[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.30 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk027-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk027-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk027.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.0 = CATGGCGAGTACGTAA-1

using 5112 reads

====================================================================================

graph has 4514 edges initially, 102 edges after simplification

total ucounts = 1314
nonsolo ucounts = 531[2^227, 3^129, 4^68, 5^29, 6^16, 7^15, 8^9, 9^7, 10^6, 11^5, 12^3, 13^3, 14, 15, 17, 18, 21, 24, 41, 73, 210, 270, 281, 416, 516, 628]
surviving nonsolo ucounts = 8[18, 73, 210, 270, 281, 416, 516, 628]
ids = [416, 184, 1296, 362, 64, 291, 134, 583]

====================================================================================

UMI info for barcode CATGGCGAGTACGTAA-1 contig 1 = GCTCTGCTTC...
umi CAAGGCAGTA = 415 reads: -59X +332 invalidated
umi CATAGGGGGT = 274 reads: +391 validated
umi CCAGCCAGAG = 18 reads: +33 -1 +3 -1 +69 -29 +57 -1 +56 -1 +76 -14 +12 -1 +14 -1 +22 non-validated
umi TTTCTCCGGG = 206 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=19)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 3 umis using 231 reads
cdr3 = CQCYDSSLTGWGF at 375, score = 8 + 8
umis assigned: [291, 362, 416, 1296]
of which 4 are surviving nonsolos
reads assigned: 900
start codons at 51, 205, 358, 385, 521
confident = true

REJECT CONTIGS

TIG 1[bases=521]
0-180 ==> 23-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=9)
377-419 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=2)
419-521 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CARVQSLKQGAISTTYYYNALDVW at 316, score = 8 + 7
umis assigned: [134, 184, 583]
of which 3 are surviving nonsolos
reads assigned: 1206
start codons at 21, 437, 498
confident = false
VJ delta = 21
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.1 = CATGGCGAGTAGGCCA-1

using 220 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[216]
surviving nonsolo ucounts = 1[216]
ids = [3]

====================================================================================

UMI info for barcode CATGGCGAGTAGGCCA-1 contig 1 = GCTCTGCTTC...
umi TCTGGTTTTC = 196 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=567]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-567 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.2 = CATGGCGAGTCAAGCG-1

using 122 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 107]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.12 = CATGGCGCAAAGTCAA-1

using 429 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 421]
surviving nonsolo ucounts = 1[421]
ids = [6]

====================================================================================

UMI info for barcode CATGGCGCAAAGTCAA-1 contig 1 = GGGAGGAACT...
umi TGCAAGACAC = 416 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQRSNWPLTF at 356, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 412
start codons at 35, 240, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.14 = CATGGCGCAAGAGTCG-1

using 793 reads

====================================================================================

graph has 314 edges initially, 30 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[246, 544]
surviving nonsolo ucounts = 2[246, 544]
ids = [0, 2]

====================================================================================

UMI info for barcode CATGGCGCAAGAGTCG-1 contig 1 = GAGTCAGTCT...
umi ACAGCGGCAC = 245 reads: +388 validated

UMI info for barcode CATGGCGCAAGAGTCG-1 contig 2 = AGTCCCAGTC...
umi ATCCATACCA = 563 reads: +215 -1XX +175 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-363 ==> 0-338 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSSNSPRMF at 352, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 25, 31, 87, 100, 236, 379, 455
confident = false

TIG 2[bases=547]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=13)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 110 reads
cdr3 = CQQLKSYPSLTF at 347, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 532
start codons at 20, 26, 82, 231, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.15 = CATGGCGCAAGGACAC-1

using 161 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[156]
surviving nonsolo ucounts = 1[156]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.35 = CATGGCGCACGACGAA-1

using 767 reads

====================================================================================

graph has 224 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[761]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.37 = CATGGCGCACGGACAA-1

using 159 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 152]
surviving nonsolo ucounts = 1[152]
ids = [5]

====================================================================================

