30, 79, 238, 337, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1505 = CCCAATCAGTAATCCC-1

using 454 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[453]
surviving nonsolo ucounts = 1[453]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1514 = CCCAATCAGTGGTAGC-1

using 114 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 7, 101]
surviving nonsolo ucounts = 1[101]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1516 = CCCAATCAGTTAACGA-1

using 114 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[108]
surviving nonsolo ucounts = 1[108]
ids = [4]

====================================================================================

UMI info for barcode CCCAATCAGTTAACGA-1 contig 1 = GGGGATCAGT...
umi TCATTTGGAC = 107 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-495 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQHKSYPFTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1521 = CCCAATCCAAGCTGAG-1

using 749 reads

====================================================================================

graph has 421 edges initially, 6 edges after simplification

total ucounts = 81
nonsolo ucounts = 24[2^13, 3^2, 4^2, 6^3, 7, 12, 277, 338]
surviving nonsolo ucounts = 3[12, 277, 338]
ids = [55, 53, 31]

====================================================================================

UMI info for barcode CCCAATCCAAGCTGAG-1 contig 1 = GAGCTCTGGG...
umi CGCATCTTGT = 318 reads: +418 validated

UMI info for barcode CCCAATCCAAGCTGAG-1 contig 2 = GCTGTGCTGT...
umi GGTACCAACC = 275 reads: +382 validated
umi GGTCCAGGAG = 11 reads: -47 +63 -6 +147 -49 +59 -11 non-validated

GOOD CONTIGS

TIG 1[bases=512]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=1)
436-455 ==> 0-19 on |26|IGHD4-23|D-REGION| [len=19] (mis=2)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 15 reads
cdr3 = CARTDDYGGNGFDYW at 422, score = 9 + 7
umis assigned: [31]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 435
confident = false

TIG 2[bases=460]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
425-460 ==> 0-35 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSADSSGTYWVF at 358, score = 8 + 8
umis assigned: [53, 55]
of which 2 are surviving nonsolos
reads assigned: 282
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1522 = CCCAATCCAAGGACTG-1

using 270 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCCAAGGACTG-1 contig 1 = AGTTAGGACC...
umi TTTAATTAGC = 253 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=507]
0-21 ==> 31-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
21-67 ==> 0-46 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
73-375 ==> 46-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-507 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPGTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 21, 361, 454
confident = false
see insertion of CAGTCT at pos 46 on |283|IGKV3-20|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1537 = CCCAATCCACTTCGAA-1

using 748 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 246, 489]
surviving nonsolo ucounts = 2[246, 489]
ids = [5, 10]

====================================================================================

UMI info for barcode CCCAATCCACTTCGAA-1 contig 1 = AGCTTCAGCT...
umi CTTCTGGGGA = 243 reads: +388 validated
umi TCGGGCAATC = 485 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=594]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-594 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5, 10]
of which 2 are surviving nonsolos
reads assigned: 720
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1539 = CCCAATCCAGACGCTC-1

using 104 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 100]
surviving nonsolo ucounts = 1[100]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1543 = CCCAATCCAGCTATTG-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1544 = CCCAATCCAGCTGCAC-1

using 6575 reads

====================================================================================

graph has 4552 edges initially, 76 edges after simplification

total ucounts = 728
nonsolo ucounts = 467[2^98, 3^69, 4^49, 5^37, 6^40, 7^21, 8^22, 9^19, 10^20, 11^18, 12^18, 13^14, 14^10, 15^5, 16^4, 17^2, 18^2, 20, 21^2, 31, 40, 56^2, 181, 205, 225, 229, 233, 257, 266, 273, 297, 311, 325, 603]
surviving nonsolo ucounts = 14[40, 56, 181, 205, 225, 229, 233, 257, 266, 273, 297, 311, 325, 603]
ids = [382, 201, 58, 265, 2, 633, 273, 624, 345, 462, ...]

====================================================================================

UMI info for barcode CCCAATCCAGCTGCAC-1 contig 1 = GGAGTGCTGG...
umi AAACAACGAA = 1 reads: -388 non-validated
umi ACCAATAGAC = 182 reads: +388 validated
umi CAGGACTCAT = 56 reads: +388 validated
umi CGAAGTACTG = 204 reads: +388 validated
umi CGCATAGGCC = 234 reads: +388 validated
umi CGCTAATTCC = 312 reads: +388 validated
umi CTGGTAGTAC = 327 reads: +388 validated
umi CTTCCGTTGA = 5 reads: -353X +1 -3XX +17 -2XX +10 -1XX +1 invalidated
umi GTCCGTTACA = 277 reads: +388 validated
umi TATAAGCGCT = 298 reads: +388 validated
umi TGCAAGGTCA = 258 reads: +388 validated
umi TGCTAGTATG = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=645]
46-397 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
434-645 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 10 umis using 323 reads
cdr3 = CSSYTSSSTVRF at 370, score = 6 + 8
umis assigned: [2, 58, 201, 265, 273, 279, 333, 345, 462, 531] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2333
start codons at 46, 203, 254, 257
confident = true

REJECT CONTIGS

TIG 1[bases=582]
0-340 ==> 11-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=24)
359-422 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
422-582 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGGIPAPGNYYYHYMDVW at 331, score = 9 + 7
umis assigned: [130, 382]
of which 2 are surviving nonsolos
reads assigned: 634
start codons at 140, 206, 224, 286, 292, 379, 476
confident = false
VJ delta = 21
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1550 = CCCAATCCATAAGACA-1

using 14048 reads

====================================================================================

graph has 6028 edges initially, 86 edges after simplification

total ucounts = 782
nonsolo ucounts = 403[2^132, 3^61, 4^65, 5^27, 6^27, 7^12, 8^14, 9^5, 10^2, 11^5, 12, 13^3, 15, 16, 18, 20, 25, 57, 62, 98, 108, 120, 125, 134, 140, 143, 151, 170, 187, 191^2, 207, 210, 235, 239, 242, 247, 257, 258^2, 267, 273, 276^2, 277, 279, 285, 294, 295, 304, 336, 339, 343, 347, 349, 513, 545, 563, 623, 638, 752]
surviving nonsolo ucounts = 42[62, 98, 108, 120, 125, 134, 140, 143, 151, 170, 187, 191^2, 207, 210, 235, 239, 242, 247, 257, 258^2, 267, 273, 276^2, 277, 279, 285, 294, 295, 304, 339, 343, 347, 349, 513, 545, 563, 623, 638, 752]
ids = [135, 440, 513, 127, 402, 609, 221, 125, 220, 357, ...]

====================================================================================

UMI info for barcode CCCAATCCATAAGACA-1 contig 1 = CCAGCCCTGA...
umi CAAGCTCCTA = 207 reads: +430 validated
umi CACTTTTCTT = 121 reads: +430 validated
umi CAGTTCACAA = 62 reads: +418 -12 non-validated
umi CCCTCCATAG = 140 reads: +430 validated
umi CCCTTTCTGC = 189 reads: +353 -5XX +72 invalidated
umi CCGCCATTTC = 194 reads: +430 validated
umi CGACCATTGA = 277 reads: +430 validated
umi CTCACGTACT = 170 reads: +430 validated
umi GACCACCTCA = 240 reads: +430 validated
umi GCACTCACCC = 276 reads: +430 validated
umi TTAGCCTCCA = 298 reads: +429 -1X invalidated
umi TTCCTCACCC = 245 reads: +430 validated

UMI info for barcode CCCAATCCATAAGACA-1 contig 2 = GCTCTGCTTC...
umi ACCTATAGCA = 256 reads: +391 validated
umi AGACCAAGAG = 348 reads: +9 -1XX +381 invalidated
umi CAATAACATA = 260 reads: +391 validated
umi CACGCCGTGA = 494 reads: -211X +2 -2XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +16 -2XX +1 -1XX +20 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +5 -1XX +5 -1XX +32 -1XX +1 -1XX +2 -2XX +2 -3XX +2 -2XX +1 -4XX +1 -1XX +1 -5XX +1 -1XX +1 -1XX +18 -1XX +12 invalidated
umi CACTTACATT = 106 reads: -212 +1 -2XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +16 -2XX +1 -1XX +20 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +5 -1XX +5 -1XX +32 -1XX +1 -1XX +2 -2XX +2 -3XX +2 -2XX +1 -4XX +1 -1XX +1 -4XX +2 -1XX +1 -1XX +18 -1XX +12 invalidated
umi CATCCAAACC = 295 reads: +391 validated
umi CCCTCCAGCC = 158 reads: +93 -1X +297 invalidated
umi CCCTGACGTA = 208 reads: +391 validated
umi CGGAAGCTCC = 339 reads: -52X +339 invalidated
umi CTCGGCAATT = 309 reads: +391 validated
umi CTTCACTTTA = 123 reads: +391 validated
umi GCAATCGACA = 98 reads: +391 validated
umi GCATTATCTT = 189 reads: +391 validated
umi GGTCATTCAT = 265 reads: +391 validated
umi GTCCTTCGTT = 107 reads: +391 validated
umi GTTTATTAGC = 245 reads: +391 validated
umi TAAACGCTGC = 641 reads: +391 validated
umi TACCCCAGAG = 234 reads: +391 validated
umi TCGGGCAGTC = 399 reads: -211X +2 -2XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +16 -2XX +1 -1XX +20 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +5 -1XX +5 -1XX +32 -1XX +1 -1XX +2 -2XX +2 -3XX +2 -2XX +1 -4XX +1 -1XX +1 -5XX +1 -1XX +1 -1XX +18 -1XX +12 invalidated
umi TCTTCCATTA = 284 reads: +391 validated
umi TTCTACCCTC = 669 reads: -211X +2 -2XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +16 -2XX +1 -1XX +20 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +5 -1XX +5 -1XX +32 -1XX +1 -1XX +2 -2XX +2 -3XX +2 -2XX +1 -4XX +1 -1XX +1 -5XX +1 -1XX +1 -1XX +18 -1XX +12 invalidated
umi TTGACACCTC = 451 reads: -211X +2 -2XX +2 -2XX +1 -1XX +2 -1XX +1 -1XX +16 -2XX +1 -1XX +20 -1XX +1 -1XX +1 -1XX +8 -1XX +2 -1XX +5 -1XX +5 -1XX +32 -1XX +1 -1XX +2 -2XX +2 -3XX +2 -2XX +1 -4XX +1 -1XX +1 -5XX +1 -1XX +1 -1XX +18 -1XX +12 invalidated
umi TTTAACTACC = 280 reads: +391 validated
umi TTTTTTTTCC = 265 reads: +361 -2XX +1 -2XX +1 -2 +22 invalidated

GOOD CONTIGS

TIG 1[bases=652]
0-62 ==> 0-62 on |115|IGHV3-20|5'UTR| [len=62] (mis=2)
62-415 ==> 0-353 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=32)
441-492 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
492-652 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 10 umis using 187 reads
cdr3 = CAKNQWVRRSLYNYGMDVW at 404, score = 9 + 7
umis assigned: [99, 127, 135, 221, 231, 233, 301, 357, 424, 444] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2371
start codons at 62, 207, 213, 218, 290, 297, 365, 449, 546
confident = true

TIG 2[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 19 umis using 857 reads
cdr3 = CQSYDSSLSGVIF at 375, score = 8 + 9
umis assigned: [38, 56, 100, 116, 125, 146, 220, 225, 312, 378] and 14 others
of which 24 are surviving nonsolos
reads assigned: 6905
start codons at 51, 205, 358, 385
confident = true

REJECT CONTIGS

TIG 1[bases=677]
1-146 ==> 5855-6000 on rc of segment after IGKV1-37 exon 1 [len=6000] (mis=0)
1-146 ==> 5855-6000 on segment before IGKV1D-37 exon 1 [len=6000] (mis=0)
67-194 ==> 5610-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=9)
146-198 ==> 0-52 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=0)
204-505 ==> 52-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=18)
504-541 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
541-677 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [48, 302, 314, 517, 609, 628, 700]
of which 6 are surviving nonsolos
reads assigned: 1929
start codons at 5, 57, 146, 152, 214, 462, 495, 583
confident = false
see insertion of CAGTCG at pos 52 on |251|IGKV1D-37|L-REGION+V-REGION|
did not find CDR3
now this is a cell
paired!

GCCTTGTATTATTGTGCAAAAAATCAGTGGGTACGTAGATCCCTCTATAACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTGTGATTTTCGGCGGAGGGACCAAGTTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1551 = CCCAATCCATACAGCT-1

using 104 reads

====================================================================================

graph has 82 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 13[2, 3^2, 4^2, 6, 7^2, 8, 13^2, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1554 = CCCAATCCATCGTCGG-1

using 275 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1556 = CCCAATCCATGCCCGA-1

using 102 reads

====================================================================================

graph has 114 edges initially, 6 edges after simplification

total ucounts = 22
nonsolo ucounts = 16[2^3, 3^2, 4^3, 7, 8^3, 9, 10, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1563 = CCCAATCGTAAACGCG-1

using 297 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 290]
surviving nonsolo ucounts = 1[290]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCGTAAACGCG-1 contig 1 = AGGAATCAGA...
umi AAGCTCCACT = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-481 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1573 = CCCAATCGTCACTTCC-1

using 388 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[386]
surviving nonsolo ucounts = 1[386]
ids = [2]

====================================================================================

UMI info for barcode CCCAATCGTCACTTCC-1 contig 1 = GAGAAGAGCT...
umi TCATGACCCA = 387 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
418-542 ==> 12-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPLVTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 383
start codons at 35, 243, 369, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1574 = CCCAATCGTCATCCCT-1

using 262 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[9, 249]
surviving nonsolo ucounts = 1[249]
ids = [3]

====================================================================================

UMI info for barcode CCCAATCGTCATCCCT-1 contig 1 = CTGGGCCTCA...
umi CTACTGCATC = 244 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=537]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-373 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-537 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQAWDSSSVVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1576 = CCCAATCGTCCGTTAA-1

using 2015 reads

====================================================================================

graph has 2694 edges initially, 38 edges after simplification

total ucounts = 860
nonsolo ucounts = 352[2^140, 3^90, 4^42, 5^25, 6^16, 7^13, 8^8, 9^6, 10, 11^3, 12^3, 13, 15, 17, 23, 212]
surviving nonsolo ucounts = 2[2, 212]
ids = [517, 523]

====================================================================================

UMI info for barcode CCCAATCGTCCGTTAA-1 contig 1 = AGTCTGGGCC...
umi GGCATATTCA = 1 reads: -188X +1 -1 +15 -2 +1 -3X +1 -1 +1 -1 +1 -1 +3 -3X +3 -1X +1 -1 +2 -1 +1 -2X +1 -1X +5 -143 invalidated
umi GGCTTATTGA = 210 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=566]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-383 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-566 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWDSSSDPYVVF at 355, score = 8 + 8
umis assigned: [519, 523]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 40, 101, 242, 338, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1578 = CCCAATCGTCGAACAG-1

using 87 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 4, 77]
surviving nonsolo ucounts = 1[77]
ids = [3]

====================================================================================

UMI info for barcode CCCAATCGTCGAACAG-1 contig 1 = AGGAACTGCT...
umi TCAGGATATG = 70 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=414]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 9 reads
cdr3 = CQQRDIWPWTF at 353, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 32, 237, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1589 = CCCAATCGTTAGATGA-1

using 41 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1590 = CCCAATCGTTCCCGAG-1

using 192 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [1]

====================================================================================

UMI info for barcode CCCAATCGTTCCCGAG-1 contig 1 = TATATGAGGA...
umi GTGAGTTCTG = 182 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=533]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
458-533 ==> 0-75 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 370, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 3, 25, 69, 248, 251, 254, 340, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1597 = CCCAATCTCACATAGC-1

using 41 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1604 = CCCAATCTCATTCACT-1

using 87 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2, 7^3, 8, 9, 12, 13, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1611 = CCCAATCTCCGAATGT-1

using 88 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^2, 3^3, 13, 15, 16, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1614 = CCCAATCTCCTATTCA-1

using 304 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCTCCTATTCA-1 contig 1 = TGGGGAGACT...
umi ATAACATTCC = 294 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=495]
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=15)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-495 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQHYNSYSPYTF at 352, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 25, 31, 100, 236, 239, 332, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1615 = CCCAATCTCGACAGCC-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1618 = CCCAATCTCGCATGGC-1

using 301 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode CCCAATCTCGCATGGC-1 contig 1 = GGGGGGTCTC...
umi TCGGACTCGT = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-535 ==> 0-107 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1619 = CCCAATCTCGCCAGCA-1

using 681 reads

====================================================================================

graph has 296 edges initially, 24 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 315, 358]
surviving nonsolo ucounts = 2[315, 358]
ids = [5, 4]

====================================================================================

UMI info for barcode CCCAATCTCGCCAGCA-1 contig 1 = GGAGTCAGAC...
umi GGCGATGCGT = 140 reads: +55 -2XX +4 -1XX +5 -1XX +15 -1XX +3 -4XX +1 -1XX +9 -3XX +23 -1XX +5 -1XX +6 -1XX +2 -1XX +2 -2XX +2 -2XX +1 -2XX +2 -1XX +5 -26 +4 -1XX +9 -1XX +3 -1XX +3 -1XX +4 -1XX +4 -1XX +28 -1XX +17 -1XX +16 -28X +9 -1XX +8 -2XX +2 -1XX +2 -1XX +1 -2XX +1 -2XX +2 -1XX +22 -1XX +2 -2XX +6 invalidated
umi GTATATACCA = 296 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=484]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-484 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYYSYTWTF at 353, score = 9 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 427
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1620 = CCCAATCTCGCCTGTT-1

using 358 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[358]
surviving nonsolo ucounts = 1[358]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCTCGCCTGTT-1 contig 1 = AGAAGAGCTG...
umi CATTTGTGCT = 336 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=463]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-370 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
416-463 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYRNSITF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 34, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1623 = CCCAATCTCGTCTGAA-1

using 394 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2^4, 3, 4, 19, 348]
surviving nonsolo ucounts = 1[348]
ids = [8]

====================================================================================

UMI info for barcode CCCAATCTCGTCTGAA-1 contig 1 = GAAGAGCTGC...
umi GCAGATGCGC = 338 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-496 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPRVTF at 357, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1625 = CCCAATCTCGTTACGA-1

using 220 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 216]
surviving nonsolo ucounts = 1[216]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=489]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-489 ==> 12-45 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 54, 252, 257, 274, 318, 351
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1627 = CCCAATCTCGTTTGCC-1

using 389 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[388]
surviving nonsolo ucounts = 1[388]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCTCGTTTGCC-1 contig 1 = GAAGAGCTGC...
umi AACATATTAT = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
421-500 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 75 reads
cdr3 = CQQYGSSPPFTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1629 = CCCAATCTCTAGCACA-1

using 318 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1636 = CCCAATCTCTGACCTC-1

using 1587 reads

====================================================================================

graph has 1854 edges initially, 4 edges after simplification

total ucounts = 473
nonsolo ucounts = 210[2^93, 3^56, 4^23, 5^10, 6^6, 7^7, 8^6, 9^4, 10, 13, 17, 269, 350]
surviving nonsolo ucounts = 2[269, 350]
ids = [320, 230]

====================================================================================

UMI info for barcode CCCAATCTCTGACCTC-1 contig 1 = AGCTTCAGCT...
umi CTGGGGGTTC = 347 reads: +388 validated
umi GTGGTTCTCG = 270 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=12)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
434-547 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 78 reads
cdr3 = CAAWDGSLSGPVF at 367, score = 7 + 8
umis assigned: [230, 320]
of which 2 are surviving nonsolos
reads assigned: 606
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1638 = CCCAATCTCTGCCAGG-1

using 256 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[256]
surviving nonsolo ucounts = 1[256]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1641 = CCCAATCTCTGGTTCC-1

using 306 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 296]
surviving nonsolo ucounts = 1[296]
ids = [0]

====================================================================================

UMI info for barcode CCCAATCTCTGGTTCC-1 contig 1 = GAGCTCTGGG...
umi ACTATTCCTC = 291 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=533]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=6)
471-519 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 13 reads
cdr3 = CAKSGSGSLITKPRHPHGVDYW at 422, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 80, 231, 236, 294, 297, 315, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1644 = CCCAATCTCTTCGGTC-1

using 324 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 13[2^2, 3, 4, 5, 6^3, 7^2, 9, 14, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode CCCAATCTCTTCGGTC-1 contig 1 = AGCTTCAGCT...
umi AGGTCAGGCT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-498 ==> 0-63 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1647 = CCCAATCTCTTTACAC-1

using 38 reads

====================================================================================

graph has 28 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3^3, 4, 6, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1656 = CCCAGTTAGAGGGATA-1

using 274 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [0]

====================================================================================

UMI info for barcode CCCAGTTAGAGGGATA-1 contig 1 = AGGAATCAGT...
umi CCCAGCCAGT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-363 ==> 0-336 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYVTYPWTF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 27, 33, 102, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1677 = CCCAGTTAGGAGCGTT-1

using 350 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 343]
surviving nonsolo ucounts = 1[343]
ids = [1]

====================================================================================

UMI info for barcode CCCAGTTAGGAGCGTT-1 contig 1 = GCTTTCTGAG...
umi ACCAATCCTA = 336 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=545]
14-391 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=1)
411-474 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARRSRWFGELLYDYYYMDVW at 380, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 14, 23, 35, 79, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1684 = CCCAGTTAGGGTGTTG-1

using 73 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2^5, 3^3, 4, 5, 7^2, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1691 = CCCAGTTAGTACGCGA-1

using 776 reads

====================================================================================

graph has 1006 edges initially, 2 edges after simplification

total ucounts = 242
nonsolo ucounts = 124[2^55, 3^24, 4^16, 5^10, 6^3, 7^8, 8^2, 9, 10^3, 11, 222]
surviving nonsolo ucounts = 1[222]
ids = [64]

====================================================================================

UMI info for barcode CCCAGTTAGTACGCGA-1 contig 1 = GTCAGTCTCA...
umi ATCTAGATCA = 222 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQSYSTPPWTF at 350, score = 9 + 8
umis assigned: [64]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1692 = CCCAGTTAGTATCGAA-1

using 126 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 5, 6, 110]
surviving nonsolo ucounts = 1[110]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=430]
0-345 ==> 6-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
344-382 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
382-430 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 321, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 0, 69, 205, 424
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1694 = CCCAGTTAGTCAATAG-1

using 26 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1699 = CCCAGTTAGTGCGTGA-1

using 21 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1705 = CCCAGTTAGTTCCACA-1

using 329 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 324]
surviving nonsolo ucounts = 1[324]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
0-32 ==> 5968-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=1)
13-83 ==> 8897-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
13-83 ==> 8906-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
13-83 ==> 8905-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=23)
386-414 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSYPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 26, 32, 88, 101, 237, 456
confident = false
not full
full length stopped transcript of length 550
frameshifted full length stopped transcript of length 550
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1706 = CCCAGTTAGTTGTAGA-1

using 335 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 5, 317]
surviving nonsolo ucounts = 1[317]
ids = [5]

====================================================================================

UMI info for barcode CCCAGTTAGTTGTAGA-1 contig 1 = GGAGTCAGAC...
umi TAATTTATTA = 311 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=500]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-500 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1712 = CCCAGTTCAAGCGTAG-1

using 175 reads

====================================================================================

graph has 69 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[171]
surviving nonsolo ucounts = 1[171]
ids = [4]

====================================================================================

UMI info for barcode CCCAGTTCAAGCGTAG-1 contig 1 = CTGGGCCTCA...
umi TTTATATTTG = 167 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=529]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
416-529 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQAWDSTTDWVF at 352, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1723 = CCCAGTTCACATCTTT-1

using 819 reads

====================================================================================

graph has 270 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^5, 3, 196, 602]
surviving nonsolo ucounts = 2[196, 602]
ids = [5, 10]

====================================================================================

UMI info for barcode CCCAGTTCACATCTTT-1 contig 1 = TGGGAGGAAT...
umi CTGGACCCCT = 199 reads: +388 validated
umi TCGTCGGACA = 602 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 126 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5, 10]
of which 2 are surviving nonsolos
reads assigned: 790
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1724 = CCCAGTTCACCAGGTC-1

using 79 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 21
nonsolo ucounts = 13[2^2, 4^3, 5^2, 6^3, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1737 = CCCAGTTCAGCCTGTG-1

using 28 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1741 = CCCAGTTCAGCTGTAT-1

using 350 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 338]
surviving nonsolo ucounts = 1[338]
ids = [2]

====================================================================================

UMI info for barcode CCCAGTTCAGCTGTAT-1 contig 1 = GATGCTTTCT...
umi GCATTCATGT = 297 reads: +469 validated

GOOD CONTIGS

TIG 1[bases=494]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=2)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGGSGKSRGSVVLSSYYYFDYW at 383, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 1, 17, 26, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1743 = CCCAGTTCATACGCCG-1

using 273 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 4, 260]
surviving nonsolo ucounts = 1[260]
ids = [4]

====================================================================================

UMI info for barcode CCCAGTTCATACGCCG-1 contig 1 = AGGAATCAGT...
umi CCTTGGGAGA = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1745 = CCCAGTTCATAGACTC-1

using 381 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 373]
surviving nonsolo ucounts = 1[373]
ids = [1]

====================================================================================

UMI info for barcode CCCAGTTCATAGACTC-1 contig 1 = GGAGACTCAG...
umi ATAGAACCAG = 380 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
22-373 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYYTFSHTF at 349, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 22, 28, 84, 97, 180, 233, 236, 329, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1746 = CCCAGTTCATCCGTGG-1

using 325 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 319]
surviving nonsolo ucounts = 1[319]
ids = [4]

====================================================================================

UMI info for barcode CCCAGTTCATCCGTGG-1 contig 1 = GGGGATCAGT...
umi TAGTAATATT = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1747 = CCCAGTTCATCCTTGC-1

using 3190 reads

====================================================================================

graph has 785 edges initially, 4 edges after simplification

total ucounts = 28
nonsolo ucounts = 13[2^3, 3, 5, 8, 9, 228, 251, 262, 454, 940, 1009]
surviving nonsolo ucounts = 6[228, 251, 262, 454, 940, 1009]
ids = [9, 17, 11, 2, 20, 13]

====================================================================================

UMI info for barcode CCCAGTTCATCCTTGC-1 contig 1 = AGCTTCAGCT...
umi GAGCAAATAC = 229 reads: +388 validated
umi GCTGGGCTTT = 265 reads: +388 validated
umi GGCTACACGA = 1012 reads: -324 +1 -2X +61 invalidated
umi TAACCACCTG = 255 reads: +388 validated
umi TACGCCTACT = 953 reads: -245X +48 -1XX +94 invalidated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 126 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [9, 11, 13, 17, 20]
of which 5 are surviving nonsolos
reads assigned: 2667
start codons at 47, 201, 351, 376, 381
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1754 = CCCAGTTCATGTTCCC-1

using 162 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 157]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1756 = CCCAGTTCATTCTTAC-1

using 1562 reads

====================================================================================

graph has 2354 edges initially, 14 edges after simplification

total ucounts = 664
nonsolo ucounts = 351[2^143, 3^72, 4^50, 5^37, 6^24, 7^14, 8^2, 9^4, 10, 11, 12^2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1760 = CCCAGTTGTAAGGGAA-1

using 1021 reads

====================================================================================

graph has 1420 edges initially, 20 edges after simplification

total ucounts = 412
nonsolo ucounts = 202[2^75, 3^42, 4^26, 5^19, 6^12, 7^9, 8^4, 9^4, 10^5, 11, 12^2, 13, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1763 = CCCAGTTGTACCGTTA-1

using 574 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 562]
surviving nonsolo ucounts = 1[562]
ids = [3]

====================================================================================

UMI info for barcode CCCAGTTGTACCGTTA-1 contig 1 = GAGGAATCAG...
umi GTGCCTGCCT = 566 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 557
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1764 = CCCAGTTGTACCTACA-1

using 233 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode CCCAGTTGTACCTACA-1 contig 1 = GGGGGTCTCA...
umi CATACGGGTC = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
39-400 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-570 ==> 0-143 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CSSYTSSSTLVF at 363, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 39, 196, 240, 247, 250, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1772 = CCCAGTTGTATCGCAT-1

using 434 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[433]
surviving nonsolo ucounts = 1[433]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=471]
17-295 ==> 67-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
296-335 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
335-471 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYNWPPYTF at 271, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 426
start codons at 19, 155, 377
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1773 = CCCAGTTGTATGAATG-1

using 387 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 385]
surviving nonsolo ucounts = 1[385]
ids = [1]

====================================================================================

UMI info for barcode CCCAGTTGTATGAATG-1 contig 1 = ACTTTCTGAG...
umi TTCAACGGTC = 386 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
411-453 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARDGGSGSYYSLDVW at 374, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 35, 79, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1793 = CCCAGTTGTGAAAGAG-1

using 2675 reads

====================================================================================

graph has 1798 edges initially, 32 edges after simplification

total ucounts = 276
nonsolo ucounts = 150[2^37, 3^27, 4^29, 5^19, 6^9, 7^4, 8^6, 9^4, 10, 11, 12^3, 18, 41, 58, 138, 222, 223, 248, 304, 315, 393]
surviving nonsolo ucounts = 7[138, 222, 223, 248, 304, 315, 393]
ids = [101, 196, 125, 98, 234, 153, 163]

====================================================================================

UMI info for barcode CCCAGTTGTGAAAGAG-1 contig 1 = AGGAGTCAGA...
umi CGTATATTGG = 244 reads: +388 validated
umi CGTCCCGATA = 141 reads: +388 validated
umi GCATGGAATT = 320 reads: +388 validated
umi TAGCCATGCG = 224 reads: +388 validated
umi TGAGTATCCA = 305 reads: +388 validated

UMI info for barcode CCCAGTTGTGAAAGAG-1 contig 2 = GAGTCTCCCT...
umi CTGGGCGAAA = 220 reads: +418 validated
umi GGGAACATCT = 376 reads: -385 +2 -5X +1 -3XX +1 -1XX +1 -3XX +1 -6XX +1 -3XX +2 -2XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 190 reads
cdr3 = CQQAHSFPLTF at 354, score = 9 + 9
umis assigned: [98, 101, 153, 196, 234]
of which 5 are surviving nonsolos
reads assigned: 1209
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=636]
0-58 ==> 1-59 on |200|IGHV5-51|5'UTR| [len=59] (mis=0)
58-335 ==> 0-277 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=20)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
476-636 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARRLQVAGHYFDLW at 400, score = 9 + 7
umis assigned: [125, 163]
of which 2 are surviving nonsolos
reads assigned: 590
start codons at 58, 145, 232, 256, 530
confident = true
now this is a cell
paired!

GCCTCGGACAGCGCCTTGTATTTCTGTGCGAGACGTTTACAAGTGGCTGGTCACTACTTTGACCTCTGGGGCCTGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTTTTGTCAACAGGCTCACAGTTTCCCTCTCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1811 = CCCAGTTGTTGCCTCT-1

using 192 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 4, 5, 174]
surviving nonsolo ucounts = 1[174]
ids = [9]

====================================================================================

UMI info for barcode CCCAGTTGTTGCCTCT-1 contig 1 = ACAAGAGGCA...
umi TACTCAGCTG = 162 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=579]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-370 ==> 0-339 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
425-579 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDGGQSASAVF at 355, score = 7 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 31, 185, 188, 239, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1822 = CCCAGTTTCACTATTC-1

using 919 reads

====================================================================================

graph has 1532 edges initially, 28 edges after simplification

total ucounts = 470
nonsolo ucounts = 190[2^81, 3^45, 4^30, 5^13, 6^9, 7^3, 8^5, 9, 10^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1826 = CCCAGTTTCAGCTTAG-1

using 87 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 13[2^2, 3^2, 4, 5, 6^2, 7^2, 9, 11, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1831 = CCCAGTTTCCAATGGT-1

using 6724 reads

====================================================================================

graph has 6368 edges initially, 84 edges after simplification

total ucounts = 1665
nonsolo ucounts = 788[2^330, 3^190, 4^111, 5^51, 6^27, 7^24, 8^17, 9^10, 10^4, 11, 12^4, 13^2, 14, 19, 22, 24, 47, 53, 119, 144, 192, 200, 202, 231, 266, 290, 464, 465, 485]
surviving nonsolo ucounts = 14[4, 5, 47, 53, 119, 144, 200, 202, 231, 266, 290, 464, 465, 485]
ids = [932, 1302, 537, 953, 340, 608, 280, 22, 947, 323, ...]

====================================================================================

UMI info for barcode CCCAGTTTCCAATGGT-1 contig 1 = GGCTGGGGTC...
umi ATCAACTAGG = 203 reads: +385 validated
umi ATGCTAGGAA = 264 reads: +385 validated
umi GCCTTGGTCG = 236 reads: +385 validated
umi GTGAAAGCGA = 294 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=638]
42-382 ==> 0-340 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=8)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 4 umis using 177 reads
cdr3 = CSSYTTTTTLF at 366, score = 7 + 8
umis assigned: [280, 323, 947, 1098]
of which 4 are surviving nonsolos
reads assigned: 976
start codons at 42, 199, 250, 253
confident = true

REJECT CONTIGS

TIG 1[bases=404]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
0-25 ==> 3160-3185 on rc of segment before IGHV7-34-1 exon 2 [len=3185] (mis=0)
4-34 ==> 1353-1383 on rc of segment before IGHV7-81 exon 2 [len=1396] (mis=1)
12-46 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
25-93 ==> 0-68 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
92-156 ==> 0-64 on rc of segment before IGHV4-34 exon 1 [len=83] (mis=0)
221-257 ==> 335-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3) [SHIFT!]
290-333 ==> 20-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
333-404 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [613, 1057]
of which 1 are surviving nonsolos
reads assigned: 497
start codons at 2, 25, 46, 90, 107, 115, 123, 128, 168, 290
confident = false
frameshifted full length stopped transcript of length 404
did not find CDR3

TIG 2[bases=398]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
0-35 ==> 4708-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-35 ==> 4692-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-35 ==> 3481-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-35 ==> 3550-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
35-216 ==> 0-181 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=10)
216-398 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
umis assigned: [22, 340, 537, 608, 672, 838, 932, 953]
of which 8 are surviving nonsolos
reads assigned: 1026
start codons at 35, 79
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1832 = CCCAGTTTCCACGAAT-1

using 772 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 4, 9, 748]
surviving nonsolo ucounts = 1[748]
ids = [10]

====================================================================================

UMI info for barcode CCCAGTTTCCACGAAT-1 contig 1 = GAGCTACAAC...
umi TTAGTCCCGT = 744 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 112 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 742
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1840 = CCCAGTTTCCTATTCA-1

using 268 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^3, 256]
surviving nonsolo ucounts = 1[256]
ids = [7]

====================================================================================

UMI info for barcode CCCAGTTTCCTATTCA-1 contig 1 = ATCAGTCCCA...
umi TTCACTGCGC = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-505 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1842 = CCCAGTTTCCTTGACC-1

using 27 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1849 = CCCAGTTTCGGAGGTA-1

using 13 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1851 = CCCAGTTTCGTAGGTT-1

using 1108 reads

====================================================================================

graph has 264 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 1096]
surviving nonsolo ucounts = 1[1096]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1852 = CCCAGTTTCGTTACAG-1

using 494 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[191, 301]
surviving nonsolo ucounts = 2[191, 301]
ids = [1, 3]

====================================================================================

UMI info for barcode CCCAGTTTCGTTACAG-1 contig 1 = AGCACTCAGG...
umi GGGCGCAGTA = 283 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=543]
0-22 ==> 29-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
22-362 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-543 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDKSLRGAVF at 346, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 22, 106, 179, 329, 356
confident = false

REJECT CONTIGS

TIG 1[bases=449]
0-76 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
31-391 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-449 ==> 0-19 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 351, score = 4 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 31, 64, 100, 151, 188, 350, 370
confident = false
not full
frameshifted full length stopped transcript of length 449
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1855 = CCCAGTTTCTAACGGT-1

using 13033 reads

====================================================================================

graph has 7737 edges initially, 68 edges after simplification

total ucounts = 1656
nonsolo ucounts = 803[2^312, 3^181, 4^121, 5^72, 6^30, 7^17, 8^13, 9^12, 10^2, 11^2, 12, 14, 15, 16, 19, 62, 108, 114, 143, 155, 178, 179, 195, 205, 212^2, 217, 219, 237, 255, 263, 266, 268, 281, 282, 291, 300, 301^2, 303, 306, 307, 309, 315, 328, 331, 340, 366, 379, 478, 533]
surviving nonsolo ucounts = 35[108, 114, 143, 155, 178, 179, 195, 205, 212^2, 217, 219, 237, 255, 263, 266, 268, 281, 282, 291, 300, 301^2, 303, 306, 307, 309, 315, 328, 331, 340, 366, 379, 478, 533]
ids = [402, 174, 209, 1319, 479, 173, 844, 465, 1444, 1599, ...]

====================================================================================

UMI info for barcode CCCAGTTTCTAACGGT-1 contig 1 = AGGAGTCAGA...
umi AAACCACCTC = 341 reads: +385 validated
umi AAACCAGCAG = 258 reads: +385 validated
umi AACCATGGGG = 315 reads: +385 validated
umi ACGGTCGCGT = 179 reads: +385 validated
umi ACGGTCGCTT = 114 reads: +385 validated
umi AGAATTGCTT = 143 reads: +385 validated
umi AGCCCAGGAG = 476 reads: -70 +315 non-validated
umi AGTCCATCAT = 369 reads: +385 validated
umi ATTGCATCTT = 109 reads: +385 validated
umi CACGCCCCGT = 257 reads: +385 validated
umi CACGTATAGG = 334 reads: +385 validated
umi CACTGCATAA = 277 reads: +385 validated
umi CGCTATAGAA = 335 reads: +385 validated
umi CGGGAGGCCA = 299 reads: +385 validated
umi CGGTCGGCAG = 303 reads: +385 validated
umi CTCCCGATTT = 311 reads: +385 validated
umi CTTGAAGGGA = 193 reads: +385 validated
umi CTTGGATGGT = 299 reads: +385 validated
umi GAAATTACTA = 214 reads: +385 validated
umi GCATCGTGCC = 238 reads: +385 validated
umi GCCTGGCCAG = 269 reads: +385 validated
umi GCGCAGCCGC = 308 reads: +385 validated
umi GGCCCAGATT = 284 reads: +385 validated
umi GTCTTGTTGG = 306 reads: +385 validated
umi TACGGTGGTC = 301 reads: +385 validated
umi TATAATCCCC = 221 reads: +385 validated
umi TCATTGGTTC = 559 reads: +385 validated
umi TCCGTAGCAT = 157 reads: +385 validated
umi TCGGATACCC = 380 reads: +385 validated
umi TGCAACCCTG = 212 reads: +385 validated
umi TTGGTTAGAT = 215 reads: +385 validated

UMI info for barcode CCCAGTTTCTAACGGT-1 contig 2 = ACTTGGTGAT...
umi AGGCGGTGGT = 261 reads: +433 validated
umi CAGCGCCGGG = 175 reads: +433 validated
umi TCCTCTATCA = 288 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 31 umis using 1330 reads
cdr3 = CQQYNSYWTF at 354, score = 8 + 8
umis assigned: [6, 7, 40, 173, 174, 209, 232, 275, 402, 459] and 21 others
of which 31 are surviving nonsolos
reads assigned: 8420
start codons at 27, 33, 89, 102, 334, 454
confident = true

TIG 2[bases=539]
0-35 ==> 44-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
35-388 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
397-428 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=2)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 57 reads
cdr3 = CARAAMTYYYDSSGYYFDYW at 377, score = 9 + 7
umis assigned: [253, 479, 1327]
of which 3 are surviving nonsolos
reads assigned: 719
start codons at 35, 186, 191, 338, 392, 405
confident = true
now this is a cell
paired!

GTTTATTACTGTGCGAGAGCCGCTATGACGTATTACTATGATAGTAGTGGTTATTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1865 = CCCAGTTTCTGAGTGT-1

using 312 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 302]
surviving nonsolo ucounts = 1[302]
ids = [1]

====================================================================================

UMI info for barcode CCCAGTTTCTGAGTGT-1 contig 1 = TGGGAGGAAT...
umi ACTTGACAGA = 2 reads: -90 +5 -1 +1 -2 +1 -4 +1 -8X +1 -1 +9 -1 +1 -1 +1 -1 +6 -4 +2 -1 +1 -1X +2 -242 invalidated
umi ACTTGACCGC = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-492 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1869 = CCCAGTTTCTGCTGCT-1

using 352 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 49, 294]
surviving nonsolo ucounts = 2[49, 294]
ids = [6, 8]

====================================================================================

UMI info for barcode CCCAGTTTCTGCTGCT-1 contig 1 = GGGAGGAATC...
umi GTTCGTCGCT = 49 reads: -9 +4 -4 +6 -1 +5 -1 +339 -19 non-validated
umi TTCTTATCAT = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [6, 8]
of which 2 are surviving nonsolos
reads assigned: 324
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1874 = CCCAGTTTCTTGCATT-1

using 150 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 8, 138]
surviving nonsolo ucounts = 1[138]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1879 = CCCATACAGAGCTTCT-1

using 7172 reads

====================================================================================

graph has 2314 edges initially, 14 edges after simplification

total ucounts = 152
nonsolo ucounts = 89[2^28, 3^11, 4^7, 5^5, 6^3, 7^3, 8^2, 11^2, 16, 22, 43, 57, 90, 128, 133, 201, 226, 228, 234, 248, 258, 261, 263, 269, 284^2, 288, 293, 296, 300, 320, 321, 326, 352, 388, 761]
surviving nonsolo ucounts = 23[90, 128, 133, 201, 226, 228, 234, 248, 258, 261, 263, 269, 284^2, 288, 293, 296, 300, 320, 321, 326, 388, 761]
ids = [113, 20, 37, 8, 134, 138, 109, 114, 47, 12, ...]

====================================================================================

UMI info for barcode CCCATACAGAGCTTCT-1 contig 1 = GAGCTACAAC...
umi AACTGTCCCG = 325 reads: +400 validated
umi ACCGCTAGCG = 204 reads: +400 validated
umi ACGGTCGGCC = 258 reads: +400 validated
umi AGCATGTACA = 129 reads: +400 validated
umi AGTATGTTGA = 386 reads: +400 validated
umi ATTTCTAGCA = 301 reads: +400 validated
umi CACAGAGTCC = 324 reads: +400 validated
umi CCACTCTCCA = 291 reads: +400 validated
umi CCAGTTGGTG = 257 reads: +400 validated
umi CGAGGGACGG = 725 reads: -332 +1 -1XX +1 -2XX +1 -5XX +1 -3XX +1 -1XX +1 -14XX +1 -1XX +34 invalidated
umi CGCATATGCG = 286 reads: +400 validated
umi CTATGCAGTA = 267 reads: +400 validated
umi GGCCGGCCAA = 302 reads: +400 validated
umi GGTAAAGCCA = 128 reads: -359X +1 -6XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi GTCAAAGTGG = 318 reads: +400 validated
umi GTCTGTCTCT = 235 reads: +400 validated
umi GTTGCACCAT = 91 reads: +400 validated
umi TAAGTCTTTA = 247 reads: +400 validated
umi TCATATGCAT = 272 reads: +400 validated
umi TCCAAGGTTC = 282 reads: +400 validated
umi TCTCCACGTC = 228 reads: +400 validated
umi TTGTTAGTCG = 301 reads: +54 -4XX +342 invalidated

UMI info for barcode CCCATACAGAGCTTCT-1 contig 2 = ACCCAAAAAC...
umi CAAGGGCATC = 123 reads: +393 -1 +4 -1 +1 -1 +1 -10 non-validated
umi TGAACTTGGC = 213 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 707 reads
cdr3 = CQQYYSTPRTF at 369, score = 9 + 8
umis assigned: [2, 8, 12, 20, 25, 35, 39, 46, 47, 62] and 12 others
of which 21 are surviving nonsolos
reads assigned: 6060
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=500]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
466-500 ==> 0-34 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARGKYGGPFDYW at 396, score = 8 + 7
umis assigned: [37, 138]
of which 2 are surviving nonsolos
reads assigned: 327
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 484
confident = true
now this is a cell
paired!

CTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGGCAAGTACGGTGGACCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCGAACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1882 = CCCATACAGCAGCGTA-1

using 371 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 173, 192]
surviving nonsolo ucounts = 2[173, 192]
ids = [1, 4]

====================================================================================

UMI info for barcode CCCATACAGCAGCGTA-1 contig 1 = GGGAGAGGAG...
umi TTTGCACCGT = 189 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=503]
0-34 ==> 6-40 on |139|IGHV3-43|5'UTR| [len=80] (mis=0)
35-75 ==> 40-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
75-430 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=37)
450-496 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=9)
junction support: 1 umis using 18 reads
cdr3 = CAKDRAVTVTTALEYW at 417, score = 7 + 5
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 75, 226, 231, 292, 310, 378
confident = false

REJECT CONTIGS

TIG 1[bases=490]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=4)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 54, 252, 257, 274, 318, 351
confident = false
full length stopped transcript of length 490
frameshifted full length stopped transcript of length 490
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1898 = CCCATACCAAGAGGCT-1

using 406 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[403]
surviving nonsolo ucounts = 1[403]
ids = [1]

====================================================================================

UMI info for barcode CCCATACCAAGAGGCT-1 contig 1 = GAGCATCACC...
umi AGATGGTATA = 408 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=551]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
434-480 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARTPGGSGSQWDYW at 404, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 396
start codons at 62, 218, 260, 265, 297, 326, 359, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1907 = CCCATACCACTTAACG-1

using 264 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode CCCATACCACTTAACG-1 contig 1 = GGGGTCTCAG...
umi TACGTATTAT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-585 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1910 = CCCATACCAGATAATG-1

using 80000 reads

====================================================================================

graph has 11653 edges initially, 16 edges after simplification

total ucounts = 3124
nonsolo ucounts = 3030[2^23, 3^30, 4^30, 5^18, 6^21, 7^19, 8^22, 9^22, 10^25, 11^32, 12^40, 13^45, 14^26, 15^50, 16^45, 17^61, 18^76, 19^86, 20^92, 21^91, 22^91, 23^122, 24^124, 25^136, 26^123, 27^155, 28^129, 29^121, 30^139, 31^137, 32^103, 33^111, 34^109, 35^91, 36^84, 37^61, 38^61, 39^60, 40^40, 41^34, 42^33, 43^25, 44^19, 45^11, 46^13, 47^7, 48^5, 49^5, 50^5, 51^2, 52^5, 55, 56^3, 58^3, 60^3, 61, 62, 70, 74, 88]
surviving nonsolo ucounts = 2792[3, 6, 7, 8^5, 9^3, 10^7, 11^6, 12^27, 13^41, 14^25, 15^49, 16^45, 17^61, 18^76, 19^86, 20^92, 21^91, 22^91, 23^122, 24^124, 25^136, 26^123, 27^155, 28^129, 29^121, 30^139, 31^137, 32^103, 33^110, 34^109, 35^91, 36^84, 37^61, 38^61, 39^60, 40^40, 41^34, 42^33, 43^25, 44^19, 45^11, 46^13, 47^7, 48^5, 49^5, 50^5, 51^2, 52^5, 55, 56^3, 58^3, 60^3, 61, 62, 70, 74, 88]
ids = [1096, 1605, 3013, 896, 999, 1242, 1797, 1965, 765, 1194, ...]