UMI info for barcode CATGGCGCACGGACAA-1 contig 1 = TGGGGAGTGA...
umi CCTATTATAC = 146 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=471]
25-383 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 33 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 370, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 25, 69, 248, 251, 254, 340, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.50 = CATGGCGCATCCCATC-1

using 326 reads

====================================================================================

graph has 170 edges initially, 22 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 119, 202]
surviving nonsolo ucounts = 2[119, 202]
ids = [2, 3]

====================================================================================

UMI info for barcode CATGGCGCATCCCATC-1 contig 1 = GGGGTCACAA...
umi CGTCATCCAG = 111 reads: +40 -1XX +347 invalidated

UMI info for barcode CATGGCGCATCCCATC-1 contig 2 = GGGGTCTCAG...
umi GTGGTTACTT = 197 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=449]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
426-449 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CCSYAGGNTWVF at 362, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 38, 246, 372
confident = false

TIG 2[bases=530]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-384 ==> 0-346 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
429-530 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYSSSTSPFVF at 362, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.51 = CATGGCGCATCCGTGG-1

using 112 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=330]
3-196 ==> 106-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=11)
273-321 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
cdr3 = CVRGGRSLWFGDLLDYW at 239, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 53, 111, 114, 262
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.54 = CATGGCGCATGCCTTC-1

using 381 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[378]
surviving nonsolo ucounts = 1[378]
ids = [0]

====================================================================================

UMI info for barcode CATGGCGCATGCCTTC-1 contig 1 = GAGGAATCAG...
umi ATTCACTCAG = 375 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.58 = CATGGCGCATTACGAC-1

using 331 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

UMI info for barcode CATGGCGCATTACGAC-1 contig 1 = GGGGAGGAAC...
umi ATCTTACGAT = 330 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRKSWPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.78 = CATGGCGGTCATCGGC-1

using 1547 reads

====================================================================================

graph has 592 edges initially, 6 edges after simplification

total ucounts = 18
nonsolo ucounts = 8[2^3, 4, 229, 284, 434, 580]
surviving nonsolo ucounts = 5[4, 229, 284, 434, 580]
ids = [12, 11, 4, 7, 8]

====================================================================================

UMI info for barcode CATGGCGGTCATCGGC-1 contig 1 = GCTCCAAACA...
umi GGCCCCCGGC = 217 reads: +388 validated
umi GGCCCCGGCT = 4 reads: -78 +1 -2 +7 -2 +4 -1 +4 -1 +18 -1 +4 -1 +2 -1 +7 -83X +1 -1X +1 -1X +1 -1X +58 -107 invalidated

GOOD CONTIGS

TIG 1[bases=541]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
430-541 ==> 0-111 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [11, 12]
of which 2 are surviving nonsolos
reads assigned: 216
start codons at 42, 181, 371, 388
confident = true

REJECT CONTIGS

TIG 1[bases=473]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-131 ==> 0-101 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
131-270 ==> 192-331 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
299-337 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
337-473 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7, 8]
of which 2 are surviving nonsolos
reads assigned: 1001
start codons at 30, 63, 99, 258, 379
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.79 = CATGGCGGTCCATGAT-1

using 537 reads

====================================================================================

graph has 664 edges initially, 4 edges after simplification

total ucounts = 290
nonsolo ucounts = 107[2^46, 3^26, 4^15, 5^6, 6^9, 7^3, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.90 = CATGGCGGTGCAGACA-1

using 391 reads

====================================================================================

graph has 169 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[385]
surviving nonsolo ucounts = 1[385]
ids = [3]

====================================================================================

UMI info for barcode CATGGCGGTGCAGACA-1 contig 1 = GTCAGACCCA...
umi CGCCGTTTCT = 391 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
23-376 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYYSFPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 383
start codons at 23, 29, 85, 98, 161, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.92 = CATGGCGGTGCATCTA-1

using 20 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.103 = CATGGCGGTTATCGGT-1

using 229 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 226]
surviving nonsolo ucounts = 1[226]
ids = [2]

====================================================================================

UMI info for barcode CATGGCGGTTATCGGT-1 contig 1 = CTGGGCCTCA...
umi GGACGGCGAT = 222 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-547 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQAWDSSTVGVVF at 352, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.104 = CATGGCGGTTCATGGT-1

using 342 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[336]
surviving nonsolo ucounts = 1[336]
ids = [0]