====================================================================================

UMI info for barcode CCCATACCAGATAATG-1 contig 1 = GGGGAGGAAC...
umi AAAACCTATA = 19 reads: -52 +96 -3 +111 -3 +82 -1 +4 -23 +7 non-validated
umi AAACACCAAC = 33 reads: +368 -1X +13 invalidated
umi AAAGAGGAGG = 18 reads: -52 +177 -1 +7 -18 +117 -10 non-validated
umi AAATGCCAAG = 20 reads: -47 +56 -22 +192 -65 non-validated
umi AACAAACCTC = 35 reads: +382 validated
umi AACACCCAGC = 21 reads: +304 -17 +3 -1 +8 -2 +2 -1 +3 -2 +5 -1 +3 -4 +7 -6X +6 -1 +1 -5 invalidated
umi AACACTGATC = 34 reads: +9 -9 +300 -16 +48 non-validated
umi AACATACTCC = 22 reads: +287 -16 +79 non-validated
umi AACCACCATA = 30 reads: -8 +367 -1X +6 invalidated
umi AACCACCCTT = 19 reads: -13 +344 -25 non-validated
umi AACCATCCCA = 32 reads: +382 validated
umi AACCATGATT = 27 reads: -3 +352 -4 +23 non-validated
umi AACCCATCTA = 34 reads: +382 validated
umi AACCCCACTA = 25 reads: -32 +135 -1 +178 -1 +35 non-validated
umi AACCTGTTAT = 33 reads: -6 +1 -1 +4 -1 +12 -1 +224 -27 +105 non-validated
umi AACCTTGCAC = 28 reads: +5 -1 +4 -3 +241 -6 +73 -3 +46 non-validated
umi AACGCTACGT = 36 reads: -11 +371 non-validated
umi AACGGCAACC = 21 reads: -1 +148 -33 +5 -1 +1 -2X +1 -2 +1 -1 +1 -2X +2 -1 +1 -2 +13 -1 +18 -1 +144 invalidated
umi AACGGTTTAC = 31 reads: -12 +231 -1 +138 non-validated
umi AACGTTTTCC = 31 reads: +382 validated
umi AACTACACCC = 18 reads: +14 -15 +211 -35 +86 -21 non-validated
umi AACTCACTCT = 30 reads: +349 -1 +23 -9 non-validated
umi AACTCATGCC = 29 reads: +5 -1X +1 -1 +5 -1 +1 -3 +364 invalidated
umi AACTCTCCCT = 24 reads: -22 +360 non-validated
umi AACTTTCCCT = 32 reads: +381 -1 non-validated
umi AAGAAAACGC = 35 reads: +67 -1 +1 -9 +304 non-validated
umi AAGAACTCCT = 20 reads: -26 +285 -71 non-validated
umi AAGACTTCCC = 33 reads: -7 +275 -1 +99 non-validated
umi AAGAGCAGGT = 26 reads: +51 -1 +190 -35 +105 non-validated
umi AAGATCCATA = 22 reads: +292 -23 +58 -9 non-validated
umi AAGCATATCT = 20 reads: +212 -5 +86 -1 +78 non-validated
umi AAGGACCGTA = 24 reads: +66 -41 +252 -1 +4 -1 +1 -1 +3 -1 +2 -1 +1 -7 non-validated
umi AAGGCTCCTA = 42 reads: +382 validated
umi AAGTAGGGCA = 31 reads: +165 -1 +180 -36 non-validated
umi AAGTCATACC = 25 reads: +38 -9 +233 -3 +6 -2 +91 non-validated
umi AAGTGTTCCT = 22 reads: -6 +274 -8 +58 -1 +35 non-validated
umi AATAAACCCA = 26 reads: +325 -1 +56 non-validated
umi AATACCCTAG = 30 reads: +322 -1 +7 -52 non-validated
umi AATAGCCATG = 32 reads: -35 +322 -25 non-validated
umi AATAGTACCC = 31 reads: +15 -1 +5 -2 +294 -1 +64 non-validated
umi AATATCACCC = 27 reads: +352 -1 +29 non-validated
umi AATATGTAAC = 19 reads: -9 +373 non-validated
umi AATATTGCAA = 44 reads: +377 -5 non-validated
umi AATCATACCC = 21 reads: +57 -1 +212 -22 +90 non-validated
umi AATCCAAGGT = 28 reads: -1 +5 -1 +280 -63 +32 non-validated
umi AATGCACACC = 28 reads: -5 +259 -36 +82 non-validated
umi AATGTGTCTC = 28 reads: +382 validated
umi AATTCATCCG = 36 reads: +86 -1 +2 -1 +2 -1 +1 -2 +3 -2 +2 -2 +264 -13 non-validated
umi AATTTACCCT = 34 reads: +382 validated
umi ACAACATTAA = 25 reads: -1 +242 -12 +89 -38 non-validated
umi ACAACTGTTA = 43 reads: +382 validated
umi ACACCAACCG = 33 reads: +358 -24 non-validated
umi ACACCCCTCC = 18 reads: -5 +342 -35 non-validated
umi ACACCGTGTG = 32 reads: -29 +347 -6 non-validated
umi ACACCTAGTG = 33 reads: +382 validated
umi ACACCTTGCA = 34 reads: +382 validated
umi ACACGATGTG = 35 reads: +245 -1XX +136 invalidated
umi ACACGCCATC = 17 reads: +6 -7 +308 -38 +2 -1 +8 -1 +3 -1 +7 non-validated
umi ACACGGGCTT = 19 reads: +354 -28 non-validated
umi ACACTAACCC = 35 reads: +255 -1X +62 -64 invalidated
umi ACACTACAGG = 31 reads: +49 -12 +259 -1 +6 -1 +4 -2 +5 -43 non-validated
umi ACACTGCCTG = 25 reads: -8 +344 -1 +29 non-validated
umi ACAGCCCCAC = 27 reads: +229 -14X +117 -22 invalidated
umi ACAGCCCGAG = 31 reads: -6 +56 -25 +283 -12 non-validated
umi ACAGCCGCTC = 28 reads: +353 -1X +3 -25 invalidated
umi ACAGCCTCGA = 28 reads: +156 -1 +225 non-validated
umi ACAGGTTATG = 29 reads: +271 -1 +9 -1 +100 non-validated
umi ACAGTCATTG = 40 reads: +382 validated
umi ACATAAGACT = 32 reads: +371 -11 non-validated
umi ACATAGTTAT = 35 reads: +280 -36 +66 non-validated
umi ACATATAGGG = 30 reads: -14 +7 -1 +253 -26 +81 non-validated
umi ACATATCGGA = 27 reads: +133 -1 +130 -20 +98 non-validated
umi ACATCAAGCC = 28 reads: +97 -1 +223 -6 +55 non-validated
umi ACATCAGCCC = 29 reads: +3 -8 +284 -3X +1 -3X +1 -3X +30 -46 invalidated
umi ACATCAGGCT = 21 reads: -13 +331 -38 non-validated
umi ACATCGCTAG = 26 reads: +28 -1 +353 non-validated
umi ACATCGCTCT = 33 reads: +290 -11 +81 non-validated
umi ACATGCCTCC = 16 reads: -56 +302 -1 +7 -1 +4 -1 +10 non-validated
umi ACATGCTCCA = 27 reads: +295 -1X +66 -7 +13 invalidated
umi ACATGTCTGA = 27 reads: +6 -1X +212 -2 +1 -1 +3 -1 +28 -1 +91 -35 invalidated
umi ACATTCAGGC = 32 reads: +382 validated
umi ACATTCCATC = 42 reads: +382 validated
umi ACATTTACTG = 26 reads: +43 -2 +3 -1 +281 -15 +37 non-validated
umi ACATTTAGGC = 34 reads: +382 validated
umi ACATTTGTCT = 33 reads: +382 validated
umi ACCAACCCGG = 35 reads: +24 -1 +1 -3 +3 -1 +8 -1 +2 -1 +13 -1 +250 -29 +44 non-validated
umi ACCAACCTTC = 29 reads: +322 -1 +3 -1 +2 -1 +1 -2 +49 non-validated
umi ACCAACGATA = 34 reads: +14 -25 +296 -5 +42 non-validated
umi ACCAAGTCTG = 23 reads: -13 +342 -18 +9 non-validated
umi ACCACACGGT = 34 reads: +7 -19 +352 -1 +3 non-validated
umi ACCACATTTC = 30 reads: +18 -2 +362 non-validated
umi ACCACTTTCG = 32 reads: -2 +3 -1 +5 -1 +343 -27 non-validated
umi ACCAGACCTC = 43 reads: +382 validated
umi ACCAGAGGTA = 17 reads: +99 -1 +1 -1 +19 -1 +168 -92 non-validated
umi ACCAGTCACT = 24 reads: -13 +18 -1XX +125 -1 +160 -31 +33 invalidated
umi ACCATACCGG = 22 reads: -35 +319 -28 non-validated
umi ACCATACGGC = 32 reads: +175 -1 +133 -12 +7 -1 +2 -1 +2 -1 +47 non-validated
umi ACCATATCTC = 29 reads: -3 +166 -3 +210 non-validated
umi ACCATCCCCC = 35 reads: +3 -10 +310 -1 +1 -57 non-validated
umi ACCATCGTGA = 18 reads: -64 +222 -1X +23 -2 +2 -1 +4 -63 invalidated
umi ACCATTAATC = 40 reads: +382 validated
umi ACCATTCTCC = 32 reads: -9 +373 non-validated
umi ACCATTTCAC = 35 reads: +299 -10 +2 -1 +70 non-validated
umi ACCATTTGGC = 28 reads: +225 -1 +4 -19 +72 -13X +8 -1 +2 -1 +6 -1 +3 -1 +25 invalidated
umi ACCATTTTCC = 19 reads: +1 -3 +3 -3 +19 -1 +280 -37 +2 -1 +2 -2 +3 -2 +2 -1 +1 -3 +8 -2 +1 -1 +1 -1 +1 -1 non-validated
umi ACCCAGTCAC = 26 reads: -24 +358 non-validated
umi ACCCAGTCTG = 40 reads: -1 +353 -2 +26 non-validated
umi ACCCATAGCA = 38 reads: +353 -1 +7 -1X +20 invalidated
umi ACCCCGGAGG = 22 reads: -10 +57 -1 +263 -7 +5 -1 +1 -1 +3 -1 +6 -3X +2 -1 +2 -1 +17 invalidated
umi ACCCCGTCGC = 29 reads: +47 -1X +265 -1 +41 -27 invalidated
umi ACCCCTATGT = 23 reads: -1 +312 -69 non-validated
umi ACCCCTCGGC = 47 reads: +382 validated
umi ACCCGCTATC = 17 reads: -10 +144 -1X +14 -1 +12 -1 +3 -1 +1 -5 +21 -1 +126 -41 invalidated
umi ACCCGGGTCT = 30 reads: +356 -14 +12 non-validated
umi ACCCGTAGCC = 14 reads: +59 -16 +211 -2 +94 non-validated
umi ACCCGTTCTG = 25 reads: -13 +56 -1 +312 non-validated
umi ACCCTAAACC = 28 reads: -24 +11 -1 +2 -1 +3 -1 +1 -1 +1 -2 +4 -1 +2 -1 +3 -1 +316 -6 non-validated
umi ACCCTATGGG = 22 reads: +116 -9 +186 -41 +30 non-validated
umi ACCCTCAGTA = 32 reads: -3 +2 -1 +1 -1 +322 -10 +4 -1 +14 -1 +22 non-validated
umi ACCCTCCATC = 25 reads: +347 -35 non-validated
umi ACCCTCCCGT = 24 reads: +355 -1 +2 -24 non-validated
umi ACCCTCGCTT = 34 reads: +382 validated
umi ACCCTGTACT = 28 reads: +1 -1 +1 -1 +70 -1 +171 -19 +13 -1 +72 -1 +30 non-validated
umi ACCCTTTTCT = 16 reads: -60 +73 -1X +20 -5 +109 -38 +76 invalidated
umi ACCCTTTTGT = 36 reads: -10 +366 -6 non-validated
umi ACCGAAACTC = 38 reads: +352 -1 +9 -20 non-validated
umi ACCGAGGGGT = 29 reads: -1 +8 -1 +294 -5 +73 non-validated
umi ACCGATTCCG = 37 reads: +295 -14 +73 non-validated
umi ACCGCAGCTT = 28 reads: -22 +11 -1 +253 -4 +1 -1 +22 -1 +41 -25 non-validated
umi ACCGCATCAC = 27 reads: +43 -16 +8 -1 +314 non-validated
umi ACCGCCATTA = 29 reads: +359 -1 +22 non-validated
umi ACCGCCCTGC = 26 reads: -2 +67 -1 +3 -1 +2 -1 +1 -1 +1 -1 +6 -1 +5 -2 +20 -1X +225 -41 invalidated
umi ACCGCGATCC = 19 reads: +110 -1 +243 -28 non-validated
umi ACCGCGTGCC = 20 reads: -41 +185 -156 non-validated
umi ACCGGAAGCC = 28 reads: -1 +2 -32 +318 -29 non-validated
umi ACCGGATTCT = 25 reads: +52 -2 +328 non-validated
umi ACCGGCCACC = 20 reads: -53 +201 -1 +5 -1 +8 -66 +47 non-validated
umi ACCGGTCGGG = 28 reads: -6 +330 -46 non-validated
umi ACCGTCCCCC = 32 reads: -3 +56 -1 +322 non-validated
umi ACCGTGAGGG = 33 reads: +382 validated
umi ACCTAAGTGT = 26 reads: +324 -1 +19 -1 +9 -28 non-validated
umi ACCTACAAGG = 22 reads: +382 validated
umi ACCTACACCT = 25 reads: -14 +361 -1 +6 non-validated
umi ACCTACCGGC = 12 reads: -31 +176 -27 +77 -11 +56 -4 non-validated
umi ACCTACTCTA = 35 reads: +382 validated
umi ACCTACTTCC = 26 reads: -3 +342 -2X +4 -1 +5 -25 invalidated
umi ACCTATAAGC = 26 reads: +8 -1 +2 -1 +370 non-validated
umi ACCTATATGC = 35 reads: +382 validated
umi ACCTATCATT = 29 reads: +240 -1 +141 non-validated
umi ACCTATGCGG = 29 reads: -3 +5 -1 +190 -1 +2 -1 +179 non-validated
umi ACCTATTCGC = 22 reads: -13 +369 non-validated
umi ACCTCCAATA = 43 reads: +382 validated
umi ACCTCCCTCT = 36 reads: +273 -1 +4 -3 +101 non-validated
umi ACCTCGACCT = 14 reads: +66 -9 +159 -1 +8 -1 +138 non-validated
umi ACCTCGATCC = 36 reads: +273 -1 +108 non-validated
umi ACCTCGGGCC = 23 reads: +186 -1 +192 -3 non-validated
umi ACCTCGGGTA = 48 reads: +2 -1 +1 -1 +377 non-validated
umi ACCTCGTCCA = 17 reads: -16 +314 -52 non-validated
umi ACCTCGTTCG = 25 reads: -13 +277 -92 non-validated
umi ACCTCTGGTA = 35 reads: -9 +297 -1 +3 -1 +71 non-validated
umi ACCTCTTCGC = 28 reads: -2 +380 non-validated
umi ACCTGATAAC = 15 reads: +45 -1 +1 -47 +5 -1 +226 -45 +11 non-validated
umi ACCTGCACCT = 37 reads: +30 -4 +325 -1XX +22 invalidated
umi ACCTGCCTAT = 39 reads: -13 +56 -19 +294 non-validated
umi ACCTTACGGC = 34 reads: +4 -1 +2 -1 +3 -1 +370 non-validated
umi ACCTTATATG = 28 reads: +342 -1 +13 -26 non-validated
umi ACCTTCATCA = 19 reads: +251 -2 +129 non-validated
umi ACCTTCCCCC = 40 reads: +382 validated
umi ACCTTCCTGC = 14 reads: -19 +87 -12 +107 -49 +98 -6 +4 non-validated
umi ACCTTGCCCT = 27 reads: +322 -24 +36 non-validated
umi ACCTTGTCCA = 22 reads: -3X +1 -1X +1 -2X +311 -15 +48 invalidated
umi ACCTTGTTGC = 21 reads: -43 +332 -1 +2 -1 +3 non-validated
umi ACCTTTCCGT = 20 reads: -9 +243 -5 +1 -1 +62 -31X +1 -1 +1 -1 +1 -2 +1 -1 +1 -1 +1 -2X +16 invalidated
umi ACGAAACAGG = 41 reads: +321 -5 +56 non-validated
umi ACGACGGTGC = 33 reads: -22 +176 -1 +2 -1 +180 non-validated
umi ACGACTTCGG = 27 reads: -29 +301 -30 +22 non-validated
umi ACGAGTAGTA = 48 reads: +382 validated
umi ACGATGCCTC = 24 reads: +3 -27 +31 -1 +5 -1 +18 -2 +5 -2 +4 -2 +1 -2 +3 -1 +2 -2 +4 -4 +1 -1 +260 non-validated
umi ACGCACCCCT = 24 reads: +344 -1 +25 -1 +1 -1 +3 -1 +5 non-validated
umi ACGCCACTCC = 29 reads: -9 +267 -1 +1 -1 +82 -21 non-validated
umi ACGCCCGGTC = 23 reads: +3 -1 +70 -4 +98 -2 +167 -1 +36 non-validated
umi ACGCCCTCTT = 15 reads: +271 -66 +7 -1 +37 non-validated
umi ACGCCGTAGT = 14 reads: +250 -12 +21 -1 +34 -8 +56 non-validated
umi ACGCCTTATA = 23 reads: -29 +82 -1X +211 -1 +55 -1 +2 invalidated
umi ACGCTCAGCC = 32 reads: +3 -1 +378 non-validated
umi ACGCTCTTCC = 13 reads: -104 +105 -15 +68 -1 +28 -52 +6 -1 +2 non-validated
umi ACGCTGAGCC = 29 reads: +348 -1 +8 -3 +6 -1 +4 -1 +10 non-validated
umi ACGGGACCTT = 45 reads: +382 validated
umi ACGGGGCCGG = 24 reads: -11 +302 -2 +67 non-validated
umi ACGGGTTCCC = 33 reads: +230 -1 +3 -11 +123 -1 +7 -6 non-validated
umi ACGGTACTTC = 31 reads: -2 +328 -1 +51 non-validated
umi ACGGTCCCCT = 30 reads: -1 +377 -4 non-validated
umi ACGGTGTGGG = 18 reads: -26 +296 -1 +2 -57 non-validated
umi ACGTATCCGT = 20 reads: -34 +294 -54 non-validated
umi ACGTATCTCC = 39 reads: +319 -32 +31 non-validated
umi ACGTCACCGG = 40 reads: +342 -1 +39 non-validated
umi ACGTCCCTGG = 22 reads: +6 -1XX +104 -1 +5 -22 +227 -7 +9 invalidated
umi ACGTCCTTTG = 16 reads: +24 -1X +16 -1 +169 -3 +56 -10 +1 -1 +5 -1 +2 -2 +4 -1 +6 -3 +76 invalidated
umi ACGTCGCCGA = 24 reads: +1 -2 +275 -7 +12 -1 +57 -21 +6 non-validated
umi ACGTCTTCCT = 23 reads: +6 -1 +181 -21 +173 non-validated
umi ACGTGGCGGC = 22 reads: -5 +56 -18 +303 non-validated
umi ACGTGGGCCT = 45 reads: +369 -1 +12 non-validated
umi ACGTTAGTAC = 31 reads: -16 +366 non-validated
umi ACGTTCGCCC = 38 reads: -33 +314 -5 +18 -1 +11 non-validated
umi ACGTTCTCTC = 20 reads: -13 +363 -6 non-validated
umi ACGTTGCACG = 33 reads: -29 +337 -16 non-validated
umi ACGTTGTTAC = 14 reads: -7 +103 -13 +1 -1 +12 -1 +172 -35 +7 -1 +29 non-validated
umi ACGTTTTATC = 29 reads: +382 validated
umi ACTAACGTCC = 32 reads: +3 -10 +1 -1X +367 invalidated
umi ACTAAGCTAC = 40 reads: +7 -6 +369 non-validated
umi ACTACTTGCA = 45 reads: +382 validated
umi ACTAGCCTCC = 26 reads: +243 -5 +86 -1 +35 -1 +11 non-validated
umi ACTAGCCTTT = 29 reads: -24 +286 -1 +65 -6 non-validated
umi ACTAGCTCTG = 30 reads: -13 +312 -57 non-validated
umi ACTAGTACCT = 30 reads: +350 -26 +6 non-validated
umi ACTAGTTCCT = 33 reads: -50 +331 -1 non-validated
umi ACTATACCGT = 27 reads: +330 -19 +33 non-validated
umi ACTATGGTCC = 13 reads: -27 +6 -1 +214 -120 +14 non-validated
umi ACTATTCATA = 44 reads: +41 -2 +276 -2 +61 non-validated
umi ACTATTGTCC = 28 reads: -10 +195 -8 +3 -1 +58 -13 +94 non-validated
umi ACTCAATGAC = 35 reads: +4 -1X +226 -17 +7 -1 +3 -1 +122 invalidated
umi ACTCATCTCT = 25 reads: +224 -55 +103 non-validated
umi ACTCCAATTA = 34 reads: -157 +225 non-validated
umi ACTCCATCCC = 24 reads: +376 -6 non-validated
umi ACTCCCGTCC = 23 reads: -26 +356 non-validated
umi ACTCCGTTCC = 20 reads: -44 +144 -1 +1 -1 +97 -1 +27 -34 +1 -1 +23 -1 +6 non-validated
umi ACTCGATCGG = 22 reads: +25 -4 +248 -77 +28 non-validated
umi ACTCGTCGCG = 29 reads: -19 +311 -52 non-validated
umi ACTCTAAGCC = 33 reads: -14 +347 -21 non-validated
umi ACTCTACAGG = 36 reads: +350 -11 +21 non-validated
umi ACTCTATTCT = 40 reads: +382 validated
umi ACTCTCCCCC = 24 reads: +165 -31 +186 non-validated
umi ACTCTCTCTC = 32 reads: +322 -8 +52 non-validated
umi ACTGATACGC = 23 reads: -25 +245 -6 +68 -1 +10 -27 non-validated
umi ACTGCTAACC = 45 reads: +382 validated
umi ACTGGAGCAG = 18 reads: +241 -1 +1 -12 +107 -20 non-validated
umi ACTGGTATGG = 30 reads: +382 validated
umi ACTGTCATTC = 30 reads: +382 validated
umi ACTGTGGGGT = 25 reads: +372 -10 non-validated
umi ACTGTTGTTC = 43 reads: -5 +113 -1XX +263 invalidated
umi ACTTAATGCC = 41 reads: +382 validated
umi ACTTACTGGG = 34 reads: +382 validated
umi ACTTCATGCC = 18 reads: +254 -53 +75 non-validated
umi ACTTCATTGG = 27 reads: +19 -15 +348 non-validated
umi ACTTCTGGGC = 25 reads: +42 -1 +211 -45 +71 -1 +11 non-validated
umi ACTTCTTCCT = 27 reads: -12 +370 non-validated
umi ACTTCTTTCC = 31 reads: -30 +352 non-validated
umi ACTTGGCACT = 23 reads: +34 -17 +137 -14 +126 -5 +49 non-validated
umi ACTTGGCCAT = 17 reads: +212 -1X +169 invalidated
umi ACTTGTACCG = 34 reads: -27 +355 non-validated
umi ACTTTTTTCC = 29 reads: +5 -1 +2 -1 +1 -1 +2 -3 +366 non-validated
umi AGAACCCCAC = 41 reads: +323 -1 +58 non-validated
umi AGAACTAGTC = 24 reads: +173 -3 +182 -12 +12 non-validated
umi AGAATACCGC = 26 reads: +251 -21 +105 -5 non-validated
umi AGACATGTTA = 35 reads: +327 -1 +5 -1 +1 -1 +2 -2 +5 -1 +15 -21 non-validated
umi AGACCCCTTA = 16 reads: -15 +164 -42 +112 -1 +13 -1X +34 invalidated
umi AGAGAATCCT = 29 reads: +3 -10 +2 -1 +251 -1 +13 -29 +72 non-validated
umi AGAGATCCCT = 25 reads: +294 -1 +2 -1 +65 -19 non-validated
umi AGAGTAACCT = 31 reads: -11 +326 -45 non-validated
umi AGATAGCCGC = 36 reads: -5 +176 -1X +143 -29 +28 invalidated
umi AGATCTACCC = 29 reads: +303 -6 +73 non-validated
umi AGATGTGGCC = 29 reads: +26 -25 +270 -9 +52 non-validated
umi AGATGTTCGC = 16 reads: +231 -24 +115 -12 non-validated
umi AGCAAGATTC = 19 reads: -13 +142 -1 +40 -40 +146 non-validated
umi AGCACACCCG = 33 reads: +382 validated
umi AGCACACTCG = 29 reads: -22 +343 -1 +13 -2 +1 non-validated
umi AGCACCTGTC = 43 reads: +368 -1 +1 -1 +10 -1 non-validated
umi AGCATATCAC = 24 reads: +69 -16 +286 -11 non-validated
umi AGCATCGCTT = 30 reads: -29 +4 -1 +348 non-validated
umi AGCATGCCTG = 27 reads: +377 -5 non-validated
umi AGCATTAGGC = 28 reads: -29 +290 -1 +24 -1 +37 non-validated
umi AGCATTGGCG = 28 reads: +368 -1 +13 non-validated
umi AGCCAACATA = 23 reads: -11 +371 non-validated
umi AGCCAAGTGA = 36 reads: -1 +370 -1 +7 -1 +2 non-validated
umi AGCCATAGTA = 16 reads: -5 +311 -18 +36 -1 +11 non-validated
umi AGCCATCTCC = 24 reads: +42 -3 +224 -1 +7 -1 +7 -10 +1 -4X +2 -1 +1 -2 +3 -3 +3 -1 +1 -2 +1 -2 +3 -1 +3 -2 +5 -2 +44 invalidated
umi AGCCATGGTG = 33 reads: -5 +285 -1 +91 non-validated
umi AGCCATTCTC = 35 reads: -3 +301 -13 +59 -1 +5 non-validated
umi AGCCCAGCTA = 25 reads: +364 -1 +3 -1 +2 -1 +3 -1 +6 non-validated
umi AGCCCCCCGG = 22 reads: +343 -39 non-validated
umi AGCCCGTGTC = 20 reads: +115 -1 +98 -5 +155 -8 non-validated
umi AGCCCTCGCC = 27 reads: +53 -18 +269 -42 non-validated
umi AGCCCTCTGC = 28 reads: -23 +359 non-validated
umi AGCCCTTGCT = 27 reads: +256 -1 +10 -59 +56 non-validated
umi AGCCGTGACC = 35 reads: +365 -6 +11 non-validated
umi AGCCTATCTG = 33 reads: +382 validated
umi AGCCTATGCT = 27 reads: +357 -1 +14 -10 non-validated
umi AGCGCACTTG = 39 reads: -13 +359 -10 non-validated
umi AGCGCGTTCC = 36 reads: -5 +306 -25 +46 non-validated
umi AGCGGCCTGC = 45 reads: +382 validated
umi AGCGGGGATG = 27 reads: -18 +322 -42 non-validated
umi AGCGTAAATG = 13 reads: -14 +72 -7 +185 -104 non-validated
umi AGCTACGCGC = 34 reads: +291 -26 +65 non-validated
umi AGCTATCCCC = 31 reads: +5 -1 +1 -2 +1 -2X +342 -1X +7 -20 invalidated
umi AGCTCCGCTG = 29 reads: -33 +349 non-validated
umi AGCTCGCATA = 26 reads: +262 -43 +49 -1X +27 invalidated
umi AGCTCTACCC = 43 reads: -12 +370 non-validated
umi AGCTCTATTC = 13 reads: +221 -33 +128 non-validated
umi AGCTGGCACC = 12 reads: -29 +127 -1 +225 non-validated
umi AGCTTCCGGC = 36 reads: -18 +364 non-validated
umi AGCTTCCTCT = 28 reads: -29 +353 non-validated
umi AGCTTGATCC = 33 reads: +29 -27 +251 -9 +66 non-validated
umi AGCTTTCGAC = 23 reads: -42 +237 -27 +76 non-validated
umi AGCTTTCTGC = 57 reads: +382 validated
umi AGGAACCTGG = 31 reads: +362 -20 non-validated
umi AGGATGCACC = 36 reads: +382 validated
umi AGGCAACCCG = 38 reads: +337 -1 +5 -1 +6 -10 +22 non-validated
umi AGGCACCACG = 24 reads: -13 +278 -48 +43 non-validated
umi AGGCCCTGGT = 23 reads: +6 -2 +2 -1 +90 -1 +112 -1 +164 -1 +2 non-validated
umi AGGGGTGTCG = 46 reads: +368 -1 +13 non-validated
umi AGGGTAATTA = 18 reads: +107 -6 +5 -1 +2 -1 +228 -1 +3 -1 +21 -1 +5 non-validated
umi AGGGTAGCCC = 22 reads: -6 +2 -2 +4 -2X +2 -1 +2 -2 +212 -6 +85 -12 +44 invalidated
umi AGGTCTACTA = 37 reads: +382 validated
umi AGGTTATTTA = 40 reads: -18 +359 -3 +2 non-validated
umi AGGTTCCATG = 28 reads: +320 -2 +2 -58 non-validated
umi AGGTTCCGGG = 32 reads: +361 -21 non-validated
umi AGGTTCGATA = 35 reads: +382 validated
umi AGTACCACCT = 31 reads: +359 -23 non-validated
umi AGTACCCATT = 36 reads: +143 -1 +12 -1 +225 non-validated
umi AGTACCTCAT = 30 reads: +66 -1 +191 -1 +116 -7 non-validated
umi AGTACGCTGC = 44 reads: +365 -2 +12 -3 non-validated
umi AGTAGAAGTG = 30 reads: +321 -61 non-validated
umi AGTATATTGC = 19 reads: +4 -100 +136 -82 +1 -1 +52 -1 +1 -4 non-validated
umi AGTATGCGTA = 34 reads: +305 -25 +52 non-validated
umi AGTATGGCCC = 19 reads: +74 -1 +2 -1 +3 -1 +135 -2 +117 -26 +20 non-validated
umi AGTATTCGCG = 39 reads: +207 -5 +109 -1 +60 non-validated
umi AGTCACCCTA = 25 reads: +134 -1 +2 -1 +149 -1 +14 -1 +63 -4X +1 -11X invalidated
umi AGTCACCTAC = 17 reads: -12 +282 -19 +57 -1 +11 non-validated
umi AGTCATCCTG = 22 reads: +275 -107 non-validated
umi AGTCCAACTT = 21 reads: +35 -1 +1 -4 +250 -58 +2 -1 +4 -1 +11 -1 +1 -2 +10 non-validated
umi AGTCCTCTGC = 31 reads: +382 validated
umi AGTCCTTCCT = 14 reads: +318 -64 non-validated
umi AGTCGTACTA = 35 reads: -26 +3 -1 +2 -1 +7 -1 +275 -20 +15 -1 +30 non-validated
umi AGTCTCGATA = 27 reads: -27 +276 -33 +46 non-validated
umi AGTCTGCTGT = 31 reads: -13 +369 non-validated
umi AGTCTGGCCC = 26 reads: +4 -1 +2 -1 +2 -1 +318 -53 non-validated
umi AGTGAACTCG = 40 reads: +382 validated
umi AGTGATCAAG = 30 reads: +149 -19 +142 -8 +56 -8 non-validated
umi AGTTAAGATA = 38 reads: +373 -9 non-validated
umi AGTTATAGGG = 37 reads: +348 -33 +1 non-validated
umi AGTTCCGAGC = 21 reads: -5 +61 -1 +5 -2 +6 -1 +274 -1 +5 -1 +1 -19 non-validated
umi AGTTGCCTCC = 30 reads: +294 -15 +73 non-validated
umi AGTTGTCCTT = 30 reads: +311 -9 +62 non-validated
umi AGTTTCATAT = 23 reads: +200 -27 +130 -13 +12 non-validated
umi AGTTTCGACC = 26 reads: +156 -1 +206 -8 +11 non-validated
umi AGTTTTCCTC = 21 reads: -13 +317 -1 +39 -12 non-validated
umi ATAACCACCT = 25 reads: -27 +314 -41 non-validated
umi ATAACCGCCT = 31 reads: +279 -5 +98 non-validated
umi ATAAGAGGGA = 39 reads: +351 -1 +30 non-validated
umi ATAATACCTA = 27 reads: +382 validated
umi ATACAACCTG = 22 reads: -29 +135 -14 +204 non-validated
umi ATACACCCCG = 23 reads: -24 +118 -7 +2 -1 +205 -11 +14 non-validated
umi ATACAGGTAG = 33 reads: +367 -1 +2 -1 +11 non-validated
umi ATACATACTA = 39 reads: +148 -1 +208 -14 +11 non-validated
umi ATACATATTC = 29 reads: -5 +255 -4 +80 -1 +10 -20 +7 non-validated
umi ATACATCACC = 20 reads: +52 -11 +227 -1 +64 -27 non-validated
umi ATACCCCCCT = 24 reads: +382 validated
umi ATACGTCCCC = 26 reads: +328 -54 non-validated
umi ATACTAAACC = 31 reads: +69 -10 +1 -5X +1 -1X +1 -2 +1 -1 +290 invalidated
umi ATACTATACC = 42 reads: +382 validated
umi ATAGACACCC = 14 reads: -13 +90 -1 +1 -2 +81 -1X +61 -31 +101 invalidated
umi ATAGCGTCCT = 19 reads: +150 -1 +13 -8 +71 -1 +1 -4 +2 -1 +1 -2 +3 -3X +83 -38 invalidated
umi ATAGGCCCAC = 26 reads: -11 +281 -1 +1 -1 +2 -3 +1 -1 +4 -2 +2 -3X +69 invalidated
umi ATAGTTCCTG = 39 reads: +382 validated
umi ATATAAGGGC = 22 reads: +370 -12 non-validated
umi ATATAGTCAC = 40 reads: +374 -8 non-validated
umi ATATCAGTAC = 26 reads: +41 -4 +181 -1XX +89 -1 +2 -1 +2 -2 +3 -7 +48 invalidated
umi ATATCCATTT = 38 reads: +382 validated
umi ATATCGTCTG = 30 reads: +382 validated
umi ATATGATTCC = 26 reads: +22 -7 +353 non-validated
umi ATATTACCAC = 17 reads: -1 +99 -1 +1 -1 +103 -49 +35 -1 +82 -9 non-validated
umi ATATTAGTCT = 24 reads: +48 -2 +204 -3 +125 non-validated
umi ATATTATATG = 33 reads: +307 -13 +62 non-validated
umi ATCAAGCTGC = 26 reads: -1 +1 -1 +1 -2 +3 -1 +2 -1 +2 -1 +2 -3 +3 -1 +1 -1 +297 -58 non-validated
umi ATCAAGGCCC = 19 reads: +206 -2 +61 -18 +11 -1 +2 -1 +80 non-validated
umi ATCAATCGTA = 16 reads: -12 +189 -1 +5 -2 +9 -1 +1 -1 +59 -102 non-validated
umi ATCACCCGTG = 18 reads: -3 +210 -1 +67 -2 +58 -32 +1 -1 +2 -1 +3 -1 non-validated
umi ATCACCTTTA = 17 reads: -22 +88 -1 +3 -1 +41 -1 +113 -112 non-validated
umi ATCACGTTGT = 31 reads: +278 -1 +1 -5 +56 -37 +2 -1 +1 non-validated
umi ATCAGGCCCT = 21 reads: +11 -19 +70 -1 +281 non-validated
umi ATCAGTTGGC = 15 reads: -2 +27 -1 +16 -1 +147 -2 +6 -1 +108 -15 +56 non-validated
umi ATCATCCCCC = 32 reads: +229 -1X +116 -36 invalidated
umi ATCATGACCC = 23 reads: -22 +360 non-validated
umi ATCATTCACC = 36 reads: -44 +5 -1 +4 -1 +1 -2 +1 -1 +322 non-validated
umi ATCCAATGTC = 14 reads: -29 +220 -61 +13 -1 +58 non-validated
umi ATCCACTCCT = 26 reads: -26 +311 -44X +1 invalidated
umi ATCCAGCATA = 23 reads: -5 +78 -1 +206 -64 +3 -1 +1 -1 +1 -1 +3 -3 +6 -1 +3 -2 +2 non-validated
umi ATCCATAGTG = 19 reads: +49 -22 +192 -36 +79 -4 non-validated
umi ATCCATTGCA = 39 reads: +248 -1XX +101 -32 invalidated
umi ATCCCACGTC = 28 reads: +49 -6 +237 -90 non-validated
umi ATCCCATGCC = 26 reads: -13 +296 -1 +1 -1 +14 -1 +8 -27 +20 non-validated
umi ATCCCCGCAC = 36 reads: +336 -2 +2 -1X +1 -2 +2 -2 +3 -1 +1 -1 +2 -1 +1 -1 +7 -1X +2 -3 +1 -1 +8 invalidated
umi ATCCCCTCAC = 28 reads: +3 -1 +11 -1 +366 non-validated
umi ATCCCGGGGC = 29 reads: +7 -1 +5 -1 +12 -1 +161 -18 +176 non-validated
umi ATCCCGTCTG = 32 reads: +304 -2 +1 -2X +3 -1 +69 invalidated
umi ATCCGTACTT = 25 reads: +287 -8 +3 -1 +2 -1 +80 non-validated
umi ATCCGTGTCC = 26 reads: -22 +321 -39 non-validated
umi ATCCTAATCT = 17 reads: -53 +34 -1 +176 -10 +106 -2 non-validated
umi ATCCTACCCC = 27 reads: +138 -1 +1 -1 +1 -64 +57 -2 +117 non-validated
umi ATCCTATCGT = 39 reads: +2 -1X +3 -3 +1 -1 +2 -1 +3 -1 +277 -12 +72 -3X invalidated
umi ATCCTCACCA = 24 reads: +4 -16 +205 -16 +3 -1 +117 -12 +8 non-validated
umi ATCCTGGATT = 39 reads: +256 -1 +125 non-validated
umi ATCCTTTGTC = 22 reads: -8 +343 -1 +10 -20 non-validated
umi ATCGAACAAG = 12 reads: -24 +16 -1 +158 -1 +60 -41 +56 -25 non-validated
umi ATCGCCTTAT = 22 reads: +5 -1 +241 -1 +134 non-validated
umi ATCGCGATGC = 26 reads: +365 -17 non-validated
umi ATCGCGTTCT = 26 reads: -19 +254 -6 +8 -1 +94 non-validated
umi ATCGGAACTG = 24 reads: +316 -66 non-validated
umi ATCGGTCGTC = 25 reads: +179 -6 +158 -39 non-validated
umi ATCGTACCAC = 19 reads: +61 -17 +8 -1 +6 -1 +115 -1 +2 -1 +3 -1 +8 -1 +9 -13 +134 non-validated
umi ATCGTCTCCT = 23 reads: -13 +113 -14 +204 -1 +2 -1 +4 -1 +10 -1 +1 -1 +2 -2 +1 -1 +2 -1 +3 -4 non-validated
umi ATCGTGGCCA = 41 reads: -8 +374 non-validated
umi ATCTAAGTCC = 25 reads: +54 -16 +312 non-validated
umi ATCTAATCCT = 18 reads: -22 +289 -6 +34 -1 +21 -9 non-validated
umi ATCTAGCTTC = 20 reads: +382 validated
umi ATCTAGGCGC = 43 reads: +382 validated
umi ATCTATAGCG = 26 reads: -12 +361 -9 non-validated
umi ATCTATATAC = 34 reads: -24 +358 non-validated
umi ATCTATCCGC = 34 reads: +355 -1X +14 -12 invalidated
umi ATCTCCCCCC = 35 reads: +360 -22 non-validated
umi ATCTCGTCTT = 40 reads: +382 validated
umi ATCTCTTGCC = 31 reads: +365 -17 non-validated
umi ATCTGTAAGG = 36 reads: +330 -52 non-validated
umi ATCTTGTATA = 28 reads: -22 +312 -48 non-validated
umi ATGAAAACCC = 22 reads: +304 -37 +2 -1 +8 -1 +29 non-validated
umi ATGAGTTAGC = 37 reads: -1 +381 non-validated
umi ATGCACTGTC = 29 reads: +375 -1 +6 non-validated
umi ATGCATCACC = 21 reads: -11 +339 -32 non-validated
umi ATGCCCAGCT = 28 reads: +275 -16 +83 -1X +6 -1 invalidated
umi ATGCCCTTTC = 23 reads: +303 -44 +35 non-validated
umi ATGCGCGCTC = 18 reads: +54 -1 +264 -36 +27 non-validated
umi ATGCTCCCCA = 47 reads: +382 validated
umi ATGGCTTGGG = 23 reads: +83 -5 +294 non-validated
umi ATGTAAGGTC = 37 reads: +10 -1X +219 -1 +5 -12 +88 -22 +24 invalidated
umi ATGTAGCCCC = 37 reads: +344 -1XX +37 invalidated
umi ATGTCAAGTT = 27 reads: +357 -1 +8 -1 +15 non-validated
umi ATGTCATTCC = 24 reads: -11 +271 -15 +85 non-validated
umi ATGTCCGCTA = 26 reads: +353 -7 +22 non-validated
umi ATGTCCGGTA = 40 reads: -51 +304 -3 +24 non-validated
umi ATGTCTGCCT = 19 reads: -10 +300 -1 +3 -1 +1 -1 +14 -1 +1 -1X +1 -47 invalidated
umi ATGTGCCCTC = 36 reads: +382 validated
umi ATGTGTACCC = 25 reads: -3 +271 -13 +3 -1 +52 -39 non-validated
umi ATGTTACTCC = 41 reads: +382 validated
umi ATGTTACTCT = 28 reads: -26 +318 -1 +37 non-validated
umi ATGTTTTTGT = 21 reads: -45 +7 -1 +1 -1 +11 -1 +62 -1X +160 -11 +56 -25 invalidated
umi ATTAAAATAA = 23 reads: +54 -5 +150 -42 +131 non-validated
umi ATTAACCCTG = 36 reads: +273 -1 +47 -45 +16 non-validated
umi ATTAACTATC = 15 reads: -12 +2 -1 +2 -1 +146 -30 +74 -72 +42 non-validated
umi ATTAAGCGTA = 18 reads: -75 +189 -1 +64 -1 +10 -1 +11 -1X +12 -1 +16 invalidated
umi ATTAAGGGCC = 16 reads: -28 +204 -1 +90 -59 non-validated
umi ATTAATCCGG = 13 reads: +94 -1 +1 -11 +122 -10 +56 -35 +1 -1 +11 -1 +5 -1 +3 -1 +1 -2 +4 -3 +1 -2 +5 -1 +4 -4 +1 non-validated
umi ATTACATCTA = 37 reads: +5 -25 +352 non-validated
umi ATTAGCCTCC = 25 reads: -22 +146 -1 +5 -3 +173 -32 non-validated
umi ATTATACATA = 38 reads: +348 -1 +3 -1 +29 non-validated
umi ATTATACCCA = 49 reads: +382 validated
umi ATTCCGCCCC = 30 reads: +382 validated
umi ATTCGCCTCT = 14 reads: +162 -1 +4 -1X +1 -1X +2 -1X +1 -1X +4 -1X +4 -5 +91 -102 invalidated
umi ATTCGGGTCC = 20 reads: -1 +332 -49 non-validated
umi ATTCGTCACA = 27 reads: +2 -1 +5 -1 +16 -1 +356 non-validated
umi ATTCGTGTAT = 27 reads: +382 validated
umi ATTCTCTCGT = 33 reads: -24 +256 -26 +7 -1 +64 -1 +1 -2 non-validated
umi ATTCTTGCCC = 22 reads: -46 +4 -1 +105 -1 +218 -1 +4 -1 +1 non-validated
umi ATTCTTGGTC = 34 reads: +382 validated
umi ATTCTTTTAC = 28 reads: +270 -7 +73 -32 non-validated
umi ATTGACCTCC = 44 reads: +382 validated
umi ATTGAGCCTC = 22 reads: +248 -1 +5 -1 +127 non-validated
umi ATTGAGGCCT = 24 reads: +7 -10 +365 non-validated
umi ATTGATCTCC = 34 reads: +239 -1 +142 non-validated
umi ATTGCACCCT = 33 reads: -9 +373 non-validated
umi ATTGCAGTCC = 25 reads: +1 -1 +8 -2 +2 -3 +4 -1 +8 -1 +1 -2 +196 -42 +110 non-validated
umi ATTGCGTCTC = 27 reads: +355 -27 non-validated
umi ATTGTTCCGC = 24 reads: +188 -3 +5 -1 +161 -24 non-validated
umi ATTGTTCTCT = 30 reads: +17 -5 +344 -16 non-validated
umi ATTTAAACAT = 20 reads: -23 +3 -2 +1 -1 +3 -1 +1 -1 +6 -1 +2 -2 +5 -1 +329 non-validated
umi ATTTAAACTC = 36 reads: -15 +346 -1 +20 non-validated
umi ATTTATCCCG = 27 reads: +382 validated
umi ATTTATCCTT = 29 reads: +57 -1 +197 -44 +83 non-validated
umi ATTTCTTACC = 22 reads: -5 +377 non-validated
umi ATTTCTTCCC = 32 reads: +287 -25 +70 non-validated
umi ATTTGTCCCT = 31 reads: +69 -1 +296 -1 +1 -1 +4 -9 non-validated
umi ATTTTAACCT = 41 reads: +382 validated
umi ATTTTCATGC = 24 reads: +323 -59 non-validated
umi ATTTTCTCCT = 16 reads: -30 +100 -1 +120 -2 +1 -1 +127 non-validated
umi ATTTTTCCCT = 27 reads: +373 -9 non-validated
umi ATTTTTCTCC = 31 reads: -70 +76 -1 +169 -20 +46 non-validated
umi CAAAACATAC = 32 reads: +280 -79X +23 invalidated
umi CAAAACCCAC = 34 reads: +382 validated
umi CAAACATGAC = 36 reads: -16 +277 -23 +66 non-validated
umi CAAACCCGGG = 24 reads: -9 +76 -1X +286 -10 invalidated
umi CAAACGCCTC = 32 reads: -4 +261 -2 +56 -16 +43 non-validated
umi CAAAGGATAC = 39 reads: +342 -40 non-validated
umi CAAAGTGCTC = 39 reads: +328 -7 +47 non-validated
umi CAAATCCGTT = 22 reads: -18 +5 -1 +230 -1 +16 -55 +56 non-validated
umi CAACAGTGAC = 38 reads: +348 -1 +11 -1 +8 -13 non-validated
umi CAACATACAG = 32 reads: +16 -13 +289 -12 +52 non-validated
umi CAACCATCTG = 24 reads: +160 -1 +10 -2 +3 -4 +2 -1 +7 -18X +84 -13 +77 invalidated
umi CAACGCCTAT = 32 reads: -9 +300 -7 +66 non-validated
umi CAACTATCAT = 48 reads: -8 +349 -25 non-validated
umi CAACTTCGCC = 39 reads: +288 -1 +93 non-validated
umi CAAGAATGTG = 23 reads: +146 -2 +163 -28 +3 -1 +6 -1X +32 invalidated
umi CAAGCACCCT = 41 reads: +382 validated
umi CAAGCCTGCC = 22 reads: +319 -1 +6 -1 +13 -1X +30 -1 +10 invalidated
umi CAAGGTCCGC = 41 reads: +130 -1XX +251 invalidated
umi CAAGTGCCCC = 24 reads: +93 -16 +84 -7 +29 -1X +128 -1 +5 -3 +4 -1 +7 -1 +2 invalidated
umi CAAGTGTTCC = 24 reads: +333 -49 non-validated
umi CAAGTTCCCG = 20 reads: -21 +361 non-validated
umi CAAGTTTCCT = 24 reads: -12 +275 -3 +23 -1 +32 -32 +4 non-validated
umi CAAGTTTCGG = 17 reads: -18 +244 -1 +5 -1 +6 -15 +11 -1 +80 non-validated
umi CAATAATATC = 23 reads: +275 -1 +41 -1 +34 -1 +5 -24 non-validated
umi CAATACTCCC = 58 reads: -20 +361 -1 non-validated
umi CAATAGACCG = 35 reads: +349 -1 +7 -2 +2 -1 +20 non-validated
umi CAATATACGC = 19 reads: -41 +203 -50 +56 -32 non-validated
umi CAATCCGTCC = 34 reads: +29 -10 +283 -1 +1 -1 +1 -1 +3 -3 +49 non-validated
umi CAATGACGGG = 30 reads: -60 +321 -1 non-validated
umi CAATGACTCT = 31 reads: -3 +249 -3 +119 -1 +6 -1 non-validated
umi CAATGAGACT = 26 reads: -35 +32 -1 +314 non-validated
umi CAATTAGGGC = 36 reads: +372 -10 non-validated
umi CACAACCCCG = 33 reads: +73 -1 +308 non-validated
umi CACAAGACAC = 34 reads: +6 -37 +303 -1 +35 non-validated
umi CACACATACC = 27 reads: -13 +216 -26 +127 non-validated
umi CACACTGGCC = 17 reads: -87 +295 non-validated
umi CACACTGGTC = 22 reads: -19 +241 -21 +57 -1 +1 -1 +41 non-validated
umi CACAGAGTTC = 15 reads: +275 -96 +11 non-validated
umi CACAGATATG = 19 reads: -19 +153 -1X +79 -1 +75 -9 +15 -1 +29 invalidated
umi CACAGCTCTA = 35 reads: -2 +380 non-validated
umi CACAGGCGTG = 26 reads: +326 -33 +23 non-validated
umi CACATATATG = 35 reads: +382 validated
umi CACATCGGCC = 26 reads: -15 +341 -26 non-validated
umi CACATCGTAC = 21 reads: +46 -1 +7 -1 +3 -1 +184 -1 +36 -85 +17 non-validated
umi CACATCTATC = 38 reads: +382 validated
umi CACATCTTCC = 38 reads: +382 validated
umi CACATTAGTG = 26 reads: -6 +1 -1 +1 -1 +11 -1 +4 -1 +2 -1 +5 -1 +341 -1 +4 non-validated
umi CACATTCACC = 35 reads: +382 validated
umi CACATTTCCT = 38 reads: +174 -8X +6 -3 +1 -1 +189 invalidated
umi CACCACGGTC = 27 reads: -12 +3 -1 +2 -1 +2 -1 +285 -14 +61 non-validated
umi CACCACTAGC = 14 reads: +56 -4 +160 -1 +7 -3 +56 -39 +56 non-validated
umi CACCACTTTG = 25 reads: -16 +325 -1 +2 -1 +3 -1 +15 -1 +11 -1 +2 -1 +2 non-validated
umi CACCAGACCC = 40 reads: +14 -1 +310 -57 non-validated
umi CACCATCGAC = 19 reads: +4 -1 +6 -2 +3 -2 +3 -1 +1 -1 +3 -1 +10 -1 +5 -1 +4 -1 +14 -2 +3 -12 +18 -1 +200 -5 +77 non-validated
umi CACCCAAGGT = 14 reads: -13 +192 -1 +8 -1 +11 -1 +58 -8 +89 non-validated
umi CACCCAATTC = 36 reads: +24 -53 +303 -1 +1 non-validated
umi CACCCCGGCC = 38 reads: +9 -1 +366 -1 +5 non-validated
umi CACCCGTCCC = 28 reads: +43 -44 +208 -5 +82 non-validated
umi CACCCTCGCG = 33 reads: +382 validated
umi CACCCTTGCT = 34 reads: +18 -3 +161 -1XX +187 -1 +11 invalidated
umi CACCGTTCTC = 44 reads: +382 validated
umi CACCTAACCG = 19 reads: -1 +1 -1 +1 -23 +284 -54 +14 -1 +2 non-validated
umi CACCTACCGG = 20 reads: -3 +320 -33 +26 non-validated
umi CACCTCAATC = 24 reads: -33 +228 -121 non-validated
umi CACGAAGCTT = 26 reads: -12 +59 -5 +285 -21 non-validated
umi CACGATAAGT = 22 reads: +31 -26 +264 -5 +13 -1 +7 -1 +3 -1 +1 -1 +4 -1 +1 -1 +8 -1 +1 -1 +9 -1 non-validated
umi CACGATTTGG = 25 reads: +189 -1 +109 -23 +56 -4 non-validated
umi CACGCACCGG = 24 reads: +293 -1 +88 non-validated
umi CACGCCAGAG = 26 reads: +271 -111 non-validated
umi CACGCCTCTA = 15 reads: -5 +92 -12 +11 -1 +209 -52 non-validated
umi CACGGACCCG = 17 reads: -5 +56 -35 +174 -5 +56 -51 non-validated
umi CACGTAGTAG = 43 reads: +377 -5 non-validated
umi CACGTCATTC = 34 reads: -5 +343 -11 +3 -1X +1 -1 +3 -1 +13 invalidated
umi CACGTTTGTA = 35 reads: -18 +297 -1 +66 non-validated
umi CACTACAGTC = 29 reads: -44 +116 -2 +5 -1 +3 -1 +210 non-validated
umi CACTACAGTG = 32 reads: +382 validated
umi CACTAGGCTA = 19 reads: -25 +64 -17 +233 -1 +42 non-validated
umi CACTATAGTA = 45 reads: +382 validated
umi CACTATGTAA = 23 reads: +51 -2 +301 -28 non-validated
umi CACTCCGAGT = 23 reads: -10 +223 -58 +64 -1 +24 -1 +1 non-validated
umi CACTCCTCCC = 26 reads: -50 +167 -9 +156 non-validated
umi CACTCGACCC = 27 reads: -10 +372 non-validated
umi CACTGTGGAC = 27 reads: +309 -1X +9 -63 invalidated
umi CACTTAGGTT = 17 reads: -30 +101 -1 +1 -1 +1 -1 +11 -2 +10 -1 +4 -15 +203 non-validated
umi CACTTCGGGG = 34 reads: +89 -17 +276 non-validated
umi CAGAACCTTG = 23 reads: -6 +324 -52 non-validated
umi CAGAAGCTCC = 33 reads: +9 -4 +344 -10 +15 non-validated
umi CAGACCCGGC = 38 reads: +335 -47 non-validated
umi CAGACTCAGC = 27 reads: +217 -2 +137 -4 +22 non-validated
umi CAGAGTGCAC = 32 reads: +285 -31 +56 -10 non-validated
umi CAGATGGGAC = 25 reads: +179 -1X +4 -1X +197 invalidated
umi CAGATTCCCC = 26 reads: -1 +6 -1 +1 -2 +269 -1 +55 -2 +3 -12 +29 non-validated
umi CAGCAACCCA = 19 reads: +18 -19 +21 -1 +259 -64 non-validated
umi CAGCACCGTT = 31 reads: +344 -1 +9 -28 non-validated
umi CAGCACTACT = 40 reads: -2 +380 non-validated
umi CAGCATGTAC = 18 reads: +33 -1X +20 -28 +8 -1X +189 -1 +31 -70 invalidated
umi CAGCCGCCTC = 24 reads: +9 -9 +238 -1 +125 non-validated
umi CAGCCGGTCC = 30 reads: +2 -2 +276 -26 +60 -1 +6 -9 non-validated
umi CAGCGAACCC = 39 reads: +205 -25 +7 -1 +5 -1 +7 -1 +2 -1 +125 -1 +1 non-validated
umi CAGCGAATCT = 12 reads: -30 +61 -2 +110 -59 +56 -64 non-validated
umi CAGCGACCCT = 35 reads: -2 +369 -1 +5 -1 +3 -1 non-validated
umi CAGCGTGTTA = 18 reads: +361 -21 non-validated
umi CAGCTCCTCC = 50 reads: +297 -1 +3 -22 +59 non-validated
umi CAGCTCTGTA = 36 reads: -34 +23 -1 +324 non-validated
umi CAGCTCTTTG = 28 reads: -29 +326 -1 +26 non-validated
umi CAGCTTCAGA = 39 reads: +382 validated
umi CAGGAACCTG = 28 reads: -12 +323 -1 +6 -1 +5 -2 +3 -1 +4 -1 +23 non-validated
umi CAGGAAGTGC = 38 reads: +337 -45 non-validated
umi CAGGACTAGG = 31 reads: -19 +363 non-validated
umi CAGGAGGTGC = 38 reads: +382 validated
umi CAGGCAGCGC = 24 reads: +266 -1 +1 -64 +50 non-validated
umi CAGGCAGGGA = 28 reads: -37 +287 -1 +2 -1 +1 -1 +8 -1 +1 -4X +1 -2 +35 invalidated
umi CAGGCGTGTT = 20 reads: +21 -1 +310 -41 +9 non-validated
umi CAGGGAATAC = 38 reads: -10 +335 -1X +2 -1X +2 -2X +2 -1X +2 -1X +3 -2 +8 -1 +8 -1 invalidated
umi CAGGTCCCTT = 38 reads: +382 validated
umi CAGGTCGTGG = 50 reads: -1 +366 -15 non-validated
umi CAGTACTCAC = 26 reads: +297 -19 +66 non-validated
umi CAGTATACTC = 22 reads: -4 +110 -1 +1 -2 +1 -16 +247 non-validated
umi CAGTCCATAC = 30 reads: +382 validated
umi CAGTCCCCCT = 15 reads: +115 -15 +183 -69 non-validated
umi CAGTGGCGGG = 25 reads: +375 -7 non-validated
umi CAGTTACTTG = 17 reads: -40 +17 -1 +198 -1 +3 -1 +1 -1 +2 -61 +48 -1 +4 -1 +2 non-validated
umi CAGTTCAGTC = 17 reads: -10 +206 -29 +93 -1 +2 -1 +35 -1 +1 -1 +2 non-validated
umi CAGTTCCCCC = 43 reads: +281 -1 +100 non-validated
umi CAGTTGGGCT = 25 reads: -37 +280 -65 non-validated
umi CAGTTTCCTT = 25 reads: -39 +105 -2 +236 non-validated
umi CATAAACTCT = 37 reads: +329 -7 +46 non-validated
umi CATAACTCTC = 23 reads: -15 +305 -1 +4 -21 +2 -1 +33 non-validated
umi CATAATCCGC = 37 reads: +382 validated
umi CATAATGGAG = 23 reads: +262 -1 +22 -1XX +70 -26 invalidated
umi CATAATTTCC = 30 reads: +372 -10 non-validated
umi CATACCGCCT = 30 reads: -10 +199 -6 +106 -34 +27 non-validated
umi CATACCTCTC = 35 reads: +3 -1 +4 -1 +3 -1 +301 -33 +35 non-validated
umi CATACGCCGT = 31 reads: +382 validated
umi CATACGGCGC = 29 reads: +44 -13 +146 -15 +2 -4 +4 -1 +5 -1 +4 -1 +1 -3 +3 -1 +2 -1 +10 -1 +11 -17 +92 non-validated
umi CATACGTCCT = 20 reads: -10 +251 -1 +8 -16 +60 -1 +3 -3 +1 -2 +1 -2 +6 -17 non-validated
umi CATACGTGCC = 15 reads: +287 -1 +2 -1 +19 -72 non-validated
umi CATACTCCTC = 40 reads: +8 -21 +327 -4 +22 non-validated
umi CATACTTGTT = 36 reads: +236 -1X +145 invalidated
umi CATAGGGCAA = 19 reads: +54 -6 +310 -1 +4 -7 non-validated
umi CATAGTAGCT = 36 reads: +320 -1 +1 -1 +1 -1 +1 -1 +1 -1 +7 -1 +4 -1 +1 -39 non-validated
umi CATAGTATTA = 37 reads: +382 validated
umi CATATAGTTG = 34 reads: +373 -9 non-validated
umi CATATGCTCC = 23 reads: -64 +71 -8 +180 -1 +21 -1 +5 -20 +11 non-validated
umi CATATGGATC = 28 reads: +126 -5 +6 -1X +213 -31 invalidated
umi CATATGGCGT = 58 reads: -229 +153 non-validated
umi CATATGTCTC = 20 reads: -15 +298 -69 non-validated
umi CATATGTGTA = 15 reads: +33 -17 +223 -34 +56 -19 non-validated
umi CATCACCCTG = 17 reads: -13 +154 -8 +135 -16 +56 non-validated
umi CATCACTGCC = 30 reads: +258 -2 +122 non-validated
umi CATCAGATCG = 37 reads: +13 -10 +295 -2X +62 invalidated
umi CATCAGCTGC = 33 reads: -24 +358 non-validated
umi CATCCACATG = 34 reads: +382 validated
umi CATCCACGGT = 28 reads: -12 +336 -34 non-validated
umi CATCCCCCCG = 32 reads: +246 -4 +115 -17 non-validated
umi CATCCCGATA = 28 reads: +382 validated
umi CATCCTCCCG = 39 reads: -10 +372 non-validated
umi CATCTACGCC = 25 reads: +19 -14 +241 -1X +16 -1 +90 invalidated
umi CATCTAGTCC = 22 reads: +294 -88 non-validated
umi CATCTATGCC = 23 reads: -51 +280 -1 +3 -1 +1 -1 +1 -1 +42 non-validated
umi CATCTCGCAC = 24 reads: -34 +336 -1 +3 -8 non-validated
umi CATCTTCTCC = 35 reads: +303 -46 +33 non-validated
umi CATGCAGTGT = 23 reads: -3 +358 -21 non-validated
umi CATGCCGCTC = 28 reads: -16 +278 -1 +3 -1 +63 -20 non-validated
umi CATGCGCAGG = 16 reads: +270 -1 +3 -1 +3 -1 +7 -1 +9 -1 +3 -1 +10 -50 +1 -1 +2 -1 +2 -5 +6 -1 +2 non-validated