====================================================================================

UMI info for barcode CATGGCGGTTCATGGT-1 contig 1 = GGGGAGGAGT...
umi ACCCAATTCT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
419-495 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CHQYESVPYTF at 358, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 31, 37, 93, 106, 245, 341, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.109 = CATGGCGTCAAAGTAG-1

using 841 reads

====================================================================================

graph has 338 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 276, 553]
surviving nonsolo ucounts = 2[276, 553]
ids = [4, 3]

====================================================================================

UMI info for barcode CATGGCGTCAAAGTAG-1 contig 1 = GGAGTCAGAC...
umi GCTACGATTA = 512 reads: +388 validated
umi GCTCTTCTCT = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 138 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 772
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.120 = CATGGCGTCATCATTC-1

using 221 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 211]
surviving nonsolo ucounts = 1[211]
ids = [4]

====================================================================================

UMI info for barcode CATGGCGTCATCATTC-1 contig 1 = AGGAGTCAGA...
umi GGTGATCATA = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.123 = CATGGCGTCCACGACG-1

using 357 reads

====================================================================================

graph has 521 edges initially, 4 edges after simplification

total ucounts = 158
nonsolo ucounts = 67[2^31, 3^13, 4^7, 5^6, 6^2, 8, 9, 10, 11, 12, 13, 14, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.126 = CATGGCGTCCCGGATG-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.130 = CATGGCGTCCTCCTAG-1

using 212 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 4, 197]
surviving nonsolo ucounts = 1[197]
ids = [3]

====================================================================================

UMI info for barcode CATGGCGTCCTCCTAG-1 contig 1 = GAAGAGCTGC...
umi CTCCACCCGC = 202 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.133 = CATGGCGTCGACAGCC-1

using 48 reads

====================================================================================

graph has 17 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 1[45]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.147 = CATGGCGTCTGTCAAG-1

using 246 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=493]
2-65 ==> 124-187 on rc of segment before IGKV3-20 exon 1 [len=187] (mis=0)
53-77 ==> 173-197 on rc of segment before IGKV3-34 exon 1 [len=197] (mis=1)
62-364 ==> 46-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
363-401 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
401-493 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPFTF at 340, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 11, 31, 224, 350, 443
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.157 = CATTATCAGAGGGCTT-1

using 583 reads

====================================================================================

graph has 224 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[245, 335]
surviving nonsolo ucounts = 2[245, 335]
ids = [0, 1]

====================================================================================

UMI info for barcode CATTATCAGAGGGCTT-1 contig 1 = GATGCTTTCT...
umi ACTTCCAAGT = 211 reads: +460 validated

UMI info for barcode CATTATCAGAGGGCTT-1 contig 2 = GTCAGTCTCA...
umi ATTCACGGAT = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=1)
414-477 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
477-505 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARRSRWFGELLYDYYYMDVW at 383, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 1, 17, 26, 38, 82, 434
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.158 = CATTATCAGATAGGAG-1

using 9817 reads

====================================================================================

graph has 4116 edges initially, 60 edges after simplification

total ucounts = 439
nonsolo ucounts = 232[2^68, 3^39, 4^18, 5^17, 6^14, 7^7, 8^10, 9^8, 10^6, 11^4, 13, 14, 20, 35^2, 47, 63, 79, 82, 116, 151, 167, 188, 203, 207, 211, 228, 229, 234, 238, 239, 246^2, 250, 254, 258, 276, 281, 282, 286, 287, 288, 294, 295, 298, 328, 335, 339, 364^2, 441]
surviving nonsolo ucounts = 36[47, 63, 79, 82, 116, 151, 167, 188, 203, 207, 211, 228, 229, 234, 238, 239, 246^2, 250, 254, 258, 276, 281, 282, 286, 287, 288, 294, 295, 298, 328, 335, 339, 364^2, 441]
ids = [157, 55, 166, 314, 3, 204, 58, 415, 239, 279, ...]