umi CATGCTGCCT = 26 reads: +83 -14 +5 -2 +3 -1 +11 -1 +245 -17 non-validated
umi CATGGACCTC = 32 reads: +382 validated
umi CATGGGAATA = 23 reads: +256 -1 +62 -1 +1 -61 non-validated
umi CATGGGATAC = 16 reads: +77 -9 +225 -71 non-validated
umi CATGGGCTTG = 23 reads: +281 -84 +17 non-validated
umi CATGGTATCT = 33 reads: +382 validated
umi CATGGTGCAC = 14 reads: -5 +62 -1 +65 -7 +68 -29 +2 -1 +2 -1 +4 -1 +1 -1 +23 -1 +31 -1 +27 -18 +31 non-validated
umi CATGTACTCA = 26 reads: -44 +323 -2X +3 -2 +4 -4 invalidated
umi CATGTATATT = 27 reads: +2 -2 +9 -2 +3 -2 +60 -1 +2 -1 +1 -1 +1 -1 +1 -1 +28 -1 +1 -12 +238 -1 +5 -6 non-validated
umi CATGTCAGCG = 26 reads: +32 -11 +339 non-validated
umi CATGTTACTG = 21 reads: +246 -1 +130 -1 +4 non-validated
umi CATTAAACCC = 35 reads: +382 validated
umi CATTAAATTA = 34 reads: +181 -1 +200 non-validated
umi CATTAATGTC = 16 reads: +101 -1X +150 -3 +88 -1 +9 -2 +2 -1 +3 -1 +3 -1 +14 -1 +1 invalidated
umi CATTACGGCT = 32 reads: +49 -1X +129 -1 +99 -59 +44 invalidated
umi CATTACGGGA = 26 reads: -29 +289 -3 +36 -1 +14 -1 +4 -5 non-validated
umi CATTACTCTC = 36 reads: +382 validated
umi CATTAGTACC = 27 reads: -12 +370 non-validated
umi CATTCAACGG = 31 reads: -5 +377 non-validated
umi CATTCAGCCC = 42 reads: -2 +380 non-validated
umi CATTCGCTCC = 15 reads: -107 +215 -1 +4 -1X +7 -1 +14 -2X +1 -29 invalidated
umi CATTGACGCC = 36 reads: +382 validated
umi CATTGACTTC = 72 reads: +382 validated
umi CATTGTTACC = 43 reads: +382 validated
umi CATTTACTAC = 28 reads: +224 -2 +131 -25 non-validated
umi CATTTAGCCT = 17 reads: -19 +307 -56 non-validated
umi CATTTCCGCC = 33 reads: -16 +271 -8 +2 -1 +84 non-validated
umi CATTTCCTCG = 26 reads: +13 -1 +284 -1 +83 non-validated
umi CATTTGACCT = 32 reads: +109 -11 +262 non-validated
umi CCAAAACCCG = 20 reads: -23 +220 -12 +3 -1 +95 -28 non-validated
umi CCAAACTCCT = 33 reads: +40 -1 +58 -1 +3 -1 +278 non-validated
umi CCAAATCCCT = 27 reads: -29 +12 -1X +187 -1 +152 invalidated
umi CCAAATCCGT = 39 reads: +318 -1 +56 -7 non-validated
umi CCAACCCCTA = 28 reads: +382 validated
umi CCAACGGACC = 31 reads: +129 -1 +5 -5 +242 non-validated
umi CCAACGGCCG = 40 reads: -18 +364 non-validated
umi CCAACGGCTG = 15 reads: +9 -2 +176 -15 +85 -5 +56 -34 non-validated
umi CCAACGGTTG = 30 reads: +251 -1X +11 -1X +16 -5 +85 -1 +11 invalidated
umi CCAACGTCCT = 21 reads: -12 +84 -1 +3 -1 +2 -2 +1 -1 +187 -1X +75 -12 invalidated
umi CCAACGTTTC = 44 reads: +382 validated
umi CCAACTGCCG = 22 reads: +328 -54 non-validated
umi CCAACTGCCT = 25 reads: +343 -39 non-validated
umi CCAACTGCTA = 36 reads: -4 +348 -1 +29 non-validated
umi CCAACTGTCC = 21 reads: +156 -9 +145 -1 +3 -3 +3 -1 +2 -1 +1 -1 +1 -2 +6 -1 +46 non-validated
umi CCAAGGGCCC = 34 reads: -2 +368 -1 +5 -6 non-validated
umi CCAAGTATCG = 12 reads: -13 +56 -48 +84 -5 +149 -27 non-validated
umi CCAAGTCTCT = 18 reads: -60 +194 -1 +14 -10 +56 -3 +2 -2 +2 -1 +37 non-validated
umi CCAAGTTGCT = 34 reads: +382 validated
umi CCAATAACCC = 34 reads: -39 +343 non-validated
umi CCAATACCCC = 16 reads: -6X +1 -2 +1 -1 +2 -2 +3 -1 +2 -1 +2 -1 +2 -2 +1 -3 +12 -1 +1 -1X +9 -1 +1 -1 +1 -20 +181 -18 +56 -46 invalidated
umi CCAATACCTC = 20 reads: -45 +65 -3 +181 -1 +5 -1 +1 -1 +8 -1 +7 -63 non-validated
umi CCAATATTTG = 27 reads: +156 -1 +123 -1X +6 -1 +7 -1 +15 -1 +1 -61 +8 invalidated
umi CCAATCTCGC = 18 reads: +337 -36 +3 -1 +5 non-validated
umi CCAATGGATA = 39 reads: -29 +353 non-validated
umi CCAATTGTTA = 30 reads: +382 validated
umi CCACAACGGA = 35 reads: +382 validated
umi CCACACACCA = 24 reads: -19 +8 -1 +5 -1 +348 non-validated
umi CCACAGGCCT = 40 reads: +66 -11 +232 -2 +13 -1 +3 -1 +2 -11 +11 -1 +14 -1 +5 -1 +5 -1 +1 non-validated
umi CCACATCTAG = 13 reads: +159 -14 +115 -83 +11 non-validated
umi CCACATTTCC = 29 reads: +94 -1 +7 -2 +254 -18 +6 non-validated
umi CCACCCTGTC = 40 reads: +382 validated
umi CCACCGATGG = 27 reads: +311 -7 +64 non-validated
umi CCACCGGTCT = 36 reads: +359 -1 +10 -1 +1 -1X +1 -2X +1 -1 +1 -2 +1 invalidated
umi CCACGACAGC = 31 reads: +258 -7 +85 -3 +29 non-validated
umi CCACGCCTTG = 35 reads: +366 -8 +6 -1 +1 non-validated
umi CCACGCTCCT = 45 reads: +350 -1 +2 -1 +3 -2 +1 -4X +1 -1 +2 -2 +2 -1 +2 -1 +3 -1 +1 -1 invalidated
umi CCACGTCTCT = 25 reads: -8 +39 -1X +21 -1 +15 -1 +2 -1 +2 -1 +290 invalidated
umi CCACTACAGA = 19 reads: +25 -6 +75 -1 +157 -23 +56 -39 non-validated
umi CCACTCGACA = 29 reads: +332 -34 +16 non-validated
umi CCACTGAGCT = 14 reads: -52 +193 -1XX +29 -107 invalidated
umi CCACTTACGG = 41 reads: +382 validated
umi CCACTTAGGC = 28 reads: +18 -11 +292 -54 +7 non-validated
umi CCACTTCATG = 26 reads: +49 -14 +156 -19 +119 -16 +9 non-validated
umi CCACTTTATG = 17 reads: +58 -1X +10 -1 +1 -14 +21 -1X +34 -49 +192 invalidated
umi CCACTTTCCC = 21 reads: +9 -1 +5 -1 +19 -40 +3 -1 +14 -1 +137 -8 +143 non-validated
umi CCAGACCTCT = 34 reads: +209 -6 +135 -4 +28 non-validated
umi CCAGACCTTC = 17 reads: +132 -1 +1 -1 +1 -6X +3 -4X +8 -1 +119 -10 +56 -39 invalidated
umi CCAGACGTTC = 24 reads: +66 -13 +270 -33 non-validated
umi CCAGAGGATA = 32 reads: +379 -3 non-validated
umi CCAGAGGATG = 22 reads: +5 -10 +219 -2 +89 -57 non-validated
umi CCAGATCTGT = 24 reads: -45 +9 -2 +326 non-validated
umi CCAGCCCTGC = 34 reads: +382 validated
umi CCAGCCGTCT = 13 reads: -29 +279 -63 +11 non-validated
umi CCAGCGCACC = 46 reads: +382 validated
umi CCAGGACACC = 34 reads: +382 validated
umi CCAGGGGATT = 26 reads: +2 -1 +1 -7 +2 -3X +1 -2 +2 -1 +4 -1X +1 -11 +75 -1 +6 -13 +248 invalidated
umi CCAGGGTCGG = 28 reads: +202 -6 +174 non-validated
umi CCAGGTGGGT = 15 reads: +3 -1 +3 -1 +4 -9 +170 -24 +167 non-validated
umi CCAGTGCCAT = 33 reads: -14 +14 -2 +1 -1X +4 -3 +3 -3 +312 -25 invalidated
umi CCAGTGTTTG = 21 reads: -8 +54 -1XX +1 -1XX +1 -24XX +236 -1X +39 -1 +15 invalidated
umi CCAGTTTAGC = 31 reads: +330 -52 non-validated
umi CCATAAGGGG = 31 reads: -45 +325 -1 +11 non-validated
umi CCATACACGG = 29 reads: +9 -1 +299 -7 +56 -10 non-validated
umi CCATACTCGT = 27 reads: +6 -1 +2 -1 +2 -1 +333 -36 non-validated
umi CCATACTCTG = 15 reads: -23 +59 -3 +146 -72 +79 non-validated
umi CCATATACCC = 25 reads: +342 -1 +22 -17 non-validated
umi CCATCACGGG = 44 reads: +382 validated
umi CCATCGCCCC = 26 reads: -59 +245 -1 +4 -16 +49 -1 +6 -1 non-validated
umi CCATGAGCAC = 40 reads: +382 validated
umi CCATGCACGC = 33 reads: -34 +253 -5 +70 -20 non-validated
umi CCATGCGGTC = 23 reads: -6 +193 -7 +176 non-validated
umi CCATGCTTAC = 36 reads: +382 validated
umi CCATGGGGTC = 27 reads: +266 -9 +107 non-validated
umi CCATGTACCA = 23 reads: +382 validated
umi CCATGTTCCT = 22 reads: +10 -5 +8 -1 +1 -1 +254 -46 +56 non-validated
umi CCATTCTATT = 23 reads: +310 -10 +36 -2X +18 -6 invalidated
umi CCATTCTCCG = 32 reads: +382 validated
umi CCATTCTTCC = 35 reads: -12 +56 -2 +234 -22 +56 non-validated
umi CCCAACCCGC = 33 reads: +236 -26 +120 non-validated
umi CCCAACGCTC = 20 reads: +72 -1 +12 -9 +149 -2 +74 -1 +28 -1 +4 -1 +10 -2 +2 -1 +9 -1X +3 invalidated
umi CCCAATAGGG = 25 reads: +30 -1 +14 -1 +6 -1 +298 -31 non-validated
umi CCCAATCTTC = 25 reads: +305 -2 +75 non-validated
umi CCCAATGCCT = 84 reads: -213X +169 invalidated
umi CCCACAGGCC = 25 reads: +266 -1 +115 non-validated
umi CCCACAGGCT = 55 reads: -15 +367 non-validated
umi CCCACAGTCC = 32 reads: -22 +286 -33 +3 -1 +37 non-validated
umi CCCACATTTC = 26 reads: -29 +251 -1 +35 -5 +61 non-validated
umi CCCACCGGGT = 44 reads: +382 validated
umi CCCACCTCCC = 34 reads: +382 validated
umi CCCACGTCGT = 27 reads: +357 -3 +1 -2 +2 -2 +1 -5X +9 invalidated
umi CCCACTAGCC = 32 reads: -15 +367 non-validated
umi CCCACTGTGT = 24 reads: +309 -42 +1 -1 +29 non-validated
umi CCCACTTTCC = 15 reads: -12 +101 -16 +95 -14 +118 -26 non-validated
umi CCCAGAACCC = 33 reads: +11 -13 +358 non-validated
umi CCCAGACCGG = 35 reads: +347 -1 +3 -1 +13 -14 +2 -1 non-validated
umi CCCAGCGGCC = 29 reads: +329 -30 +23 non-validated
umi CCCAGTCAGC = 19 reads: +20 -4 +136 -1X +203 -6 +12 invalidated
umi CCCAGTCGGG = 37 reads: -13 +2 -1 +366 non-validated
umi CCCATACACC = 22 reads: -2 +3 -1 +1 -1 +1 -21 +67 -1 +64 -1 +219 non-validated
umi CCCATAGCCT = 22 reads: +61 -1 +289 -28 +3 non-validated
umi CCCATATAGC = 27 reads: +382 validated
umi CCCATATCCA = 28 reads: -13 +369 non-validated
umi CCCATATCTC = 19 reads: -11 +347 -24 non-validated
umi CCCATCCCTC = 24 reads: +284 -15 +83 non-validated
umi CCCATCTCCT = 31 reads: -24 +358 non-validated
umi CCCATGCAAC = 27 reads: +9 -1 +19 -1 +260 -1 +91 non-validated
umi CCCATTAATG = 33 reads: +20 -10 +352 non-validated
umi CCCATTGTTC = 34 reads: +2 -1 +3 -1 +2 -4 +369 non-validated
umi CCCCACATCC = 31 reads: +2 -1 +25 -2 +76 -1 +204 -1X +34 -1X +11 -1 +10 -1 +3 -1 +3 -5 invalidated
umi CCCCACATCT = 25 reads: -11 +371 non-validated
umi CCCCACCCTC = 39 reads: +197 -1XX +179 -5 invalidated
umi CCCCACCTGC = 25 reads: +24 -7 +1 -1X +349 invalidated
umi CCCCAGAGTG = 29 reads: +53 -1 +20 -1X +215 -1 +91 invalidated
umi CCCCAGCGAC = 38 reads: +382 validated
umi CCCCATAGGT = 35 reads: -10 +356 -1X +10 -5 invalidated
umi CCCCCACTGC = 31 reads: +20 -1X +62 -21 +15 -1X +1 -1X +260 invalidated
umi CCCCCAGGGT = 27 reads: +382 validated
umi CCCCCCCCTC = 18 reads: +35 -1 +11 -1 +14 -1 +6 -24 +6 -1 +4 -1 +135 -1 +9 -1 +5 -23 +91 -10 +2 non-validated
umi CCCCCCGGAC = 41 reads: +367 -2 +13 non-validated
umi CCCCCGTCAC = 31 reads: -22 +333 -1 +1 -2 +23 non-validated
umi CCCCCGTCTG = 37 reads: +2 -1 +379 non-validated
umi CCCCCTCGCC = 14 reads: +31 -29 +125 -1 +7 -42 +93 -54 non-validated
umi CCCCCTTTAG = 38 reads: +358 -1 +23 non-validated
umi CCCCGAATCG = 23 reads: -11 +303 -68 non-validated
umi CCCCGAGCCC = 17 reads: +201 -6 +175 non-validated
umi CCCCGCACCT = 14 reads: +25 -23 +56 -18 +80 -5 +112 -1 +24 -17 +20 -1 non-validated
umi CCCCGCTCTC = 32 reads: +69 -18 +295 non-validated
umi CCCCGGCTCT = 29 reads: +280 -12 +90 non-validated
umi CCCCGTAATC = 24 reads: -63 +2 -1 +1 -1 +313 -1 non-validated
umi CCCCGTGATG = 29 reads: +382 validated
umi CCCCGTTTTC = 34 reads: +382 validated
umi CCCCTACCCG = 40 reads: +382 validated
umi CCCCTCATGC = 24 reads: +382 validated
umi CCCCTCTCTC = 21 reads: +7 -2 +1 -1 +5 -1 +365 non-validated
umi CCCCTGCTGC = 18 reads: -13 +28 -1 +15 -1 +12 -1 +183 -1 +127 non-validated
umi CCCCTGTAGG = 31 reads: -25 +178 -1 +4 -1 +21 -2 +16 -1 +116 -17 non-validated
umi CCCCTGTATG = 36 reads: -6 +376 non-validated
umi CCCCTTTGTT = 36 reads: +382 validated
umi CCCGACTGCC = 34 reads: +382 validated
umi CCCGATCTCC = 40 reads: +382 validated
umi CCCGATGTTC = 28 reads: -22 +4 -1 +13 -1 +341 non-validated
umi CCCGATTGTG = 26 reads: +335 -10 +28 -1 +8 non-validated
umi CCCGCAAATC = 29 reads: +342 -6 +34 non-validated
umi CCCGCATCCT = 60 reads: +382 validated
umi CCCGCGAGTC = 40 reads: -15 +366 -1 non-validated
umi CCCGCGGCTG = 15 reads: -18 +225 -1 +67 -1X +8 -1 +18 -43 invalidated
umi CCCGCTCCCT = 31 reads: +330 -52 non-validated
umi CCCGCTCCGG = 25 reads: +382 validated
umi CCCGGACGTC = 36 reads: +26 -1 +317 -38 non-validated
umi CCCGGACTCC = 31 reads: +5 -19 +96 -1 +92 -1 +71 -1 +96 non-validated
umi CCCGGCCTCC = 19 reads: -29 +2 -1 +1 -1 +1 -1 +68 -1 +205 -68 +3 -1 non-validated
umi CCCGGTCATG = 35 reads: +382 validated
umi CCCGTCTTCG = 23 reads: +116 -12 +221 -1 +27 -1 +4 non-validated
umi CCCGTGCATA = 21 reads: +2 -2 +11 -1 +13 -2 +2 -60 +157 -13 +119 non-validated
umi CCCGTGTACC = 32 reads: +330 -29 +23 non-validated
umi CCCGTTCCTT = 24 reads: -10 +366 -6 non-validated
umi CCCGTTCGCT = 26 reads: +10 -1 +15 -1 +58 -25 +201 -9 +35 -1 +14 -1 +11 non-validated
umi CCCGTTCGGT = 30 reads: +69 -18 +295 non-validated
umi CCCGTTGCCT = 14 reads: +26 -35 +219 -102 non-validated
umi CCCTACTGTC = 32 reads: +325 -1X +4 -2X +3 -2X +9 -1X +1 -2X +1 -4X +27 invalidated
umi CCCTAGATCC = 40 reads: +382 validated
umi CCCTAGTCAG = 19 reads: -12 +84 -1 +238 -47 non-validated
umi CCCTATTCCT = 34 reads: +358 -1X +23 invalidated
umi CCCTCAATCG = 45 reads: +382 validated
umi CCCTCAGCTC = 39 reads: +374 -1 +7 non-validated
umi CCCTCATTAC = 15 reads: +34 -25 +160 -57 +106 non-validated
umi CCCTCCCGGC = 43 reads: +369 -13 non-validated
umi CCCTCTATAC = 16 reads: -13 +197 -13 +85 -1 +1 -29 +5 -2 +1 -1 +1 -1 +2 -1 +1 -1 +27 non-validated
umi CCCTCTTAGC = 27 reads: +58 -16 +31 -1 +225 -1 +2 -2 +46 non-validated
umi CCCTCTTGGC = 26 reads: +10 -1XX +264 -13 +9 -1 +84 invalidated
umi CCCTGACCCT = 21 reads: +244 -1 +15 -13 +5 -1 +1 -2 +1 -1 +9 -1 +17 -1 +70 non-validated
umi CCCTGACGCT = 22 reads: +133 -1XX +119 -1 +2 -1 +71 -54 invalidated
umi CCCTGCTGCC = 23 reads: -31 +106 -56 +189 non-validated
umi CCCTGGCTCT = 48 reads: +382 validated
umi CCCTGGTGTA = 43 reads: +304 -9 +56 -13 non-validated
umi CCCTGTCACT = 35 reads: +382 validated
umi CCCTGTTGGG = 45 reads: +321 -1 +1 -2 +18 -4 +8 -1 +8 -1 +17 non-validated
umi CCCTTATACC = 38 reads: +297 -4 +56 -21 +4 non-validated
umi CCCTTCCCTC = 25 reads: +2 -1 +4 -1 +2 -2 +2 -1 +6 -1 +326 -1 +1 -32 non-validated
umi CCCTTCCTCT = 16 reads: -12 +56 -4 +99 -1 +91 -20 +56 -17 +5 -1 +4 -1 +15 non-validated
umi CCCTTGCATC = 31 reads: -39 +328 -15 non-validated
umi CCCTTGTTCG = 35 reads: +320 -1 +27 -1X +33 invalidated
umi CCCTTTATCG = 27 reads: +382 validated
umi CCGAAAAGTC = 31 reads: +9 -2 +371 non-validated
umi CCGAACATGC = 31 reads: -18 +364 non-validated
umi CCGAATCGTC = 23 reads: -7 +311 -64 non-validated
umi CCGACAGCCG = 32 reads: +382 validated
umi CCGACTGGTG = 24 reads: +96 -8 +149 -1 +2 -1 +105 -20 non-validated
umi CCGAGAGGCC = 27 reads: -12 +297 -5 +68 non-validated
umi CCGATCTCTC = 24 reads: -43 +179 -13 +122 -25 non-validated
umi CCGCAATCGG = 19 reads: -29 +195 -2 +7 -2 +19 -1 +15 -75 +37 non-validated
umi CCGCAATCTA = 33 reads: +85 -1X +237 -1 +58 invalidated
umi CCGCAGCATA = 19 reads: +291 -8 +46 -1 +2 -1 +5 -1 +2 -1 +24 non-validated
umi CCGCAGCCTC = 25 reads: +287 -5 +90 non-validated
umi CCGCCGGTCG = 19 reads: -19 +294 -58 +11 non-validated
umi CCGCGTATCG = 32 reads: -6 +345 -1 +13 -1 +4 -1 +7 -1 +3 non-validated
umi CCGCTATCGG = 23 reads: +85 -12 +213 -14 +58 non-validated
umi CCGCTCTCAA = 29 reads: +55 -1 +1 -1X +4 -1 +4 -1 +297 -17 invalidated
umi CCGCTTCATA = 26 reads: +173 -1 +208 non-validated
umi CCGCTTTCCC = 24 reads: -28 +281 -5 +11 -1 +11 -1 +3 -1 +9 -2 +14 -1 +2 -12 non-validated
umi CCGCTTTTCA = 31 reads: -47 +251 -3 +81 non-validated
umi CCGGAACCCT = 35 reads: +382 validated
umi CCGGAACCTG = 27 reads: -16 +366 non-validated
umi CCGGACATGG = 26 reads: -13 +12 -1 +9 -1 +7 -1 +2 -1 +4 -1 +1 -2 +3 -1 +6 -1 +2 -15 +268 -20 +1 -1 +9 non-validated
umi CCGGATGCTC = 14 reads: +19 -5 +59 -1 +164 -66 +66 -2 non-validated
umi CCGGCACCAA = 33 reads: +6 -2 +2 -1 +371 non-validated
umi CCGGCACTCA = 33 reads: +51 -13 +247 -3 +56 -1 +11 non-validated
umi CCGGCAGCTC = 40 reads: +382 validated
umi CCGGCCAACC = 18 reads: +53 -16 +157 -1X +155 invalidated
umi CCGGCCCTGC = 41 reads: +360 -1 +21 non-validated
umi CCGGCCGCTC = 39 reads: +2 -1 +6 -2 +4 -1 +2 -1 +5 -1 +2 -1 +1 -1 +5 -1 +6 -1 +1 -19 +280 -39 non-validated
umi CCGGCTCCAA = 39 reads: +382 validated
umi CCGGCTTCTT = 30 reads: +372 -10 non-validated
umi CCGGGACTCC = 30 reads: +382 validated
umi CCGGGTCTCT = 40 reads: +47 -9 +326 non-validated
umi CCGGGTTTTG = 25 reads: -2 +286 -6 +81 -7 non-validated
umi CCGGTACAGG = 28 reads: -6 +272 -1X +36 -5 +62 invalidated
umi CCGTACTCCC = 24 reads: +23 -34 +284 -1 +8 -1 +15 -1 +3 -1 +11 non-validated
umi CCGTATTGGT = 36 reads: -30 +311 -1 +40 non-validated
umi CCGTCACCGT = 30 reads: +54 -1 +21 -1 +3 -2 +291 -9 non-validated
umi CCGTCACCTA = 30 reads: +382 validated
umi CCGTCCTCCG = 32 reads: +7 -2 +3 -1 +5 -31 +2 -2 +4 -1 +324 non-validated
umi CCGTCCTCGG = 28 reads: +2 -2 +5 -2 +1 -3 +2 -2 +2 -1 +7 -1 +335 -4 +7 -1 +1 -2 +2 non-validated
umi CCGTCGATGG = 18 reads: +311 -1 +15 -1 +7 -47 non-validated
umi CCGTCTAGCT = 31 reads: -10 +12 -1X +359 invalidated
umi CCGTCTGCGG = 12 reads: -11 +91 -61 +2 -2 +80 -6 +56 -73 non-validated
umi CCGTGCCCCA = 25 reads: +63 -1X +180 -1 +3 -2 +122 -10 invalidated
umi CCGTGTGTCT = 29 reads: -7 +375 non-validated
umi CCGTTGGGGG = 21 reads: +13 -1 +150 -4 +153 -61 non-validated
umi CCGTTGGGTC = 38 reads: -31 +1 -2 +1 -2 +1 -1 +2 -1 +289 -14 +37 non-validated
umi CCTAAACTCA = 36 reads: +382 validated
umi CCTAACCGTC = 17 reads: -8 +242 -104 +28 non-validated
umi CCTAACGTCC = 24 reads: +381 -1 non-validated
umi CCTAAGATCC = 18 reads: -7 +258 -2 +5 -2 +6 -1 +2 -1 +10 -1 +87 non-validated
umi CCTAATAGTC = 31 reads: +281 -40 +61 non-validated
umi CCTAATCGCG = 31 reads: +6 -1 +2 -4 +337 -30 +2 non-validated
umi CCTACAGCCG = 19 reads: +134 -1 +21 -1 +1 -1 +1 -1 +3 -5 +179 -1 +8 -25 non-validated
umi CCTACATGCC = 21 reads: -45 +56 -13 +5 -1 +250 -1 +11 non-validated
umi CCTACCTTGG = 36 reads: +200 -1 +181 non-validated
umi CCTACGCATA = 40 reads: +135 -1XX +244 -2 invalidated
umi CCTACTGATA = 20 reads: +312 -70 non-validated
umi CCTACTGTCC = 35 reads: +382 validated
umi CCTACTTCGC = 29 reads: -2 +380 non-validated
umi CCTAGCACAC = 34 reads: -14 +314 -6 +2 -3 +29 -1 +11 -1 +1 non-validated
umi CCTAGTGTTC = 31 reads: +382 validated
umi CCTAGTTCGC = 38 reads: +382 validated
umi CCTAGTTTCT = 26 reads: -10 +1 -1 +2 -1 +59 -9 +187 -25 +28 -1 +25 -1XX +5 -1 +26 invalidated
umi CCTATAACCG = 33 reads: +377 -5 non-validated
umi CCTATATTGA = 18 reads: +199 -32 +110 -1 +3 -1 +5 -23 +8 non-validated
umi CCTATCATTC = 24 reads: -5 +290 -26 +23 -1 +37 non-validated
umi CCTATCCTTC = 27 reads: +54 -16 +312 non-validated
umi CCTATGCACC = 18 reads: +8 -1 +2 -1 +45 -1 +11 -1 +136 -2 +1 -22 +8 -1 +81 -50 +11 non-validated
umi CCTATGTACG = 17 reads: -46 +153 -6 +72 -7 +63 -6 +29 non-validated
umi CCTATGTATC = 28 reads: +355 -24 +3 non-validated
umi CCTATGTTGC = 21 reads: +45 -15 +93 -1 +2 -2X +7 -3 +1 -1 +1 -1 +4 -2X +74 -1 +1 -2 +2 -1 +2 -1 +6 -1 +4 -2 +1 -15 +56 -35 invalidated
umi CCTATTCCTC = 22 reads: -63 +57 -8 +28 -1 +225 non-validated
umi CCTATTCTGC = 37 reads: -20 +330 -10 +22 non-validated
umi CCTATTGCCT = 34 reads: +4 -1 +377 non-validated
umi CCTCACCCTG = 46 reads: -16 +366 non-validated
umi CCTCACCTGC = 18 reads: +41 -7 +52 -1 +117 -1 +56 -107 non-validated
umi CCTCAGCGCC = 32 reads: +15 -11 +9 -1 +62 -1 +283 non-validated
umi CCTCATGATT = 33 reads: +382 validated
umi CCTCATGGCC = 25 reads: +203 -5 +103 -38 +32 -1X invalidated
umi CCTCATGGGT = 32 reads: +344 -1 +28 -9 non-validated
umi CCTCCAGGAC = 21 reads: +236 -25 +104 -17 non-validated
umi CCTCCATGCG = 30 reads: +7 -22 +353 non-validated
umi CCTCCCGACT = 14 reads: +49 -1 +215 -15 +102 non-validated
umi CCTCCCGGGT = 26 reads: -22 +173 -1 +186 non-validated
umi CCTCCTGTAT = 31 reads: +5 -1 +362 -1 +1 -1 +5 -1 +2 -1 +2 non-validated
umi CCTCGGAATC = 22 reads: +8 -6 +195 -1 +172 non-validated
umi CCTCGGCCCT = 30 reads: +331 -1 +5 -20 +4 -1 +3 -1X +5 -2 +9 invalidated
umi CCTCTAATTC = 25 reads: +313 -69 non-validated
umi CCTCTACCCC = 20 reads: -18 +277 -1X +8 -22 +1 -1 +5 -1 +1 -1 +46 invalidated
umi CCTCTATATC = 28 reads: -3X +320 -59 invalidated
umi CCTCTCTTCT = 25 reads: -6 +324 -52 non-validated
umi CCTCTTGGCC = 15 reads: -19 +107 -5 +175 -16 +6 -1 +53 non-validated
umi CCTCTTGTGG = 42 reads: +7 -1 +374 non-validated
umi CCTCTTTACG = 30 reads: -29 +353 non-validated
umi CCTCTTTGAC = 34 reads: +382 validated
umi CCTGACTGGG = 39 reads: +382 validated
umi CCTGAGCCCT = 41 reads: +4 -1 +4 -2 +2 -4X +365 invalidated
umi CCTGATTGGT = 32 reads: +382 validated
umi CCTGCGCTCT = 37 reads: -2 +262 -24 +94 non-validated
umi CCTGCTGTTG = 13 reads: -64 +14 -1 +303 non-validated
umi CCTGCTTCGC = 35 reads: +382 validated
umi CCTGGTCTCT = 22 reads: +254 -1 +3 -1 +19 -2 +56 -46 non-validated
umi CCTGTAAGGT = 29 reads: +37 -23 +322 non-validated
umi CCTGTATCCG = 26 reads: +3 -3 +1 -1 +1 -2 +330 -11 +30 non-validated
umi CCTGTGTCCC = 33 reads: +13 -1 +180 -31 +157 non-validated
umi CCTGTTTTGG = 24 reads: +171 -4 +199 -1 +7 non-validated
umi CCTTAACTAG = 24 reads: -34 +245 -1 +99 -1 +1 -1 non-validated
umi CCTTAATACC = 24 reads: +382 validated
umi CCTTAATCCT = 17 reads: +6 -1 +12 -1 +20 -20 +228 -47 +6 -1 +4 -1 +10 -2 +3 -1 +1 -1 +17 non-validated
umi CCTTACGAAC = 32 reads: +373 -9 non-validated
umi CCTTACTCCA = 34 reads: +344 -1 +3 -34 non-validated
umi CCTTAGACTG = 23 reads: -13 +239 -4X +2 -4X +43 -14 +63 invalidated
umi CCTTAGTGTA = 34 reads: +39 -1XX +253 -2 +8 -2 +77 invalidated
umi CCTTATCTGT = 28 reads: -20 +352 -10 non-validated
umi CCTTATGGGT = 24 reads: +311 -3 +19 -1X +43 -5 invalidated
umi CCTTCACTCT = 36 reads: -2 +363 -17 non-validated
umi CCTTCTGGGG = 27 reads: -43 +148 -2 +111 -3 +5 -1 +59 -10 non-validated
umi CCTTGCGCGC = 41 reads: +319 -15 +48 non-validated
umi CCTTGGGTAG = 38 reads: +29 -1 +1 -1X +3 -1 +303 -43 invalidated
umi CCTTGGTGTC = 32 reads: -13 +369 non-validated
umi CCTTGTACAA = 32 reads: -3 +379 non-validated
umi CCTTGTCACC = 19 reads: +20 -1 +69 -5 +5 -1 +82 -22 +177 non-validated
umi CCTTTAGACG = 24 reads: +366 -3 +2 -1 +1 -2 +2 -1 +4 non-validated
umi CCTTTAGGAC = 23 reads: -10 +372 non-validated
umi CCTTTCCCTC = 27 reads: +7 -6 +319 -16 +34 non-validated
umi CCTTTGAGTT = 22 reads: +382 validated
umi CGAAACCGGC = 35 reads: +382 validated
umi CGAAAGCGTC = 30 reads: -2 +237 -1XX +40 -2 +94 -6 invalidated
umi CGAAATACCA = 19 reads: -17 +53 -1X +226 -1 +84 invalidated
umi CGAAATGCCC = 28 reads: +34 -3 +128 -22 +100 -5 +90 non-validated
umi CGAACATAGT = 33 reads: -13 +369 non-validated
umi CGAAGTTCCC = 36 reads: +310 -4 +68 non-validated
umi CGAATGATCG = 28 reads: +267 -1 +71 -15 +28 non-validated
umi CGAATGTTTG = 40 reads: +15 -1 +9 -1 +356 non-validated
umi CGACATACCT = 32 reads: +355 -1 +2 -1 +5 -1 +2 -1 +14 non-validated
umi CGACCTACAC = 42 reads: +382 validated
umi CGACCTTTGG = 35 reads: -12 +370 non-validated
umi CGACGCCGTA = 37 reads: +2 -1 +32 -1 +12 -1 +324 -9 non-validated
umi CGACTCGCCG = 27 reads: -25 +156 -5 +20 -1 +1 -1 +1 -1 +1 -1 +8 -1X +1 -1X +1 -1X +156 invalidated
umi CGACTCTCCT = 23 reads: -13 +327 -1 +7 -1 +5 -28 non-validated
umi CGACTCTTCC = 31 reads: +382 validated
umi CGACTGTCTT = 23 reads: -13 +316 -1 +2 -18 +20 -1 +11 non-validated
umi CGACTTATGA = 25 reads: +80 -8 +222 -1 +16 -32 +11 -1 +11 non-validated
umi CGACTTTGTG = 22 reads: +382 validated
umi CGAGTACTTC = 26 reads: +59 -1 +322 non-validated
umi CGAGTTCGTC = 18 reads: +153 -10 +130 -1 +18 -43 +13 -1X +13 invalidated
umi CGAGTTTTCC = 25 reads: -29 +237 -44 +34 -1 +34 -1 +2 non-validated
umi CGATATCTCG = 25 reads: +293 -13 +14 -1 +61 non-validated
umi CGATGCCTCA = 21 reads: +117 -1X +25 -15 +190 -7 +27 invalidated
umi CGATGGCTCC = 25 reads: +309 -1 +1 -1 +70 non-validated
umi CGATGGGCCG = 18 reads: -6 +1 -1X +4 -1 +263 -1 +1 -1 +1 -1 +1 -1 +2 -1 +1 -2 +1 -3 +5 -1 +3 -1 +2 -1 +2 -1 +1 -72 invalidated
umi CGATGTCGTC = 24 reads: +382 validated
umi CGATTACCCG = 40 reads: +21 -1 +340 -5 +15 non-validated
umi CGATTGTCCT = 32 reads: +5 -1 +350 -1 +4 -1 +4 -16 non-validated
umi CGATTTTTCT = 21 reads: +288 -33 +61 non-validated
umi CGCAACCGTC = 37 reads: -9 +373 non-validated
umi CGCAACTCCT = 29 reads: +91 -1XX +267 -1 +16 -1 +1 -1 +3 invalidated
umi CGCAATCCGG = 24 reads: -29 +353 non-validated
umi CGCACAAATG = 23 reads: -20 +230 -1 +3 -45 +83 non-validated
umi CGCACGACAC = 32 reads: +357 -2 +2 -1X +2 -2 +1 -1 +9 -1 +1 -1 +1 -1 invalidated
umi CGCACGGTGC = 37 reads: +1 -1 +241 -1 +138 non-validated
umi CGCACGGTTC = 50 reads: +1 -1 +4 -29 +8 -3 +5 -1 +2 -1 +327 non-validated
umi CGCAGGGCGG = 30 reads: +362 -20 non-validated
umi CGCATACGGG = 28 reads: +342 -1 +3 -1 +35 non-validated
umi CGCATAGCAC = 25 reads: +382 validated
umi CGCATATCCT = 32 reads: -25 +245 -31 +81 non-validated
umi CGCATCGAGT = 37 reads: -16 +5 -1 +360 non-validated
umi CGCATGCCCC = 37 reads: -5 +374 -1 +2 non-validated
umi CGCATTGGGA = 17 reads: +3 -21 +284 -74 non-validated
umi CGCATTGTGG = 27 reads: +362 -1 +1 -2 +16 non-validated
umi CGCCAACCCT = 29 reads: +382 validated
umi CGCCACCCGG = 32 reads: +313 -2 +67 non-validated
umi CGCCACCGAT = 37 reads: +362 -20 non-validated
umi CGCCATAACC = 24 reads: +68 -5 +206 -1XX +38 -1 +16 -1 +40 -6 invalidated
umi CGCCATCTCC = 31 reads: +33 -2 +1 -7X +1 -1 +312 -25 invalidated
umi CGCCCACCCC = 27 reads: +32 -9 +262 -50 +22 -1 +6 non-validated
umi CGCCCCCTTC = 25 reads: +198 -1 +5 -13 +165 non-validated
umi CGCCCCTAGC = 26 reads: +288 -17 +77 non-validated
umi CGCCCGGTAG = 34 reads: -10 +2 -1 +297 -1XX +71 invalidated
umi CGCCCTCCGT = 33 reads: +31 -1 +350 non-validated
umi CGCCGACTCC = 30 reads: +366 -1 +8 -1 +2 -1 +3 non-validated
umi CGCCGATCGG = 20 reads: +85 -3X +1 -2 +2 -1 +5 -1 +2 -1 +1 -1 +6 -1X +1 -10 +56 -11 +160 -32 invalidated
umi CGCCGGTTCC = 36 reads: +352 -2 +1 -1 +1 -25 non-validated
umi CGCCTACTTC = 34 reads: -11 +371 non-validated
umi CGCCTTCTTG = 36 reads: +382 validated
umi CGCCTTGCAC = 39 reads: +54 -33 +295 non-validated
umi CGCGATTTCC = 28 reads: +4 -1 +284 -1 +92 non-validated
umi CGCGGACTGG = 42 reads: +347 -2 +33 non-validated
umi CGCTACTTCC = 23 reads: +88 -22 +208 -21 +43 non-validated
umi CGCTAGTGCG = 39 reads: +382 validated
umi CGCTCAGAGT = 27 reads: +355 -27 non-validated
umi CGCTCGGCTC = 31 reads: +193 -10 +179 non-validated
umi CGCTCTCCGC = 33 reads: +382 validated
umi CGCTGCCGCC = 31 reads: +5 -1 +2 -2 +16 -2 +10 -1 +298 -1X +2 -1X +17 -24 invalidated
umi CGCTGTTATG = 23 reads: -13 +200 -21 +148 non-validated
umi CGCTTAAGCC = 30 reads: +280 -7 +12 -1XX +82 invalidated
umi CGCTTGGTTA = 28 reads: -4 +153 -12 +1 -2X +210 invalidated
umi CGCTTTTACC = 29 reads: +382 validated
umi CGGATCGCCC = 18 reads: -98 +116 -1 +167 non-validated
umi CGGATGTCTA = 20 reads: -11 +297 -71 +3 non-validated
umi CGGCAGCATA = 39 reads: +382 validated
umi CGGCCCGCCG = 25 reads: +297 -9 +76 non-validated
umi CGGCGACCCT = 29 reads: +316 -41 +13 -1 +11 non-validated
umi CGGCGACTCT = 19 reads: -13 +207 -7X +1 -1 +1 -1 +2 -5X +1 -1 +2 -1X +59 -49 +1 -1 +29 invalidated
umi CGGCGCCCGC = 38 reads: +310 -20 +15 -2 +3 -1 +2 -1 +2 -1 +11 -1 +13 non-validated
umi CGGCGGCACC = 24 reads: +15 -6 +266 -29 +21 -1 +15 -1 +28 non-validated
umi CGGCGGGAGG = 38 reads: +382 validated
umi CGGCGTTATA = 27 reads: +74 -1XX +261 -1 +35 -10 invalidated
umi CGGCGTTCTC = 31 reads: +25 -5 +191 -1 +112 -1 +31 -1 +8 -2 +4 -1 non-validated
umi CGGCTACTCC = 40 reads: -1 +381 non-validated
umi CGGCTTGGCC = 29 reads: +1 -1 +1 -1 +304 -9 +65 non-validated
umi CGGGACTCCG = 26 reads: +36 -1 +6 -1 +2 -1 +309 -11 +15 non-validated
umi CGGGCCCGCC = 29 reads: +49 -1 +3 -8X +241 -24 +56 invalidated
umi CGGTACGTAC = 18 reads: -3 +56 -11 +60 -1 +2 -1 +142 -26 +56 -13 +11 non-validated
umi CGGTAGTTTC = 25 reads: +273 -13 +75 -15 +6 non-validated
umi CGGTCTCATA = 35 reads: +362 -20 non-validated
umi CGGTTACCTG = 59 reads: +382 validated
umi CGGTTGTTCG = 34 reads: -16 +261 -17 +56 -3 +29 non-validated
umi CGGTTTATCT = 33 reads: +45 -3 +9 -1 +324 non-validated
umi CGTAATATAG = 23 reads: -2 +312 -68 non-validated
umi CGTAATATGC = 23 reads: -10 +372 non-validated
umi CGTACCGCGC = 22 reads: -9 +34 -1 +236 -36 +4 -1 +1 -2 +11 -1 +1 -1 +2 -1 +3 -1X +6 -1 +9 -1 +1 -1 +3 -1 +4 -10 invalidated
umi CGTACCGTCC = 31 reads: -19 +363 non-validated
umi CGTAGATGGG = 29 reads: -10 +56 -2 +314 non-validated
umi CGTAGGATTG = 34 reads: -10 +7 -1 +286 -13 +65 non-validated
umi CGTATAGTCG = 33 reads: +361 -1X +20 invalidated
umi CGTATATGGT = 22 reads: -13 +297 -16 +56 non-validated
umi CGTATCAATT = 26 reads: +362 -20 non-validated
umi CGTATCGTCA = 32 reads: -2 +339 -41 non-validated
umi CGTATGCGTA = 30 reads: +284 -53 +45 non-validated
umi CGTCAATGGG = 32 reads: +115 -1X +188 -2 +14 -1 +4 -1 +37 -1 +1 -17 invalidated
umi CGTCACCCTG = 28 reads: +249 -8 +56 -60 +9 non-validated
umi CGTCACCTAC = 26 reads: +335 -5 +42 non-validated
umi CGTCATATTA = 29 reads: +337 -1 +17 -1 +26 non-validated
umi CGTCCATTTA = 34 reads: +342 -1 +4 -1 +2 -32 non-validated
umi CGTCCCCAGG = 16 reads: +13 -1 +53 -1 +25 -11 +111 -9 +63 -8 +87 non-validated
umi CGTCCGGGTG = 16 reads: +72 -1 +2 -18 +242 -1 +1 -1 +7 -3 +2 -1 +3 -1 +8 -19 non-validated
umi CGTCCGTATG = 28 reads: +1 -13 +368 non-validated
umi CGTCCGTTTC = 25 reads: +243 -11 +69 -36 +23 non-validated
umi CGTCCTAATG = 22 reads: +229 -16X +7 -2X +3 -12 +104 -9 invalidated
umi CGTCGACGCC = 29 reads: +28 -5 +56 -4 +264 -22 +3 non-validated
umi CGTCGCCTCC = 25 reads: +78 -9 +270 -2 +6 -1 +2 -1 +4 -9 non-validated
umi CGTCGGCATA = 25 reads: -8 +372 -2 non-validated
umi CGTCGGCTGC = 16 reads: +178 -9 +114 -35 +46 non-validated
umi CGTCGTCCAA = 13 reads: -79 +191 -84 +3 -1 +6 -1 +17 non-validated
umi CGTCGTCGTT = 23 reads: +233 -2 +10 -1 +2 -1 +11 -1 +9 -2 +1 -1 +108 non-validated
umi CGTCTAAACC = 31 reads: +11 -10 +260 -25 +8 -1 +67 non-validated
umi CGTCTAGTGG = 37 reads: +382 validated
umi CGTGCACTCG = 33 reads: +254 -5 +93 -1 +15 -1 +12 -1 non-validated
umi CGTGCCTTGC = 41 reads: -5 +377 non-validated
umi CGTGCTCCCC = 32 reads: -18 +301 -1 +3 -1 +58 non-validated
umi CGTGCTTCCC = 33 reads: +361 -1 +20 non-validated
umi CGTGGTAATG = 38 reads: +363 -1 +2 -1 +15 non-validated
umi CGTGTGCCAC = 30 reads: +382 validated
umi CGTGTTCCCC = 63 reads: +48 -1 +2 -2X +1 -1 +327 invalidated
umi CGTGTTGTTC = 40 reads: +382 validated
umi CGTTAACCCC = 30 reads: +53 -1 +2 -1 +264 -14 +47 non-validated
umi CGTTATAACG = 34 reads: -18 +249 -1 +1 -1 +3 -2 +1 -2 +3 -2 +4 -1 +10 -3 +13 -1 +67 non-validated
umi CGTTCGATGG = 12 reads: +93 -1 +26 -23 +13 -1 +63 -1 +14 -2 +17 -1 +118 -9 non-validated
umi CGTTCTCACG = 69 reads: -190 +7 -1 +9 -1 +2 -1 +2 -1 +168 non-validated
umi CGTTGATGTG = 31 reads: -31 +351 non-validated
umi CGTTGTCTCC = 22 reads: +321 -19 +3 -1 +20 -1 +13 -1 +3 non-validated
umi CGTTTAACAC = 38 reads: -12 +12 -1 +331 -26 non-validated
umi CGTTTCACCG = 24 reads: +382 validated
umi CGTTTTTCCC = 15 reads: -26 +204 -87 +25 -1 +22 -1 +7 -9 non-validated
umi CTAAAATAGG = 12 reads: -11 +251 -120 non-validated
umi CTAAACTCCC = 34 reads: +382 validated
umi CTAAATCCAC = 32 reads: +314 -7 +61 non-validated
umi CTAACACAGC = 27 reads: -7 +187 -2 +186 non-validated
umi CTAACATATC = 20 reads: +54 -1X +217 -1X +2 -1 +3 -1 +7 -1 +9 -1 +2 -1 +3 -1X +6 -71 invalidated
umi CTAACCCCCG = 34 reads: +357 -25 non-validated
umi CTAACGGCCC = 44 reads: +361 -1 +6 -1 +1 -12 non-validated
umi CTAACTACGT = 29 reads: +365 -17 non-validated
umi CTAAGAAGCC = 37 reads: +382 validated
umi CTAAGATCGT = 26 reads: +312 -9 +61 non-validated
umi CTAAGTCACT = 26 reads: +19 -7 +356 non-validated
umi CTAATACGGC = 23 reads: +89 -4 +263 -26 non-validated
umi CTAATCAGTC = 13 reads: +71 -22 +56 -28 +57 -1X +14 -13 +32 -1 +6 -1 +80 invalidated
umi CTACAAGGTC = 34 reads: +379 -1 +2 non-validated
umi CTACACCCGT = 25 reads: -10 +282 -90 non-validated
umi CTACACGGGC = 20 reads: -15 +234 -1 +127 -5 non-validated
umi CTACAGGTAC = 34 reads: +382 validated
umi CTACATCCGG = 26 reads: +264 -11X +1 -1 +17 -1X +40 -47 invalidated
umi CTACATCTGA = 29 reads: +301 -58 +3 -7 +1 -2 +4 -1 +2 -1 +2 non-validated
umi CTACCAACGG = 32 reads: +8 -1 +19 -31 +234 -1X +15 -8 +65 invalidated
umi CTACCAGCCC = 34 reads: -50 +8 -1 +28 -1 +5 -1 +1 -1 +286 non-validated
umi CTACCCCACC = 34 reads: +4 -1 +4 -1 +5 -1 +5 -1 +1 -2 +1 -1 +5 -2 +348 non-validated
umi CTACGATTCG = 39 reads: +382 validated
umi CTACGCCTCT = 39 reads: +330 -52 non-validated
umi CTACGGAGTA = 34 reads: +382 validated
umi CTACGTCCAC = 23 reads: +243 -1 +77 -4 +57 non-validated
umi CTACGTTCCC = 34 reads: +50 -3X +64 -4 +252 -9 invalidated
umi CTACTACCTC = 24 reads: -10 +28 -1XX +330 -13 invalidated
umi CTACTAGTGC = 43 reads: -13 +1 -1 +367 non-validated
umi CTACTCGTTG = 26 reads: +382 validated
umi CTACTGGGAG = 33 reads: -5 +377 non-validated
umi CTACTGGTTG = 27 reads: +356 -1 +17 -1 +1 -1 +5 non-validated
umi CTAGAAACGC = 39 reads: -22 +335 -25 non-validated
umi CTAGAAATGG = 22 reads: +249 -13 +100 -17 +3 non-validated
umi CTAGAATGGG = 26 reads: +258 -1 +100 -23 non-validated
umi CTAGATTCCC = 25 reads: +297 -12 +73 non-validated
umi CTAGCGGCGC = 28 reads: +225 -19 +138 non-validated
umi CTAGGGGCGC = 41 reads: +361 -5 +14 -1 +1 non-validated
umi CTAGGTGGCC = 25 reads: +34 -2 +250 -1 +95 non-validated
umi CTAGTAGATC = 36 reads: +16 -8 +358 non-validated
umi CTAGTAGTCC = 17 reads: +204 -38 +133 -7 non-validated
umi CTAGTCGTCC = 21 reads: +9 -47 +236 -1 +6 -47 +2 -2 +3 -2 +1 -3X +5 -1 +10 -2 +1 -2 +1 -1 invalidated
umi CTAGTCTCGT = 44 reads: +244 -1 +137 non-validated
umi CTATAACGGC = 23 reads: +209 -1 +88 -1XX +49 -34 invalidated
umi CTATAAGTCC = 39 reads: +29 -1XX +313 -1X +20 -3 +1 -1 +2 -1 +9 -1 invalidated
umi CTATACGTTG = 12 reads: -41 +100 -12 +56 -10 +84 -74 +5 non-validated
umi CTATCCTGGG = 34 reads: +254 -1 +110 -1 +5 -1 +9 -1X invalidated
umi CTATCGCGGT = 22 reads: -1 +2 -1 +1 -1 +281 -7 +67 -1 +20 non-validated
umi CTATGCTCCT = 21 reads: -3 +56 -12 +294 -17 non-validated
umi CTATTAACGC = 23 reads: +14 -8 +173 -1 +186 non-validated
umi CTATTAAGGG = 41 reads: +382 validated
umi CTATTAGTAT = 42 reads: +382 validated
umi CTATTGTGTG = 27 reads: +6 -11 +327 -31 +7 non-validated
umi CTATTTAACC = 37 reads: -12 +14 -1 +342 -1 +12 non-validated
umi CTATTTACCC = 26 reads: -3 +240 -7 +61 -24 +47 non-validated
umi CTCAACGACT = 32 reads: -10 +372 non-validated
umi CTCAACTCGT = 31 reads: +382 validated
umi CTCAATACCT = 35 reads: -11 +1 -3 +367 non-validated
umi CTCAATATTC = 20 reads: +189 -1 +53 -1 +1 -1 +136 non-validated
umi CTCACAGCTC = 36 reads: +26 -1XX +19 -1 +335 invalidated
umi CTCACCTTGC = 31 reads: -10 +280 -5 +87 non-validated
umi CTCACTGGGG = 36 reads: -47 +1 -1 +4 -1 +1 -4X +1 -1 +321 invalidated
umi CTCAGGTTTC = 21 reads: +346 -36 non-validated
umi CTCATAACCC = 21 reads: +297 -20 +65 non-validated
umi CTCATCCTGG = 35 reads: -5 +367 -1X +9 invalidated
umi CTCATCTCGA = 36 reads: +338 -1 +31 -12 non-validated
umi CTCATTCATA = 39 reads: -8 +282 -19 +73 non-validated
umi CTCATTGCAC = 13 reads: +7 -3 +214 -14 +62 -1 +10 -1 +1 -69 non-validated
umi CTCATTTGGG = 21 reads: -1 +281 -1 +4 -11 +73 -11 non-validated
umi CTCCAACCAC = 32 reads: +382 validated
umi CTCCACGCCT = 21 reads: +172 -1 +1 -1 +99 -52 +56 non-validated
umi CTCCACGCTC = 18 reads: +17 -51 +298 -16 non-validated
umi CTCCAGCGTC = 29 reads: -24 +232 -1 +37 -15 +73 non-validated
umi CTCCAGCGTG = 23 reads: -35 +200 -39 +9 -1 +60 -1 +22 -1 +2 -1 +3 -8 non-validated
umi CTCCATCGTG = 36 reads: +382 validated
umi CTCCATGCCC = 34 reads: -10 +351 -21 non-validated
umi CTCCCAGGAG = 34 reads: -22 +4 -2 +1 -1 +12 -1 +1 -1 +2 -1 +20 -1 +249 -13 +51 non-validated
umi CTCCCATATC = 39 reads: +308 -12 +62 non-validated
umi CTCCCATGCG = 42 reads: +290 -1X +91 invalidated
umi CTCCCTCTCT = 39 reads: +382 validated
umi CTCCCTTGCC = 24 reads: +372 -10 non-validated
umi CTCCGCCACC = 28 reads: +271 -68 +6 -1 +36 non-validated
umi CTCCGTACTA = 25 reads: +287 -92 +3 non-validated
umi CTCCGTATAC = 22 reads: -1 +159 -6 +190 -26 non-validated
umi CTCCGTCCGG = 30 reads: +308 -1 +21 -52 non-validated
umi CTCCTGACTA = 37 reads: +22 -1 +4 -7 +255 -1 +61 -2 +4 -1 +24 non-validated
umi CTCCTTTCCC = 43 reads: +382 validated
umi CTCCTTTGGG = 41 reads: -24 +323 -12 +11 -1 +11 non-validated
umi CTCCTTTTCC = 28 reads: +382 validated
umi CTCGAGGAGA = 44 reads: +382 validated
umi CTCGATCCTG = 25 reads: -6 +3 -1 +109 -7 +256 non-validated
umi CTCGCAAGAA = 37 reads: +301 -1X +80 invalidated
umi CTCGCACCCC = 34 reads: -13 +369 non-validated
umi CTCGCCGGTC = 26 reads: -8 +279 -12 +83 non-validated
umi CTCGCGCCCT = 15 reads: +48 -9 +254 -15 +56 non-validated
umi CTCGCGTCAG = 25 reads: +273 -36 +14 -1 +58 non-validated
umi CTCGCTGATA = 27 reads: +2 -1X +65 -8 +306 invalidated
umi CTCGGACCTC = 13 reads: +236 -18 +70 -1 +19 -1 +5 -32 non-validated
umi CTCGGACTCC = 26 reads: +292 -23 +42 -1 +24 non-validated
umi CTCGGTCCTG = 28 reads: +382 validated
umi CTCGTAACAG = 40 reads: +382 validated
umi CTCGTATTAG = 26 reads: +382 validated
umi CTCGTCGGGC = 20 reads: -4 +186 -1 +2 -19 +170 non-validated
umi CTCGTCTTGG = 16 reads: +160 -3 +62 -1 +8 -1 +127 -20 non-validated
umi CTCGTGAGCC = 23 reads: +249 -5 +108 -20 non-validated
umi CTCGTTCCGC = 31 reads: +382 validated
umi CTCTAAATGA = 25 reads: +382 validated
umi CTCTACATAC = 33 reads: +62 -1X +319 invalidated
umi CTCTACCTTA = 25 reads: +12 -6 +356 -8 non-validated
umi CTCTACTCCT = 14 reads: +69 -9 +159 -46 +68 -1 +30 non-validated
umi CTCTAGAGCC = 29 reads: +320 -2 +56 -4 non-validated
umi CTCTATAATA = 49 reads: +382 validated
umi CTCTATTAGG = 26 reads: +382 validated
umi CTCTCATCCC = 13 reads: -30 +224 -18 +10 -1X +11 -1X +33 -54 invalidated
umi CTCTCATGTG = 26 reads: +3 -1 +5 -1 +372 non-validated
umi CTCTCCGTCG = 15 reads: +72 -7 +18 -1 +131 -46 +107 non-validated
umi CTCTCGGGAC = 35 reads: +382 validated
umi CTCTCTATGG = 40 reads: +285 -1 +79 -17 non-validated
umi CTCTCTCACT = 29 reads: +365 -17 non-validated
umi CTCTCTTCTC = 37 reads: +337 -19 +26 non-validated
umi CTCTGATTCT = 20 reads: +7 -13 +158 -6 +198 non-validated
umi CTCTGCGCGG = 44 reads: -27 +355 non-validated
umi CTCTGGGATG = 23 reads: -5 +216 -39 +81 -41 non-validated
umi CTCTGGGCTG = 31 reads: +311 -40 +31 non-validated
umi CTCTGGGTCC = 30 reads: +339 -25 +18 non-validated
umi CTCTGTCAAC = 16 reads: -13 +211 -68 +18 -1 +2 -1 +9 -1 +24 -34 non-validated
umi CTCTTGGCCC = 33 reads: -8 +283 -14 +77 non-validated
umi CTCTTGTCCT = 19 reads: -2 +353 -27 non-validated
umi CTCTTTCGCC = 46 reads: +34 -2 +346 non-validated
umi CTCTTTGCTC = 30 reads: -15 +367 non-validated
umi CTGAAACCCG = 39 reads: -12 +370 non-validated
umi CTGAACGGCC = 24 reads: +382 validated
umi CTGACCTCCC = 33 reads: +373 -1X +8 invalidated
umi CTGAGTCATG = 24 reads: +75 -3 +3 -1 +107 -1 +192 non-validated
umi CTGATAACCC = 41 reads: -26 +353 -1 +2 non-validated
umi CTGATCTTCC = 29 reads: -14 +2 -1 +293 -72 non-validated
umi CTGCCCCCCT = 24 reads: +90 -4 +288 non-validated
umi CTGCCGCCAT = 17 reads: +209 -1 +5 -1 +27 -139 non-validated
umi CTGCCTTCTC = 32 reads: +382 validated
umi CTGCTACCCT = 25 reads: -14 +320 -48 non-validated
umi CTGCTAGGCC = 26 reads: +382 validated
umi CTGCTCAGTC = 37 reads: +382 validated
umi CTGGAATTTC = 36 reads: -2 +380 non-validated
umi CTGGAGGTCT = 37 reads: +382 validated
umi CTGGATTAGC = 41 reads: +234 -1 +14 -6 +1 -1 +1 -1 +123 non-validated
umi CTGGCAGATA = 26 reads: -5 +56 -1 +1 -1 +1 -2 +2 -10 +18 -1 +223 -61 non-validated
umi CTGGCATAAC = 29 reads: -13 +369 non-validated
umi CTGGCCCTTG = 29 reads: +297 -1 +72 -1 +4 -7 non-validated
umi CTGGCGTCTA = 32 reads: +9 -1 +1 -1 +1 -1 +352 -1 +3 -12 non-validated
umi CTGGGCCTTA = 42 reads: +382 validated
umi CTGGGTCGGA = 28 reads: +325 -5 +52 non-validated
umi CTGGTACAGG = 55 reads: -10 +372 non-validated
umi CTGGTTATAC = 38 reads: +344 -1 +37 non-validated
umi CTGTAACGTC = 35 reads: +343 -39 non-validated
umi CTGTAGGGGT = 30 reads: +320 -6 +56 non-validated
umi CTGTGGGCTC = 22 reads: -28 +1 -2 +230 -1 +2 -1 +62 -1 +47 -1 +5 -1 non-validated
umi CTGTTACCCT = 28 reads: +382 validated
umi CTGTTACCTC = 33 reads: -17 +365 non-validated
umi CTGTTCGTAG = 27 reads: +15 -29 +220 -38 +80 non-validated
umi CTGTTTGCCG = 25 reads: +233 -30 +3 -1 +71 -1 +3 -1 +2 -2 +4 -2 +1 -2 +1 -2 +3 -20 non-validated
umi CTTAAAATCC = 34 reads: +11 -1 +2 -3X +1 -18 +9 -1 +5 -2 +6 -1 +290 -32 invalidated
umi CTTAACGGGT = 33 reads: +357 -25 non-validated
umi CTTAAGGGTC = 28 reads: -30 +255 -3 +56 -9 +2 -1 +1 -2 +5 -3 +4 -2 +2 -1 +6 non-validated
umi CTTACACTCG = 31 reads: -10 +372 non-validated
umi CTTACATCCG = 30 reads: +47 -13 +216 -23 +2 -1 +80 non-validated
umi CTTACGATTC = 39 reads: +382 validated
umi CTTACGGGCC = 22 reads: -64 +143 -1 +173 -1 non-validated
umi CTTACTCCGC = 27 reads: +365 -17 non-validated
umi CTTACTGGGC = 43 reads: +382 validated
umi CTTAGCCCTG = 31 reads: +6 -16 +360 non-validated
umi CTTAGGTGGG = 25 reads: +81 -1 +290 -10 non-validated
umi CTTAGTACTC = 18 reads: -22 +111 -2X +7 -1 +6 -1 +216 -16 invalidated
umi CTTATAGGTG = 37 reads: -5 +377 non-validated
umi CTTATATGGG = 26 reads: +313 -4 +65 non-validated
umi CTTATCACTG = 19 reads: +1 -1X +181 -4 +176 -19 invalidated
umi CTTATGCATA = 35 reads: +382 validated
umi CTTATGGTCC = 30 reads: +319 -1 +62 non-validated
umi CTTATTCCAT = 33 reads: +380 -1 +1 non-validated
umi CTTATTGCCG = 24 reads: -5 +306 -15 +8 -1 +3 -1 +6 -2 +4 -3 +1 -1 +23 -1 +2 non-validated
umi CTTCAACATG = 40 reads: +9 -1 +372 non-validated
umi CTTCAACCTG = 60 reads: +370 -6 +6 non-validated
umi CTTCACTCAC = 29 reads: -11X +194 -2 +170 -5 invalidated
umi CTTCAGCGTA = 37 reads: -45 +263 -2 +1 -1 +1 -1 +12 -10 +46 non-validated
umi CTTCCAATCC = 16 reads: +31 -14 +190 -33 +56 -58 non-validated
umi CTTCCACCCC = 19 reads: +186 -7 +92 -35 +62 non-validated
umi CTTCCACTCC = 28 reads: +370 -1 +6 -5 non-validated
umi CTTCCCCCCT = 26 reads: +2 -1 +279 -1 +79 -1X +19 invalidated
umi CTTCCCTCCG = 37 reads: +328 -20 +33 -1X invalidated
umi CTTCCTCCCC = 30 reads: +356 -6 +20 non-validated
umi CTTCCTCCCT = 42 reads: +382 validated
umi CTTCCTGTTG = 28 reads: +10 -1 +3 -1 +17 -1 +1 -12 +297 -27 +12 non-validated
umi CTTCGACCCT = 14 reads: -29 +127 -1 +2 -1 +150 -20 +52 non-validated
umi CTTCGCGCCC = 25 reads: -20 +305 -6 +51 non-validated
umi CTTCGCTGCT = 29 reads: +29 -2 +158 -5 +56 -4 +11 -1 +10 -1 +105 non-validated
umi CTTCGGGTAT = 29 reads: +248 -1 +118 -1 +10 -4 non-validated
umi CTTCTCATCG = 36 reads: -12 +370 non-validated
umi CTTCTCGTGC = 36 reads: +362 -20 non-validated
umi CTTCTCTTAT = 29 reads: +244 -11 +121 -6 non-validated
umi CTTGAAACTG = 33 reads: +55 -1 +264 -10 +52 non-validated
umi CTTGAATCCT = 32 reads: +382 validated
umi CTTGCACACT = 27 reads: +382 validated
umi CTTGCAGGGC = 28 reads: +327 -1 +34 -17 +3 non-validated
umi CTTGCATCGG = 29 reads: +2 -1 +10 -1 +327 -1 +6 -1 +33 non-validated
umi CTTGCCCTCC = 28 reads: -1 +1 -3 +2 -1 +1 -2 +1 -1 +352 -2 +2 -1 +12 non-validated
umi CTTGCGAGGG = 21 reads: -50 +282 -31 +19 non-validated
umi CTTGCGTCTC = 17 reads: -13 +134 -1X +182 -52 invalidated
umi CTTGCTCTTC = 39 reads: -13 +340 -2 +1 -2X +1 -1 +2 -1 +1 -1 +8 -1 +3 -1 +4 invalidated
umi CTTGGAGCTC = 33 reads: +326 -34 +22 non-validated
umi CTTGGCAACC = 31 reads: -12 +343 -1 +21 -5 non-validated
umi CTTGGCACCC = 36 reads: +374 -8 non-validated
umi CTTGGTCGAG = 34 reads: +365 -1 +16 non-validated
umi CTTGGTGCTT = 27 reads: +382 validated
umi CTTGGTTCGC = 28 reads: -19 +357 -6 non-validated
umi CTTGTACCCC = 22 reads: -45 +302 -1 +1 -2 +1 -1 +4 -1X +8 -1X +3 -1 +1 -10 invalidated
umi CTTGTCGTCC = 37 reads: +349 -10 +23 non-validated
umi CTTGTGGGTG = 18 reads: +62 -30 +159 -1 +2 -1 +25 -1 +70 -4 +27 non-validated
umi CTTGTTAGCC = 26 reads: +219 -24 +139 non-validated
umi CTTGTTCGGG = 14 reads: -93 +6 -1 +282 non-validated
umi CTTGTTGGGA = 33 reads: +287 -60 +35 non-validated
umi CTTTAGACTA = 48 reads: -10 +372 non-validated
umi CTTTATAGTA = 22 reads: -16 +342 -24 non-validated
umi CTTTCACTTC = 37 reads: +87 -1XX +223 -23 +48 invalidated
umi CTTTCCCCCT = 23 reads: -18 +336 -1 +10 -17 non-validated
umi CTTTCCTCTG = 30 reads: -24 +263 -11 +76 -8 non-validated
umi CTTTCCTGTT = 23 reads: +67 -1 +212 -19 +56 -27 non-validated
umi CTTTGAACCC = 22 reads: +21 -1 +3 -2 +8 -1 +314 -32 non-validated
umi CTTTGGAGTC = 25 reads: +234 -2 +146 non-validated
umi CTTTGTAAGA = 27 reads: -13 +256 -1 +5 -52 +55 non-validated
umi CTTTGTGTCC = 30 reads: +117 -8 +240 -17 non-validated
umi CTTTTACCGG = 19 reads: +56 -1 +253 -53 +19 non-validated
umi CTTTTCCATC = 44 reads: +52 -1 +329 non-validated
umi CTTTTCCATG = 25 reads: +121 -6 +249 -6 non-validated
umi CTTTTGCACT = 19 reads: +57 -1 +324 non-validated
umi CTTTTGGTCC = 33 reads: +382 validated
umi CTTTTTTTCC = 24 reads: -12 +319 -51 non-validated
umi GAAACACGTA = 33 reads: +49 -1 +298 -1 +4 -5X +1 -1X +21 -1 invalidated
umi GAAACCAGTG = 16 reads: -13 +136 -22 +67 -19 +125 non-validated
umi GAAACTCCAA = 32 reads: +311 -10 +61 non-validated
umi GAAATCCAGA = 28 reads: -1 +1 -1 +2 -1 +3 -1 +39 -1X +320 -1 +2 -1 +8 invalidated
umi GAACACCTCT = 30 reads: +9 -3 +370 non-validated
umi GAACATGACC = 29 reads: +382 validated
umi GAACCTCTTC = 16 reads: -51 +197 -3 +62 -69 non-validated
umi GAACTATATA = 23 reads: +2 -1X +3 -1 +5 -1 +1 -1 +2 -1 +364 invalidated
umi GAATCCCGTA = 30 reads: -13 +252 -1 +4 -1 +111 non-validated
umi GAATTTCCTA = 37 reads: +347 -35 non-validated
umi GACAACTCGA = 31 reads: +4 -26 +190 -1 +161 non-validated
umi GACACATTGG = 19 reads: +87 -19 +276 non-validated
umi GACACTCTCC = 37 reads: +382 validated
umi GACAGCCACC = 37 reads: +382 validated
umi GACATACTCC = 26 reads: +59 -1 +254 -31 +37 non-validated
umi GACATATATC = 18 reads: +83 -19 +92 -8 +168 -1 +2 -9 non-validated
umi GACATTCTCC = 41 reads: -13 +369 non-validated
umi GACCAACTGT = 28 reads: -1 +3 -1 +2 -1 +1 -1 +4 -1 +1 -1 +3 -1 +6 -3 +1 -1X +2 -3 +345 invalidated
umi GACCACTTCA = 30 reads: -15 +1 -1 +1 -1 +210 -2 +5 -21 +91 -11 +23 non-validated
umi GACCATGCTA = 19 reads: -1 +31 -1 +8 -1 +114 -2 +82 -1X +117 -1X +23 invalidated
umi GACCCCCTGG = 31 reads: +28 -28 +326 non-validated
umi GACCGGTTAT = 14 reads: +1 -1 +44 -6X +80 -7 +138 -100 +5 invalidated
umi GACGCAGCTG = 26 reads: +225 -1 +2 -1 +7 -1 +2 -2 +10 -1 +113 -17 non-validated
umi GACGGAGCGG = 12 reads: +184 -17 +9 -1 +6 -1 +62 -102 non-validated
umi GACGTACATG = 28 reads: +366 -16 non-validated
umi GACGTAGTAC = 25 reads: -10 +369 -1 +2 non-validated
umi GACTACCCTG = 46 reads: +382 validated
umi GACTCCACTA = 25 reads: -85 +29 -1X +264 -3 invalidated
umi GACTCCAGTA = 29 reads: +3 -2 +211 -1 +5 -1 +11 -2 +2 -1 +23 -1 +62 -57 non-validated
umi GACTCCCTAC = 36 reads: +382 validated
umi GACTTCTCCT = 33 reads: +376 -6 non-validated
umi GAGACTCGCC = 19 reads: -12 +12 -1 +189 -49 +56 -7 +56 non-validated
umi GAGATATCCG = 32 reads: -13 +11 -1 +226 -4 +25 -1 +101 non-validated
umi GAGATCCTAC = 17 reads: -15 +208 -44 +56 -59 non-validated
umi GAGATCCTCT = 18 reads: -26 +282 -74 non-validated
umi GAGCACGGGT = 24 reads: -12 +340 -1 +17 -1 +9 -1 +1 non-validated
umi GAGCATAGTG = 28 reads: +14 -41 +327 non-validated
umi GAGCCCCACG = 44 reads: +274 -46 +62 non-validated
umi GAGCCTAGTA = 36 reads: +5 -1 +2 -1 +370 -1 +2 non-validated
umi GAGCGTGAGG = 31 reads: +2 -8 +284 -6 +56 -26 non-validated
umi GAGCTACGGT = 30 reads: +325 -1 +16 -1 +1 -1 +37 non-validated
umi GAGCTCCATA = 23 reads: +365 -17 non-validated
umi GAGCTCTCTC = 21 reads: +100 -1X +9 -1X +1 -1X +240 -29 invalidated
umi GAGTACTATA = 42 reads: +382 validated
umi GAGTACTCTC = 20 reads: -14 +13 -1 +171 -1 +80 -38 +56 -8 non-validated
umi GAGTCCACCT = 21 reads: +9 -1 +244 -23 +105 non-validated
umi GAGTCCCACT = 25 reads: -13 +368 -1 non-validated
umi GAGTCGTCCC = 28 reads: +191 -3 +152 -1X +24 -1 +1 -1 +2 -1 +5 invalidated
umi GAGTCTAATA = 16 reads: -29 +145 -34 +110 -55 +9 non-validated
umi GAGTCTCTCC = 32 reads: +99 -1 +282 non-validated
umi GAGTGCGTCC = 32 reads: -2 +378 -1 +1 non-validated
umi GAGTGTTCTC = 14 reads: -47 +78 -1 +3 -1 +14 -1 +80 -1 +8 -1 +147 non-validated
umi GATAACACCG = 23 reads: +74 -2 +267 -39 non-validated
umi GATAAGCCCT = 34 reads: +278 -1XX +103 invalidated
umi GATACAGCTC = 18 reads: +11 -80 +2 -1 +5 -1 +211 -71 non-validated
umi GATACCGGTA = 20 reads: +7 -20 +251 -37 +58 -1 +5 -1 +2 non-validated
umi GATACCTAAC = 37 reads: +273 -6 +83 -20 non-validated
umi GATAGAATGC = 11 reads: -33 +99 -27 +143 -1 +7 -72 non-validated
umi GATAGACACC = 30 reads: +32 -1 +221 -1 +16 -1 +1 -1 +108 non-validated
umi GATAGCCTTA = 25 reads: -50 +312 -20 non-validated
umi GATAGTCCCT = 27 reads: +32 -1 +8 -4 +324 -13 non-validated
umi GATATACCTC = 41 reads: +2 -1 +310 -28 +11 -1 +21 -1 +7 non-validated
umi GATATACTAG = 27 reads: +382 validated
umi GATATAGCCC = 30 reads: +182 -26 +155 -3 +1 -2 +3 -1 +1 -1 +5 -2 non-validated
umi GATATCCCTT = 27 reads: +11 -1 +370 non-validated
umi GATATGGCTG = 26 reads: -5 +228 -1 +9 -1 +76 -1 +21 -14 +26 non-validated
umi GATCATTCCT = 24 reads: +107 -1 +142 -1 +15 -1 +103 -1 +1 -10 non-validated
umi GATCATTCTC = 28 reads: +236 -1 +1 -1X +1 -15 +118 -9 invalidated
umi GATCCTAATA = 35 reads: +362 -1 +19 non-validated
umi GATCGACCCC = 35 reads: +321 -61 non-validated
umi GATCGCGATA = 36 reads: +382 validated
umi GATCGTATAA = 26 reads: -11 +358 -13 non-validated
umi GATCTCACTC = 20 reads: +66 -8 +159 -3 +129 -17 non-validated
umi GATCTTCCTC = 28 reads: +43 -16 +276 -4 +31 -1 +11 non-validated
umi GATGCTATAT = 33 reads: +347 -35 non-validated
umi GATGCTCCAT = 37 reads: +10 -3 +269 -23 +77 non-validated
umi GATGGGTTCG = 37 reads: +21 -1 +321 -2 +37 non-validated
umi GATGTCTCGC = 30 reads: +51 -6 +325 non-validated
umi GATGTGCGCG = 35 reads: +382 validated
umi GATGTGTGGG = 23 reads: +143 -12 +158 -1 +68 non-validated
umi GATTCACCGC = 39 reads: -4 +351 -27 non-validated
umi GATTCCTTTC = 31 reads: +331 -1 +1 -1 +3 -1 +16 -1 +22 -5 non-validated
umi GATTGCTCTC = 17 reads: +165 -9 +159 -49 non-validated
umi GATTGTTCCC = 18 reads: +107 -1 +17 -15 +121 -1 +7 -43 +70 non-validated
umi GATTTGACCC = 30 reads: -22 +360 non-validated
umi GATTTGGGCC = 28 reads: +2 -2 +300 -9 +58 -1 +1 -1 +4 -1 +3 non-validated
umi GATTTTTCAC = 22 reads: -24 +263 -19 +59 -1 +2 -1X +1 -1 +3 -4 +4 invalidated
umi GCAAAATTCC = 34 reads: -10 +310 -1X +22 -1 +38 invalidated
umi GCAAACTCCT = 23 reads: -12 +221 -1 +1 -1 +1 -1 +144 non-validated
umi GCAACACTGC = 23 reads: +209 -1 +4 -1 +2 -1 +7 -1 +71 -1 +1 -1X +1 -1X +1 -15X +1 -1X +1 -1X +1 -1X +1 -8 +49 invalidated
umi GCAACGACTG = 14 reads: -13 +2 -1 +264 -102 non-validated
umi GCAACTGGCC = 25 reads: +64 -6 +154 -3 +1 -1 +5 -1 +3 -1 +131 -1 +11 non-validated
umi GCAAGAACGC = 29 reads: +278 -9 +67 -1 +3 -1 +4 -1 +16 -1 +1 non-validated
umi GCAATCATCT = 36 reads: +267 -18 +95 -1 +1 non-validated
umi GCAATTTGCG = 41 reads: +45 -6 +331 non-validated
umi GCACACATGA = 29 reads: +382 validated
umi GCACAGCGTA = 32 reads: -5 +329 -1 +36 -1 +10 non-validated
umi GCACCGTCCC = 31 reads: +357 -25 non-validated
umi GCACCTTATC = 26 reads: -2 +380 non-validated
umi GCACGATCAC = 22 reads: -10 +330 -42 non-validated
umi GCACGCCATA = 22 reads: +2 -1 +4 -1 +313 -38 +23 non-validated
umi GCACGTTCCC = 29 reads: -26 +226 -1 +1 -1 +1 -1 +2 -1 +68 -3 +51 non-validated
umi GCACTACATG = 41 reads: +382 validated
umi GCACTGTATA = 27 reads: -5 +280 -51 +46 non-validated
umi GCACTTTCCT = 18 reads: -24 +200 -37 +56 -19 +46 non-validated
umi GCAGAGTATA = 16 reads: +68 -10 +247 -57 non-validated
umi GCAGATTATT = 18 reads: -2 +67 -26 +175 -27 +13 -1 +71 non-validated
umi GCAGCCTCCT = 28 reads: +311 -4 +56 -11 non-validated
umi GCAGGACGTC = 37 reads: +98 -1 +172 -14 +97 non-validated
umi GCAGGCGGTC = 12 reads: -58 +294 -1 +17 -12 non-validated
umi GCAGGTCCCT = 35 reads: -6 +376 non-validated
umi GCATAACGAC = 30 reads: +240 -23 +119 non-validated
umi GCATATCCAC = 26 reads: +238 -1 +71 -1 +10 -61 non-validated
umi GCATATTCTC = 27 reads: +271 -10 +101 non-validated
umi GCATCACAGC = 29 reads: +376 -6 non-validated
umi GCATCATTCC = 23 reads: -31 +351 non-validated
umi GCATCCCCGC = 35 reads: +3 -29 +350 non-validated
umi GCATCTGTAG = 49 reads: +327 -9 +46 non-validated
umi GCATGACTTG = 28 reads: -8 +374 non-validated
umi GCATTACTCC = 38 reads: +382 validated
umi GCATTGAGCG = 36 reads: -8 +347 -11 +16 non-validated
umi GCATTGGCAT = 44 reads: +382 validated
umi GCCACACTCC = 38 reads: -8 +7 -1 +366 non-validated
umi GCCACCACCC = 37 reads: +301 -41 +40 non-validated
umi GCCACCTATA = 21 reads: -19 +257 -1 +79 -1 +19 -1 +5 non-validated
umi GCCACGTATA = 21 reads: +52 -1 +14 -1 +4 -1 +2 -1 +209 -97 non-validated
umi GCCATAGGGT = 27 reads: -48 +278 -39 +17 non-validated
umi GCCATATCAC = 22 reads: -10 +59 -10 +6 -1 +168 -1 +37 -1 +1 -38 +20 -1 +29 non-validated
umi GCCATCCCAT = 23 reads: +313 -30 +39 non-validated
umi GCCATCTCGG = 32 reads: +14 -41 +273 -51 +3 non-validated
umi GCCATGGTAG = 36 reads: -3 +4 -1 +374 non-validated
umi GCCATTCAAC = 17 reads: +203 -1 +10 -1 +1 -1 +86 -79 non-validated
umi GCCATTGCTG = 33 reads: +19 -1 +362 non-validated
umi GCCCACTCTC = 41 reads: +376 -6 non-validated
umi GCCCAGGAAC = 20 reads: -10 +266 -1 +61 -44 non-validated
umi GCCCAGTCTC = 25 reads: -12 +4 -1 +4 -4 +1 -2 +215 -49 +90 non-validated
umi GCCCATACCG = 34 reads: +382 validated
umi GCCCATTACC = 18 reads: -8 +120 -46 +2 -1 +1 -1 +9 -1 +168 -25 non-validated
umi GCCCATTTGC = 18 reads: -15 +173 -38 +34 -1 +21 -28 +69 -2 +1 non-validated
umi GCCCCGTTAC = 35 reads: +191 -2 +189 non-validated
umi GCCCGCACTC = 29 reads: -10 +339 -1 +16 -1 +15 non-validated
umi GCCCGGTCTA = 21 reads: -13 +3 -1 +1 -1 +7 -1 +2 -2 +1 -1 +3 -1 +3 -1 +1 -1 +3 -2 +3 -1 +330 non-validated
umi GCCCGTCTTG = 27 reads: +4 -2 +2 -1 +364 -9 non-validated
umi GCCCTATCTG = 31 reads: +5 -1 +321 -1 +9 -1 +23 -1 +17 -1 +2 non-validated
umi GCCCTCGATC = 26 reads: -8 +333 -21 +20 non-validated
umi GCCCTCTCGC = 28 reads: +382 validated
umi GCCCTCTGCG = 29 reads: +24 -1 +357 non-validated
umi GCCGACACCC = 18 reads: +237 -4 +70 -71 non-validated
umi GCCGCCTCAG = 22 reads: +4 -1X +19 -1 +1 -2 +2 -1 +1 -1 +5 -1 +5 -1 +1 -2 +5 -1 +3 -1 +223 -1XX +100 invalidated
umi GCCGCTATTC = 28 reads: +3 -2 +5 -1 +344 -1X +26 invalidated
umi GCCGGTACCC = 25 reads: +318 -64 non-validated
umi GCCGGTTCTA = 42 reads: +382 validated
umi GCCTAAGGCT = 21 reads: +2 -1 +13 -40 +274 -24 +2 -1 +25 non-validated
umi GCCTAATGTA = 18 reads: -63 +102 -4X +1 -1 +1 -1 +136 -21 +52 invalidated
umi GCCTACGATA = 19 reads: -16 +85 -9 +216 -56 non-validated
umi GCCTACTGCG = 21 reads: -40 +127 -1X +1 -1X +2 -1 +1 -1X +4 -1X +5 -2 +3 -1 +10 -5 +84 -1 +6 -1 +84 invalidated
umi GCCTATATCT = 32 reads: +382 validated
umi GCCTCATGTA = 17 reads: -5 +177 -25 +87 -27 +61 non-validated
umi GCCTCCGGCT = 31 reads: -22 +203 -14 +143 non-validated
umi GCCTCGCTCT = 35 reads: +254 -8 +120 non-validated
umi GCCTCGTCGG = 24 reads: +33 -1 +291 -5 +52 non-validated
umi GCCTCTACAT = 13 reads: -5 +151 -1 +82 -1 +3 -1 +2 -1 +7 -1 +3 -1 +4 -6 +56 -57 non-validated
umi GCCTGCCATA = 25 reads: +21 -1 +1 -69 +231 -1 +10 -1 +2 -1 +3 -1 +4 -36 non-validated
umi GCCTGGCTCT = 31 reads: +1 -29 +265 -4 +20 -1 +62 non-validated
umi GCCTGTCATA = 25 reads: -8 +319 -1X +54 invalidated
umi GCCTTACACC = 34 reads: +382 validated
umi GCCTTCCTCT = 36 reads: +382 validated
umi GCCTTCTCTC = 18 reads: +12 -1 +13 -13 +276 -47 +20 non-validated
umi GCCTTCTGCC = 25 reads: -10 +211 -26 +1 -1 +133 non-validated
umi GCCTTTCCCG = 36 reads: +44 -15 +8 -1 +174 -1 +122 -1X +16 invalidated
umi GCGAACACGC = 24 reads: +253 -24 +56 -49 non-validated
umi GCGACTAGGG = 39 reads: -9 +64 -1 +254 -8 +2 -1 +43 non-validated
umi GCGAGCAGTC = 19 reads: +25 -43 +94 -1 +4 -1X +1 -1X +2 -1X +126 -62 +21 invalidated
umi GCGAGCTCCC = 25 reads: -10 +309 -23 +2 -1 +6 -1 +30 non-validated
umi GCGATATTTG = 33 reads: +351 -29 +2 non-validated
umi GCGATCGCTC = 28 reads: +85 -1 +40 -1 +138 -1 +2 -1 +3 -2 +108 non-validated
umi GCGATTTCCT = 28 reads: +330 -9 +12 -1 +30 non-validated
umi GCGCAAAGGC = 34 reads: +301 -1 +80 non-validated
umi GCGCCATGTA = 19 reads: -11 +326 -45 non-validated
umi GCGCTATTGG = 41 reads: +321 -15 +46 non-validated
umi GCGCTCTGAT = 22 reads: +17 -1 +213 -1 +1 -39 +110 non-validated
umi GCGGCACCCT = 17 reads: -8 +193 -1 +20 -1 +1 -1 +1 -33 +96 -7 +2 -1 +13 -1 +3 non-validated
umi GCGGCGCACC = 28 reads: +357 -25 non-validated
umi GCGGTTGCGA = 46 reads: +1 -1 +380 non-validated
umi GCGTCACTCC = 37 reads: -3 +376 -3 non-validated
umi GCGTCCCGCG = 29 reads: +360 -22 non-validated
umi GCGTCCCTAC = 33 reads: -13 +369 non-validated
umi GCGTCGCTGT = 26 reads: +73 -1 +210 -1 +3 -38 +23 -1X +32 invalidated
umi GCGTCGTTTG = 15 reads: -37 +284 -61 non-validated
umi GCGTGCCCTC = 25 reads: +376 -6 non-validated
umi GCGTTATACC = 20 reads: -18 +214 -42 +88 -20 non-validated
umi GCGTTATGTG = 35 reads: -12 +328 -39 +3 non-validated
umi GCGTTCGCAG = 23 reads: -46 +246 -34 +56 non-validated
umi GCGTTGTATA = 39 reads: +205 -1 +2 -3 +3 -1 +167 non-validated
umi GCTAACTATG = 21 reads: +156 -1 +219 -6 non-validated
umi GCTAAGTTCT = 22 reads: +160 -1X +57 -30 +94 -40 invalidated
umi GCTAATAACT = 17 reads: -27 +59 -25 +200 -44 +11 -1 +15 non-validated
umi GCTAATTGGA = 35 reads: +378 -4 non-validated
umi GCTACACCCC = 26 reads: -5 +19 -1 +254 -9 +94 non-validated
umi GCTACATGTA = 20 reads: -17 +91 -7 +201 -52 +14 non-validated
umi GCTACCCTGC = 15 reads: +41 -33 +232 -1 +3 -2 +2 -1 +11 -1 +11 -1 +1 -1 +2 -7 +4 -5X +2 -1X +2 -2 +1 -1 +1 -1X +4 -1 +3 -3 +1 invalidated
umi GCTAGCTCTG = 19 reads: +46 -12 +196 -1 +12 -1 +5 -5 +69 -30 +5 non-validated
umi GCTATAAATG = 23 reads: +208 -1X +1 -1 +81 -8 +56 -26 invalidated
umi GCTATCCATT = 13 reads: -22 +25 -1 +30 -13 +217 -19 +12 -1X +42 invalidated
umi GCTATCCCAT = 28 reads: +3 -1 +30 -3 +92 -3 +5 -1 +244 non-validated
umi GCTATTGTAC = 34 reads: +9 -7 +297 -13 +56 non-validated
umi GCTCAACCTC = 12 reads: -87 +5 -1 +218 -71 non-validated
umi GCTCAATTAG = 24 reads: +257 -1 +124 non-validated
umi GCTCAATTCG = 25 reads: +290 -26 +66 non-validated
umi GCTCACAACG = 20 reads: -46 +20 -1 +215 -1 +4 -77 +18 non-validated
umi GCTCACCTTG = 22 reads: -13 +2 -2 +1 -1 +353 -10 non-validated
umi GCTCACGTTA = 28 reads: -29 +353 non-validated
umi GCTCAGGGTT = 25 reads: +347 -1 +34 non-validated
umi GCTCATATGG = 28 reads: -2 +5 -1 +4 -1 +9 -37 +3 -1 +239 -1 +8 -5 +66 non-validated
umi GCTCCTCATA = 39 reads: +382 validated
umi GCTCGCCACC = 37 reads: +8 -2 +2 -3X +298 -5 +64 invalidated
umi GCTCGGATCT = 29 reads: -43 +270 -15 +54 non-validated
umi GCTCGTGTTC = 39 reads: +336 -46 non-validated
umi GCTGACTAGC = 27 reads: +360 -1 +2 -1 +18 non-validated
umi GCTGATCGCT = 31 reads: +382 validated
umi GCTGATGGTT = 17 reads: +270 -112 non-validated
umi GCTGCATGCT = 35 reads: +1 -29 +352 non-validated
umi GCTGGCTGGG = 22 reads: +128 -39 +115 -100 non-validated
umi GCTGTATTCC = 17 reads: -27 +15 -1 +24 -1 +15 -4 +224 -1 +1 -1 +2 -1 +65 non-validated
umi GCTGTTTTAT = 36 reads: +4 -1 +377 non-validated
umi GCTTACTGGA = 22 reads: +41 -1 +5 -31 +245 -30 +29 non-validated
umi GCTTATAGGG = 38 reads: -2 +372 -8 non-validated
umi GCTTCATCTC = 21 reads: +268 -114 non-validated
umi GCTTCGAACC = 39 reads: +323 -24 +35 non-validated
umi GCTTCTCTCG = 15 reads: +48 -1 +250 -1 +59 -2 +3 -1 +5 -2 +7 -1 +1 -1 non-validated
umi GCTTCTTCCT = 25 reads: +65 -1 +5 -1 +5 -26 +30 -2 +162 -16 +69 non-validated
umi GCTTGCATAT = 34 reads: -18 +56 -2 +306 non-validated
umi GCTTGGACAG = 27 reads: +56 -32 +280 -14 non-validated
umi GCTTTACCCT = 51 reads: +18 -1 +356 -1 +6 non-validated
umi GCTTTATTCC = 19 reads: -46 +241 -3 +56 -36 non-validated
umi GCTTTCTTCC = 37 reads: +35 -5 +268 -22 +52 non-validated
umi GCTTTTTCCC = 23 reads: +30 -3 +340 -9 non-validated
umi GGAAAGGCCG = 31 reads: +5 -1 +1 -2 +373 non-validated
umi GGAACAGTCC = 21 reads: -10 +235 -2 +69 -7 +3 -2 +13 -3 +2 -1 +3 -1 +3 -1 +7 -1 +5 -1 +8 -5 non-validated
umi GGAACTGCCC = 23 reads: +240 -1 +3 -1 +9 -1 +15 -32 +60 -20 non-validated
umi GGAATCCTCC = 26 reads: +172 -1 +4 -2 +38 -1XX +40 -1 +111 -12 invalidated
umi GGAATCGGTA = 49 reads: +2 -1 +379 non-validated
umi GGACACCCGG = 29 reads: +304 -78 non-validated
umi GGACACGACC = 28 reads: +6 -30 +313 -33 non-validated
umi GGACAGAGCC = 39 reads: +33 -6 +340 -1 +2 non-validated
umi GGACCTATTC = 32 reads: -2 +380 non-validated
umi GGACCTGCTC = 28 reads: +2 -1 +6 -1 +301 -71 non-validated
umi GGACGCCCAA = 36 reads: +382 validated
umi GGACTCAGGC = 39 reads: +382 validated
umi GGACTCCACG = 18 reads: +66 -1 +5 -3 +7 -1 +2 -1 +4 -3 +289 non-validated
umi GGAGACGTGT = 28 reads: -10 +372 non-validated
umi GGAGCTTACG = 29 reads: +241 -3 +136 -1 +1 non-validated
umi GGAGGAGCTC = 23 reads: +334 -48 non-validated
umi GGAGTCCCTA = 30 reads: +45 -3 +2 -1 +1 -3 +1 -1 +5 -2 +5 -1 +9 -1X +302 invalidated
umi GGAGTGTAGG = 24 reads: +275 -15 +92 non-validated
umi GGATAACCCT = 25 reads: -37 +345 non-validated
umi GGATAACCTG = 47 reads: +2 -1 +21 -6 +1 -1 +350 non-validated
umi GGATACCCGG = 29 reads: +360 -22 non-validated
umi GGATCAAATA = 25 reads: +382 validated
umi GGATCATATC = 35 reads: -32 +238 -4 +3 -1 +65 -11 +28 non-validated
umi GGATCTTACT = 32 reads: +18 -47 +278 -39 non-validated
umi GGATTCCCTC = 37 reads: +382 validated
umi GGCACACATA = 22 reads: +12 -1 +5 -22 +271 -71 non-validated
umi GGCACAGGTT = 19 reads: -27 +74 -7 +184 -22 +56 -12 non-validated
umi GGCACATCTC = 35 reads: +361 -1 +11 -9 non-validated
umi GGCACTTCAC = 20 reads: +74 -1 +89 -1 +4 -15 +198 non-validated
umi GGCATACGCC = 19 reads: -2 +4 -1 +4 -2 +7 -1 +5 -1 +137 -15 +10 -1 +90 -19 +83 non-validated
umi GGCATCCCTA = 26 reads: +326 -56 non-validated
umi GGCATTCAAA = 25 reads: -21 +297 -1X +63 invalidated
umi GGCCACCCTA = 39 reads: +374 -8 non-validated
umi GGCCATTTAC = 31 reads: +270 -8 +104 non-validated
umi GGCCCGGATC = 29 reads: -22 +322 -1 +7 -1 +2 -3 +12 -1 +8 -3 non-validated
umi GGCCCGTCTA = 33 reads: +382 validated
umi GGCCGGTGGA = 25 reads: -22 +332 -1 +3 -24 non-validated
umi GGCCTACCGT = 29 reads: +213 -6 +90 -26 +47 non-validated
umi GGCGACTGTC = 15 reads: -30 +109 -1 +61 -16 +63 -5 +56 -41 non-validated
umi GGCGCCAATA = 21 reads: +160 -2 +166 -27 +27 non-validated
umi GGCGTTACTC = 31 reads: +382 validated
umi GGCTAACTCT = 26 reads: +280 -5 +97 non-validated
umi GGCTCACCTT = 29 reads: +254 -1 +127 non-validated
umi GGCTCAGCTA = 33 reads: +382 validated
umi GGCTCGCCGG = 31 reads: +46 -1 +4 -2 +88 -1 +163 -6 +1 -1 +7 -1X +1 -1 +3 -1 +4 -1X +1 -2 +1 -1 +3 -2X +40 invalidated
umi GGCTCGGCTC = 44 reads: +9 -1 +372 non-validated
umi GGCTCTTTCT = 26 reads: +382 validated
umi GGCTGTAATC = 12 reads: +51 -8 +128 -37 +3 -2 +1 -1 +5 -1 +14 -2 +2 -1 +2 -1 +60 -13 +50 non-validated
umi GGCTTCCTTC = 20 reads: -6 +59 -5 +312 non-validated
umi GGCTTTCTCC = 30 reads: -1 +3 -2X +3 -2 +4 -2 +313 -24 +28 invalidated
umi GGGAAACCTC = 31 reads: -12 +353 -17 non-validated
umi GGGACCCACC = 27 reads: -13 +41 -1 +229 -1 +96 -1 non-validated
umi GGGACCCCTT = 31 reads: +280 -7 +3 -1 +91 non-validated
umi GGGAGGCCTT = 25 reads: -13 +334 -1 +3 -31 non-validated
umi GGGCAAACCT = 34 reads: -10 +340 -32 non-validated
umi GGGCAGTTTC = 30 reads: +373 -9 non-validated
umi GGGCGCAGCA = 40 reads: +321 -61 non-validated
umi GGGCTCCCGT = 20 reads: +246 -2 +114 -20 non-validated
umi GGGGATCTAA = 51 reads: -1 +381 non-validated
umi GGGGCACAAC = 44 reads: +382 validated
umi GGGGCACTCC = 28 reads: +14 -1X +303 -1 +63 invalidated
umi GGGGTTACCT = 32 reads: +28 -27 +319 -8 non-validated
umi GGGGTTCGCT = 19 reads: +137 -1 +244 non-validated
umi GGGTAACTAT = 32 reads: +358 -24 non-validated
umi GGGTGCCCCT = 23 reads: -10 +189 -24 +20 -2 +3 -1 +5 -1 +127 non-validated
umi GGGTGTGGGC = 34 reads: +358 -24 non-validated
umi GGTAAAATGA = 28 reads: +1 -1 +354 -26 non-validated
umi GGTAAACCTC = 27 reads: -12 +283 -7 +2 -1 +8 -1 +13 -1 +1 -1 +5 -2 +4 -1 +1 -1 +5 -1 +1 -1 +2 -2 +2 -5 +7 -1 +11 non-validated
umi GGTAACACCA = 32 reads: +311 -15 +31 -2 +7 -1 +15 non-validated
umi GGTAAGATAG = 20 reads: -1 +1 -1 +5 -1 +60 -1 +19 -1 +124 -51 +100 -17 non-validated
umi GGTAAGCGCC = 21 reads: +2 -2 +31 -1 +5 -23 +140 -15 +154 -9 non-validated
umi GGTAAGCTCG = 21 reads: -8 +3 -1 +65 -11 +6 -1 +218 -43 +26 non-validated
umi GGTACACCCT = 31 reads: +370 -1 +2 -1 +3 -1 +3 -1 non-validated
umi GGTACACCGC = 35 reads: +377 -1 +3 -1 non-validated
umi GGTACACCTC = 27 reads: +5 -1 +321 -1 +7 -1 +21 -1 +5 -19 non-validated
umi GGTACAGTCG = 23 reads: +250 -29 +65 -1 +25 -1 +1 -10 non-validated
umi GGTACTAATC = 35 reads: +243 -1 +138 non-validated
umi GGTATAGCTC = 31 reads: +15 -8 +295 -16 +48 non-validated
umi GGTATAGCTT = 26 reads: +307 -1 +26 -22 +26 non-validated
umi GGTATTACCT = 33 reads: +317 -2 +63 non-validated
umi GGTATTGTCC = 28 reads: -15 +350 -9 +8 non-validated
umi GGTCACCTCT = 20 reads: +150 -19 +174 -39 non-validated
umi GGTCATCAAG = 17 reads: +62 -42 +245 -22 +11 non-validated
umi GGTCATTGTA = 41 reads: +43 -1 +318 -20 non-validated
umi GGTCCATCCT = 21 reads: +11 -20 +59 -1 +5 -1 +7 -1 +1 -1 +3 -1 +251 -20 non-validated
umi GGTCCCCCGC = 28 reads: +314 -7 +6 -2 +7 -1 +3 -2 +40 non-validated
umi GGTCTTCGGT = 27 reads: +334 -26 +22 non-validated
umi GGTGAACATC = 27 reads: +16 -34 +56 -6 +270 non-validated
umi GGTGAATCCG = 28 reads: +9 -4 +1 -2 +4 -1 +269 -1 +59 -32 non-validated
umi GGTGCAGCGA = 25 reads: +99 -1 +4 -1 +3 -1X +12 -2 +259 invalidated
umi GGTGTCCCGA = 25 reads: +67 -15 +200 -1 +36 -8 +55 non-validated
umi GGTGTTACTG = 48 reads: -15 +265 -10 +92 non-validated
umi GGTTACATGG = 23 reads: +32 -1 +1 -1 +347 non-validated
umi GGTTACCCCC = 27 reads: +42 -37 +278 -25 non-validated
umi GGTTAGGGGC = 25 reads: +19 -24 +339 non-validated
umi GGTTCGATCC = 29 reads: -34 +348 non-validated
umi GGTTCGTATC = 30 reads: +83 -1X +19 -1 +7 -1 +5 -1 +3 -9 +252 invalidated
umi GTAAAGCCCG = 16 reads: -40 +231 -88 +23 non-validated
umi GTAATAAGGC = 22 reads: -12 +316 -8 +46 non-validated
umi GTAATACCTT = 35 reads: +355 -27 non-validated
umi GTAATACTGC = 22 reads: +260 -1 +4 -1 +75 -1 +4 -1 +1 -1 +2 -5 +14 -1 +11 non-validated
umi GTAATCAGGG = 27 reads: +11 -40 +5 -1 +214 -1 +110 non-validated
umi GTAATGTCTC = 39 reads: +3 -1 +378 non-validated
umi GTAATGTTTG = 33 reads: +69 -16 +267 -1 +3 -2X +1 -1 +5 -2 +1 -1 +1 -1 +2 -1X +5 -1 +2 invalidated
umi GTACACCTCC = 28 reads: -11 +1 -1 +2 -1 +232 -1 +2 -28 +93 -1 +9 non-validated
umi GTACACGCCC = 21 reads: -39 +2 -1 +6 -1 +230 -6 +97 non-validated
umi GTACACTTCC = 33 reads: +382 validated
umi GTACATTATC = 29 reads: +2 -2 +3 -1 +6 -15 +342 -11 non-validated
umi GTACCACTGC = 35 reads: +382 validated
umi GTACCCGGCA = 19 reads: -5 +65 -1 +284 -27 non-validated
umi GTACCTCTCC = 31 reads: +373 -9 non-validated
umi GTACGACCTC = 40 reads: -1 +381 non-validated
umi GTACGTGTAG = 32 reads: +46 -1 +6 -1 +269 -3 +56 non-validated
umi GTACTCATAC = 24 reads: -30 +252 -9 +56 -2 +7 -1 +25 non-validated
umi GTACTTCGTA = 29 reads: +201 -1XX +180 invalidated
umi GTACTTGCGG = 39 reads: -16 +310 -2 +54 non-validated
umi GTAGAGCCCC = 45 reads: +43 -2 +297 -1X +39 invalidated
umi GTAGCCAATT = 18 reads: -18 +156 -31 +120 -1 +9 -1 +3 -1 +4 -1 +2 -1 +23 -1 +10 non-validated
umi GTAGCCACGG = 38 reads: -9 +4 -2 +367 non-validated
umi GTAGTCTCGA = 32 reads: +24 -1 +341 -16 non-validated
umi GTAGTTCACG = 41 reads: +2 -1 +355 -24 non-validated
umi GTAGTTCGTG = 25 reads: +66 -8 +106 -2 +103 -1 +90 -6 non-validated
umi GTATAAAGGC = 42 reads: -2 +362 -1 +1 -1 +3 -1 +3 -1 +7 non-validated
umi GTATAAGTTA = 33 reads: +54 -1 +287 -1 +3 -1 +5 -1 +4 -1 +7 -1 +7 -9 non-validated
umi GTATAATTGT = 42 reads: +368 -1 +2 -11 non-validated
umi GTATACCTCC = 52 reads: +382 validated
umi GTATAGCGCC = 29 reads: +2 -1 +374 -5 non-validated
umi GTATATCAGC = 15 reads: +61 -10 +56 -5 +250 non-validated
umi GTATCAGGGT = 19 reads: -18 +276 -1XX +18 -24 +14 -2 +29 invalidated
umi GTATCATTTA = 29 reads: +382 validated
umi GTATCCCCCT = 23 reads: +152 -1 +1 -14 +182 -32 non-validated
umi GTATCCCTTC = 30 reads: -12 +348 -1 +15 -2 +4 non-validated
umi GTATCCGCCC = 33 reads: +229 -25 +16 -1 +111 non-validated
umi GTATCCTATA = 30 reads: +325 -14 +4 -1 +38 non-validated
umi GTATGACTCC = 23 reads: +5 -25 +5 -2 +8 -1 +239 -1 +66 -1 +13 -1 +8 -1 +6 non-validated
umi GTATGAGCCC = 25 reads: +26 -2 +305 -22 +15 -1 +6 -1 +4 non-validated
umi GTATGATCCG = 35 reads: +373 -2 +7 non-validated
umi GTATGCTGTT = 17 reads: -8 +61 -8 +164 -14 +58 -3 +56 -10 non-validated
umi GTATGGTATA = 44 reads: +382 validated
umi GTATGTAACC = 35 reads: +4 -2 +2 -1 +2 -1 +275 -20 +75 non-validated
umi GTATGTCAGG = 32 reads: -45 +311 -1 +15 -1 +9 non-validated
umi GTATGTCCCG = 31 reads: -33 +12 -1 +1 -1 +18 -1 +22 -15 +3 -1 +274 non-validated
umi GTATGTCCGC = 18 reads: -41 +80 -26 +62 -30 +5 -1 +137 non-validated
umi GTATGTGTAA = 37 reads: +32 -41 +309 non-validated
umi GTATTAACCG = 42 reads: +370 -1 +1 -1 +8 -1 non-validated
umi GTATTACTGG = 34 reads: +12 -25 +85 -1X +259 invalidated
umi GTATTTACTC = 32 reads: -37 +77 -12 +192 -17 +47 non-validated
umi GTATTTCGGG = 22 reads: -30 +352 non-validated
umi GTATTTGGAA = 29 reads: -12 +353 -1 +16 non-validated
umi GTCAATCTTG = 18 reads: -41 +214 -19 +81 -25 +2 non-validated
umi GTCAATTCTC = 29 reads: -12 +353 -17 non-validated
umi GTCACATCCT = 22 reads: +335 -47 non-validated
umi GTCACTTGGA = 33 reads: +198 -16 +168 non-validated
umi GTCAGCTTCG = 18 reads: -3 +318 -13 +48 non-validated
umi GTCAGTTGCC = 25 reads: -36 +9 -1 +6 -4 +326 non-validated
umi GTCATCGTTT = 27 reads: -10 +252 -1 +3 -8 +108 non-validated
umi GTCATTCAAC = 37 reads: -24 +358 non-validated
umi GTCCACGCTC = 19 reads: +38 -13 +237 -94 non-validated
umi GTCCATCCTC = 18 reads: +66 -2 +213 -1 +53 -1 +5 -1 +1 -1 +1 -1 +4 -32 non-validated
umi GTCCCACACC = 18 reads: -10 +78 -1 +240 -5 +48 non-validated
umi GTCCCAGAGG = 37 reads: +382 validated
umi GTCCCCGCAG = 26 reads: -13 +369 non-validated
umi GTCCCTTGTG = 32 reads: +377 -5 non-validated
umi GTCCGATGTG = 20 reads: -13 +18 -1 +4 -1 +8 -1 +7 -1 +292 -17 +19 non-validated
umi GTCCGTGGAC = 20 reads: -90 +236 -56 non-validated
umi GTCCTAGAGA = 22 reads: +266 -1 +6 -1 +4 -1 +5 -2 +1 -39 +56 non-validated
umi GTCCTGCACG = 28 reads: -2 +292 -1 +2 -2 +75 -8 non-validated
umi GTCCTGGATA = 25 reads: +352 -1 +29 non-validated
umi GTCCTTAGCC = 28 reads: +382 validated
umi GTCCTTTGTA = 32 reads: -1 +365 -7 +1 -1 +2 -1 +1 -2 +1 non-validated
umi GTCGAGGCCT = 31 reads: +61 -9 +312 non-validated
umi GTCGCTTCTT = 43 reads: -13 +331 -1 +37 non-validated
umi GTCGGACTCC = 20 reads: +155 -29 +165 -33 non-validated
umi GTCGGTATGG = 50 reads: +382 validated
umi GTCGTCCCTT = 29 reads: +44 -19 +319 non-validated
umi GTCTAATCTC = 17 reads: -3 +56 -6 +233 -8 +76 non-validated
umi GTCTATAACA = 30 reads: -13 +277 -92 non-validated
umi GTCTATGCCC = 16 reads: -10 +186 -24 +88 -19 +17 -1 +37 non-validated
umi GTCTCACTCC = 26 reads: -8 +374 non-validated
umi GTCTCATTCG = 36 reads: +311 -1 +70 non-validated
umi GTCTCCACTT = 40 reads: -29 +284 -13 +2 -1 +19 -1 +7 -1 +25 non-validated
umi GTCTCGTAGT = 34 reads: -14 +349 -1 +18 non-validated
umi GTCTCGTCTC = 25 reads: +18 -3 +361 non-validated
umi GTCTCTCCCT = 20 reads: -13 +287 -26 +1 -1 +25 -1 +28 non-validated
umi GTCTCTGTCC = 31 reads: -13 +271 -98 non-validated
umi GTCTGATAAG = 27 reads: +7 -15 +360 non-validated
umi GTCTGGTTTA = 23 reads: -29 +247 -1X +3 -18 +56 -8 +8 -1 +11 invalidated
umi GTCTGTAACC = 29 reads: +311 -9 +62 non-validated
umi GTCTTACAAC = 41 reads: +51 -12 +299 -6 +14 non-validated
umi GTCTTAGAAT = 26 reads: +382 validated
umi GTCTTATCAC = 52 reads: +382 validated
umi GTCTTCCATA = 42 reads: +382 validated
umi GTCTTCGCTG = 29 reads: -50 +1 -1 +6 -2X +6 -1 +4 -1 +1 -1X +308 invalidated
umi GTGAATTACT = 25 reads: +100 -4 +209 -13 +56 non-validated
umi GTGACAACTC = 38 reads: +2 -1 +1 -1 +4 -1 +3 -8 +361 non-validated
umi GTGACACTCC = 12 reads: +78 -51 +1 -1X +1 -1 +9 -1 +1 -1 +3 -1 +1 -1 +1 -1 +100 -46 +82 -1 invalidated
umi GTGACCTGCC = 27 reads: -1 +1 -1 +2 -1 +5 -6 +365 non-validated
umi GTGACGTTGG = 30 reads: +283 -24 +75 non-validated
umi GTGAGGGATC = 27 reads: +382 validated
umi GTGATCGTCG = 36 reads: +22 -1XX +28 -1 +330 invalidated
umi GTGCACCCGG = 32 reads: +111 -1 +270 non-validated
umi GTGCCCTATA = 26 reads: -33 +247 -9 +93 non-validated
umi GTGCGCGCAC = 40 reads: +351 -1 +3 -2 +13 -1 +4 -1 +6 non-validated
umi GTGCGCGCGA = 35 reads: +49 -1 +2 -2 +4 -1X +1 -2 +3 -1 +3 -1 +18 -1 +293 invalidated
umi GTGCGGTTTT = 43 reads: +382 validated
umi GTGCGTTTGT = 27 reads: +335 -47 non-validated
umi GTGCTACCTG = 27 reads: +91 -1 +200 -18 +72 non-validated
umi GTGCTAGACC = 19 reads: -20 +1 -1 +1 -1 +113 -1 +3 -20 +107 -23 +56 -4 +31 non-validated
umi GTGGACCGGC = 19 reads: -40 +212 -3 +3 -1 +117 -6 non-validated
umi GTGGATTATC = 30 reads: +53 -1 +1 -1 +34 -1 +271 -20 non-validated
umi GTGGGCCCCC = 36 reads: +382 validated
umi GTGTAACCCC = 13 reads: -32 +4 -1X +274 -33 +38 invalidated
umi GTGTCCACTC = 26 reads: -20 +258 -1 +1 -1 +5 -1 +1 -1 +8 -1 +37 -1 +13 -1 +6 -26 non-validated
umi GTGTGGAATA = 24 reads: +130 -1X +251 invalidated
umi GTGTTCTATG = 40 reads: +3 -1 +2 -1 +2 -2X +1 -1 +333 -1 +10 -25 invalidated
umi GTTAAACCTA = 31 reads: +350 -1 +1 -1 +3 -1 +1 -1 +4 -1 +1 -1 +2 -1 +1 -3 +9 non-validated
umi GTTAACGCTA = 21 reads: +382 validated
umi GTTACACCCG = 34 reads: +19 -10 +290 -7 +56 non-validated
umi GTTACACTCA = 16 reads: +181 -1 +4 -1 +7 -1 +8 -7 +110 -19 +18 -1 +24 non-validated
umi GTTACCTACC = 25 reads: -13 +285 -1 +34 -21 +1 -2 +4 -1 +2 -1 +2 -1 +6 -2 +2 -1 +3 non-validated
umi GTTACTCTGT = 26 reads: -47 +335 non-validated
umi GTTAGTCTGG = 47 reads: -14 +359 -9 non-validated
umi GTTATATTGC = 38 reads: +382 validated
umi GTTATTTTGT = 20 reads: +3 -2 +86 -2 +281 -8 non-validated
umi GTTCATTCGG = 39 reads: -22 +288 -12 +60 non-validated
umi GTTCCCCTTC = 33 reads: +52 -11 +319 non-validated
umi GTTCCGCACC = 32 reads: -7 +10 -1 +293 -1X +4 -1 +65 invalidated
umi GTTCCGGCGC = 16 reads: -27 +325 -1 +2 -24 +3 non-validated
umi GTTCCGTTCC = 18 reads: +300 -82 non-validated
umi GTTCGGACCT = 26 reads: -11 +101 -1 +79 -8 +127 -1X +50 -4 invalidated
umi GTTCGGCCCT = 32 reads: -6 +333 -1 +30 -1 +11 non-validated
umi GTTCGGTCCT = 24 reads: -57 +294 -31 non-validated
umi GTTCTATGGG = 41 reads: +339 -21 +22 non-validated
umi GTTCTCTCTT = 28 reads: +355 -10 +17 non-validated
umi GTTCTTCTCC = 23 reads: -2 +309 -21 +50 non-validated
umi GTTGAATGGT = 22 reads: -25 +3 -1 +2 -2 +7 -3 +1 -1 +3 -1 +3 -3 +3 -1 +23 -1X +1 -1 +2 -1 +187 -20 +62 -25 invalidated
umi GTTGCACCTC = 27 reads: +260 -1 +121 non-validated
umi GTTGCATTTG = 34 reads: +25 -4 +353 non-validated
umi GTTGCTATAC = 35 reads: -8 +374 non-validated
umi GTTGGGTTTC = 34 reads: +106 -2 +257 -1 +12 -2 +1 -1 non-validated
umi GTTGGTCCTT = 23 reads: -27 +76 -1 +119 -1XX +158 invalidated
umi GTTGTAACAG = 24 reads: +12 -1 +9 -1 +358 -1 non-validated
umi GTTGTCACCC = 37 reads: +379 -3 non-validated
umi GTTGTCATAG = 20 reads: +23 -34 +191 -7X +56 -54 +12 -1 +4 invalidated
umi GTTTAAGGCC = 21 reads: +297 -85 non-validated
umi GTTTACCCGT = 20 reads: -43 +222 -1 +90 -26 non-validated
umi GTTTAGAGCC = 45 reads: -1 +381 non-validated
umi GTTTAGGCCA = 30 reads: +346 -1 +35 non-validated
umi GTTTATCTCA = 25 reads: +9 -22 +75 -1 +251 -24 non-validated
umi GTTTCACTCC = 31 reads: +343 -30 +9 non-validated
umi GTTTCGTTCC = 31 reads: +40 -1 +4 -1 +312 -24 non-validated
umi GTTTCTTAAC = 27 reads: -53 +78 -1 +232 -1 +1 -1 +15 non-validated
umi GTTTCTTCCC = 46 reads: +382 validated
umi GTTTGAGACC = 30 reads: +156 -7 +168 -12 +39 non-validated
umi GTTTGCCCCG = 17 reads: +258 -15 +83 -26 non-validated
umi GTTTTTGTGC = 39 reads: +62 -1 +4 -20 +295 non-validated
umi TAAACACTAC = 18 reads: -15 +3 -4 +4 -1 +17 -1 +1 -1 +3 -1 +23 -1 +62 -1 +244 non-validated
umi TAACAACCAC = 26 reads: +382 validated
umi TAACAGACAC = 30 reads: +382 validated
umi TAACCACCTT = 15 reads: -29 +290 -63 non-validated
umi TAACCATCAC = 31 reads: +381 -1 non-validated
umi TAACCATGAG = 35 reads: +382 validated
umi TAACCCACAC = 33 reads: +14 -11 +357 non-validated
umi TAACCCTGTC = 29 reads: -21 +122 -4 +58 -1 +176 non-validated
umi TAACGCCATC = 22 reads: +336 -1 +26 -19 non-validated
umi TAAGACCCTT = 40 reads: +193 -1 +9 -1 +129 -1 +8 -1 +1 -1 +37 non-validated
umi TAAGATAGTG = 21 reads: +382 validated
umi TAAGATATAG = 19 reads: +16 -48 +309 -9 non-validated
umi TAAGCAATCT = 28 reads: +382 validated
umi TAAGCCCCCC = 43 reads: +382 validated
umi TAAGGGGCCC = 26 reads: +271 -44 +56 -1 +5 -5 non-validated
umi TAAGTAAAGA = 42 reads: +382 validated
umi TAAGTACCTT = 28 reads: +287 -5 +90 non-validated
umi TAAGTCCTCC = 29 reads: +345 -37 non-validated
umi TAAGTTACCC = 37 reads: +348 -3 +31 non-validated
umi TAAGTTGTCC = 24 reads: +375 -7 non-validated
umi TAATAACCCA = 29 reads: +29 -2 +147 -28 +166 -10 non-validated
umi TAATAATCCA = 30 reads: -18 +241 -1 +106 -1 +8 -7 non-validated
umi TAATAATCCC = 26 reads: -28 +245 -54 +55 non-validated
umi TAATATACAG = 25 reads: +62 -1X +1 -2X +2 -1X +2 -1X +2 -2X +1 -1X +7 -3X +1 -1X +134 -1 +1 -1 +116 -2 +37 invalidated
umi TAATATGGCT = 37 reads: +382 validated
umi TAATCCCATC = 34 reads: +382 validated
umi TAATCCCGGC = 43 reads: +331 -18 +3 -1 +29 non-validated
umi TAATGGCATA = 23 reads: +382 validated
umi TAATTCCCTA = 30 reads: +7 -3 +92 -13 +203 -64 non-validated
umi TAATTTCCTA = 41 reads: +382 validated
umi TACAACCGTA = 37 reads: +301 -2X +2 -2X +1 -3X +1 -3X +67 invalidated
umi TACAAGCTCT = 33 reads: +318 -62 +2 non-validated
umi TACACCCCCG = 24 reads: -1 +317 -48 +16 non-validated
umi TACACCGCCA = 31 reads: +250 -12 +120 non-validated
umi TACACCTCCA = 24 reads: +382 validated
umi TACACTCATA = 38 reads: +382 validated
umi TACACTGCAC = 39 reads: -30 +352 non-validated
umi TACAGATCGG = 24 reads: -34 +246 -1 +13 -42 +46 non-validated
umi TACAGGTTCC = 41 reads: +382 validated
umi TACATAAACC = 48 reads: -2 +6 -1 +4 -1 +368 non-validated
umi TACATAAGTA = 20 reads: -6 +120 -1 +212 -1 +13 -1 +16 -1 +1 -6 +4 non-validated
umi TACATACCCG = 42 reads: +293 -1X +74 -1 +7 -6 invalidated
umi TACATGTAGC = 35 reads: +275 -8 +99 non-validated
umi TACATTGCTA = 30 reads: +61 -1 +25 -1 +5 -1 +268 -20 non-validated
umi TACCATAGGC = 21 reads: -60 +5 -1 +198 -11 +107 non-validated
umi TACCATAGGG = 23 reads: +311 -20 +51 non-validated
umi TACCATCTGG = 19 reads: +6 -2 +4 -1 +4 -1 +6 -1 +11 -2 +10 -1 +1 -1 +5 -31 +122 -1 +57 -58 +57 non-validated
umi TACCATTACC = 13 reads: -33 +57 -1 +207 -28 +26 -1 +29 non-validated
umi TACCATTCTC = 43 reads: +382 validated
umi TACCCAACTG = 21 reads: +284 -98 non-validated
umi TACCCACTGC = 24 reads: -34 +348 non-validated
umi TACCCAGAGG = 27 reads: +22 -23 +295 -11 +31 non-validated
umi TACCCAGATA = 19 reads: +23 -18 +84 -1 +1 -31 +170 -54 non-validated
umi TACCCAGCTG = 26 reads: -13 +352 -17 non-validated
umi TACCCATCCT = 32 reads: +382 validated
umi TACCCCTGGC = 34 reads: -12 +307 -22 +41 non-validated
umi TACCCGACCG = 29 reads: -13 +20 -1 +1 -1 +346 non-validated
umi TACCCGTTGT = 32 reads: -13 +8 -1X +1 -2 +357 invalidated
umi TACCGGCCTA = 18 reads: -11 +156 -47 +4 -1 +163 non-validated
umi TACCGTTCTC = 42 reads: +376 -6 non-validated
umi TACCTACCGT = 31 reads: +127 -1XX +6 -1 +173 -26 +48 invalidated
umi TACCTGATGG = 21 reads: +1 -1 +11 -1 +9 -6 +56 -14 +185 -1 +5 -1 +14 -1 +14 -1 +2 -1 +16 -1 +5 -1 +35 non-validated
umi TACCTGGTTT = 34 reads: +356 -26 non-validated
umi TACCTTCATC = 32 reads: +382 validated
umi TACCTTCTCC = 30 reads: +8 -1 +6 -4 +363 non-validated
umi TACGATTCGC = 16 reads: -15 +104 -2X +4 -2 +1 -3X +1 -1 +214 -12 +23 invalidated
umi TACGCAAGTA = 18 reads: +9 -2 +176 -3 +103 -22 +66 -1 non-validated
umi TACGCGCGGC = 25 reads: -19 +261 -1 +34 -1X +23 -8 +35 invalidated
umi TACGGCCCCA = 44 reads: +6 -1 +4 -13 +322 -1X +23 -1 +10 -1 invalidated
umi TACGGTAGCG = 20 reads: +117 -1 +192 -1 +1 -1 +13 -1 +1 -21 +33 non-validated
umi TACGGTAGTC = 41 reads: +1 -1 +380 non-validated
umi TACGTATTTC = 35 reads: +99 -1 +2 -1 +2 -2 +190 -12 +73 non-validated
umi TACGTCCGCC = 33 reads: -1 +6 -1 +6 -1 +367 non-validated
umi TACGTTCTCC = 19 reads: -29 +9 -1 +326 -17 non-validated
umi TACTACTCAC = 14 reads: -30 +279 -73 non-validated
umi TACTAGGCCC = 35 reads: +299 -2X +1 -3X +69 -1X +7 invalidated
umi TACTATGCCC = 20 reads: +254 -3 +87 -10X +5 -12X +11 invalidated
umi TACTCAATTC = 37 reads: +270 -3 +1 -28 +80 non-validated
umi TACTCACTTA = 30 reads: +382 validated
umi TACTCCCAAC = 38 reads: +382 validated
umi TACTCGTCCT = 24 reads: +375 -7 non-validated
umi TACTCTACCA = 27 reads: +279 -103 non-validated
umi TACTGCCTCC = 38 reads: +368 -1 +13 non-validated
umi TACTTACGGC = 31 reads: +23 -58 +301 non-validated
umi TACTTTAAAT = 34 reads: +382 validated
umi TACTTTGGGC = 31 reads: +32 -1 +10 -1 +1 -1 +284 -44 +8 non-validated
umi TAGAAGTCAC = 30 reads: +67 -1 +18 -25 +271 non-validated
umi TAGAATTTCC = 22 reads: +59 -5 +11 -1 +17 -1 +271 -17 non-validated