====================================================================================

UMI info for barcode CATTATCAGATAGGAG-1 contig 1 = AGGAGTCAGA...
umi AAGCCCGCCT = 115 reads: +376 validated
umi AGTCCCTCTT = 291 reads: +376 validated
umi ATGCTTCGAA = 456 reads: +56 -1XX +1 -1XX +2 -1XX +1 -5XX +4 -20XX +1 -3XX +3 -11XX +266 invalidated
umi CGCATTTTAC = 289 reads: +376 validated
umi CTATTGTCCC = 231 reads: +376 validated
umi CTGTAAAGAG = 252 reads: +376 validated
umi GGATTGCGCT = 202 reads: +376 validated
umi TACTCAATCC = 293 reads: +376 validated
umi TATGACGCCT = 231 reads: +376 validated
umi TATTCCTCCG = 80 reads: +376 validated
umi TCGGTCCATT = 252 reads: +376 validated
umi TGGCAACAGC = 237 reads: +376 validated
umi TTCCACTGGT = 246 reads: +376 validated
umi TTTGTCTTCA = 243 reads: +376 validated

UMI info for barcode CATTATCAGATAGGAG-1 contig 2 = TGGGGGACTC...
umi AGCATTTCTT = 336 reads: +442 validated
umi ATATATACTC = 279 reads: +442 validated
umi ATGTAACAGC = 138 reads: +442 validated
umi ATTTTTCCCG = 363 reads: +442 validated
umi CAAGATACAG = 296 reads: +442 validated
umi CACCACAGCT = 207 reads: +442 validated
umi CATGGAGTTG = 333 reads: +442 validated
umi CCGTGTTGGG = 286 reads: +442 validated
umi CGCCGTTCTG = 47 reads: -45 +342 -26 +3 -1 +1 -1X +4 -1 +2 -1 +2 -1 +2 -1 +3 -1 +1 -1 +1 -1 +1 invalidated
umi CGTTAAGTTT = 75 reads: +442 validated
umi GCACCAGTGT = 208 reads: +442 validated
umi TAATATATGA = 287 reads: +442 validated
umi TAATGAGAGC = 369 reads: +442 validated
umi TTGTACCACA = 159 reads: +442 validated
umi TTGTATGCTG = 292 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=539]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-364 ==> 0-337 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
365-403 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 562 reads
cdr3 = CQQLRTF at 354, score = 8 + 8
umis assigned: [3, 41, 56, 154, 180, 190, 239, 296, 308, 314] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3355
start codons at 27, 33, 89, 102, 238, 241, 334, 445
confident = true

TIG 2[bases=535]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=2)
381-408 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
416-464 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 343 reads
cdr3 = CAHSLNYYGSGSYSQRYYFDYW at 367, score = 7 + 7
umis assigned: [32, 46, 58, 68, 70, 77, 91, 132, 157, 166] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3619
start codons at 22, 66, 245, 248, 328, 337, 389
confident = true

REJECT CONTIGS

TIG 1[bases=573]
0-67 ==> 12-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
0-67 ==> 5070-5137 on rc of segment before IGHV1-67 exon 2 [len=5137] (mis=0)
37-116 ==> 6508-6587 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=4)
67-417 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=0)
439-502 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
502-573 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARDEVPWLVRGATTTTVWTSGAKGPRSPSPQGVHPPQPF at 406, score = 9 + 4
umis assigned: [12, 55, 204, 305, 369]
of which 5 are surviving nonsolos
reads assigned: 905
start codons at 67, 223, 367, 416, 459
confident = false
frameshifted full length transcript of length 573
VJ delta = 78
delta too large
not full
not full
now this is a cell
paired!