umi TAGACCCCGT = 19 reads: +51 -1 +330 non-validated
umi TAGAGACCCG = 30 reads: +55 -1 +326 non-validated
umi TAGAGGCCCC = 22 reads: +382 validated
umi TAGATCGACA = 22 reads: +280 -14 +78 -10 non-validated
umi TAGATGTCTC = 40 reads: +370 -1 +5 -6 non-validated
umi TAGCAACCCT = 35 reads: -6 +243 -5 +127 -1 non-validated
umi TAGCACCTCC = 37 reads: +382 validated
umi TAGCACGCTC = 17 reads: +222 -120 +40 non-validated
umi TAGCCCTATA = 39 reads: +374 -1 +7 non-validated
umi TAGCCGGGCG = 36 reads: -20 +337 -3 +22 non-validated
umi TAGCCTGGAC = 22 reads: -5 +5 -1 +84 -1 +225 -2 +59 non-validated
umi TAGCCTTTCG = 15 reads: -19 +226 -39 +27 -1 +14 -1 +13 -42 non-validated
umi TAGCGGGCAT = 29 reads: +304 -4 +74 non-validated
umi TAGCGTGCCT = 29 reads: +7 -1 +1 -1 +23 -10 +339 non-validated
umi TAGCTAGCCG = 26 reads: +382 validated
umi TAGCTTCGGA = 22 reads: +6 -1 +1 -1 +3 -1 +1 -1 +4 -41 +270 -52 non-validated
umi TAGCTTTCCT = 30 reads: +3 -10 +73 -1 +3 -1 +136 -1 +84 -13 +57 non-validated
umi TAGGCAACTC = 34 reads: +315 -5 +56 -6 non-validated
umi TAGGCTTCTC = 23 reads: +266 -15 +3 -1 +31 -1 +15 -1 +2 -1 +1 -2 +43 non-validated
umi TAGGGGCCCC = 35 reads: +350 -32 non-validated
umi TAGGTCTCTC = 43 reads: +308 -7 +67 non-validated
umi TAGGTCTTTC = 30 reads: +295 -6 +56 -25 non-validated
umi TAGGTTCGGC = 34 reads: +378 -1 +3 non-validated
umi TAGTACTCAA = 24 reads: +21 -1X +150 -1X +158 -51 invalidated
umi TAGTACTGTA = 27 reads: +48 -1 +293 -40 non-validated
umi TAGTAGACAC = 30 reads: -19 +173 -1 +189 non-validated
umi TAGTCCCTCT = 23 reads: -5 +241 -9 +127 non-validated
umi TAGTGAACGG = 35 reads: +382 validated
umi TAGTTAATCT = 27 reads: +323 -1 +7 -22 +17 -1 +11 non-validated
umi TAGTTATCCT = 23 reads: -30 +37 -1 +314 non-validated
umi TATAAACATA = 29 reads: -10 +363 -2 +7 non-validated
umi TATAACCCTG = 24 reads: -13 +16 -1 +316 -1 +3 -1 +15 -1 +8 -1 +1 -1 +4 non-validated
umi TATAAGCCTG = 25 reads: +311 -13 +56 -2 non-validated
umi TATAAGGCCC = 29 reads: -13 +352 -1 +16 non-validated
umi TATAATCGCG = 24 reads: -6 +348 -28 non-validated
umi TATAATTCCC = 25 reads: +243 -1 +3 -1 +6 -1 +1 -1 +3 -1 +9 -1 +20 -91 non-validated
umi TATACCTTCG = 34 reads: -1 +329 -1X +51 invalidated
umi TATACTCGAA = 57 reads: +382 validated
umi TATACTGTAT = 33 reads: +382 validated
umi TATAGGTTCC = 22 reads: +251 -21 +110 non-validated
umi TATATGGGAC = 24 reads: +59 -3 +8 -1 +229 -21 +57 -1 +1 -2 non-validated
umi TATATTGGGT = 32 reads: -2 +319 -1 +56 -4 non-validated
umi TATCAACCCC = 26 reads: -16 +203 -15 +142 -6 non-validated
umi TATCCCACTG = 19 reads: +85 -5 +246 -26 +4 -1 +5 -1 +5 -1 +3 non-validated
umi TATCCGCCGA = 32 reads: +334 -48 non-validated
umi TATCGCCCGC = 26 reads: +34 -7 +341 non-validated
umi TATCGGCCTG = 20 reads: -10 +226 -14 +75 -1 +2 -2X +52 invalidated
umi TATGAATCCC = 23 reads: -17 +332 -33 non-validated
umi TATGAGATAC = 23 reads: +23 -7 +99 -1X +27 -2 +76 -2X +3 -1 +4 -1 +2 -4 +56 -29 +45 invalidated
umi TATGCCATAC = 21 reads: +220 -1 +57 -17 +66 -21 non-validated
umi TATGCTCCAT = 30 reads: +73 -5 +304 non-validated
umi TATGCTTTCC = 21 reads: -70 +312 non-validated
umi TATGGACTCC = 22 reads: +75 -10 +3 -1 +157 -2 +102 -32 non-validated
umi TATGGATACC = 42 reads: +208 -12 +162 non-validated
umi TATGGCCTCT = 28 reads: +318 -64 non-validated
umi TATGGGATAG = 37 reads: -24 +323 -8 +27 non-validated
umi TATGGTTCGG = 46 reads: +285 -1 +96 non-validated
umi TATGTTACCC = 24 reads: -23 +264 -95 non-validated
umi TATGTTCTCC = 34 reads: +382 validated
umi TATGTTTCCC = 20 reads: +214 -40 +67 -18 +43 non-validated
umi TATTAAAATA = 32 reads: +290 -26 +6 -1 +59 non-validated
umi TATTAACGGG = 31 reads: +382 validated
umi TATTACGCCT = 35 reads: -5 +350 -6 +9 -1 +11 non-validated
umi TATTCACGTC = 28 reads: +65 -6 +299 -1 +4 -7 non-validated
umi TATTCATGGC = 26 reads: +17 -13 +213 -1 +114 -24 non-validated
umi TATTCGCGTG = 29 reads: -40 +218 -43 +22 -1 +58 non-validated
umi TATTCGTCCT = 37 reads: +382 validated
umi TATTCTCTCG = 28 reads: +264 -15 +11 -1 +7 -1 +2 -1 +4 -1 +75 non-validated
umi TATTGCTCTC = 38 reads: -12 +32 -1 +312 -2 +6 -1 +4 -1 +3 -2 +4 -1 +1 non-validated
umi TATTGGCTCT = 24 reads: +185 -1 +4 -1 +4 -2 +5 -1 +2 -2 +1 -3X +1 -1 +25 -1 +1 -4X +1 -7X +1 -4X +1 -1 +6 -1X +1 -4 +70 -8 +33 invalidated
umi TATTGGGTAG = 28 reads: +273 -5 +104 non-validated
umi TATTGGTTGA = 20 reads: -3 +86 -21 +231 -41 non-validated
umi TATTGTGGAT = 23 reads: -29 +20 -1 +35 -2 +222 -2 +7 -1 +8 -2 +9 -4 +6 -20 +14 non-validated
umi TATTGTTATG = 38 reads: -1 +381 non-validated
umi TATTTAATGA = 29 reads: +380 -2 non-validated
umi TATTTAGATC = 21 reads: +335 -1 +46 non-validated
umi TATTTATCAC = 28 reads: +2 -1 +4 -5 +370 non-validated
umi TATTTGTCCC = 34 reads: +15 -1 +366 non-validated
umi TATTTTCCCG = 32 reads: +1 -3 +2 -1 +1 -1 +373 non-validated
umi TATTTTTTTG = 28 reads: -24 +297 -15 +46 non-validated
umi TCAAACCCAA = 28 reads: -8 +374 non-validated
umi TCAAACGGGG = 19 reads: +243 -15 +81 -43 non-validated
umi TCAAATGCCC = 36 reads: +287 -29 +66 non-validated
umi TCAACATGTA = 37 reads: -10 +287 -32 +53 non-validated
umi TCAACCCTTG = 30 reads: +4 -1 +333 -44 non-validated
umi TCAACTCCCC = 39 reads: -29 +353 non-validated
umi TCAAGGCAAC = 25 reads: -18 +230 -1 +133 non-validated
umi TCAAGGTCCC = 17 reads: +7 -56 +319 non-validated
umi TCAATACCCC = 14 reads: -62 +181 -19 +120 non-validated
umi TCAATACTCC = 22 reads: -3 +56 -28 +295 non-validated
umi TCAATATAGA = 29 reads: +53 -11 +249 -45 +24 non-validated
umi TCAATTCAGC = 39 reads: +372 -7 +3 non-validated
umi TCACAATTCC = 42 reads: -12 +370 non-validated
umi TCACACTCTG = 38 reads: -15 +367 non-validated
umi TCACAGTCTG = 22 reads: +2 -18 +147 -11 +177 -27 non-validated
umi TCACATACCC = 61 reads: +49 -2XX +2 -4XX +1 -2XX +1 -1XX +1 -307XX +1 -5X +2 -2X +2 invalidated
umi TCACATATGG = 32 reads: +317 -1 +6 -1 +5 -2 +2 -1X +1 -1 +33 -1 +10 -1 invalidated
umi TCACATATTC = 34 reads: +352 -1 +25 -1 +3 non-validated
umi TCACATGAGC = 19 reads: -29 +2 -1 +16 -1 +9 -1 +173 -25 +71 -1 +6 -1 +3 -1 +25 -1 +8 -1 +7 non-validated
umi TCACATTCTG = 20 reads: -10 +324 -5 +43 non-validated
umi TCACCACCCC = 27 reads: +4 -1 +377 non-validated
umi TCACCGCGTA = 26 reads: +362 -20 non-validated
umi TCACCGTCTG = 29 reads: -29 +17 -1 +296 -39 non-validated
umi TCACCTAGGG = 42 reads: -5 +377 non-validated
umi TCACCTGGCT = 24 reads: -10 +3 -1 +3 -1 +242 -45 +77 non-validated
umi TCACCTGTCG = 19 reads: -49 +231 -48 +54 non-validated
umi TCACGACCTT = 40 reads: -10 +372 non-validated
umi TCACGACTCC = 32 reads: +351 -31 non-validated
umi TCACGATCCC = 35 reads: +382 validated
umi TCACGGCGAG = 18 reads: -39 +202 -1 +62 -22 +56 non-validated
umi TCACGGTAGC = 34 reads: -5 +377 non-validated
umi TCACTAATCC = 37 reads: +10 -38 +244 -14 +76 non-validated
umi TCACTACCTG = 29 reads: +65 -1 +2 -6 +227 -1X +33 -44 +3 invalidated
umi TCACTCACCC = 24 reads: -14 +327 -12 +29 non-validated
umi TCACTCACGG = 29 reads: +382 validated
umi TCACTCCATC = 25 reads: -21 +361 non-validated
umi TCACTTTTGG = 45 reads: -2 +370 -7 +3 non-validated
umi TCAGAAAGGC = 27 reads: +155 -1 +20 -1 +205 non-validated
umi TCAGATACCA = 28 reads: +311 -2 +69 non-validated
umi TCAGATCCTG = 29 reads: +268 -1 +102 -1 +4 -6 non-validated
umi TCAGCAGTCC = 35 reads: -2 +270 -1 +6 -1 +102 non-validated
umi TCAGCTTCCT = 23 reads: +316 -66 non-validated
umi TCAGGACCCT = 31 reads: +344 -1 +37 non-validated
umi TCAGGTAGAG = 28 reads: +26 -25 +330 -1 non-validated
umi TCAGTAGCCA = 35 reads: +217 -1 +91 -1XX +7 -39 +26 invalidated
umi TCAGTAGGGC = 39 reads: +358 -1 +23 non-validated
umi TCAGTCCCTA = 39 reads: +330 -33 +19 non-validated
umi TCATACAGTG = 26 reads: +2 -2 +2 -2X +5 -2 +17 -1 +2 -1 +5 -10 +320 -1 +4 -6 invalidated
umi TCATACTCTC = 37 reads: -3 +379 non-validated
umi TCATAGCTCT = 21 reads: +290 -1 +70 -21 non-validated
umi TCATAGTCCC = 25 reads: +300 -2 +1 -1 +5 -1X +6 -4 +1 -1 +32 -1 +2 -1 +3 -1 +6 -1 +7 -6 invalidated
umi TCATAGTCCG = 29 reads: -22 +13 -1 +25 -1 +67 -1 +252 non-validated
umi TCATATCCGG = 39 reads: +327 -9 +3 -1 +42 non-validated
umi TCATATTGCT = 27 reads: +31 -4 +127 -1 +4 -1X +1 -1X +2 -1X +1 -1X +1 -1 +2 -1 +6 -1 +1 -1 +2 -1 +165 -25 invalidated
umi TCATCATATC = 28 reads: +47 -15 +158 -1X +96 -17 +48 invalidated
umi TCATCCTCCT = 26 reads: +330 -33 +1 -1 +3 -2 +1 -1 +9 -1 non-validated
umi TCATCGGCTT = 26 reads: +8 -1 +1 -1 +1 -1 +277 -86 +6 non-validated
umi TCATCTACCC = 39 reads: +27 -1XX +354 invalidated
umi TCATCTGATC = 33 reads: +323 -11 +6 -1 +41 non-validated
umi TCATGTGGGG = 31 reads: +56 -2 +324 non-validated
umi TCATGTGTCT = 46 reads: +382 validated
umi TCATTCACCC = 27 reads: +16 -1X +365 invalidated
umi TCATTCATTC = 32 reads: -24 +346 -12 non-validated
umi TCATTCCCGC = 13 reads: +201 -9 +63 -48 +61 non-validated
umi TCATTCTACC = 23 reads: +270 -1 +57 -54 non-validated
umi TCATTGCGCC = 28 reads: +350 -32 non-validated
umi TCATTGGATC = 30 reads: +304 -15 +10 -1 +4 -1 +1 -3 +12 -1 +30 non-validated
umi TCCAACAGGG = 43 reads: +313 -4 +59 -1 +5 non-validated
umi TCCAACGTCC = 33 reads: +310 -27 +45 non-validated
umi TCCAAGGCCT = 28 reads: +293 -17 +72 non-validated
umi TCCAATAGCG = 24 reads: +214 -2 +92 -1 +10 -63 non-validated
umi TCCACATGTA = 30 reads: +34 -31 +317 non-validated
umi TCCACCAGCT = 30 reads: -13 +369 non-validated
umi TCCACGCATA = 26 reads: -5 +321 -56 non-validated
umi TCCACGCCTG = 26 reads: +297 -1 +80 -1 +3 non-validated
umi TCCACGTGGG = 23 reads: +352 -1 +10 -10 +9 non-validated
umi TCCACTGGCG = 36 reads: +382 validated
umi TCCACTGGCT = 32 reads: -29 +14 -1 +338 non-validated
umi TCCACTGGGG = 14 reads: +11 -37 +70 -3 +3 -2 +1 -1 +5 -1 +4 -1 +1 -1 +132 -1 +56 -52 non-validated
umi TCCAGACCCC = 27 reads: -11 +350 -4 +17 non-validated
umi TCCAGGCGTA = 26 reads: +357 -25 non-validated
umi TCCAGTCTCA = 26 reads: -37 +281 -1 +2 -1 +11 -8 +41 non-validated
umi TCCAGTGCGG = 30 reads: -13 +343 -26 non-validated
umi TCCATATATC = 30 reads: +284 -11 +58 -2 +27 non-validated
umi TCCATATTCG = 31 reads: +313 -13 +56 non-validated
umi TCCATCACCT = 21 reads: -72 +262 -27 +21 non-validated
umi TCCATCCTAG = 32 reads: +9 -20 +353 non-validated
umi TCCATCGGAG = 27 reads: -39 +312 -1 +30 non-validated
umi TCCATGCAAT = 26 reads: +331 -1 +9 -1 +40 non-validated
umi TCCATGGTCG = 28 reads: +56 -1 +313 -1 +11 non-validated
umi TCCATGTCCC = 34 reads: +9 -20 +350 -3 non-validated
umi TCCATTAGCG = 19 reads: -52 +164 -1 +87 -12 +66 non-validated
umi TCCATTCTTT = 34 reads: -21 +285 -1 +1 -15 +59 non-validated
umi TCCATTGAGC = 24 reads: +177 -1 +80 -44 +80 non-validated
umi TCCCAACTCC = 35 reads: +362 -20 non-validated
umi TCCCACCCAC = 34 reads: -2 +380 non-validated
umi TCCCACCGGA = 34 reads: +382 validated
umi TCCCAGCCTC = 18 reads: +68 -25 +263 -26 non-validated
umi TCCCAGTACC = 39 reads: -13 +298 -71 non-validated
umi TCCCATATCG = 34 reads: +382 validated
umi TCCCATCCTG = 25 reads: +25 -26 +189 -38 +9 -1 +94 non-validated
umi TCCCATGTAC = 30 reads: +10 -1 +1 -1 +335 -1 +1 -1 +31 non-validated
umi TCCCATTACC = 38 reads: +5 -6 +371 non-validated
umi TCCCATTCTC = 19 reads: +34 -17 +116 -26 +189 non-validated
umi TCCCCACACC = 28 reads: +5 -1 +38 -1 +6 -4 +3 -1 +10 -1 +259 -42 +11 non-validated
umi TCCCCATCCG = 31 reads: -59 +323 non-validated
umi TCCCCCTTTA = 37 reads: +382 validated
umi TCCCCGCCGT = 30 reads: +11 -1 +329 -3 +2 -1 +1 -2 +3 -1 +1 -3 +3 -1 +3 -2 +15 non-validated
umi TCCCCGCCTA = 34 reads: -4 +6 -1 +2 -1 +64 -15 +258 -1 +30 non-validated
umi TCCCCTGGGG = 24 reads: -11 +323 -1 +47 non-validated
umi TCCCCTTACC = 32 reads: -16 +284 -72X +10 invalidated
umi TCCCGACGGC = 22 reads: +137 -1 +166 -1 +3 -1 +73 non-validated
umi TCCCGCATCT = 34 reads: -5 +360 -17 non-validated
umi TCCCGCCCTC = 19 reads: +19 -3 +333 -27 non-validated
umi TCCCGTAAGT = 24 reads: +16 -10 +356 non-validated
umi TCCCGTTTCA = 27 reads: -2 +83 -11 +181 -17 +78 -10 non-validated
umi TCCCTAAGGA = 22 reads: +11 -48 +112 -19 +161 -31 non-validated
umi TCCCTCGTAT = 34 reads: +355 -6 +21 non-validated
umi TCCCTCTGGC = 28 reads: +249 -6 +126 -1 non-validated
umi TCCCTGTTTC = 14 reads: -28 +2 -1 +166 -1 +14 -2 +3 -1 +12 -42 +83 -1X +3 -1 +6 -1 +3 -1 +8 -1 +2 invalidated
umi TCCCTTCCTC = 31 reads: -11 +371 non-validated
umi TCCCTTGTTT = 25 reads: +34 -11 +42 -1 +294 non-validated
umi TCCGAACCTA = 28 reads: -22 +1 -1 +3 -1 +4 -1 +329 -17 +3 non-validated
umi TCCGAATAGT = 44 reads: +7 -2 +4 -2 +26 -1 +314 -2 +6 -3 +15 non-validated
umi TCCGACTGGG = 25 reads: -41 +341 non-validated
umi TCCGAGCTAC = 31 reads: -1 +1 -1 +1 -2 +2 -1 +3 -1 +140 -1 +2 -1X +2 -1 +2 -1 +219 invalidated
umi TCCGAGTCTC = 36 reads: +35 -26 +153 -5 +24 -1 +10 -1 +20 -15 +92 non-validated
umi TCCGCAGCCC = 31 reads: +382 validated
umi TCCGCCGACC = 19 reads: +230 -80 +72 non-validated
umi TCCGCGAGTG = 41 reads: +378 -4 non-validated
umi TCCGCGCTTT = 26 reads: +5 -5 +187 -1 +13 -1X +164 -6 invalidated
umi TCCGCGGTAC = 35 reads: +382 validated
umi TCCGCTACCC = 20 reads: +109 -1 +1 -1 +134 -2 +98 -22 +12 -1 +1 non-validated
umi TCCGCTTGTG = 26 reads: +7 -5 +370 non-validated
umi TCCGGACTCA = 24 reads: +382 validated
umi TCCGGGTTTC = 15 reads: +12 -47 +221 -3 +56 -35 +8 non-validated
umi TCCGGTAATA = 25 reads: +141 -1 +146 -1 +18 -14 +2 -1 +56 -2 non-validated
umi TCCGTCCCCC = 49 reads: +358 -24 non-validated
umi TCCGTTAACT = 37 reads: +382 validated
umi TCCTACTGTC = 29 reads: -12 +309 -39 +22 non-validated
umi TCCTAGGACC = 25 reads: -13 +13 -1 +2 -2 +4 -1 +89 -33 +207 -3 +14 non-validated
umi TCCTAGTCTA = 27 reads: +2 -1 +8 -1 +3 -7 +134 -1 +194 -31 non-validated
umi TCCTATATCG = 36 reads: +356 -26 non-validated
umi TCCTATCCGC = 34 reads: +59 -15 +301 -7 non-validated
umi TCCTATGGTC = 32 reads: +373 -9 non-validated
umi TCCTCACACG = 53 reads: -3 +379 non-validated
umi TCCTCACGTG = 21 reads: +56 -3 +21 -1 +239 -51 +11 non-validated
umi TCCTCAGAGC = 38 reads: -39 +343 non-validated
umi TCCTCAGGTC = 24 reads: +2 -1 +29 -3 +304 -19 +24 non-validated
umi TCCTCATTCG = 42 reads: +382 validated
umi TCCTCGGGCC = 26 reads: -15 +355 -12 non-validated
umi TCCTCGGTAG = 31 reads: -27 +355 non-validated
umi TCCTCTTGGG = 27 reads: -3 +317 -1 +27 -1X +33 invalidated
umi TCCTCTTTGG = 32 reads: +43 -4 +240 -22 +66 -7 non-validated
umi TCCTGAACCT = 29 reads: +321 -61 non-validated
umi TCCTGGGTAC = 25 reads: +31 -33 +246 -1 +17 -54 non-validated
umi TCCTGTAAGC = 42 reads: +382 validated
umi TCCTGTGCCT = 26 reads: +2 -2 +4 -2 +6 -2 +6 -1 +1 -2 +1 -1 +1 -1 +1 -3 +2 -1 +2 -1 +4 -2 +1 -1 +4 -3 +278 -1 +15 -26 +5 non-validated
umi TCCTTACTCC = 21 reads: -12 +141 -1 +108 -43 +77 non-validated
umi TCCTTATTGC = 31 reads: +382 validated
umi TCGAAACGCA = 30 reads: -7 +2 -1 +193 -1XX +54 -1 +2 -1 +2 -1 +1 -1 +77 -1 +37 invalidated
umi TCGAAAGTCA = 27 reads: +357 -6 +19 non-validated
umi TCGACCTTTT = 30 reads: +5 -30 +289 -1 +17 -1 +3 -36 non-validated
umi TCGACTAGGC = 28 reads: +6 -12 +210 -3 +114 -5 +32 non-validated
umi TCGAGAACCA = 34 reads: +326 -6 +50 non-validated
umi TCGAGACACC = 17 reads: -12 +298 -1X +4 -67 invalidated
umi TCGATAGCCT = 32 reads: +49 -3 +233 -4 +93 non-validated
umi TCGATCTCTG = 30 reads: -22 +299 -1 +60 non-validated
umi TCGATCTCTT = 23 reads: +15 -1X +2 -18 +4 -1 +242 -1 +71 -27 invalidated
umi TCGCACATCG = 32 reads: -29 +307 -15 +31 non-validated
umi TCGCAGGCTC = 30 reads: +67 -1 +214 -1 +1 -1 +56 -8 +12 -1 +20 non-validated
umi TCGCATTTAC = 29 reads: +279 -82 +9 -1 +11 non-validated
umi TCGCCCCCGC = 35 reads: +292 -8 +76 -6 non-validated
umi TCGCCGTTTT = 25 reads: -30 +232 -1 +12 -5 +72 -1 +4 -25 non-validated
umi TCGCTCCCTC = 44 reads: +382 validated
umi TCGCTTGACC = 24 reads: +242 -13 +56 -49 +22 non-validated
umi TCGCTTTGCT = 28 reads: +295 -87 non-validated
umi TCGGATACCC = 35 reads: +347 -24 +5 -1 +5 non-validated
umi TCGGATCTAC = 23 reads: +382 validated
umi TCGGATGCCC = 34 reads: +29 -1 +352 non-validated
umi TCGGCGGTTG = 31 reads: -43 +339 non-validated
umi TCGGTGCCTA = 29 reads: +8 -8 +266 -80 +8 -1 +11 non-validated
umi TCGGTGGAGC = 32 reads: -18 +56 -15 +6 -1 +286 non-validated
umi TCGGTTGCTA = 20 reads: +258 -1 +5 -75 +43 non-validated
umi TCGGTTTAAG = 22 reads: +22 -42 +277 -41 non-validated
umi TCGTACACCG = 26 reads: -64 +194 -1 +123 non-validated
umi TCGTACGGAC = 34 reads: +19 -40 +296 -27 non-validated
umi TCGTACTTTC = 39 reads: +7 -3 +372 non-validated
umi TCGTCACGGC = 21 reads: +250 -87 +6 -1 +5 -1 +2 -1 +29 non-validated
umi TCGTCATCCT = 30 reads: +382 validated
umi TCGTCCTCTC = 24 reads: +290 -16 +76 non-validated
umi TCGTCGGTTA = 35 reads: +382 validated
umi TCGTCGTGGT = 12 reads: -39 +64 -1 +1 -1 +3 -1 +7 -2 +5 -1 +2 -1 +1 -1 +174 -14 +56 -8 non-validated
umi TCGTCGTTAG = 24 reads: -15 +1 -1 +258 -27 +80 non-validated
umi TCGTGCGACG = 27 reads: -2 +5 -2X +4 -1 +309 -59 invalidated
umi TCGTGGCTCT = 28 reads: -10 +337 -35 non-validated
umi TCGTGTCCTC = 19 reads: -50 +293 -39 non-validated
umi TCGTGTGCGC = 23 reads: -3 +8 -1 +370 non-validated
umi TCGTTCACTC = 28 reads: +372 -10 non-validated
umi TCGTTCTCCT = 19 reads: +2 -1 +272 -27 +64 -1 +12 -1 +2 non-validated
umi TCGTTTAAGC = 27 reads: +280 -1 +1 -23 +56 -21 non-validated
umi TCTAAAATAT = 24 reads: -29 +217 -7 +129 non-validated
umi TCTAACCGCC = 30 reads: +310 -1 +16 -1 +27 -1 +26 non-validated
umi TCTAACGCAC = 29 reads: +251 -1 +6 -1 +57 -6 +60 non-validated
umi TCTAATAGCC = 23 reads: -12 +247 -1X +97 -16 +8 -1 invalidated
umi TCTACCACCT = 45 reads: +346 -1 +25 -1X +9 invalidated
umi TCTACCATGT = 39 reads: -5 +353 -1X +23 invalidated
umi TCTACCGACG = 31 reads: +357 -1 +24 non-validated
umi TCTACGGTCG = 32 reads: +343 -3 +36 non-validated
umi TCTACGTGTC = 31 reads: +330 -52 non-validated
umi TCTAGATGGC = 26 reads: +297 -2 +83 non-validated
umi TCTAGGTCCT = 29 reads: -16 +13 -1 +12 -1 +312 -27 non-validated
umi TCTAGTCCTT = 29 reads: +7 -9 +140 -1 +225 non-validated
umi TCTATGAGTA = 13 reads: +234 -2 +2 -1 +39 -1 +18 -39 +46 non-validated
umi TCTATGCCCG = 21 reads: -10 +366 -1 +5 non-validated
umi TCTATTCCGG = 17 reads: +43 -63 +205 -30 +3 -1 +6 -1 +18 -1 +11 non-validated
umi TCTATTTAGA = 32 reads: +12 -17 +353 non-validated
umi TCTATTTGTC = 30 reads: -5 +184 -1 +192 non-validated
umi TCTCAACCAG = 31 reads: -3 +367 -1 +3 -8 non-validated
umi TCTCAATCCG = 26 reads: -14 +72 -62 +8 -2 +173 -1 +5 -1 +3 -1 +40 non-validated
umi TCTCAGTCTC = 22 reads: +69 -25 +217 -1X +8 -1X +1 -1 +10 -2X +1 -1X +2 -2 +41 invalidated
umi TCTCAGTCTG = 44 reads: +2 -1 +4 -1 +319 -2X +53 invalidated
umi TCTCAGTGCT = 27 reads: +382 validated
umi TCTCATGTCC = 22 reads: -19 +309 -54 non-validated
umi TCTCATTAGG = 33 reads: -51 +1 -1 +3 -1 +173 -1 +4 -19 +128 non-validated
umi TCTCATTTCC = 30 reads: +382 validated
umi TCTCCATCCT = 28 reads: +153 -1 +2 -22 +132 -1 +71 non-validated
umi TCTCCCGGGT = 30 reads: +356 -26 non-validated
umi TCTCCGTATA = 34 reads: -108 +49 -41 +180 -2 +2 non-validated
umi TCTCCGTTCG = 41 reads: +382 validated
umi TCTCCTGGGC = 24 reads: -24 +328 -1 +1 -1 +9 -1 +11 -1 +2 -1 +1 -1 non-validated
umi TCTCGCGAGC = 32 reads: -29 +309 -1 +5 -1 +33 -1 +1 -2 non-validated
umi TCTCGCGTCC = 38 reads: +377 -5 non-validated
umi TCTCGGCGCT = 20 reads: -35 +6 -2 +165 -7 +132 -35 non-validated
umi TCTCTAGACC = 30 reads: +3 -1 +138 -1 +25 -1X +175 -38 invalidated
umi TCTCTAGGTT = 23 reads: +7 -103 +245 -27 non-validated
umi TCTCTAGTGC = 52 reads: +382 validated
umi TCTCTCCCCC = 33 reads: +160 -1X +39 -1XX +122 -59 invalidated
umi TCTCTGGTGC = 37 reads: +382 validated
umi TCTCTTCGGG = 46 reads: +54 -1 +322 -5 non-validated
umi TCTCTTGGTA = 35 reads: +350 -1 +31 non-validated
umi TCTGACGCCC = 30 reads: +382 validated
umi TCTGGGATTC = 32 reads: -5 +377 non-validated
umi TCTGGTCTCC = 26 reads: +341 -41 non-validated
umi TCTGTCGCGT = 35 reads: +344 -1 +6 -3X +3 -2 +23 invalidated
umi TCTGTGGGCC = 24 reads: +21 -8 +295 -1X +2 -55 invalidated
umi TCTGTTAGGA = 28 reads: +348 -12 +6 -2 +5 -1 +1 -1 +4 -1 +1 non-validated
umi TCTGTTTGCT = 34 reads: +74 -8 +269 -1 +30 non-validated
umi TCTTAACTCT = 43 reads: +382 validated
umi TCTTAAGCTC = 24 reads: +51 -20 +10 -1 +266 -18 +16 non-validated
umi TCTTACCCTC = 30 reads: +355 -24 +2 -1 non-validated
umi TCTTAGTCCC = 32 reads: +291 -1 +90 non-validated
umi TCTTGGTGGG = 14 reads: -48 +190 -6 +86 -52 non-validated
umi TCTTTATGGT = 30 reads: -36 +308 -1 +11 -26 non-validated
umi TCTTTCCCAT = 18 reads: -86 +76 -32 +176 -3 +1 -1 +1 -1 +1 -1X +1 -1 +1 invalidated
umi TCTTTCCTCC = 32 reads: +330 -29 +23 non-validated
umi TCTTTCTATT = 37 reads: +382 validated
umi TCTTTCTCCT = 30 reads: +303 -6 +56 -4 +8 -1 +4 non-validated
umi TCTTTGCGCA = 19 reads: +15 -14 +214 -1 +138 non-validated
umi TCTTTGCTCA = 35 reads: +231 -1X +145 -5 invalidated
umi TCTTTTTCCC = 27 reads: +214 -20 +135 -13 non-validated
umi TGAACTAGAC = 36 reads: -10 +3 -1 +358 -1 +9 non-validated
umi TGAATACCCG = 24 reads: -11 +145 -1 +6 -1 +218 non-validated
umi TGAATACCGG = 36 reads: -34 +99 -1XX +191 -11 +46 invalidated
umi TGACAATCCT = 22 reads: -34 +267 -11 +70 non-validated
umi TGACACATAT = 32 reads: -1 +299 -1 +2 -1 +78 non-validated
umi TGACAGGGTG = 33 reads: +370 -12 non-validated
umi TGACATATTG = 33 reads: +382 validated
umi TGACCAGGTA = 24 reads: -13 +274 -28 +67 non-validated
umi TGACCATTCT = 33 reads: +357 -17 +8 non-validated
umi TGACTTTCAC = 21 reads: -24 +358 non-validated
umi TGAGCGCCCC = 34 reads: -10 +372 non-validated
umi TGAGCTTGGG = 30 reads: +53 -4 +10 -1 +279 -21 +14 non-validated
umi TGATAACATC = 29 reads: -59 +315 -8 non-validated
umi TGATAAGCCC = 15 reads: +34 -23 +64 -5 +62 -50 +1 -1 +1 -2 +2 -1 +5 -1 +92 -1 +5 -11 +21 non-validated
umi TGATATGCCC = 37 reads: +9 -1 +372 non-validated
umi TGATCATCCT = 21 reads: +2 -2 +4 -1 +145 -1 +136 -80 +11 non-validated
umi TGATCGCTGT = 17 reads: +31 -1 +208 -8 +6 -1 +49 -21 +1 -3 +2 -1 +50 non-validated
umi TGATTCCGTG = 36 reads: +97 -4 +280 -1 non-validated
umi TGATTGTTAC = 28 reads: +321 -1X +60 invalidated
umi TGCAAAGCCC = 38 reads: -11 +76 -1 +294 non-validated
umi TGCAACAACC = 33 reads: +382 validated
umi TGCAACCCGT = 26 reads: +282 -32 +56 -1 +11 non-validated
umi TGCACACCCG = 26 reads: +260 -42 +7 -1 +72 non-validated
umi TGCACCCTCT = 26 reads: -57 +233 -44 +48 non-validated
umi TGCAGACCCG = 21 reads: +347 -19 +16 non-validated
umi TGCAGTTCCC = 30 reads: +287 -1 +94 non-validated
umi TGCATAAGGG = 27 reads: +382 validated
umi TGCATAATAG = 33 reads: +243 -14 +76 -22 +1 -2 +2 -1 +11 -2 +2 -1 +2 -3 non-validated
umi TGCATAGCCC = 29 reads: +5 -1X +4 -1 +336 -24 +11 invalidated
umi TGCATATTAA = 27 reads: +333 -49 non-validated
umi TGCATTCCCA = 27 reads: +264 -10 +93 -4 +7 -1 +3 non-validated
umi TGCCAACGTC = 32 reads: +382 validated
umi TGCCAATTGT = 32 reads: -1 +373 -2 +3 -1 +2 non-validated
umi TGCCAATTTC = 36 reads: +235 -17 +130 non-validated
umi TGCCATGGAC = 24 reads: +165 -3 +3 -1 +4 -1 +126 -7 +57 -1 +3 -11 non-validated
umi TGCCCAACTG = 30 reads: -16 +152 -1X +2 -8 +1 -1 +201 invalidated
umi TGCCCACTCA = 13 reads: -80 +185 -74 +43 non-validated
umi TGCCCCGGTC = 28 reads: -8 +374 non-validated
umi TGCCCGTGTC = 49 reads: +35 -16 +331 non-validated
umi TGCCGTTGTT = 24 reads: +93 -11 +186 -46 +46 non-validated
umi TGCCTTCTGA = 39 reads: +352 -1 +4 -25 non-validated
umi TGCCTTGCCC = 32 reads: +346 -6 +30 non-validated
umi TGCGACATTT = 35 reads: +382 validated
umi TGCGCCCATC = 27 reads: +290 -40 +52 non-validated
umi TGCGCGCCCA = 40 reads: +382 validated
umi TGCTACACCC = 49 reads: +382 validated
umi TGCTAGGCAC = 17 reads: -2 +114 -36 +72 -1 +1 -1 +83 -11 +61 non-validated
umi TGCTCCACCC = 26 reads: +165 -1 +3 -2 +2 -4 +72 -16 +117 non-validated
umi TGCTCCTCGT = 33 reads: +325 -1 +13 -1 +42 non-validated
umi TGCTCTCTCC = 28 reads: -13 +328 -21 +20 non-validated
umi TGCTCTTCAA = 27 reads: -10 +218 -1 +6 -1X +104 -1 +11 -1 +29 invalidated
umi TGCTTACCCG = 20 reads: -14 +172 -7 +156 -33 non-validated
umi TGCTTTCCTC = 34 reads: +382 validated
umi TGGAACCCCA = 41 reads: +361 -7 +14 non-validated
umi TGGAACCCCC = 30 reads: -20 +297 -2 +1 -1 +4 -3X +2 -2 +1 -2X +5 -1 +5 -4X +5 -1 +2 -9 +15 invalidated
umi TGGACACACT = 35 reads: +318 -64 non-validated
umi TGGACATACC = 26 reads: -18 +352 -1 +1 -10 non-validated
umi TGGACGCTTT = 36 reads: +382 validated
umi TGGCCAGCTA = 27 reads: +335 -47 non-validated
umi TGGCCTATCC = 31 reads: -12 +368 -1 +1 non-validated
umi TGGCCTATTA = 24 reads: -367 +15 non-validated
umi TGGCGCTTCC = 26 reads: +192 -1 +177 -12 non-validated
umi TGGCTAACGC = 35 reads: -6 +376 non-validated
umi TGGGATGCCT = 19 reads: +28 -1 +8 -1 +29 -1 +302 -1 +11 non-validated
umi TGGGCGTCGG = 16 reads: +34 -7 +60 -2 +86 -4 +189 non-validated
umi TGGGGATCTC = 30 reads: -23 +359 non-validated
umi TGGGGCCCGC = 40 reads: +382 validated
umi TGGGTACGCC = 36 reads: +301 -6 +75 non-validated
umi TGGTACGCGG = 33 reads: -20 +362 non-validated
umi TGGTATCCTA = 29 reads: -10 +170 -1 +184 -2 +3 -1 +5 -6 non-validated
umi TGGTCACTCG = 37 reads: +382 validated
umi TGTAAGCCCC = 18 reads: -20 +125 -1 +1 -2 +4 -1 +128 -1X +10 -53 +36 invalidated
umi TGTAAGCTCC = 25 reads: -26 +105 -4 +177 -14 +56 non-validated
umi TGTACCCACC = 42 reads: +311 -1 +6 -2X +62 invalidated
umi TGTAGCCATC = 29 reads: +382 validated
umi TGTAGCCCTG = 26 reads: +269 -9 +104 non-validated
umi TGTATAACTC = 31 reads: +382 validated
umi TGTATACGAC = 16 reads: -22 +5 -1 +1 -2 +5 -3 +3 -1 +6 -1 +312 -6 +14 non-validated
umi TGTATATGGG = 57 reads: +382 validated
umi TGTCAAGCTA = 20 reads: +382 validated
umi TGTCACACGC = 27 reads: +327 -52 +3 non-validated
umi TGTCATACTC = 35 reads: +382 validated
umi TGTCCACCGC = 34 reads: -13 +369 non-validated
umi TGTCCATCCC = 32 reads: -19 +363 non-validated
umi TGTCCTGACC = 13 reads: -43 +69 -1 +186 -52 +1 -1 +2 -1 +1 -1 +10 -1 +2 -1 +10 non-validated
umi TGTCGATCCT = 29 reads: +319 -1 +62 non-validated
umi TGTCGCGCCC = 36 reads: +382 validated
umi TGTCGTGTTA = 32 reads: +297 -85 non-validated
umi TGTCGTTTGT = 30 reads: +239 -3 +27 -1X +2 -19X +1 -4 +56 -30 invalidated
umi TGTGAATCGG = 40 reads: +382 validated
umi TGTGATCCCC = 16 reads: -13 +166 -14 +133 -3 +2 -1 +1 -1 +3 -26 +19 non-validated
umi TGTGATCTCT = 30 reads: -3 +125 -10 +18 -1 +186 -1 +2 -1 +2 -1 +1 -1 +3 -1 +1 -2 +5 -2 +16 non-validated
umi TGTGCCTTTC = 32 reads: -2 +380 non-validated
umi TGTGTAGTTC = 20 reads: -45 +279 -1 +19 -1 +37 non-validated
umi TGTTACCGCG = 24 reads: +9 -1 +366 -6 non-validated
umi TGTTCCATAC = 28 reads: +13 -1X +368 invalidated
umi TGTTCCATTT = 33 reads: -22 +351 -9 non-validated
umi TGTTCTCAAC = 28 reads: +382 validated
umi TGTTCTCCAT = 24 reads: +31 -6 +172 -13 +156 -4 non-validated
umi TGTTCTCCTC = 34 reads: +218 -1X +163 invalidated
umi TGTTCTGTAG = 30 reads: +25 -1 +278 -29 +49 non-validated
umi TGTTTCCTAC = 21 reads: +85 -28 +262 -2 +1 -1 +3 non-validated
umi TGTTTGACCA = 33 reads: +11 -1 +319 -51 non-validated
umi TTAACAGCCC = 22 reads: -24 +5 -2 +13 -2 +6 -1 +7 -1 +6 -1 +308 -6 non-validated
umi TTAACCTGGG = 25 reads: +352 -1 +29 non-validated
umi TTAACCTTGA = 39 reads: -1 +265 -1XX +115 invalidated
umi TTAACGCGGC = 32 reads: +382 validated
umi TTAACTTCCC = 27 reads: +21 -1 +1 -4 +270 -85 non-validated
umi TTAAGATTCC = 26 reads: -33 +234 -3 +88 -24 non-validated
umi TTAAGGACCG = 42 reads: +382 validated
umi TTAAGGCGCA = 25 reads: +365 -2 +2 -1 +2 -1 +3 -1 +5 non-validated
umi TTAATATCCT = 28 reads: +74 -3 +305 non-validated
umi TTAATCTCAA = 27 reads: +315 -1 +62 -4 non-validated
umi TTAATTCACG = 20 reads: -29 +133 -28 +166 -26 non-validated
umi TTACAAGGAC = 25 reads: +250 -3 +3 -1 +125 non-validated
umi TTACACGGCC = 21 reads: +361 -21 non-validated
umi TTACATATAT = 20 reads: +156 -1 +190 -2 +8 -1 +3 -1 +3 -1 +16 non-validated
umi TTACATCCTA = 42 reads: +382 validated
umi TTACCAACTC = 38 reads: +275 -6 +101 non-validated
umi TTACCCCGCC = 33 reads: +333 -1 +20 -1X +27 invalidated
umi TTACCTTCGC = 19 reads: +201 -1X +4 -1 +1 -1X +4 -2X +2 -2X +9 -1 +115 -1 +11 -1 +2 -1 +6 -1 +13 -1 +1 invalidated
umi TTACGGCCGA = 29 reads: +299 -83 non-validated
umi TTACGTGTAG = 20 reads: +309 -73 non-validated
umi TTACTACCAG = 27 reads: +234 -33 +98 -12 +5 non-validated
umi TTACTACTCT = 26 reads: +310 -7 +20 -1 +44 non-validated
umi TTACTATTCT = 24 reads: +19 -7 +19 -1 +335 -1 non-validated
umi TTACTCTGGG = 31 reads: +322 -1 +59 non-validated
umi TTACTTCGTG = 29 reads: -14 +368 non-validated
umi TTAGACTATA = 25 reads: +341 -41 non-validated
umi TTAGCCACGA = 17 reads: -29 +172 -1 +3 -1 +137 -22 +6 -1 +10 non-validated
umi TTAGGGAGCC = 20 reads: +382 validated
umi TTAGTCCCGC = 40 reads: +382 validated
umi TTATAACTCC = 29 reads: +371 -1 +10 non-validated
umi TTATACAATC = 31 reads: +180 -1 +1 -35 +165 non-validated
umi TTATACCCAC = 18 reads: -18 +220 -1 +132 -11 non-validated
umi TTATACTCAC = 22 reads: -27 +225 -13 +92 -1 +6 -3 +12 -1 +2 non-validated
umi TTATACTGTC = 31 reads: -13 +369 non-validated
umi TTATAGTCGG = 29 reads: -5 +5 -1 +361 -10 non-validated
umi TTATCAACCG = 35 reads: +382 validated
umi TTATCAATCC = 35 reads: +382 validated
umi TTATCACGAC = 28 reads: -27 +11 -1 +343 non-validated
umi TTATCCCCAA = 29 reads: +382 validated
umi TTATCTACCA = 23 reads: +216 -44 +87 -35 non-validated
umi TTATGACCTC = 27 reads: +279 -2X +12 -1 +6 -1X +10 -23 +48 invalidated
umi TTATGATGCA = 11 reads: -50 +135 -1 +4 -1 +9 -1 +7 -1 +138 -35 non-validated
umi TTATGTACTA = 24 reads: +57 -1 +4 -1 +319 non-validated
umi TTATTAGTCC = 36 reads: -7 +375 non-validated
umi TTATTCCTCT = 29 reads: -5 +326 -51 non-validated
umi TTATTGGTAT = 29 reads: +262 -40 +1 -1 +42 -1 +35 non-validated
umi TTATTTCGCT = 23 reads: -34 +257 -1 +2 -1 +87 non-validated
umi TTATTTTCCC = 24 reads: +71 -8 +87 -1 +163 -44 +8 non-validated
umi TTCAAAACTA = 26 reads: -34 +215 -3 +2 -1 +1 -1 +4 -2 +101 -1 +17 non-validated
umi TTCAAATTAC = 17 reads: +282 -27 +56 -17 non-validated
umi TTCAACCCAT = 27 reads: -20 +293 -1 +4 -9 +55 non-validated
umi TTCAACTCCC = 24 reads: -13 +2 -1 +2 -1 +7 -1 +3 -1 +7 -1 +1 -1 +2 -2 +1 -1 +287 -24 +24 non-validated
umi TTCAAGTCTG = 30 reads: +382 validated
umi TTCAATCCTA = 35 reads: -5 +377 non-validated
umi TTCACACATC = 20 reads: -18 +1 -2 +299 -1 +2 -1 +9 -2 +1 -1 +1 -1 +9 -2 +11 -21 non-validated
umi TTCACACCCG = 26 reads: +272 -19 +58 -1 +2 -1 +4 -1 +1 -1 +2 -1 +4 -1 +14 non-validated
umi TTCACCGGTT = 38 reads: +363 -1 +6 -2 +10 non-validated
umi TTCACCTACT = 24 reads: +248 -1 +21 -4 +108 non-validated
umi TTCACCTCTC = 21 reads: -11 +371 non-validated
umi TTCACGACCT = 17 reads: +86 -1 +236 -59 non-validated
umi TTCACTTCTT = 30 reads: +382 validated
umi TTCAGACCGA = 32 reads: +347 -2 +1 -1 +4 -18 +9 non-validated
umi TTCAGCATGA = 32 reads: -15 +367 non-validated
umi TTCAGCATTA = 19 reads: +277 -46 +56 -3 non-validated
umi TTCAGCTGTC = 28 reads: +363 -19 non-validated
umi TTCAGGCTCA = 34 reads: +381 -1 non-validated
umi TTCAGGTAGC = 14 reads: +6 -1 +21 -11 +78 -1 +3 -2 +30 -1 +20 -1 +1 -1 +122 -83 non-validated
umi TTCATAACCG = 24 reads: +29 -1 +347 -5 non-validated
umi TTCATACCCC = 26 reads: -13 +177 -1 +5 -1 +132 -5 +4 -1 +1 -1 +3 -1 +6 -1 +5 -1 +2 -1 +3 -1 +5 -1 +3 -1 +7 non-validated
umi TTCATACTCA = 23 reads: +109 -1XX +219 -53 invalidated
umi TTCATACTCC = 23 reads: +8 -1 +325 -1 +47 non-validated
umi TTCATAGTTC = 24 reads: -10 +348 -1 +6 -17 non-validated
umi TTCATCCGGT = 31 reads: +46 -1 +249 -1 +3 -9 +73 non-validated
umi TTCATGCGCC = 32 reads: -29 +310 -1X +13 -10 +19 invalidated
umi TTCATTCCCG = 27 reads: +297 -1 +20 -37 +20 -1 +5 -1 non-validated
umi TTCATTCGGC = 28 reads: +282 -2 +57 -6 +5 -1 +29 non-validated
umi TTCATTTTCC = 37 reads: +325 -57 non-validated
umi TTCATTTTTC = 37 reads: -51 +26 -6 +20 -1 +278 non-validated
umi TTCCAATCAC = 28 reads: +43 -51 +216 -1X +22 -1 +17 -1 +30 invalidated
umi TTCCACCCTG = 28 reads: +272 -16 +78 -16 non-validated
umi TTCCACTCAG = 42 reads: +382 validated
umi TTCCAGCGCA = 33 reads: +382 validated
umi TTCCAGTTTC = 18 reads: -5 +63 -1 +110 -18 +116 -8 +61 non-validated
umi TTCCATGCCA = 23 reads: -29 +154 -4 +157 -1 +37 non-validated
umi TTCCATTAGG = 15 reads: +11 -7 +141 -15 +65 -1 +16 -1 +7 -16 +56 -4 +5 -1 +3 -2 +5 -2 +1 -2 +2 -3 +1 -2X +3 -1X +6 -1 +1 -1 invalidated
umi TTCCATTATG = 40 reads: +382 validated
umi TTCCATTCCC = 53 reads: +330 -41 +11 non-validated
umi TTCCCATCTC = 20 reads: -22 +360 non-validated
umi TTCCCCGCCA = 26 reads: +14 -17 +339 -1 +1 -10 non-validated
umi TTCCCCTTCA = 36 reads: +341 -1 +40 non-validated
umi TTCCCGACCG = 23 reads: +317 -8 +57 non-validated
umi TTCCCGGCAA = 27 reads: -40 +240 -6 +96 non-validated
umi TTCCCTAATG = 28 reads: +30 -41 +311 non-validated
umi TTCCCTCCGC = 19 reads: +371 -11 non-validated
umi TTCCGACCTC = 24 reads: +326 -4 +52 non-validated
umi TTCCGCACAC = 28 reads: -4 +378 non-validated
umi TTCCGCCCCC = 37 reads: +64 -1 +317 non-validated
umi TTCCGGCTGT = 26 reads: +358 -24 non-validated
umi TTCCGTCTTT = 23 reads: +354 -14 +14 non-validated
umi TTCCTAAGAG = 30 reads: +20 -19 +9 -1 +3 -2 +5 -1 +2 -2 +1 -1X +289 -27 invalidated
umi TTCCTAAGGT = 21 reads: +27 -1 +7 -24 +191 -20 +38 -1 +38 -35 non-validated
umi TTCCTACCGA = 28 reads: -2 +1 -1 +377 -1 non-validated
umi TTCCTTAATA = 33 reads: +258 -36 +88 non-validated
umi TTCCTTCGTC = 23 reads: -12 +8 -1 +1 -1 +1 -1 +318 -39 non-validated
umi TTCCTTCTGC = 28 reads: +330 -13X +2 -1 +36 invalidated
umi TTCCTTGGGT = 17 reads: +297 -12 +73 non-validated
umi TTCGAGCACT = 49 reads: +5 -24 +353 non-validated
umi TTCGAGCTCT = 32 reads: +280 -10 +56 -23 +13 non-validated
umi TTCGCACCTG = 33 reads: +382 validated
umi TTCGCTCATA = 40 reads: -13 +369 non-validated
umi TTCGCTCCCA = 24 reads: +374 -8 non-validated
umi TTCGGCCGGG = 28 reads: +342 -1 +5 -1 +33 non-validated
umi TTCGTAGTAG = 21 reads: +234 -1 +52 -19 +71 -5 non-validated
umi TTCGTGTGCA = 25 reads: -10 +302 -37 +11 -1 +1 -1 +19 non-validated
umi TTCGTTAATA = 41 reads: +321 -1 +18 -5 +37 non-validated
umi TTCTACCCTA = 34 reads: +341 -38 +3 non-validated
umi TTCTCAATTG = 23 reads: -12 +275 -23 +56 -16 non-validated
umi TTCTCCGATC = 28 reads: +273 -11 +1 -1X +93 -3 invalidated
umi TTCTCGTTCT = 20 reads: -41 +271 -23 +47 non-validated
umi TTCTGTTTCG = 44 reads: +333 -49 non-validated
umi TTCTTCAAGC = 12 reads: -42 +96 -1 +8 -3 +116 -116 non-validated
umi TTCTTCGCAC = 34 reads: +326 -10 +46 non-validated
umi TTCTTTAGGG = 31 reads: -12 +370 non-validated
umi TTCTTTCGAG = 23 reads: +325 -9 +48 non-validated
umi TTCTTTCTCC = 39 reads: +382 validated
umi TTGAAACTAT = 32 reads: -13 +369 non-validated
umi TTGAAGTCCG = 19 reads: +106 -3 +273 non-validated
umi TTGACATCTC = 31 reads: +382 validated
umi TTGACCATCG = 41 reads: +382 validated
umi TTGACCTAGG = 33 reads: -19 +278 -1 +4 -3 +58 -19 non-validated
umi TTGACTGATA = 36 reads: +135 -1 +158 -4 +24 -1 +47 -1 +5 -1 +2 -1 +2 non-validated
umi TTGAGAATAC = 33 reads: +31 -27 +268 -2 +1 -1 +2 -1 +14 -32 +3 non-validated
umi TTGATCCTCT = 45 reads: +280 -1 +101 non-validated
umi TTGCACACCA = 29 reads: -60 +297 -25 non-validated
umi TTGCATACCA = 22 reads: +20 -1 +290 -71 non-validated
umi TTGCATCTTG = 27 reads: -29 +353 non-validated
umi TTGCATGTAG = 30 reads: -26 +346 -1 +3 -6 non-validated
umi TTGCCCGTCG = 19 reads: +26 -2 +4 -1 +2 -1 +6 -1X +2 -2 +109 -1 +73 -6 +132 -3 +6 -5 invalidated
umi TTGCCTCGCC = 39 reads: +382 validated
umi TTGCCTTTCC = 40 reads: +382 validated
umi TTGCGGCTCT = 18 reads: -50 +5 -1 +6 -1 +5 -1 +286 -1 +2 -24 non-validated
umi TTGCGTCGTA = 17 reads: +237 -28 +57 -37 +19 -1 +3 non-validated
umi TTGCGTGGTC = 20 reads: -1 +3 -4 +1 -2 +2 -1 +18 -16 +7 -1 +163 -53 +8 -1 +63 -1 +6 -1 +11 -11 +8 non-validated
umi TTGCTACATA = 30 reads: +8 -1X +2 -1 +370 invalidated
umi TTGCTTTGCA = 35 reads: +329 -42 +5 -1 +5 non-validated
umi TTGGACTATC = 19 reads: -39 +343 non-validated
umi TTGGCTTCCC = 34 reads: +328 -3 +51 non-validated
umi TTGGGGCCGC = 36 reads: +382 validated
umi TTGGTAACTC = 38 reads: +5 -1 +1 -1 +10 -2 +312 -50 non-validated
umi TTGTAATATG = 24 reads: +340 -1 +2 -1 +5 -2 +4 -27 non-validated
umi TTGTACAGCC = 20 reads: -59 +260 -8 +9 -1 +1 -1 +1 -3 +6 -1 +7 -1 +7 -1 +7 -1 +8 non-validated
umi TTGTAGCCTC = 59 reads: +382 validated
umi TTGTATAACC = 33 reads: +327 -34 +20 -1 non-validated
umi TTGTATCCCT = 31 reads: +382 validated
umi TTGTATCCTG = 25 reads: +89 -1 +1 -7 +284 non-validated
umi TTGTATGAGA = 18 reads: +41 -1 +10 -1 +2 -58 +110 -1 +158 non-validated
umi TTGTGACCTA = 31 reads: -11 +9 -1 +6 -1 +302 -19 +33 non-validated
umi TTGTGATCCC = 16 reads: +41 -2 +1 -2 +1 -1 +1 -1 +1 -4 +4 -1 +2 -1X +1 -2 +2 -1 +2 -1 +2 -1 +57 -3 +1 -1 +2 -1 +59 -9 +14 -1 +134 -2 +23 invalidated
umi TTGTTAGAAA = 35 reads: +343 -16 +5 -2 +16 non-validated
umi TTGTTGTTCG = 15 reads: -46 +289 -47 non-validated
umi TTGTTTCCCC = 18 reads: +82 -1 +91 -34 +8 -1 +165 non-validated
umi TTGTTTTCAC = 18 reads: -58 +260 -64 non-validated
umi TTTAAACGCT = 31 reads: +382 validated
umi TTTAAGTCCC = 18 reads: +43 -12 +276 -23 +28 non-validated
umi TTTAATGGGC = 28 reads: +382 validated
umi TTTACACCGT = 26 reads: -41 +241 -100 non-validated
umi TTTACAGTTC = 36 reads: +318 -6 +58 non-validated
umi TTTACCGACC = 25 reads: +249 -1 +2 -1 +3 -1 +2 -1 +1 -4X +76 -9 +32 invalidated
umi TTTACCTTGG = 36 reads: -17 +365 non-validated
umi TTTACCTTTG = 27 reads: +47 -14 +264 -11 +46 non-validated
umi TTTACTCCGC = 20 reads: -5 +316 -61 non-validated
umi TTTACTCTCG = 37 reads: +9 -3 +345 -22 +3 non-validated
umi TTTACTCTTC = 27 reads: +262 -18 +4 -1 +4 -3 +2 -1 +24 -1 +10 -1 +5 -14 +1 -1 +28 -1X +1 invalidated
umi TTTACTGCGG = 42 reads: +382 validated
umi TTTACTTTCC = 30 reads: +114 -1 +182 -66 +2 -1 +9 -1 +3 -1 +2 non-validated
umi TTTAGACACC = 33 reads: +248 -1 +133 non-validated
umi TTTAGACCCT = 32 reads: -1 +2 -1X +260 -14 +104 invalidated
umi TTTAGACCGT = 30 reads: +323 -9 +5 -2 +4 -1 +4 -1 +33 non-validated
umi TTTATGCCTC = 32 reads: +91 -1 +244 -1 +18 -27 non-validated
umi TTTATTGACC = 31 reads: -19 +10 -1 +63 -1 +277 -11 non-validated
umi TTTCCAGTCC = 19 reads: -56 +148 -6 +137 -1X +23 -11 invalidated
umi TTTCCCATCC = 26 reads: +50 -1 +223 -59 +49 non-validated
umi TTTCCCCATC = 25 reads: +24 -16 +2 -2 +2 -1 +2 -1 +1 -5 +243 -20 +63 non-validated
umi TTTCCGATCA = 26 reads: -60 +258 -41 +23 non-validated
umi TTTCCGCCTA = 17 reads: +56 -38 +90 -1 +4 -1 +3 -1 +8 -15 +134 -1 +30 non-validated
umi TTTCCGCCTC = 37 reads: -10 +56 -3 +313 non-validated
umi TTTCCTTCAC = 34 reads: +369 -13 non-validated
umi TTTCCTTGTC = 29 reads: -45 +1 -1 +246 -1 +1 -4 +81 -1 +1 non-validated
umi TTTCGTACAC = 43 reads: +351 -1 +1 -3 +21 -1 +1 -2 +1 non-validated
umi TTTCTCGCAC = 36 reads: +382 validated
umi TTTCTTGAGG = 34 reads: +10 -1 +317 -6 +48 non-validated
umi TTTGAAAACC = 36 reads: +352 -1 +29 non-validated
umi TTTGCATTCC = 17 reads: -13 +159 -1 +150 -13 +46 non-validated
umi TTTGCCCCCC = 24 reads: -3 +345 -34 non-validated
umi TTTGGTCCCC = 27 reads: +58 -2 +271 -51 non-validated
umi TTTGTAATCG = 31 reads: +66 -4 +1 -1 +2 -1 +2 -3 +4 -2 +272 -1 +23 non-validated
umi TTTGTGTTCT = 27 reads: +58 -13 +311 non-validated
umi TTTGTTCCCC = 16 reads: -13 +61 -29 +267 -1 +11 non-validated
umi TTTTAATCAC = 22 reads: +49 -48 +1 -2 +2 -1 +3 -1 +3 -4 +218 -1 +4 -9 +5 -1 +12 -1 +11 -1 +5 non-validated
umi TTTTACAACC = 27 reads: +243 -1 +1 -6X +89 -2 +40 invalidated
umi TTTTACCAGC = 31 reads: +143 -1 +4 -1 +42 -1 +10 -1 +179 non-validated
umi TTTTACCCAT = 21 reads: +273 -103 +6 non-validated
umi TTTTATTACC = 39 reads: +382 validated
umi TTTTCTACCA = 26 reads: -32 +129 -1 +3 -1 +5 -4 +207 non-validated
umi TTTTGAACCC = 29 reads: +35 -1 +1 -2 +258 -1 +13 -8 +63 non-validated
umi TTTTGGTCGC = 32 reads: +382 validated
umi TTTTGGTTCC = 39 reads: +342 -1 +39 non-validated
umi TTTTTACCTG = 24 reads: +14 -43 +286 -29 +10 non-validated
umi TTTTTCCAGA = 30 reads: -13 +334 -35 non-validated
umi TTTTTCCTCA = 25 reads: +3 -1 +4 -1 +26 -15 +10 -1X +296 -25 invalidated
umi TTTTTCGGCA = 29 reads: +332 -10 +40 non-validated

UMI info for barcode CCCATACCAGATAATG-1 contig 2 = GAGAGAGGAG...
umi AATAGAGAAT = 22 reads: +256 -2 +56 -1 +1 -1 +4 -1 +47 -1 +8 -18 +7 non-validated
umi ACAAAACCTG = 11 reads: -1 +134 -13 +103 -152 non-validated
umi ACATTTCGAT = 21 reads: +251 -1 +10 -9 +4 -1 +5 -2X +2 -1X +1 -1 +6 -1 +6 -1 +1 -1 +21 -1 +1 -48 +1 -3 +4 -2 +1 -1 +3 -1 +1 -1 +4 -2 +4 invalidated
umi ACCATTACCG = 13 reads: +161 -1 +4 -1 +3 -1 +4 -1 +5 -1 +7 -1 +7 -1 +5 -65 +30 -1 +25 -32 +47 non-validated
umi ACCCTACGTC = 30 reads: +130 -1 +203 -34 +35 non-validated
umi ACGATAATCG = 17 reads: +12 -31 +149 -19 +66 -1 +1 -1 +3 -1 +5 -1 +1 -1 +104 -1 +6 non-validated
umi ACGCAATGTG = 16 reads: +141 -4 +69 -1 +79 -34 +56 -19 non-validated
umi ACTAACGGCT = 35 reads: +251 -8 +144 non-validated
umi ACTTGACCCC = 14 reads: +92 -11 +2 -1 +84 -1 +4 -13 +83 -20 +21 -1 +34 -36 non-validated
umi AGACCTCGTC = 23 reads: +35 -41 +7 -1 +4 -1 +266 -1 +47 non-validated
umi AGCGGGCCAA = 10 reads: +13 -17 +87 -24 +6 -2 +13 -1 +4 -1 +104 -1 +7 -1 +3 -1 +4 -1 +1 -2X +1 -1 +3 -1 +2 -1 +2 -1 +2 -1 +4 -1 +66 -24 invalidated
umi AGCTTGCTTG = 20 reads: +39 -21 +1 -3X +1 -2X +3 -1 +1 -1 +1 -3 +4 -1 +1 -1 +195 -95 +20 -1 +8 invalidated
umi AGTGAACCCC = 15 reads: +240 -17 +56 -25 +6 -1 +49 -9 non-validated
umi AGTTGCCCAC = 18 reads: -10 +25 -7 +4 -1 +2 -2 +19 -1 +194 -1 +18 -1 +59 -59 non-validated
umi ATCACAATCC = 19 reads: -33 +9 -1 +1 -1X +4 -2X +174 -1 +1 -1 +82 -1 +20 -1X +7 -3X +5 -4X +4 -1 +1 -1 +4 -1 +5 -1 +34 invalidated
umi ATCCCTGTCC = 33 reads: +272 -64 +67 non-validated
umi ATCCTATAGG = 20 reads: -3 +16 -1 +277 -4 +102 non-validated
umi ATCGCCGCCC = 25 reads: +13 -1 +344 -1 +44 non-validated
umi ATCTTCTCCT = 22 reads: +91 -1 +42 -5 +10 -1 +1 -1 +2 -6X +7 -1X +3 -1 +1 -2 +3 -1 +166 -58 invalidated
umi ATCTTTCTCG = 14 reads: -19 +232 -49 +2 -1 +53 -47 non-validated
umi ATGATATAGG = 18 reads: +49 -1 +32 -2 +7 -1 +2 -2 +2 -1 +156 -1 +3 -1 +1 -1 +1 -8 +127 -5 non-validated
umi ATGTAGCTTT = 11 reads: -69 +1 -1 +1 -2 +1 -1 +1 -1 +227 -98 non-validated
umi ATGTGTTTCC = 22 reads: +64 -41 +176 -1X +70 -51 invalidated
umi ATTACGCCAC = 14 reads: +20 -9 +133 -2 +2 -2 +114 -104 +8 -1 +8 non-validated
umi ATTCGTTACG = 13 reads: +158 -17 +72 -72 +3 -1 +1 -1 +38 -1 +30 -9 non-validated
umi ATTTACACCT = 18 reads: +56 -2 +107 -16 +133 -1 +4 -3 +1 -1 +1 -1 +14 -1 +14 -1 +43 -4 non-validated
umi ATTTACGCAC = 16 reads: +258 -5 +56 -84 non-validated
umi ATTTCCTAGC = 12 reads: -27 +146 -7 +28 -1 +15 -1 +153 -25 non-validated
umi CAAATCACCT = 11 reads: -36 +163 -1 +75 -47 +68 -13 non-validated
umi CAATTTCAAA = 10 reads: -35 +56 -1 +2 -2 +2 -1 +191 -113 non-validated
umi CACGGTCCCC = 34 reads: +403 validated
umi CAGATGCCGC = 23 reads: +199 -1 +1 -4 +86 -1 +108 -3 non-validated
umi CATACCACTC = 28 reads: +91 -27 +137 -1 +3 -1 +2 -1 +101 -15 +24 non-validated
umi CATATAACGC = 15 reads: +60 -20 +3 -1 +305 -14 non-validated
umi CATGCACGGG = 10 reads: -35 +175 -13 +4 -1 +1 -1X +1 -1 +3 -2 +1 -5 +1 -1 +1 -1 +1 -1 +2 -2X +2 -2 +14 -1 +1 -1 +1 -1 +2 -62 +56 -7 invalidated
umi CATTCACCCT = 30 reads: +148 -1 +4 -1X +2 -1 +2 -1 +135 -17 +66 -25 invalidated
umi CATTGCTCTC = 9 reads: +4 -1 +54 -1 +3 -1 +1 -1 +4 -1 +1 -1 +1 -2 +6 -2 +102 -5 +1 -1 +2 -1 +2 -1 +3 -2 +4 -1 +3 -1 +4 -1 +1 -1 +5 -1 +2 -1 +7 -1 +1 -1 +2 -1 +3 -53 +56 -49 non-validated
umi CCACACATCT = 11 reads: -35 +5 -1 +6 -1 +27 -1 +15 -1 +2 -2 +2 -1 +6 -1 +24 -1 +7 -2X +5 -1 +2 -1 +7 -1 +5 -1 +3 -8 +124 -4 +56 -45 invalidated
umi CCACCGGAAC = 15 reads: +83 -1 +2 -1 +99 -1 +5 -1 +87 -123 non-validated
umi CCACCTCTAG = 13 reads: +105 -1 +202 -3 +48 -1 +7 -36 non-validated
umi CCACGTTGCC = 22 reads: +403 validated
umi CCACTGATCC = 24 reads: +187 -8 +82 -19 +6 -1 +17 -1 +74 -8 non-validated
umi CCATATAGCC = 21 reads: +70 -1 +2 -1 +1 -1 +1 -1 +5 -1 +14 -1 +54 -1 +119 -1 +105 -12 +12 non-validated
umi CCATTTCCCA = 8 reads: +17 -54 +1 -2 +1 -1 +7 -1 +4 -1 +2 -1 +6 -1 +28 -19 +56 -11 +56 -22 +1 -1 +65 -1 +2 -1 +10 -2 +10 -19 non-validated
umi CCCATCCCCT = 17 reads: +11 -1 +83 -1X +186 -1 +2 -1 +27 -2 +2 -2 +3 -1 +19 -61 invalidated
umi CCCATCGGCC = 11 reads: +22 -15 +86 -7 +2 -1 +16 -1 +62 -191 non-validated
umi CCCCCCGGCT = 28 reads: +302 -62 +39 non-validated
umi CCCGATATTC = 27 reads: +315 -2 +1 -1 +1 -7 +4 -1 +26 -1 +1 -1 +4 -1 +17 -20 non-validated
umi CCCGTCCCCT = 11 reads: +18 -1 +72 -2 +1 -1 +3 -1 +14 -6 +58 -1 +90 -135 non-validated
umi CCCTAGGGAT = 21 reads: +144 -1 +140 -38 +1 -1 +7 -1 +17 -1 +20 -1 +6 -25 non-validated
umi CCCTCTAGCC = 8 reads: +5 -36 +3 -1 +66 -2 +3 -1 +3 -1 +6 -1 +8 -1 +1 -1 +25 -1 +1 -1X +1 -8 +89 -138 invalidated
umi CCCTTACAAG = 22 reads: -14 +152 -3 +7 -1 +140 -15 +16 -1 +11 -1 +8 -1 +11 -1 +6 -15 non-validated
umi CCCTTCGTCG = 13 reads: +1 -1 +3 -45 +301 -52 non-validated
umi CCGCATCATG = 17 reads: +83 -1 +181 -1 +39 -1 +30 -67 non-validated
umi CCGCTCTCGC = 12 reads: +96 -4 +213 -18 +55 -17 non-validated
umi CCGTCGGTCC = 19 reads: +6 -31 +33 -1 +22 -6 +89 -29 +97 -9 +80 non-validated
umi CCTAATATCT = 24 reads: +373 -1 +11 -18 non-validated
umi CCTAGGTTCC = 3 reads: -60 +1 -1 +1 -1 +1 -3 +4 -2 +1 -2 +6 -1 +7 -2 +1 -1 +20 -52 +56 -180 non-validated
umi CCTATAGCGC = 10 reads: +98 -1 +4 -12 +67 -5 +165 -51 non-validated
umi CCTCGCATCT = 28 reads: +288 -1 +1 -6 +71 -1 +5 -1 +3 -1 +1 -1 +2 -2 +2 -1 +1 -15 non-validated
umi CCTTGCCAAC = 25 reads: +115 -1 +27 -1 +1 -1 +4 -1 +237 -15 non-validated
umi CGAGATACGG = 10 reads: -1 +1 -1 +9 -1 +14 -1 +75 -2 +122 -176 non-validated
umi CGCAGTTTTG = 12 reads: -26 +103 -1 +4 -2 +167 -1 +15 -84 non-validated
umi CGCATACATG = 20 reads: +83 -1X +154 -1 +60 -18 +66 -20 invalidated
umi CGCGCCCCGG = 7 reads: -47 +2 -1 +4 -1 +1 -1 +13 -1 +4 -1 +5 -1 +90 -41 +32 -1 +1 -1 +21 -30 +55 -49 non-validated
umi CGCTAGGGCG = 31 reads: +226 -1 +2 -1 +4 -1 +5 -1 +15 -22 +3 -1 +101 -20 non-validated
umi CGCTTTTGCC = 18 reads: +72 -1 +161 -12 +9 -1 +59 -88 non-validated
umi CGGAGCAGGC = 23 reads: +303 -3 +1 -2 +3 -1 +3 -1X +1 -1 +84 invalidated
umi CGGTCCTGCC = 32 reads: +373 -1X +1 -2X +2 -1X +1 -1 +2 -1 +18 invalidated
umi CGTAAAGCAC = 17 reads: +98 -1 +6 -23 +149 -1X +39 -1 +24 -61 invalidated
umi CGTAGTTAAT = 16 reads: -13 +71 -1 +8 -2 +197 -1 +3 -1 +17 -89 non-validated
umi CGTATGGAAT = 20 reads: +241 -1 +1 -1 +123 -36 non-validated
umi CGTCCACGGC = 18 reads: +45 -1 +18 -1 +173 -1X +66 -1 +14 -1 +11 -71 invalidated
umi CGTCCAGTGC = 18 reads: +264 -1X +4 -1 +2 -1 +23 -1 +29 -1 +2 -74 invalidated
umi CGTTACCCCT = 23 reads: -53 +2 -1 +1 -1 +14 -1X +319 -1 +2 -1 +2 -5 invalidated
umi CGTTACTTCG = 23 reads: +51 -2X +3 -1 +1 -1 +226 -21 +97 invalidated
umi CTACTAAGTC = 12 reads: -50 +5 -1 +19 -1 +159 -26 +73 -69 non-validated
umi CTAGTCACGG = 20 reads: +4 -14 +246 -4 +56 -24 +55 non-validated
umi CTATATGTTC = 17 reads: +94 -2 +9 -1 +23 -47 +3 -1 +4 -1 +5 -1 +91 -50 +34 -1 +25 -11 non-validated
umi CTATCAGCGA = 13 reads: +95 -1 +9 -1 +64 -1 +100 -1 +12 -52 +57 -10 non-validated
umi CTATGGAGTA = 28 reads: +239 -1 +110 -1 +5 -1 +18 -1 +1 -26 non-validated
umi CTCAGTACAG = 11 reads: +20 -20 +57 -1 +6 -1 +14 -83 +186 -15 non-validated
umi CTCAGTAGCC = 19 reads: -17 +229 -9 +1 -1X +3 -1 +3 -1 +3 -1 +114 -20 invalidated
umi CTCCATACCT = 21 reads: -20 +254 -124 +5 non-validated
umi CTCCCCGTCC = 20 reads: +52 -1 +4 -1 +8 -1 +8 -1 +94 -1 +217 -1 +14 non-validated
umi CTCGAACTGC = 18 reads: +159 -20 +16 -1 +3 -1 +35 -20 +4 -1 +58 -27 +56 -2 non-validated
umi CTCGGTGTGG = 16 reads: +64 -14 +9 -2 +1 -1 +156 -1 +3 -1X +68 -1 +57 -25 invalidated
umi CTCTCCCAGT = 25 reads: +351 -52 non-validated
umi CTCTCCCTTC = 12 reads: +28 -36 +2 -2 +1 -2 +1 -1 +83 -66 +4 -1 +18 -1 +2 -1 +6 -1 +17 -1 +60 -15 +9 -1 +44 non-validated
umi CTCTTTGGTG = 23 reads: +29 -12 +192 -69 +7 -1 +5 -1 +1 -1 +13 -1 +71 non-validated
umi CTGTAGTCCT = 24 reads: +311 -21 +26 -1 +8 -1 +20 -11 +4 non-validated
umi CTTAACGTTC = 15 reads: +167 -14 +3 -1 +93 -1 +5 -1 +16 -1 +5 -1 +17 -13 +56 -9 non-validated
umi CTTACACGCC = 19 reads: +69 -22 +271 -41 non-validated
umi CTTACAGCAC = 18 reads: -18 +1 -1 +1 -2 +75 -1 +304 non-validated
umi CTTGTATGGC = 21 reads: +280 -49 +74 non-validated
umi CTTTAGATCT = 6 reads: +70 -2 +10 -2 +4 -1 +2 -1 +3 -1 +1 -2 +29 -53 +77 -8 +56 -81 non-validated
umi GACATGAATC = 15 reads: +70 -1 +1 -4 +99 -27 +82 -1 +6 -1 +13 -1 +32 -5 +60 non-validated
umi GACCATCATG = 15 reads: +72 -1 +2 -1 +3 -1 +5 -1 +1 -2 +1 -3 +1 -1 +2 -1 +198 -65 +42 non-validated
umi GAGCAGCACC = 25 reads: +328 -1X +49 -25 invalidated
umi GAGTTGCTCT = 11 reads: -68 +5 -1 +1 -3 +5 -1 +2 -1 +1 -1 +2 -2 +1 -2 +1 -2 +6 -1 +18 -5 +81 -11 +8 -1X +169 -1 +1 -2 invalidated
umi GATCCCCCGT = 16 reads: -2 +7 -1 +30 -1X +3 -1X +1 -4X +1 -18X +1 -2X +1 -6X +136 -3 +56 -3 +57 -54 +15 invalidated
umi GATCTACTGC = 20 reads: +9 -1 +232 -3 +5 -2 +73 -72 +6 non-validated
umi GCAACTATAC = 15 reads: -3 +17 -1 +226 -1 +26 -12 +3 -1 +34 -1 +17 -61 non-validated
umi GCACCACATA = 10 reads: -36 +33 -1 +24 -1 +20 -1 +1 -1 +5 -1 +5 -1 +127 -21 +56 -69 non-validated
umi GCACCACCTC = 18 reads: +83 -1 +2 -1 +8 -1 +1 -1 +147 -1 +4 -1 +6 -1 +30 -1X +4 -1X +3 -1 +29 -14 +30 -1 +22 -1 +2 -6 invalidated
umi GCAGTACGTT = 32 reads: +292 -1 +1 -3 +83 -1 +3 -1 +3 -15 non-validated
umi GCCAATTCGG = 22 reads: -55 +1 -2 +3 -1 +1 -1X +2 -1 +247 -2 +4 -1 +1 -1 +3 -1 +4 -1 +19 -2 +16 -1 +33 invalidated
umi GCCCAACATA = 22 reads: +156 -13 +100 -14 +91 -29 non-validated
umi GCCCCCATTC = 8 reads: -30 +4 -3 +8 -1 +3 -1 +1 -1 +4 -1 +84 -15 +102 -145 non-validated
umi GCCCTACATC = 19 reads: +237 -1 +3 -1 +60 -99 +2 non-validated
umi GCCTTATATC = 19 reads: +13 -16 +144 -1 +61 -26 +65 -1 +5 -1 +3 -3 +2 -1 +9 -1 +51 non-validated
umi GCGCTTCTTC = 24 reads: +94 -1 +164 -1XX +28 -1 +9 -29 +76 invalidated
umi GCTAAAGCAC = 21 reads: +307 -96 non-validated
umi GCTAATACCC = 19 reads: +126 -1X +1 -4X +1 -2XX +1 -3XX +1 -1XX +145 -1 +1 -109 +6 invalidated
umi GCTCGCTTGG = 12 reads: -8 +156 -3 +66 -1 +3 -1X +7 -1X +5 -1 +2 -1 +8 -1 +36 -2 +1 -1 +1 -1 +3 -2 +5 -1 +3 -1 +3 -1 +13 -65 invalidated
umi GCTTACAGCT = 15 reads: +166 -1 +69 -22 +145 non-validated
umi GCTTATATAC = 15 reads: +19 -1X +1 -2X +67 -1 +2 -1 +91 -1X +77 -1 +1 -1 +8 -129 invalidated
umi GCTTCAGTAC = 25 reads: +331 -72 non-validated
umi GCTTGTTCCC = 20 reads: +82 -2 +8 -3 +157 -24 +56 -38 +33 non-validated
umi GGAATATTTC = 16 reads: +73 -5 +5 -1X +2 -3 +2 -2 +5 -1 +51 -1 +3 -1 +3 -1 +5 -1 +2 -1 +2 -1 +3 -1 +208 -20 invalidated
umi GGATACGGCG = 14 reads: +58 -33 +7 -1 +6 -1 +103 -12 +71 -70 +26 -1 +5 -1 +8 non-validated
umi GGCCCATTCG = 8 reads: +20 -65 +1 -1 +1 -1 +5 -1 +187 -1 +24 -1 +1 -1 +1 -1 +3 -2 +1 -1 +1 -3 +2 -1 +22 -55 non-validated
umi GGCTGCGCCG = 39 reads: -99 +304 non-validated
umi GGCTTAACCC = 16 reads: -19 +230 -98 +56 non-validated
umi GGTCATCTCC = 26 reads: +10 -1 +362 -3 +6 -2 +10 -1 +8 non-validated
umi GGTTCTCCAC = 24 reads: +195 -5 +1 -1 +123 -10 +21 -1 +34 -12 non-validated
umi GTACATACGG = 15 reads: +105 -1 +11 -2 +20 -24 +91 -1X +3 -28 +117 invalidated
umi GTAGCCCTTG = 15 reads: +77 -7 +4 -1 +141 -8 +54 -1 +1 -2 +4 -1 +51 -13 +38 non-validated
umi GTATGGGGCT = 14 reads: -26 +97 -1 +145 -134 non-validated
umi GTCAGCCTGG = 21 reads: -10 +381 -1 +11 non-validated
umi GTCCCATCCA = 23 reads: +324 -79 non-validated
umi GTCCGTACCC = 23 reads: +264 -40 +99 non-validated
umi GTCTCCCATT = 29 reads: +403 validated
umi GTCTCGAGGC = 9 reads: +12 -72 +58 -4 +6 -1 +2 -4 +3 -2 +2 -1 +1 -1 +1 -3 +1 -2 +2 -1 +8 -1 +2 -7 +2 -4 +5 -1 +1 -1 +1 -1 +10 -1 +2 -1 +2 -1 +15 -1 +1 -1 +5 -94 +56 non-validated
umi GTGATAGGTC = 16 reads: +13 -6 +7 -1 +16 -2 +89 -1 +64 -1 +203 non-validated
umi GTGTGACCGT = 19 reads: +278 -15 +2 -1 +3 -2 +2 -1 +1 -1 +3 -2 +5 -1 +1 -1 +2 -2 +1 -2X +23 -54 invalidated
umi GTTCCCTTAG = 12 reads: +114 -53 +9 -1 +74 -152 non-validated
umi GTTGTCAAAC = 22 reads: +339 -25 +39 non-validated
umi GTTTCGTAGG = 20 reads: -12 +226 -1 +67 -47 +50 non-validated
umi TAATACCCCT = 23 reads: +317 -10 +31 -1 +44 non-validated
umi TAATGTCTCT = 19 reads: +303 -1 +2 -1 +11 -1 +84 non-validated
umi TACATCTCCT = 10 reads: -4 +66 -1 +2 -1 +1 -3 +5 -1 +90 -40 +56 -2 +4 -1 +17 -1 +73 -35 non-validated
umi TACTCCTCAT = 19 reads: +35 -9 +6 -1 +12 -1 +219 -38 +56 -13 +4 -1 +8 non-validated
umi TACTCGTCCG = 15 reads: -53 +3 -2 +3 -1 +3 -1 +1 -1 +3 -1 +3 -2 +6 -1X +1 -1 +241 -4 +2 -1 +7 -1 +12 -1 +4 -1 +43 invalidated
umi TAGAAACTAG = 20 reads: +354 -49 non-validated
umi TATAAACTAC = 14 reads: -1 +3 -1 +1 -3 +1 -1 +1 -2 +1 -1 +1 -1 +144 -2X +2 -4X +2 -2X +4 -2X +1 -2X +1 -21 +105 -1 +1 -1X +1 -1 +1 -2 +1 -1 +2 -1 +12 -1 +1 -66 invalidated
umi TATGAACTGG = 12 reads: -31 +63 -1 +3 -1 +67 -13 +7 -1 +56 -39X +2 -2 +1 -1 +1 -1X +1 -3X +3 -1 +2 -5X +2 -1 +1 -2X +92 invalidated
umi TCAACGCTAT = 19 reads: +235 -54 +3 -1 +12 -1 +7 -1 +3 -1 +29 -1 +2 -1 +3 -5X +7 -2X +6 -1X +2 -1 +1 -2 +1 -21X invalidated
umi TCAACGCTCT = 11 reads: +147 -7 +56 -49 +62 -82 non-validated
umi TCAGCACTCT = 20 reads: +58 -4 +2 -2 +4 -1 +1 -2 +1 -1 +1 -1 +291 -21 +13 non-validated
umi TCCACGTCAC = 18 reads: +287 -11 +9 -1 +2 -1 +9 -1 +33 -49 non-validated
umi TCCACTTCAC = 33 reads: +329 -62 +3 -2 +3 -1 +3 non-validated
umi TCCAGCGCTC = 17 reads: -8 +14 -1 +195 -4 +21 -1X +34 -43 +67 -1 +14 invalidated
umi TCCATATCTC = 11 reads: -30 +68 -1 +62 -1 +75 -2 +56 -108 non-validated
umi TCCCAGTCAG = 24 reads: +285 -1 +3 -2 +1 -3 +5 -1 +4 -1 +1 -4X +2 -2 +4 -1 +72 -11 invalidated
umi TCCCATTACT = 23 reads: +158 -1 +107 -67 +57 -13 non-validated
umi TCCTGTGGTC = 21 reads: +197 -1 +1 -1 +8 -2 +2 -1 +27 -5 +6 -1 +2 -1 +4 -1 +82 -61 non-validated
umi TCCTTTTAGC = 11 reads: +91 -18 +4 -1 +176 -43 +16 -1 +1 -1 +4 -1 +3 -1 +1 -2 +5 -1 +3 -1 +15 -14 non-validated
umi TCGACTTCTA = 21 reads: +241 -162 non-validated
umi TCGGCAATTA = 22 reads: +282 -4 +6 -1 +10 -1 +45 -1 +53 non-validated
umi TCGTGACCGT = 22 reads: +88 -26 +127 -9 +56 -17 +57 -23 non-validated
umi TCTACTCCCT = 15 reads: +95 -1 +176 -1 +1 -62 +33 -1 +24 -2 +5 -1 +1 non-validated
umi TCTACTGGGT = 24 reads: +265 -1 +78 -1 +13 -1 +8 -36 non-validated
umi TCTCCTATCT = 26 reads: +306 -14 +61 -22 non-validated
umi TCTGCGTGCT = 18 reads: +62 -2 +1 -1 +1 -1 +7 -1 +7 -1 +2 -2X +2 -3X +1 -2X +1 -2X +150 -10 +88 -56 invalidated
umi TCTTTCTTTC = 18 reads: +49 -1X +150 -1 +67 -4 +6 -1 +124 invalidated
umi TGAAAGTCCG = 25 reads: +4 -1 +1 -2X +1 -2X +1 -4X +1 -7X +1 -1 +1 -2 +272 -1 +35 -1 +40 -1 +24 invalidated
umi TGATTCTTAC = 37 reads: -370 +33 non-validated
umi TGCCCAACCG = 15 reads: +148 -18 +23 -1 +134 -16 +13 -1 +34 -1 +7 -7 non-validated
umi TGCTTCTCCC = 29 reads: +259 -1 +2 -1 +6 -1 +75 -1 +42 -1 +14 non-validated
umi TGGCTTTTCC = 26 reads: +298 -1 +17 -1 +6 -1 +13 -11 +55 non-validated
umi TGTATCAGTT = 25 reads: +314 -14 +60 -15 non-validated
umi TGTATTTCTC = 22 reads: +273 -130 non-validated
umi TGTCGTCCCC = 22 reads: +88 -1 +16 -1 +218 -1 +19 -59 non-validated
umi TGTTACAACC = 13 reads: +87 -1 +4 -1 +1 -1 +3 -1 +68 -1 +3 -1 +2 -1 +6 -1 +140 -46 +35 non-validated
umi TGTTACCGAT = 14 reads: +40 -1 +15 -1 +16 -1 +1 -1 +130 -31 +60 -1 +1 -1 +1 -1X +86 -15 invalidated
umi TTAAACCCGT = 12 reads: -47 +2 -1 +72 -1 +63 -1 +6 -1 +59 -49 +56 -26 +19 non-validated
umi TTAATCTCTC = 21 reads: -17 +9 -2 +2 -2 +279 -12 +1 -1 +34 -1 +19 -24 non-validated
umi TTATCAGGCT = 19 reads: +22 -4 +258 -65 +54 non-validated
umi TTCAAACGCC = 29 reads: +232 -14 +157 non-validated
umi TTCAGCCATG = 18 reads: -9 +245 -1 +1 -1 +1 -2 +3 -1 +32 -1 +27 -1 +4 -4 +69 -1 non-validated
umi TTCCCATCCT = 12 reads: +139 -32 +7 -1 +160 -64 non-validated
umi TTCCTAGACC = 16 reads: +255 -1 +36 -18 +2 -1 +6 -1 +5 -1 +3 -1 +1 -2 +4 -1 +2 -1 +1 -1 +3 -1 +4 -2 +2 -1 +2 -1 +1 -1 +3 -1 +1 -37 non-validated
umi TTCCTATGCC = 19 reads: +230 -173 non-validated
umi TTCGAAAGGC = 27 reads: +94 -1 +226 -82 non-validated
umi TTCGCGAGTA = 24 reads: +45 -1 +278 -46 +33 non-validated
umi TTCTCATCTC = 34 reads: +383 -20 non-validated
umi TTCTCGCACT = 13 reads: +65 -3 +2 -1 +4 -3 +5 -1 +83 -39 +90 -2 +82 -1 +3 -1 +17 -1 non-validated
umi TTCTTCTATG = 7 reads: -40 +91 -1 +34 -3 +1 -1 +75 -46 +4 -1 +8 -1 +7 -1 +33 -56 non-validated
umi TTGGGGTCGC = 22 reads: +305 -1 +24 -1 +2 -1 +12 -1 +7 -16 +18 -1 +14 non-validated
umi TTTCCATTAC = 24 reads: +88 -1X +2 -1 +2 -2 +2 -1X +260 -44 invalidated
umi TTTTCTGGGG = 27 reads: +238 -1 +90 -7 +12 -1 +3 -1 +1 -1 +5 -2 +6 -1 +7 -1 +10 -1 +5 -1 +3 -1 +5 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1010 umis using 6302 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0, 1, 2, 5, 6, 7, 8, 9, 10, 11] and 2590 others
of which 2600 are surviving nonsolos
reads assigned: 73793
start codons at 36, 105, 241, 460
confident = true

TIG 2[bases=658]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=31)
440-476 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
476-658 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 21 umis using 103 reads
cdr3 = CAKNSGIYAW at 415, score = 9 + 8
umis assigned: [41, 55, 94, 113, 132, 196, 198, 234, 279, 289] and 182 others
of which 192 are surviving nonsolos
reads assigned: 3525
start codons at 73, 139, 229, 376, 437
confident = true
now this is a cell
paired!

ATGAATAGTTTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAGAATAGTGGGATCTATGCCTGGGGCCAGGGAACCCGGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCTGCAGTATAGTGACTGGCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1917 = CCCATACCATAGACTC-1

using 774 reads

====================================================================================

graph has 506 edges initially, 8 edges after simplification

total ucounts = 109
nonsolo ucounts = 42[2^13, 3^13, 4^5, 5^3, 6, 8^2, 9, 13, 14, 257, 292]
surviving nonsolo ucounts = 2[257, 292]
ids = [77, 75]

====================================================================================

UMI info for barcode CCCATACCATAGACTC-1 contig 1 = AGAAGCAGAG...
umi GTGGCACCCA = 288 reads: +382 validated
umi TACAAGGCCA = 243 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=571]
0-28 ==> 12-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-365 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=15)
372-410 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
410-571 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 93 reads
cdr3 = CNSRDSGGNFWVF at 343, score = 7 + 8
umis assigned: [75, 77]
of which 2 are surviving nonsolos
reads assigned: 520
start codons at 28, 176, 227, 326
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1919 = CCCATACCATGCGCAC-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 1[11]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1920 = CCCATACCATGGGACA-1

using 371 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [0]

====================================================================================

UMI info for barcode CCCATACCATGGGACA-1 contig 1 = GGAGGAACTG...
umi TTTACTCCCA = 352 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
384-422 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
422-503 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQRSNWPPEFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 34, 239, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1922 = CCCATACCATGTCTCC-1

using 430 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 425]
surviving nonsolo ucounts = 1[425]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=539]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
0-36 ==> 5964-6000 on segment before IGLV6-57 exon 1 [len=6000] (mis=0)
28-69 ==> 5820-5861 on segment before IGLV2-34 exon 1 [len=6000] (mis=4)
36-201 ==> 0-165 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=3)
201-290 ==> 264-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=5)
290-328 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
328-539 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSPSVVF at 264, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 36, 99, 190, 274
confident = false
not full
full length transcript of length 539
VJ delta = 115
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1929 = CCCATACGTAGCTTGT-1

using 221 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 47
nonsolo ucounts = 15[2^6, 3^2, 4^2, 5^2, 10, 11, 132]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1932 = CCCATACGTCCGAGTC-1

using 116 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=345]
10-264 ==> 99-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=19)
296-344 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
cdr3 = CARDKSLGTISQTFYYFDYW at 253, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 67, 214
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1938 = CCCATACGTGTGTGCC-1

using 174 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 170]
surviving nonsolo ucounts = 1[170]
ids = [3]

====================================================================================

UMI info for barcode CCCATACGTGTGTGCC-1 contig 1 = GGGGGACCCA...
umi TTGGCTCTCT = 162 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=496]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 59, 257, 262, 279, 323, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1944 = CCCATACGTTTGTGTG-1

using 8711 reads

====================================================================================

graph has 2998 edges initially, 40 edges after simplification

total ucounts = 360
nonsolo ucounts = 159[2^54, 3^28, 4^24, 5^6, 6^5, 7^3, 8^3, 16, 21, 38, 51, 58, 84, 115, 155, 175, 184, 185, 188, 198, 211^2, 229, 232, 235, 243, 254, 260, 266, 271, 279, 281, 284, 288, 295, 301, 315, 319, 327, 335, 338, 383, 492]
surviving nonsolo ucounts = 33[51, 58, 84, 115, 155, 175, 184, 185, 188, 198, 211^2, 229, 232, 235, 243, 254, 260, 266, 271, 279, 281, 284, 288, 295, 301, 315, 319, 327, 335, 338, 383, 492]
ids = [37, 302, 207, 5, 79, 323, 185, 292, 29, 239, ...]

====================================================================================

UMI info for barcode CCCATACGTTTGTGTG-1 contig 1 = AGGAGTCAGA...
umi AATCCATCTC = 292 reads: +391 validated
umi ACATAGTTCC = 318 reads: +391 validated
umi ACCGTAGACG = 193 reads: +227 -3XX +161 invalidated
umi ACGTAGGCTT = 235 reads: +310 -1XX +80 invalidated
umi ACTCCTTGGA = 52 reads: +391 validated
umi AGCTAATATA = 324 reads: +391 validated
umi ATACCGTCCG = 295 reads: +391 validated
umi ATACGTCTTC = 341 reads: +362 -2X +27 invalidated
umi ATTCACCGCG = 235 reads: +391 validated
umi ATTCCACTCA = 380 reads: +391 validated
umi CACACCACTA = 299 reads: +391 validated
umi CACATATCGT = 235 reads: +391 validated
umi CCAAGGGGCT = 259 reads: +391 validated
umi GATCTTACCC = 269 reads: +391 validated
umi GCAAGCTCTG = 245 reads: +391 validated
umi GCGACGGGGT = 276 reads: +391 validated
umi GGAATAGGGC = 83 reads: +391 validated
umi GTCCCTGTCG = 212 reads: +391 validated
umi GTGCTGTTAC = 280 reads: +391 validated
umi TCCCACCGTT = 494 reads: -99 +1 -2XX +289 invalidated
umi TGTTTGGTAC = 319 reads: +391 validated
umi TTCAGCTAGC = 258 reads: +391 validated

UMI info for barcode CCCATACGTTTGTGTG-1 contig 2 = GGAGTCTCCC...
umi AACATATTTG = 113 reads: +427 validated
umi ATGTTTCCGT = 146 reads: +427 validated
umi CACTATATGG = 336 reads: +427 validated
umi GAATTGCCAG = 288 reads: +427 validated
umi GATTTTGTAC = 185 reads: +403 -24 non-validated
umi GTCGTACTGG = 199 reads: +424 -1 +2 non-validated
umi TCGGGCTTTA = 187 reads: +427 validated
umi TCTGTTCAGG = 57 reads: +401 -1 +22 -3 non-validated
umi TGAGTATCTT = 256 reads: +427 validated
umi TGGCCACTAT = 210 reads: +427 validated
umi TGTGTTGAGT = 175 reads: +376 -1 +3 -1 +46 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 909 reads
cdr3 = CQQANSFPGVTF at 354, score = 9 + 8
umis assigned: [13, 24, 29, 34, 37, 50, 59, 61, 85, 88] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5787
start codons at 27, 33, 89, 102, 238, 460
confident = true

TIG 2[bases=588]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=3)
423-486 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
486-588 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 108 reads
cdr3 = CARANGSGKNYYYYMDVW at 401, score = 8 + 7
umis assigned: [5, 79, 102, 177, 185, 239, 292, 302, 308, 316] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2115
start codons at 59, 233, 257, 392, 414, 443, 504, 565
confident = true
now this is a cell
paired!

ACCGCCATGTATTACTGTGCGAGAGCGAATGGTTCGGGGAAGAACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCCGGGGTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1954 = CCCATACTCCAAGTAC-1

using 327 reads

====================================================================================

graph has 471 edges initially, 2 edges after simplification

total ucounts = 148
nonsolo ucounts = 61[2^17, 3^14, 4^10, 5^9, 6^7, 7^2, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1973 = CCCATACTCTATCCCG-1

using 217 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [0]

====================================================================================

UMI info for barcode CCCATACTCTATCCCG-1 contig 1 = GCTTTCTGAG...
umi ATTCGCTATC = 210 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=514]
14-391 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=20)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
471-514 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARHWVGYNYGHYRNYFDSW at 380, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 14, 23, 35, 79, 302, 408
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1981 = CCCTCCTAGACATAAC-1

using 288 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 280]
surviving nonsolo ucounts = 1[280]
ids = [4]

====================================================================================

UMI info for barcode CCCTCCTAGACATAAC-1 contig 1 = ATCACATAAC...
umi TACAACCCCG = 284 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=532]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=42)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
491-532 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CGREFEGFCTDGSCYGFDYW at 400, score = 10 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 58, 355, 431, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.1990 = CCCTCCTAGAGTAAGG-1

using 12022 reads

====================================================================================

graph has 7035 edges initially, 72 edges after simplification

total ucounts = 1546
nonsolo ucounts = 822[2^313, 3^176, 4^107, 5^83, 6^34, 7^28, 8^9, 9^14, 10^9, 11^4, 12, 13, 14^3, 15, 16, 17, 37, 42, 57, 79, 92, 97, 105, 108, 123, 140, 147, 156, 167, 174, 197^2, 226, 242, 248, 253, 258, 281, 295, 303, 306, 309, 316, 318, 325, 333, 341, 343, 353, 357, 366, 376, 386]
surviving nonsolo ucounts = 35[57, 79, 92, 97, 105, 108, 123, 140, 147, 156, 167, 174, 197^2, 226, 242, 248, 253, 258, 281, 295, 303, 306, 309, 316, 318, 325, 333, 341, 343, 353, 357, 366, 376, 386]
ids = [141, 1290, 1412, 1325, 1087, 935, 849, 221, 78, 1067, ...]

====================================================================================

UMI info for barcode CCCTCCTAGAGTAAGG-1 contig 1 = GGGGAGGAGT...
umi AACTTCTATC = 232 reads: -28X +1 -5XX +1 -2XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +342 invalidated
umi ACACCCTTTC = 343 reads: +394 validated
umi ACCGCCTCGT = 146 reads: +394 validated
umi ACTAAAAAGT = 339 reads: +394 validated
umi ACTTCCTGTG = 58 reads: +394 validated
umi ACTTTCTAAG = 310 reads: +394 validated
umi AGCTCGTATA = 280 reads: +394 validated
umi AGCTCTTTCA = 167 reads: +394 validated
umi AGTTGTAACC = 139 reads: +394 validated
umi AGTTGTCGGT = 337 reads: +394 validated
umi ATCACCCTCT = 174 reads: +394 validated
umi ATCTAGGCAT = 196 reads: +394 validated
umi CCAGGCAGTG = 384 reads: +394 validated
umi CCATCTACGT = 292 reads: +394 validated
umi CCCGGTTCGG = 245 reads: +394 validated
umi CTCCCACCTG = 364 reads: +394 validated
umi GCTCACCGTA = 226 reads: +394 validated
umi GCTTTAGGAT = 124 reads: +394 validated
umi GGGCCTTAAG = 327 reads: +394 validated
umi GTCCCGTTTA = 108 reads: +394 validated
umi TAGGCACTGT = 154 reads: +394 validated
umi TATATGGTGC = 106 reads: -6 +388 non-validated
umi TCACTCTGTA = 378 reads: +394 validated
umi TCCACAGTCA = 313 reads: +394 validated
umi TCGTCGACAG = 370 reads: +394 validated
umi TCTAGGGCTT = 320 reads: +394 validated
umi TCTCATGTGT = 256 reads: +394 validated
umi TCTTTGGAAG = 81 reads: +394 validated
umi TGATCCCACT = 297 reads: +394 validated
umi TGCACTCACT = 88 reads: -379 +1 -1 +1 -1 +8 -1 +2 non-validated
umi TGTCCTACAA = 359 reads: +394 validated
umi TTAGCATACA = 87 reads: +373 -21 non-validated
umi TTATAATTCC = 258 reads: +394 validated
umi TTCTTCAGTC = 308 reads: +394 validated
umi TTGTCAACCA = 197 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=561]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 32 umis using 1248 reads
cdr3 = CQQYDNLPRGITF at 358, score = 9 + 8
umis assigned: [13, 32, 78, 113, 141, 146, 179, 180, 221, 222] and 25 others
of which 35 are surviving nonsolos
reads assigned: 8215
start codons at 31, 37, 93, 106, 245, 368, 467
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2009 = CCCTCCTAGCTGAACG-1

using 159 reads

====================================================================================

graph has 84 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 147]
surviving nonsolo ucounts = 2[4, 147]
ids = [1, 0]

====================================================================================

UMI info for barcode CCCTCCTAGCTGAACG-1 contig 1 = GCTCTGCTTC...
umi ACCATCCTAG = 136 reads: +394 validated
umi ATACTATTTA = 1 reads: -343 +1 -6X +2 -1X +2 -1X +6 -1X +30 -1X invalidated

GOOD CONTIGS

TIG 1[bases=469]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
445-469 ==> 0-24 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGPVVF at 375, score = 7 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 134
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2010 = CCCTCCTAGCTGATAA-1

using 33 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 4, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2017 = CCCTCCTAGGGTCTCC-1

using 345 reads

====================================================================================

graph has 218 edges initially, 10 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 119, 213]
surviving nonsolo ucounts = 2[119, 213]
ids = [4, 9]

====================================================================================

UMI info for barcode CCCTCCTAGGGTCTCC-1 contig 1 = TGAGCGCAGA...
umi CCCACTAACT = 18 reads: -5 +3 -2XX +1 -1XX +1 -2XX +2 -1XX +11 -1XX +4 -1XX +3 -3XX +23 -3XX +4 -1XX +5 -2XX +4 -1XX +7 -1XX +1 -1X +1 -296 invalidated
umi TATCGTTCTA = 208 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=566]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=12)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-566 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CGTWDNSLRALYVF at 357, score = 7 + 8
umis assigned: [4, 9]
of which 2 are surviving nonsolos
reads assigned: 221
start codons at 36, 190, 247, 365, 391, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2028 = CCCTCCTAGTTCCACA-1

using 695 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[291, 403]
surviving nonsolo ucounts = 2[291, 403]
ids = [2, 1]

====================================================================================

UMI info for barcode CCCTCCTAGTTCCACA-1 contig 1 = GGAGGAACTG...
umi GCTAACCTTG = 408 reads: +382 validated
umi GTTTTCGATT = 292 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 100 reads
cdr3 = CLQYYNWPRTF at 355, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 689
start codons at 34, 89, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2057 = CCCTCCTCACGGTAAG-1

using 378 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 3, 23, 338]
surviving nonsolo ucounts = 1[338]
ids = [4]

====================================================================================

UMI info for barcode CCCTCCTCACGGTAAG-1 contig 1 = AGGAACTGCT...
umi GCGTCTCGTC = 295 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=489]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPLTF at 353, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 32, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2062 = CCCTCCTCACTTAACG-1

using 186 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 4, 170]
surviving nonsolo ucounts = 1[170]
ids = [6]

====================================================================================

UMI info for barcode CCCTCCTCACTTAACG-1 contig 1 = GGGGTCTCAG...
umi GCATACTCAC = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-464 ==> 0-38 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYAGSSHVVF at 362, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 38, 195, 239, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2065 = CCCTCCTCAGACAAGC-1

using 42 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[42]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2068 = CCCTCCTCAGATGAGC-1

using 232 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode CCCTCCTCAGATGAGC-1 contig 1 = GGAAATCAGT...
umi TGGTCTTCCG = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2083 = CCCTCCTCATCCTAGA-1

using 152 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 5, 135]
surviving nonsolo ucounts = 1[135]
ids = [5]

====================================================================================

UMI info for barcode CCCTCCTCATCCTAGA-1 contig 1 = AGCTCTGGGA...
umi TCAGCAAGGA = 130 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=538]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=10)
445-476 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
474-510 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
510-538 ==> 0-28 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CASLPNLGGYCSGGSCQTW at 422, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 80, 236, 383, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2085 = CCCTCCTCATCGGAAG-1

using 230 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[227]
surviving nonsolo ucounts = 1[227]
ids = [3]

====================================================================================

UMI info for barcode CCCTCCTCATCGGAAG-1 contig 1 = GAGCTACAAC...
umi TATGAGCTCC = 208 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=494]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-494 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2086 = CCCTCCTCATCGTCGG-1

using 309 reads

====================================================================================

graph has 130 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2, 3, 4, 5, 81, 205]
surviving nonsolo ucounts = 2[81, 205]
ids = [1, 14]

====================================================================================

UMI info for barcode CCCTCCTCATCGTCGG-1 contig 1 = AGAGCTCTGG...
umi ACTCTCTATC = 19 reads: -242 +15 -1XX +11 -1XX +27 -1XX +8 -1XX +5 -2XX +12 -2X +2 -40 +1 -1X +5 -1X +7 invalidated
umi TTGGCCCTTC = 202 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYNNWPPFTF at 365, score = 9 + 8
umis assigned: [1, 14]
of which 2 are surviving nonsolos
reads assigned: 221
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2098 = CCCTCCTGTAAGGATT-1

using 656 reads

====================================================================================

graph has 284 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 644]
surviving nonsolo ucounts = 1[644]
ids = [2]

====================================================================================

UMI info for barcode CCCTCCTGTAAGGATT-1 contig 1 = GCTGTGCTGT...
umi CCGACTCAGC = 649 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=633]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CQSADSSGTWVF at 358, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 634
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2104 = CCCTCCTGTACTCTCC-1

using 16 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2112 = CCCTCCTGTCAAAGCG-1

using 255 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode CCCTCCTGTCAAAGCG-1 contig 1 = GCTGGGGTCT...
umi ATCACTCGGA = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=565]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
432-565 ==> 0-133 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSSTLDVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 41, 198, 242, 249, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2114 = CCCTCCTGTCCAACTA-1

using 342 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 329]
surviving nonsolo ucounts = 1[329]
ids = [4]

====================================================================================

UMI info for barcode CCCTCCTGTCCAACTA-1 contig 1 = AGGAGTCAGT...
umi TAAGGACTGG = 327 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYDNLFTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2133 = CCCTCCTGTGCCTTGG-1

using 302 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 7[2^3, 3^2, 4, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode CCCTCCTGTGCCTTGG-1 contig 1 = GATCAGGACT...
umi AAGCTATTGG = 264 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=504]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-504 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2154 = CCCTCCTGTTCCCTTG-1

using 366 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [0]

====================================================================================

UMI info for barcode CCCTCCTGTTCCCTTG-1 contig 1 = GCTACAACAG...
umi CCTTGAGGAC = 374 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2166 = CCCTCCTGTTTGCATG-1

using 12 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2168 = CCCTCCTTCAACACTG-1

using 304 reads

====================================================================================

graph has 97 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2^5, 3^2, 9, 13, 260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode CCCTCCTTCAACACTG-1 contig 1 = GTGGGTCCAG...
umi AAAGACAGTA = 245 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=525]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=5)
376-414 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
414-525 ==> 0-111 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSTDSSGTYVF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 35, 96, 165, 183, 227, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2177 = CCCTCCTTCAGCGACC-1

using 29 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2199 = CCCTCCTTCCGCGGTA-1

using 54 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 29
nonsolo ucounts = 12[2^6, 3^3, 4^2, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2211 = CCCTCCTTCGCGTAGC-1

using 343 reads

====================================================================================

graph has 143 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 5[2, 3^2, 108, 213]
surviving nonsolo ucounts = 2[108, 213]
ids = [5, 8]

====================================================================================

UMI info for barcode CCCTCCTTCGCGTAGC-1 contig 1 = TGGGAGTCTC...
umi CTTTCACTGG = 89 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false

REJECT CONTIGS

TIG 1[bases=531]
2-325 ==> 15-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
326-364 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
364-531 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 48, 135, 281, 285
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2222 = CCCTCCTTCTCAACTT-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2224 = CCCTCCTTCTCCAACC-1

using 615 reads

====================================================================================

graph has 250 edges initially, 32 edges after simplification

total ucounts = 22
nonsolo ucounts = 11[2^4, 3^3, 5, 84, 149, 349]
surviving nonsolo ucounts = 3[84, 149, 349]
ids = [15, 8, 18]

====================================================================================

UMI info for barcode CCCTCCTTCTCCAACC-1 contig 1 = GAGGAACTGC...
umi TCAGACTCCG = 355 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQHYNNWPPWTF at 354, score = 9 + 7
umis assigned: [18]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 33, 102, 238, 460
confident = false

REJECT CONTIGS

TIG 1[bases=521]
8-305 ==> 43-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=4)
321-359 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
359-521 ==> 0-162 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CCSYAGSSTIPYVF at 289, score = 8 + 8
umis assigned: [8, 15]
of which 2 are surviving nonsolos
reads assigned: 209
start codons at 166, 173, 299, 323, 491
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2227 = CCCTCCTTCTCTTATG-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2234 = CCCTCCTTCTTGACGA-1

using 334 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^4, 3, 4, 8, 303]
surviving nonsolo ucounts = 1[303]
ids = [11]

====================================================================================

UMI info for barcode CCCTCCTTCTTGACGA-1 contig 1 = GGGGAGTCAG...
umi TAGTGTTAAC = 306 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2235 = CCCTCCTTCTTGCAAG-1

using 46 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 12[2^8, 3^3, 4]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2238 = CCGGGATAGAAACGAG-1

using 8360 reads

====================================================================================

graph has 4296 edges initially, 44 edges after simplification

total ucounts = 758
nonsolo ucounts = 307[2^115, 3^61, 4^35, 5^23, 6^18, 7^8, 8^6, 9^2, 10, 11^3, 12, 13^2, 23, 25, 33, 97, 98, 107, 114, 138^2, 153, 166, 182, 187, 198, 218, 226, 237, 238, 244, 246, 257, 267, 272, 281, 295, 301, 314, 353, 358, 376, 393, 394]
surviving nonsolo ucounts = 29[25, 97, 98, 107, 114, 138^2, 153, 182, 187, 198, 218, 226, 237, 238, 244, 246, 257, 267, 272, 281, 295, 301, 314, 353, 358, 376, 393, 394]
ids = [585, 696, 601, 695, 348, 245, 387, 382, 224, 673, ...]

====================================================================================

UMI info for barcode CCGGGATAGAAACGAG-1 contig 1 = AGCTTCAGCT...
umi AACCATTCTA = 238 reads: +391 validated
umi AGATTCCTGT = 240 reads: +391 validated
umi CAAACCCGGC = 245 reads: +391 validated
umi CATGCTGCTA = 132 reads: -10 +1 -2X +1 -2X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -12XX +1 -1XX +348 invalidated
umi CGATCAGTCT = 234 reads: +391 validated
umi GCCGACGTGC = 226 reads: +391 validated
umi TAGTGTGGGA = 26 reads: -3 +268 -1 +5 -1 +42 -1X +13 -19 +3 -1 +17 -1 +7 -1X +7 -1 invalidated
umi TGAGGGAGGT = 182 reads: +391 validated

UMI info for barcode CCGGGATAGAAACGAG-1 contig 2 = TGGGGAGTGA...
umi AACGATCCTT = 395 reads: +433 validated
umi CGCTATGCTC = 133 reads: -384X +1 -1X +1 -4X +1 -1XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CGGCGACTCA = 281 reads: +433 validated
umi CGGTACCCGC = 115 reads: +409 -23 +1 non-validated
umi CTCCTTATGT = 153 reads: +2 -1 +430 non-validated
umi CTCCTTCGCA = 390 reads: +433 validated
umi CTCTATCGGC = 138 reads: +433 validated
umi GACTCCCTTT = 287 reads: +433 validated
umi GCAATGTTGA = 245 reads: +433 validated
umi GGATATCACT = 215 reads: +418 -1 +9 -1 +4 non-validated
umi GTCCTTTGGT = 301 reads: +433 validated
umi TAGTACATTT = 297 reads: +433 validated
umi TATCTGCCTA = 77 reads: -433 non-validated
umi TCCACTTTCC = 280 reads: +433 validated
umi TCCGCCTGCA = 274 reads: +433 validated
umi TGCGGTTGCA = 270 reads: +433 validated
umi TGTGCTCTTC = 108 reads: +433 validated
umi TGTGTAGGCA = 78 reads: +433 validated
umi TTAAACTCCC = 208 reads: +433 validated
umi TTCGATGGGA = 202 reads: -6 +360 -1XX +66 invalidated

GOOD CONTIGS

TIG 1[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 207 reads
cdr3 = CAAWDDSLSGQVVF at 367, score = 7 + 8
umis assigned: [11, 119, 196, 245, 327, 442, 585, 673]
of which 8 are surviving nonsolos
reads assigned: 1503
start codons at 46, 200, 350, 375, 380
confident = true

TIG 2[bases=529]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
387-410 ==> 0-23 on |21|IGHD3-3|D-REGION| [len=31] (mis=2)
410-458 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 16 umis using 383 reads
cdr3 = CAHSPANYDFWSGSPFDYW at 370, score = 7 + 7
umis assigned: [13, 344, 347, 348, 382, 383, 387, 414, 432, 472] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4377
start codons at 25, 69, 248, 251, 331, 340
confident = true

REJECT CONTIGS

TIG 1[bases=369]
1-195 ==> 2451-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
215-267 ==> 11-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
267-369 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [224]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 224, 285, 346
confident = false
did not find CDR3
now this is a cell
paired!

GCCACATATTACTGTGCACACAGTCCCGCAAATTACGATTTTTGGAGTGGTTCCCCATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCAGGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2242 = CCGGGATAGAGATGAG-1

using 413 reads

====================================================================================

graph has 190 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 197, 210]
surviving nonsolo ucounts = 2[197, 210]
ids = [5, 4]

====================================================================================

UMI info for barcode CCGGGATAGAGATGAG-1 contig 1 = AAAAACCACA...
umi TATAATCATT = 202 reads: +436 validated
umi TGTATCCGGG = 179 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=584]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-584 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 47 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 374
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2248 = CCGGGATAGCAGGTCA-1

using 217 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2250 = CCGGGATAGCGATGAC-1

using 133 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 127]
surviving nonsolo ucounts = 1[127]
ids = [5]

====================================================================================

UMI info for barcode CCGGGATAGCGATGAC-1 contig 1 = AGAGCTCTGG...
umi TCCTGTGTAG = 1 reads: -84 +1 -4X +1 -1 +2 -1 +12 -1 +4 -1 +15 -1 +3 -1 +3 -1 +3 -252 invalidated
umi TCCTTCGTAG = 117 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=510]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
435-510 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYGSSPPRYTF at 368, score = 9 + 8
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 44, 252, 378, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2252 = CCGGGATAGCTGAAAT-1

using 182 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[179]
surviving nonsolo ucounts = 1[179]
ids = [0]

====================================================================================

UMI info for barcode CCGGGATAGCTGAAAT-1 contig 1 = CGGGACGTCT...
umi ACGGCACATA = 169 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=516]
15-343 ==> 0-328 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
368-406 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
406-516 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CTSYTNRSPLALF at 339, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 15, 172, 216, 226
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2254 = CCGGGATAGGACAGCT-1

using 34 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 4, 7, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2259 = CCGGGATAGTGTACCT-1

using 317 reads

====================================================================================

graph has 168 edges initially, 28 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 18, 19, 273]
surviving nonsolo ucounts = 3[18, 19, 273]
ids = [6, 2, 3]

====================================================================================

UMI info for barcode CCGGGATAGTGTACCT-1 contig 1 = GGAGTCAGTC...
umi ATTGACGCTG = 12 reads: -28 +13 -1XX +6 -1XX +3 -1XX +9 -1XX +36 -12X +13 -1XX +22 -2XX +5 -2XX +1 -3XX +5 -3XX +4 -1X +8 -1XX +20 -1XX +3 -1XX +3 -1XX +17 -1XX +25 -1XX +3 -2XX +15 -1XX +11 -74 +27 invalidated
umi GAGCCACCAA = 244 reads: +388 validated
umi TCAGACGCAA = 11 reads: +22 -1X +1 -35 +3 -1X +47 -1XX +13 -1XX +22 -2XX +5 -2XX +1 -3XX +5 -3X +4 -1X +5 -15 +9 -1X +3 -1X +3 -1X +17 -1XX +25 -1X +3 -2X +15 -1X +8 -104 invalidated

GOOD CONTIGS

TIG 1[bases=474]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-474 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQSYSTPGTF at 353, score = 9 + 8
umis assigned: [2, 3, 6]
of which 3 are surviving nonsolos
reads assigned: 260
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2275 = CCGGGATCACATTCGA-1

using 848 reads

====================================================================================

graph has 394 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[138, 321, 385]
surviving nonsolo ucounts = 3[138, 321, 385]
ids = [3, 1, 6]

====================================================================================

UMI info for barcode CCGGGATCACATTCGA-1 contig 1 = GAGGAACTGC...
umi CCGCGTAAGG = 322 reads: +379 validated
umi TCTCCCTCCC = 389 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-366 ==> 0-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 114 reads
cdr3 = CQERGGWWTF at 354, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 695
start codons at 33, 241, 454
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2278 = CCGGGATCACTTAAGC-1

using 604 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 152, 445]
surviving nonsolo ucounts = 2[152, 445]
ids = [4, 5]

====================================================================================

UMI info for barcode CCGGGATCACTTAAGC-1 contig 1 = AGCCTCTGAG...
umi GTCCCGAGCG = 133 reads: +430 validated

UMI info for barcode CCGGGATCACTTAAGC-1 contig 2 = GAGCAGAGCT...
umi TATCGAACAG = 448 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=565]
0-26 ==> 278-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
26-379 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
408-456 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
456-565 ==> 0-109 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 368, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 26, 182, 224, 290, 323, 413, 510
confident = false

TIG 2[bases=637]
26-388 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=10)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CETWDSNTLVLF at 362, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 26, 190, 230, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2281 = CCGGGATCAGATGGCA-1

using 561 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[558]
surviving nonsolo ucounts = 1[558]
ids = [0]

====================================================================================

UMI info for barcode CCGGGATCAGATGGCA-1 contig 1 = AGGAGTCAGT...
umi AGAGACTTTG = 556 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQQSYSTPWQF at 354, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 547
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2284 = CCGGGATCAGGTTTCA-1

using 334 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[331]
surviving nonsolo ucounts = 1[331]
ids = [3]

====================================================================================

UMI info for barcode CCGGGATCAGGTTTCA-1 contig 1 = TGGGGGATCA...
umi TATTGTTCTT = 335 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTRETF at 371, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2286 = CCGGGATCAGTACACT-1

using 34 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 25]
surviving nonsolo ucounts = 1[25]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2293 = CCGGGATCATGTCTCC-1

using 286 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode CCGGGATCATGTCTCC-1 contig 1 = GAGTCAGTCT...
umi TCCCCCCCTT = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2297 = CCGGGATCATTAGGCT-1

using 254 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [0]

====================================================================================

UMI info for barcode CCGGGATCATTAGGCT-1 contig 1 = TGGGGATCAC...
umi AAACTTCCAC = 237 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=553]
63-414 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
439-487 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
487-553 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARLQVDAPLAHGGDYW at 405, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 63, 261, 424, 541
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2299 = CCGGGATCATTGTGCA-1

using 11787 reads

====================================================================================

graph has 4831 edges initially, 44 edges after simplification

total ucounts = 649
nonsolo ucounts = 304[2^138, 3^48, 4^29, 5^16, 6^8, 7^11, 8^3, 9^2, 10, 11^2, 12^3, 13, 14, 51, 87^2, 90, 122, 123, 134, 154, 157, 174, 177, 178, 188, 197, 225, 248, 257, 263, 266, 270, 272, 276, 282, 284, 285, 288, 293, 297, 303, 317, 322, 334, 346, 350, 362, 364, 370, 372, 411, 413, 575]
surviving nonsolo ucounts = 40[51, 87, 90, 122, 123, 134, 154, 157, 174, 177, 178, 188, 197, 225, 248, 257, 263, 266, 270, 272, 276, 282, 284, 285, 288, 293, 297, 303, 317, 322, 334, 346, 350, 362, 364, 370, 372, 411, 413, 575]
ids = [522, 332, 344, 24, 446, 487, 470, 291, 419, 42, ...]

====================================================================================

UMI info for barcode CCGGGATCATTGTGCA-1 contig 1 = AGTCCCAGTC...
umi AAGATCCCGT = 412 reads: +388 validated
umi AAGGCGGGCA = 122 reads: +388 validated
umi ACACGCGGCT = 177 reads: +388 validated
umi ACGATATCTG = 257 reads: +207 -2XX +1 -1XX +1 -1XX +1 -2XX +1 -3XX +1 -2XX +2 -1XX +162 invalidated
umi AGACCAGTCA = 346 reads: +388 validated
umi AGATCCGTCC = 365 reads: +388 validated
umi AGGCCGTGGG = 330 reads: +388 validated
umi ATCTTCCCAC = 291 reads: +388 validated
umi CACCCCTCCT = 298 reads: +388 validated
umi CACCTCAACA = 320 reads: +388 validated
umi CACGTTTCAC = 288 reads: +388 validated
umi CCATAGTCAT = 570 reads: +388 validated
umi CCTCGACAGA = 288 reads: +388 validated
umi CGTTTACCAT = 270 reads: +388 validated
umi CTACTGCGTA = 176 reads: +388 validated
umi CTCTCATTAG = 156 reads: +388 validated
umi CTTTGCTGGC = 283 reads: +388 validated
umi GATCCCCGTG = 363 reads: +388 validated
umi GCACGATTTC = 272 reads: +388 validated
umi GGCCTTGCCA = 413 reads: +388 validated
umi GTACATCGCA = 348 reads: +388 validated
umi GTTCTCGGCA = 174 reads: +388 validated
umi GTTGGGATGG = 329 reads: +388 validated
umi TACCATCTCC = 123 reads: +388 validated
umi TCACCGATTG = 268 reads: +388 validated
umi TCCACGGCGG = 300 reads: +388 validated
umi TCCCTGCCTG = 369 reads: +388 validated
umi TCCTGTTCGG = 294 reads: +28 -1XX +359 invalidated
umi TCTTGAAGCT = 270 reads: +388 validated
umi TTTTATATCC = 375 reads: +388 validated

UMI info for barcode CCGGGATCATTGTGCA-1 contig 2 = CACTTGGTGA...
umi CTGTCTCCCT = 269 reads: +454 validated
umi CTTCTTGCGG = 171 reads: +426 -28 non-validated
umi GAATTGGCAA = 86 reads: +454 validated
umi GATTATCCCT = 90 reads: +439 -1 +5 -1 +8 non-validated
umi TACTCCGACC = 205 reads: +454 validated
umi TATCAGCCGT = 155 reads: +454 validated
umi TCACTATGCG = 134 reads: +409 -1 +44 non-validated
umi TCCTGTAGTT = 44 reads: +330 -17 +85 -22 non-validated
umi TTACTTGCCA = 194 reads: +454 validated
umi TTCAATCTTC = 235 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 30 umis using 1388 reads
cdr3 = CQQLNSYPRTF at 347, score = 9 + 8
umis assigned: [19, 24, 42, 63, 86, 90, 100, 124, 161, 165] and 20 others
of which 30 are surviving nonsolos
reads assigned: 8691
start codons at 20, 26, 82, 231, 450
confident = true

TIG 2[bases=561]
0-36 ==> 43-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
36-389 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=0)
395-426 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=6)
427-490 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
490-561 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 94 reads
cdr3 = CARDGGAYDFWSGYNIEQNYYYGMDVW at 378, score = 9 + 7
umis assigned: [304, 313, 332, 344, 455, 470, 487, 522, 596, 602]
of which 10 are surviving nonsolos
reads assigned: 1555
start codons at 36, 187, 192, 339, 388, 447
confident = true
now this is a cell
paired!

GGAGGGGCATACGATTTTTGGAGTGGTTATAATATTGAACAAAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGCTTAATAGTTACCCTCGGACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2300 = CCGGGATGTAAACCTC-1

using 436 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 430]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2305 = CCGGGATGTAGCTTGT-1

using 265 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=548]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-32 ==> 5705-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
31-257 ==> 0-226 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
257-366 ==> 227-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7) [SHIFT!]
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYRNSITF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 31, 454
confident = false
not full
frameshifted full length transcript of length 548
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2308 = CCGGGATGTATTCGTG-1

using 379 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 373]
surviving nonsolo ucounts = 1[373]
ids = [5]

====================================================================================

UMI info for barcode CCGGGATGTATTCGTG-1 contig 1 = GTTTTCATTC...
umi TTTATTACAG = 377 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=521]
0-41 ==> 39-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
41-400 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=15)
419-450 ==> 15-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
450-521 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CTTWRCMVCF at 389, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 41, 197, 264, 321, 335, 350, 397, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2316 = CCGGGATGTCGGCACT-1

using 146 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[144]
surviving nonsolo ucounts = 1[144]
ids = [1]

====================================================================================

UMI info for barcode CCGGGATGTCGGCACT-1 contig 1 = GGAACTGCTC...
umi ATCGTTCGCT = 133 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=26)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQFHNWPSVGF at 352, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 31, 80, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2324 = CCGGGATGTGAACCTT-1

using 221 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 216]
surviving nonsolo ucounts = 1[216]
ids = [1]

====================================================================================

UMI info for barcode CCGGGATGTGAACCTT-1 contig 1 = GGAGTCAGAC...
umi AATCATGCTG = 2 reads: -132 +1 -1 +2 -1 +3 -1 +1 -1 +3 -2 +2 -1 +7 -1 +1 -1X +6 -3 +4 -6 +3 -1 +3 -201X invalidated
umi AATCCTGCGG = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-503 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2334 = CCGGGATGTTATGTGC-1

using 164 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 157]
surviving nonsolo ucounts = 1[157]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2339 = CCGGGATGTTCCAACA-1

using 732 reads

====================================================================================

graph has 294 edges initially, 38 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[5, 58, 319, 347]
surviving nonsolo ucounts = 3[58, 319, 347]
ids = [4, 0, 5]

====================================================================================

UMI info for barcode CCGGGATGTTCCAACA-1 contig 1 = GAATCAGTCC...
umi ACACTTCGGG = 327 reads: +110 -1XX +13 -1XX +263 invalidated

UMI info for barcode CCGGGATGTTCCAACA-1 contig 2 = AGTCTCAGTC...
umi GAGAACTGAC = 23 reads: -234X +8 -5XX +1 -1XX +4 -1XX +6 -1XX +2 -1XX +32 -1XX +5 -2XX +8 -3XX +3 -2XX +3 -1X +3 -33X +3 -3X +7 -1X +1 -1X +7 -1X +4 invalidated
umi TACCTGCCGT = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSTPYTF at 347, score = 9 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 366
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2357 = CCGGGATTCATGCAAC-1

using 1648 reads

====================================================================================

graph has 2230 edges initially, 32 edges after simplification

total ucounts = 817
nonsolo ucounts = 338[2^146, 3^78, 4^48, 5^26, 6^14, 7^9, 8^7, 9^3, 10^2, 11^2, 12, 16, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2363 = CCGGGATTCCTCGCAT-1

using 468 reads

====================================================================================

graph has 222 edges initially, 6 edges after simplification

total ucounts = 23
nonsolo ucounts = 12[2^4, 3, 4, 5, 7, 8, 9, 13, 400]
surviving nonsolo ucounts = 1[400]
ids = [10]

====================================================================================

UMI info for barcode CCGGGATTCCTCGCAT-1 contig 1 = GGAGTCAGTC...
umi GCTGTTGCAA = 396 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYDNLLRATF at 353, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 26, 32, 88, 101, 240, 363, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2364 = CCGGGATTCCTTAATC-1

using 87 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 80]
surviving nonsolo ucounts = 1[80]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2367 = CCGGGATTCGAGAGCA-1

using 143 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[9, 129]
surviving nonsolo ucounts = 1[129]
ids = [0]

====================================================================================

UMI info for barcode CCGGGATTCGAGAGCA-1 contig 1 = GAAGAGCTGC...
umi ATTTCAGTCA = 129 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2373 = CCGGGATTCTAACCGA-1

using 1447 reads

====================================================================================

graph has 318 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 7, 1431]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2374 = CCGGGATTCTACCAGA-1

using 518 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[515]
surviving nonsolo ucounts = 1[515]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=582]
0-337 ==> 17-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=20)
333-371 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
371-582 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CNSYAGSDKWVF at 307, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 499
start codons at 140, 184, 191, 290, 317
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2375 = CCGGGATTCTACTCAT-1

using 84 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[83]
surviving nonsolo ucounts = 1[83]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=306]
0-304 ==> 4-308 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=23)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 2, 207, 210
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2383 = CCGGTAGAGAACAACT-1

using 862 reads

====================================================================================

graph has 1289 edges initially, 24 edges after simplification

total ucounts = 478
nonsolo ucounts = 186[2^94, 3^47, 4^21, 5^14, 6^4, 7^2, 8, 9, 11, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2386 = CCGGTAGAGACCCACC-1

using 29 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3^2, 4, 5^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2389 = CCGGTAGAGAGCAATT-1

using 97 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 90]
surviving nonsolo ucounts = 1[90]
ids = [2]

====================================================================================

UMI info for barcode CCGGTAGAGAGCAATT-1 contig 1 = TGGGGGCTTT...
umi CCCTTTCCCG = 88 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=478]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=12)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 7 reads
cdr3 = CAKWGGPGAVMAYFDYW at 385, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 87
start codons at 19, 28, 40, 84, 253, 307, 393, 415
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2390 = CCGGTAGAGAGCTGCA-1

using 10752 reads

====================================================================================

graph has 3973 edges initially, 80 edges after simplification

total ucounts = 324
nonsolo ucounts = 171[2^49, 3^29, 4^7, 5^7, 6^2, 7^5, 8^2, 10, 12^2, 13, 37, 67, 68, 71, 74^2, 78, 79, 80, 81, 88, 89, 91, 100, 103, 106, 107, 109, 110^2, 111, 113, 119, 121^2, 123, 125, 128, 129, 132, 133, 134, 136, 137, 139^2, 144^2, 145^2, 148^2, 149, 154, 161, 162, 165, 166, 167, 168^3, 169^2, 187, 188, 189, 191, 195^2, 197, 314, 326, 375, 545, 737]
surviving nonsolo ucounts = 64[6, 68, 71, 74, 78, 79, 80, 81, 88, 89, 91, 100, 103, 106, 107, 109, 110^2, 111, 113, 119, 121^2, 123, 125, 128, 129, 132, 133, 134, 136, 137, 139^2, 144^2, 145^2, 148^2, 149, 154, 161, 162, 165, 166, 167, 168^3, 169^2, 187, 188, 189, 191, 195^2, 197, 314, 326, 375, 545, 737]
ids = [306, 4, 6, 205, 120, 274, 28, 80, 242, 260, ...]

====================================================================================

UMI info for barcode CCGGTAGAGAGCTGCA-1 contig 1 = ACTTTCTGAG...
umi ACAGTCGCCG = 167 reads: +427 validated
umi ATTAACTGCG = 184 reads: +427 validated
umi CACTTCCGCC = 166 reads: +427 validated
umi CGTATTAACA = 105 reads: +427 validated
umi CTCATGCATA = 150 reads: +427 validated
umi GACTGGCCTT = 139 reads: +427 validated
umi GCATTGGATA = 172 reads: +427 validated
umi GCTTTCCAGT = 196 reads: +427 validated
umi TAATGCATTG = 173 reads: +391 -13 +2 -1 +20 non-validated

UMI info for barcode CCGGTAGAGAGCTGCA-1 contig 2 = GGGGGCTGGG...
umi AAAATTGTCC = 150 reads: +382 validated
umi AACACTCCTG = 68 reads: +382 validated
umi ACACAGCCAA = 80 reads: +382 validated
umi ACACTCCGAC = 125 reads: +382 validated
umi ATGACTAGAC = 746 reads: -337 +2 -4XX +1 -1XX +5 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ATGCCATTCA = 83 reads: +382 validated
umi ATTTCACTTA = 111 reads: +382 validated
umi CACGAAGCGT = 98 reads: +382 validated
umi CATCGATTCG = 109 reads: +382 validated
umi CCAAGGTCAT = 143 reads: +382 validated
umi CCCCTTCGGT = 77 reads: +14 -2 +366 non-validated
umi CCCTATCCGC = 119 reads: +382 validated
umi CCGGATTGGC = 131 reads: +382 validated
umi CGAAGAACGG = 120 reads: +382 validated
umi CGAGATTCGT = 165 reads: +382 validated
umi CGCAAATCAT = 198 reads: +382 validated
umi CGTGGCAGTA = 160 reads: +382 validated
umi CTTAAAGGTT = 168 reads: +382 validated
umi GAATACCGCT = 105 reads: +382 validated
umi GAATAGGGGG = 108 reads: +382 validated
umi GACGCCATAG = 122 reads: +382 validated
umi GATTGCTCCT = 150 reads: +382 validated
umi GCCCTAGTCG = 74 reads: +382 validated
umi GGAGCGCTGT = 582 reads: -338 +1 -4XX +1 -1XX +5 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi GTCATATAGC = 90 reads: +382 validated
umi TACCACTCCC = 135 reads: +382 validated
umi TATAACGAGT = 132 reads: +382 validated
umi TCAGAGCATT = 88 reads: +382 validated
umi TCTCTTTCTG = 79 reads: +382 validated
umi TCTGTTTGGA = 155 reads: +382 validated
umi TTCAAACAAT = 147 reads: +194 -1XX +187 invalidated
umi TTCCGTTGGG = 112 reads: +382 validated
umi TTGACTACAA = 134 reads: +382 validated
umi TTTCTTCGCC = 162 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=533]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=19)
409-462 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 100 reads
cdr3 = CVSEVVPAARHWYFDLW at 380, score = 9 + 7
umis assigned: [31, 83, 97, 145, 155, 194, 204, 207, 237]
of which 9 are surviving nonsolos
reads assigned: 1432
start codons at 35, 79, 302
confident = true

TIG 2[bases=638]
45-390 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-638 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 31 umis using 636 reads
cdr3 = CSSYTSSWVF at 369, score = 8 + 8
umis assigned: [0, 6, 28, 30, 78, 80, 86, 94, 105, 110] and 24 others
of which 34 are surviving nonsolos
reads assigned: 5080
start codons at 45, 202, 246, 253, 256, 559
confident = true

REJECT CONTIGS

TIG 1[bases=555]
7-79 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
31-384 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=1)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4, 9, 15, 23, 57, 70, 71, 111, 151, 158] and 8 others
of which 18 are surviving nonsolos
reads assigned: 2805
start codons at 31, 37, 93, 341, 374, 461
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGTGAGTGAGGTAGTACCAGCTGCTAGACACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCTGGGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2401 = CCGGTAGAGCTGAAAT-1

using 58 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 1[56]
ids = [2]

====================================================================================

UMI info for barcode CCGGTAGAGCTGAAAT-1 contig 1 = TCATGACCTG...
umi GTCTAGTGTA = 51 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=414]
2-355 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
352-390 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
390-414 ==> 0-24 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CGTWDNSLSAWVF at 323, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 2, 207, 331
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2409 = CCGGTAGAGGGTGTTG-1

using 45 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2413 = CCGGTAGAGTACGATA-1

using 2943 reads

====================================================================================

graph has 3249 edges initially, 72 edges after simplification

total ucounts = 1014
nonsolo ucounts = 611[2^197, 3^135, 4^87, 5^52, 6^41, 7^29, 8^19, 9^19, 10^14, 11^8, 12^4, 13^4, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2415 = CCGGTAGAGTCCTCCT-1

using 196 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 184]
surviving nonsolo ucounts = 1[184]
ids = [1]

====================================================================================

UMI info for barcode CCGGTAGAGTCCTCCT-1 contig 1 = GAGGAGTCAG...
umi GATTCAGCAC = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-473 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQSFITPRSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 28, 34, 90, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2423 = CCGGTAGCAAACGTGG-1

using 267 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 5, 35, 223]
surviving nonsolo ucounts = 2[35, 223]
ids = [0, 4]

====================================================================================

UMI info for barcode CCGGTAGCAAACGTGG-1 contig 1 = GGGGGGGTCT...
umi TGCGCGTCAA = 225 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-386 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
426-548 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSSLRVF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2428 = CCGGTAGCAAGCTGGA-1

using 158 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 152]
surviving nonsolo ucounts = 1[152]
ids = [0]

====================================================================================

UMI info for barcode CCGGTAGCAAGCTGGA-1 contig 1 = GTGGGCTCAG...
umi AGAGGTCTTT = 145 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=565]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=1)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=8)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
418-565 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CNSRDSSGNHVVF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 36, 155, 235, 334, 379
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2460 = CCGGTAGCATTCCTGC-1

using 30774 reads

====================================================================================

graph has 10791 edges initially, 66 edges after simplification

total ucounts = 1101
nonsolo ucounts = 536[2^198, 3^105, 4^31, 5^26, 6^16, 7^9, 8^8, 9^3, 10^3, 11, 12^2, 13, 14^2, 16, 20, 27, 28, 30^2, 31, 40, 43^3, 44, 58, 63, 65, 88, 102, 117, 130, 137, 139, 148, 157, 160^2, 168^3, 169, 170, 172^3, 179, 182, 184, 185^2, 186, 192, 195, 199^2, 201, 204, 208, 209^2, 211, 213, 217, 218^2, 221, 223, 224^2, 225, 227, 229, 230^2, 231, 232^2, 237^2, 239, 240^2, 241, 242^2, 243^2, 246^2, 248, 250, 251, 253^2, 257, 261, 262, 263, 264^2, 266^3, 267^3, 269, 271^2, 272, 273, 274, 275, 276^2, 277, 278, 279, 284, 287^2, 288, 295, 308^2, 310, 315^2, 316, 317, 318, 319, 322, 327, 328, 335, 336, 338, 343, 352, 390, 409, 529]
surviving nonsolo ucounts = 120[40, 43, 44, 63, 65, 88, 117, 130, 137, 139, 148, 157, 160^2, 168^3, 169, 170, 172^3, 179, 182, 184, 185^2, 186, 192, 195, 199^2, 201, 204, 208, 209^2, 211, 213, 217, 218^2, 221, 223, 224^2, 225, 227, 229, 230^2, 231, 232^2, 237^2, 239, 240^2, 241, 242^2, 243^2, 246^2, 248, 250, 251, 253^2, 257, 261, 262, 263, 264^2, 266^3, 267^3, 269, 271^2, 272, 273, 274, 275, 276^2, 277, 278, 279, 284, 287^2, 288, 295, 308^2, 310, 315^2, 316, 317, 318, 319, 322, 327, 328, 335, 336, 338, 343, 352, 390, 409, 529]
ids = [415, 618, 502, 413, 701, 842, 921, 627, 755, 859, ...]

====================================================================================

UMI info for barcode CCGGTAGCATTCCTGC-1 contig 1 = GAGCTCTGGG...
umi ACTTTGCGTA = 182 reads: +421 validated
umi ATTACAGCTG = 235 reads: +365 -19 +37 non-validated
umi CACATACGCA = 132 reads: +421 validated
umi CCTTACGGAG = 37 reads: -380X +4 -2X +9 -1X +2 -1X +3 -2X +17 invalidated
umi CCTTGCACTA = 38 reads: +325 -24 +72 non-validated
umi CGCGAGTTCC = 280 reads: +421 validated
umi CTCTCGCGTC = 177 reads: +421 validated
umi CTCTTAGCCT = 47 reads: +332 -1 +46 -12 +30 non-validated
umi GAATCGTGAG = 187 reads: +406 -1 +3 -1 +1 -1 +8 non-validated
umi GACCAATCCA = 338 reads: -210X +211 invalidated
umi GCATGCTAAA = 38 reads: +344 -9 +63 -2 +3 non-validated
umi GCCGCCCTCA = 161 reads: +401 -2 +3 -15 non-validated
umi GGTTGGGATA = 68 reads: +347 -2 +72 non-validated
umi GTGTATTGAC = 172 reads: +421 validated
umi TAAATCGTTG = 301 reads: +408 -1 +8 -2 +2 non-validated
umi TAGTGCTGGC = 186 reads: +421 validated
umi TATTTACCAT = 88 reads: +392 -1 +3 -1 +7 -1 +4 -2 +10 non-validated
umi TCTAACGGCG = 4 reads: -350 +71 non-validated
umi TTGACGCCTC = 230 reads: +421 validated

UMI info for barcode CCGGTAGCATTCCTGC-1 contig 2 = AGGAGTCAGA...
umi AATCAATGGC = 290 reads: +188 -1XX +196 invalidated
umi ACCGTCTTGG = 309 reads: +385 validated
umi ACGGCTAGCA = 307 reads: +385 validated
umi ATAAACGCTA = 167 reads: +385 validated
umi ATCCTACATT = 257 reads: +385 validated
umi ATGGCATACG = 199 reads: +385 validated
umi ATTTCAATAT = 254 reads: -255X +130 invalidated
umi CACTGTGGAT = 284 reads: +385 validated
umi CACTTCTCTG = 337 reads: +385 validated
umi CATACTCGTA = 323 reads: +385 validated
umi CATCTCCGGG = 188 reads: +385 validated
umi CATGCTAGTA = 273 reads: +385 validated
umi CCGAACCGCC = 258 reads: +385 validated
umi CCGACCGTGC = 208 reads: +385 validated
umi CGAACCCCCC = 159 reads: +385 validated
umi CGAGATCCGT = 266 reads: +385 validated
umi CGGCTGGTTT = 240 reads: +385 validated
umi CGGGCATAAT = 242 reads: +385 validated
umi CGTATACCAT = 184 reads: +385 validated
umi CTACCGGCCA = 256 reads: +385 validated
umi CTAGATCGTA = 270 reads: +385 validated
umi GAAAGGTCGT = 211 reads: +385 validated
umi GACCACTCTG = 241 reads: +385 validated
umi GAGTTTATTG = 197 reads: +385 validated
umi GCCCCACATT = 318 reads: +385 validated
umi GCCCGACCAC = 131 reads: +385 validated
umi GCGGACAAGC = 278 reads: +385 validated
umi GCTCTCAGTC = 277 reads: +385 validated
umi GTCCTGCCCC = 225 reads: +385 validated
umi GTTCGATCAG = 314 reads: +385 validated
umi TAAATGATTC = 284 reads: +385 validated
umi TAACAAAAGG = 233 reads: +385 validated
umi TAACCCTTAA = 317 reads: +385 validated
umi TAACGGTCTT = 270 reads: +385 validated
umi TAAGATCCAC = 232 reads: +385 validated
umi TACAACGGGG = 277 reads: +385 validated
umi TACACATTTC = 262 reads: +385 validated
umi TACCCGTGTG = 398 reads: +385 validated
umi TACTAACGAC = 223 reads: +385 validated
umi TACTTGGACA = 258 reads: +385 validated
umi TATCATTTCG = 243 reads: +385 validated
umi TCACACATTT = 144 reads: +385 validated
umi TCAGTAGCGA = 244 reads: +385 validated
umi TCAGTCGGCC = 213 reads: +385 validated
umi TCCAAGATTA = 264 reads: +385 validated
umi TCCCCCGAAG = 355 reads: +385 validated
umi TCCCGTGACC = 171 reads: +385 validated
umi TTACCTGGGT = 267 reads: +385 validated
umi TTACGCCCCC = 321 reads: +385 validated
umi TTTTCGTGGG = 321 reads: +385 validated
umi TTTTGAACGG = 263 reads: +294 -1XX +90 invalidated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=5)
461-501 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 196 reads
cdr3 = CAKEHDYGEPGPRDYW at 422, score = 9 + 7
umis assigned: [129, 242, 291, 413, 415, 435, 499, 502, 565, 575] and 9 others
of which 19 are surviving nonsolos
reads assigned: 2825
start codons at 80, 231, 236, 294, 297, 315, 383, 435
confident = true

TIG 2[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 51 umis using 1924 reads
cdr3 = CQQYNSYWTF at 354, score = 8 + 8
umis assigned: [48, 92, 107, 191, 217, 236, 258, 308, 310, 323] and 41 others
of which 51 are surviving nonsolos
reads assigned: 12757
start codons at 27, 33, 89, 102, 334, 454
confident = true

REJECT CONTIGS

TIG 1[bases=685]
1-166 ==> 5835-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
166-514 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
512-549 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
549-685 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [74, 117, 133, 143, 150, 185, 195, 204, 207, 266] and 37 others
of which 47 are surviving nonsolos
reads assigned: 11615
start codons at 71, 111, 166, 374, 500, 591
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAAAGAGCATGACTACGGTGAACCCGGGCCTCGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2474 = CCGGTAGGTGATGATA-1

using 206 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 194]
surviving nonsolo ucounts = 1[194]
ids = [3]

====================================================================================

UMI info for barcode CCGGTAGGTGATGATA-1 contig 1 = TGAGCGCAGA...
umi ATGGAACTGC = 180 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=449]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
430-449 ==> 0-19 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CGTWDSSLSAGFYVF at 357, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 36, 190, 241, 365, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2477 = CCGGTAGGTGCAGTAG-1

using 190 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4^2, 176]
surviving nonsolo ucounts = 1[176]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=382]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-250 ==> 0-223 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
254-292 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
292-382 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 27, 33, 89, 102, 334
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2481 = CCGGTAGGTGTTAAGA-1

using 260 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode CCGGTAGGTGTTAAGA-1 contig 1 = GTCAGTCTCA...
umi GCATTCGTAC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYSTPRTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2492 = CCGGTAGGTTTGACAC-1

using 74 reads

====================================================================================

graph has 72 edges initially, 4 edges after simplification

total ucounts = 25
nonsolo ucounts = 15[2^3, 3^3, 4^3, 5^4, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2505 = CCGGTAGTCCACGAAT-1

using 257 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [2]

====================================================================================

UMI info for barcode CCGGTAGTCCACGAAT-1 contig 1 = GAGGAACTGC...
umi GCATCTAGAA = 228 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2512 = CCGGTAGTCGAATCCA-1

using 1514 reads

====================================================================================

graph has 2143 edges initially, 46 edges after simplification

total ucounts = 826
nonsolo ucounts = 328[2^152, 3^93, 4^35, 5^22, 6^9, 7^10, 8^5, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2514 = CCGGTAGTCGAGCCCA-1

using 179 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[176]
surviving nonsolo ucounts = 1[176]
ids = [1]

====================================================================================

UMI info for barcode CCGGTAGTCGAGCCCA-1 contig 1 = CTGGGCCTCA...
umi AACGACTCGT = 153 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=489]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
416-489 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQAWDSTTDWVF at 352, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2519 = CCGGTAGTCTCCAGGG-1

using 139 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 135]
surviving nonsolo ucounts = 1[135]
ids = [0]

====================================================================================

UMI info for barcode CCGGTAGTCTCCAGGG-1 contig 1 = TCACTGCCCA...
umi GGATTCAGAT = 129 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=493]
0-49 ==> 10-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
49-402 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
421-467 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
467-493 ==> 0-26 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARPYNSYWLGFDYW at 391, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 49, 223
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2522 = CCGGTAGTCTGCCAGG-1

using 146 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [0]

====================================================================================

UMI info for barcode CCGGTAGTCTGCCAGG-1 contig 1 = AATCAGTCCC...
umi ACTGCCTTGG = 132 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-480 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2523 = CCGGTAGTCTGGGCCA-1

using 237 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 3, 4, 6, 12, 203]
surviving nonsolo ucounts = 1[203]
ids = [3]

====================================================================================

UMI info for barcode CCGGTAGTCTGGGCCA-1 contig 1 = TGAGCGCAGA...
umi ATTAAGTAAC = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=4)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
424-520 ==> 0-96 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2532 = CCGTACTAGACCGGAT-1

using 616 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[615]
surviving nonsolo ucounts = 1[615]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=382]
0-206 ==> 139-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
208-246 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
246-382 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNNWPPWTF at 182, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 606
start codons at 66, 288
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2533 = CCGTACTAGACGCAAC-1

using 277 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 265]
surviving nonsolo ucounts = 1[265]
ids = [3]

====================================================================================

UMI info for barcode CCGTACTAGACGCAAC-1 contig 1 = ACGTGAAGCT...
umi GTGAAGCTCA = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
65-405 ==> 0-340 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
415-453 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
453-585 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 45 reads
cdr3 = CSSYTTTGSWVF at 389, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 65, 222, 273, 276
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2538 = CCGTACTAGATGTGGC-1

using 33 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 26]
surviving nonsolo ucounts = 1[26]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2542 = CCGTACTAGCCATCGC-1

using 411 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[5, 399]
surviving nonsolo ucounts = 1[399]
ids = [7]

====================================================================================

UMI info for barcode CCGTACTAGCCATCGC-1 contig 1 = GGAATCAGTC...
umi TACGTTTGAC = 398 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 392
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2546 = CCGTACTAGCGTTCCG-1

using 162 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 154]
surviving nonsolo ucounts = 1[154]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2548 = CCGTACTAGCTAGTGG-1

using 9124 reads

====================================================================================

graph has 4282 edges initially, 88 edges after simplification

total ucounts = 571
nonsolo ucounts = 287[2^101, 3^58, 4^41, 5^18, 6^8, 7^7, 8^6, 9^5, 10, 13^3, 18, 22, 31, 45, 82, 90, 92, 95, 96, 126^2, 136, 160, 167, 176, 181, 182, 186, 190, 201, 203, 208, 211, 238, 242, 250, 254, 256, 257, 283, 287, 289, 293, 294, 308, 318, 326, 343, 709]
surviving nonsolo ucounts = 33[22, 92, 95, 96, 126^2, 136, 160, 167, 176, 181, 182, 186, 190, 201, 208, 211, 238, 242, 250, 254, 256, 257, 283, 287, 289, 293, 294, 308, 318, 326, 343, 709]
ids = [412, 379, 150, 477, 128, 170, 230, 435, 461, 220, ...]

====================================================================================

UMI info for barcode CCGTACTAGCTAGTGG-1 contig 1 = GGGGAGTCAG...
umi AGCTGTGACT = 254 reads: +388 validated
umi CAACAACTCG = 127 reads: +388 validated
umi CATACAGAGC = 181 reads: +388 validated
umi GGTCAACCAT = 283 reads: +388 validated
umi TACATCTGCC = 22 reads: +355 -33 non-validated
umi TATCATCCGA = 160 reads: +388 validated
umi TCATGTTCGC = 167 reads: +388 validated
umi TGATAATACC = 318 reads: +20 -1XX +367 invalidated
umi TTACAGAGTT = 286 reads: +388 validated

UMI info for barcode CCGTACTAGCTAGTGG-1 contig 2 = AGTGCTTTCT...
umi ACGGTTGGTG = 297 reads: +385 -1X +3 -3X +38 invalidated
umi AGCCAAAGAT = 246 reads: +430 validated
umi CAGTAGTCAA = 96 reads: +430 validated
umi CAGTGATTGT = 205 reads: +430 validated
umi CATAATTACC = 307 reads: +430 validated
umi CATTTTTCGG = 126 reads: +430 validated
umi CCCCTCCATC = 237 reads: +430 validated
umi CCTTGGTACA = 183 reads: +430 validated
umi CGGCCCAAAA = 133 reads: +430 validated
umi CTCACCGGTC = 248 reads: +427 -3 non-validated
umi GATATAGGTA = 260 reads: +430 validated
umi GTCACCTCCC = 158 reads: +430 validated
umi TAGGTACCTT = 177 reads: +430 validated
umi TAGTTCTCTC = 328 reads: +430 validated
umi TCAAACCTCT = 293 reads: +430 validated
umi TCGGGGGATT = 93 reads: +415 -15 non-validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 310 reads
cdr3 = CQQSYSTPITF at 355, score = 9 + 8
umis assigned: [74, 128, 156, 370, 412, 435, 461, 499, 527]
of which 9 are surviving nonsolos
reads assigned: 1773
start codons at 28, 34, 90, 103, 239, 458
confident = true

TIG 2[bases=518]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
398-447 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
447-518 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 311 reads
cdr3 = CARGGYAPLFDPW at 377, score = 9 + 7
umis assigned: [48, 70, 150, 151, 154, 170, 182, 208, 230, 259] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3339
start codons at 17, 38, 82, 168
confident = true

REJECT CONTIGS

TIG 1[bases=631]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-87 ==> 5638-5697 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [250, 457]
of which 2 are surviving nonsolos
reads assigned: 886
start codons at 40, 101, 242, 338, 383
confident = false
did not find CDR3

TIG 2[bases=654]
3-57 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
41-73 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
57-73 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
57-81 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
57-82 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
100-179 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
100-128 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
270-377 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
273-376 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
353-378 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
405-443 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
443-654 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [14, 220, 379, 388, 427, 564]
of which 6 are surviving nonsolos
reads assigned: 1133
start codons at 57, 208, 258, 383, 406
confident = false
did not find CDR3
now this is a cell
paired!

GTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGCGGTTACGCCCCCCTTTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2552 = CCGTACTAGGCCATAG-1

using 360 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 4^2, 8, 334]
surviving nonsolo ucounts = 1[334]
ids = [1]

====================================================================================

UMI info for barcode CCGTACTAGGCCATAG-1 contig 1 = AGGAGTCAGT...
umi ACCAACCTAG = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYTTLLTF at 354, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2555 = CCGTACTAGGGCACTA-1

using 55 reads

====================================================================================

graph has 48 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 4, 6, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2557 = CCGTACTAGGTGCTTT-1

using 10511 reads

====================================================================================

graph has 5866 edges initially, 64 edges after simplification

total ucounts = 1221
nonsolo ucounts = 590[2^264, 3^126, 4^71, 5^36, 6^25, 7^11, 8^6, 9^6, 10^2, 11, 13^3, 14, 18, 59, 63, 79, 87, 115, 128^2, 133, 147, 150, 156, 160, 169, 174, 175, 177, 182, 183^2, 187, 189, 190, 191^2, 197, 202, 207, 214, 222^2, 227, 236, 322, 467, 589, 629, 749]
surviving nonsolo ucounts = 36[59, 79, 87, 115, 128^2, 133, 147, 150, 156, 160, 169, 174, 175, 177, 182, 183^2, 187, 189, 190, 191^2, 197, 202, 207, 214, 222^2, 227, 236, 322, 467, 589, 629, 749]
ids = [69, 782, 378, 41, 517, 1038, 730, 175, 334, 869, ...]

====================================================================================

UMI info for barcode CCGTACTAGGTGCTTT-1 contig 1 = CTGATTTGCA...
umi ACATAATAGG = 188 reads: +394 validated
umi ACGTTCTGGT = 188 reads: +394 validated
umi ACTTGGCGTC = 146 reads: +394 validated
umi AGCATGTTCT = 174 reads: +394 validated
umi AGTAGGGCTT = 188 reads: +394 validated
umi ATGAATGCGC = 187 reads: +394 validated
umi ATTATACATA = 226 reads: +394 validated
umi CACCCACTTT = 326 reads: -344 +1 -11X +1 -3X +2 -1X +5 -2 +24 invalidated
umi CAGATAGATC = 234 reads: +394 validated
umi CAGCGTGACT = 753 reads: -330 +1 -6XX +1 -4XX +1 -13XX +1 -2XX +3 -1XX +31 invalidated
umi CATAGCTCAC = 86 reads: +394 validated
umi CCATCTCCCG = 176 reads: +394 validated
umi CCTGGGGCAT = 162 reads: +394 validated
umi CGACTCTGGT = 133 reads: +394 validated
umi GAGGTACAGC = 190 reads: +394 validated
umi GCCAAGGCGC = 136 reads: +394 validated
umi GCCCTAGTGC = 595 reads: -357 +1 -1XX +3 -1XX +31 invalidated
umi GGGCTATCTC = 78 reads: +394 validated
umi GTTTGCTTGC = 213 reads: +394 validated
umi TAACACGGAC = 638 reads: -356X +1 -2XX +3 -1XX +31 invalidated
umi TACAATAACG = 226 reads: +394 validated
umi TACAGTGTCC = 155 reads: +394 validated
umi TCCTCTAACA = 223 reads: +394 validated
umi TCTCCCACAC = 177 reads: +290 -1XX +103 invalidated
umi TCTTGTCGGG = 468 reads: +394 validated
umi TGATTAGCGT = 129 reads: +394 validated
umi TGCGTCACGG = 201 reads: +394 validated
umi TGGTTACCAG = 186 reads: +394 validated
umi TTGTGTGCTC = 184 reads: +394 validated

UMI info for barcode CCGTACTAGGTGCTTT-1 contig 2 = GGGAGCATCA...
umi AAGTCGCTAT = 55 reads: +376 -6 +4 -1 +8 -1 +9 -1 +27 non-validated
umi ATAGCCAATC = 165 reads: +433 validated
umi TGGAATTTGG = 195 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=719]
0-114 ==> 0-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
114-467 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
470-508 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
508-719 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 25 umis using 610 reads
cdr3 = CAAWDDSLNGSHVVF at 435, score = 8 + 8
umis assigned: [101, 149, 175, 195, 223, 273, 299, 347, 358, 361] and 19 others
of which 29 are surviving nonsolos
reads assigned: 6820
start codons at 9, 13, 36, 114, 418, 443, 448, 460, 469
confident = true

TIG 2[bases=523]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=0)
434-497 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
497-523 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 29 reads
cdr3 = CARDSAHILTQHYYYGMDVW at 406, score = 8 + 7
umis assigned: [69, 243, 1058]
of which 3 are surviving nonsolos
reads assigned: 408
start codons at 64, 220, 262, 267, 299, 328, 361, 454
confident = true

REJECT CONTIGS

TIG 1[bases=689]
1-466 ==> 1842-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
462-624 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
624-662 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
662-689 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [41, 142, 334, 354]
of which 4 are surviving nonsolos
reads assigned: 624
start codons at 1, 61, 146, 211, 243, 278, 302, 379, 432, 487, 492, 605
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATAGTGCCCATATTTTGACCCAACACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTTCTCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2558 = CCGTACTAGTAAGTAC-1

using 1149 reads

====================================================================================

graph has 1756 edges initially, 26 edges after simplification

total ucounts = 528
nonsolo ucounts = 244[2^110, 3^52, 4^31, 5^10, 6^16, 7^10, 8^4, 9^5, 10, 11, 12^2, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2563 = CCGTACTAGTCCGTAT-1

using 512 reads

====================================================================================

graph has 188 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 234, 268]
surviving nonsolo ucounts = 2[234, 268]
ids = [5, 2]

====================================================================================

UMI info for barcode CCGTACTAGTCCGTAT-1 contig 1 = GGAGTCAGAC...
umi CAGTGTGTGG = 268 reads: +388 validated

UMI info for barcode CCGTACTAGTCCGTAT-1 contig 2 = GGGACTGATC...
umi GGCGACCCCC = 234 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYFIYSYTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 26, 32, 88, 101, 333, 456
confident = false

TIG 2[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQVLQTPSWTF at 372, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2569 = CCGTACTCAAAGGTGC-1

using 321 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 310]
surviving nonsolo ucounts = 1[310]
ids = [0]

====================================================================================

UMI info for barcode CCGTACTCAAAGGTGC-1 contig 1 = GGGGGACTCC...
umi ACCACAGCTG = 311 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=525]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=2)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
454-525 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAHSTYLTGTNGPDAFDIW at 366, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 21, 65, 244, 247, 327, 336, 406, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2576 = CCGTACTCAAGCGATG-1

using 236 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 227]
surviving nonsolo ucounts = 1[227]
ids = [2]

====================================================================================

UMI info for barcode CCGTACTCAAGCGATG-1 contig 1 = GGGGTCACAA...
umi CATAAGCACT = 223 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=499]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-331 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
429-499 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYAGRTTFDVF at 362, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 38, 174, 177, 192, 195, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2580 = CCGTACTCAATGAATG-1

using 323 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 318]
surviving nonsolo ucounts = 1[318]
ids = [2]

====================================================================================

UMI info for barcode CCGTACTCAATGAATG-1 contig 1 = GGAGTCTCCC...
umi TCCCCATGGC = 319 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=563]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
415-440 ==> 6-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=0)
444-492 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CARPAYDSSGYYYPRYFDYW at 401, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 59, 233, 257, 392, 417
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2585 = CCGTACTCACAACTGT-1

using 93 reads

====================================================================================

graph has 56 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2, 3, 8, 10, 13, 15^2, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2600 = CCGTACTCATAACCTG-1

using 358 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3^2, 4, 341]
surviving nonsolo ucounts = 1[341]
ids = [1]

====================================================================================

UMI info for barcode CCGTACTCATAACCTG-1 contig 1 = ATCCAACAAC...
umi CGGAGTTACG = 333 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=573]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=33)
432-485 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
485-573 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARNPGDNSWDSYFHLDLW at 397, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 55, 209, 249, 253, 319, 352, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2601 = CCGTACTCATACGCTA-1

using 1619 reads

====================================================================================

graph has 2118 edges initially, 30 edges after simplification

total ucounts = 719
nonsolo ucounts = 341[2^130, 3^78, 4^51, 5^36, 6^21, 7^6, 8^7, 9^4, 10^3, 11, 13, 14, 16, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2603 = CCGTACTCATCACCCT-1

using 1811 reads

====================================================================================

graph has 2074 edges initially, 40 edges after simplification

total ucounts = 775
nonsolo ucounts = 331[2^146, 3^80, 4^41, 5^27, 6^15, 7^5, 8^7, 9^4, 10, 12^2, 15, 16, 254]
surviving nonsolo ucounts = 1[254]
ids = [697]

====================================================================================

UMI info for barcode CCGTACTCATCACCCT-1 contig 1 = TGGGGGATCA...
umi TGTCGAGTGC = 251 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQGTHWPPWTF at 371, score = 9 + 8
umis assigned: [697]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 35, 68, 96, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 28.2605 = CCGTACTCATCATCCC-1

using 54 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 44]
surviving nonsolo ucounts = 1[44]
ids = [1]

====================================================================================
NOT paired!
sorting bam, mem = 0.12
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk028-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk028-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

143.015 seconds used processing barcodes, peak mem = 0.34