TACTGTGCACACAGTTTAAATTACTATGGTTCGGGGAGTTATTCCCAACGTTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTTGCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.161 = CATTATCAGATGTCGG-1

using 31 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.166 = CATTATCAGCGTAATA-1

using 559 reads

====================================================================================

graph has 246 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 225, 331]
surviving nonsolo ucounts = 2[225, 331]
ids = [3, 1]

====================================================================================

UMI info for barcode CATTATCAGCGTAATA-1 contig 1 = AGAAGAGCTG...
umi ATGTTAATAC = 300 reads: +385 validated

UMI info for barcode CATTATCAGCGTAATA-1 contig 2 = AGCTCTGAGA...
umi TATTCTCAGT = 223 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=506]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
419-506 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSPVTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 34, 242, 245, 368, 461
confident = false

TIG 2[bases=586]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-586 ==> 0-83 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.168 = CATTATCAGCTCCCAG-1

using 1011 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 168, 834]
surviving nonsolo ucounts = 2[168, 834]
ids = [5, 0]

====================================================================================

UMI info for barcode CATTATCAGCTCCCAG-1 contig 1 = AGGAAGCAGC...
umi ACCGACTATT = 836 reads: -324 +55 non-validated
umi GATACCGTTG = 169 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=618]
0-28 ==> 223-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-361 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=39)
369-407 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
407-618 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CQVWDSDDHWVF at 343, score = 8 + 8
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 990
start codons at 28, 89, 227, 230, 326
confident = false
>vscore_27.168_84.6%
ATGGCCGGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGTTTCTGTGACGTCGTATGAGCTGAATCAGCCACCCTCACTGTCTGTGGCCCCAGGAAAGACGGCCAGGATTTCCTGTGGGGGAGACGATATTGGTAGTAAGCTTGTGCAGTGGTACAAGCAGGAGCCAGGCCAGGCCCCTGTGGTGGTCATTTATGATGATAGGGAGCGGCCGTCACGGACCCCTGCGCGATTCTCTGGCTCCAACTCTGGAAATACGGCCACCCTGACCATCACCGGGGTCGAGGCCGGTGATGAGGCCGACTATTATTGTCAGGTGTGGGATAGTGACGATCATTGGGTGTTC
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.185 = CATTATCAGTTCCACA-1

using 207 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode CATTATCAGTTCCACA-1 contig 1 = AGCATCATCC...
umi AAAAATGCCG = 202 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=512]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
433-479 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
479-512 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CALVSTLSALPFDFW at 403, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 61, 259, 265, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.189 = CATTATCCAAACTGCT-1

using 331 reads

====================================================================================

graph has 141 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 4, 8, 311]
surviving nonsolo ucounts = 1[311]
ids = [6]

====================================================================================

UMI info for barcode CATTATCCAAACTGCT-1 contig 1 = AGGAGTCAGA...
umi GGAGCCGGTC = 295 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=508]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-508 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSYPFTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.200 = CATTATCCACATTTCT-1

using 237 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[15, 216]
surviving nonsolo ucounts = 1[216]
ids = [6]

====================================================================================

UMI info for barcode CATTATCCACATTTCT-1 contig 1 = GAGCTCTGGG...
umi TCTTGCACTC = 198 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=522]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=13)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
486-522 ==> 0-36 on |60|IGHM|C-REGION| [len=1358] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CAKDGDGCDYW at 422, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 80, 236, 294, 297, 315, 383, 432, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.205 = CATTATCCACGACGAA-1

using 155 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 150]
surviving nonsolo ucounts = 1[150]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=454]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=9)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-454 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 30, 63, 99, 187, 250, 349, 369
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.218 = CATTATCCAGTAAGAT-1

using 492 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 483]
surviving nonsolo ucounts = 1[483]
ids = [0]

====================================================================================

UMI info for barcode CATTATCCAGTAAGAT-1 contig 1 = TCCAAACAGA...
umi ACCCCCCGTT = 469 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
428-584 ==> 0-156 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CSSWDSSLSAWVF at 361, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 460
start codons at 40, 179, 251, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.222 = CATTATCCAGTTCATG-1

using 61 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 13[2^3, 3^4, 4, 5^3, 6, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.225 = CATTATCCATCACAAC-1

using 555 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[255, 293]
surviving nonsolo ucounts = 2[255, 293]
ids = [1, 8]

====================================================================================

UMI info for barcode CATTATCCATCACAAC-1 contig 1 = ACCCAAAAAC...
umi AATCCGGGTC = 251 reads: +436 validated
umi TACCGCGTAA = 292 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=589]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-589 ==> 0-99 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 8]
of which 2 are surviving nonsolos
reads assigned: 534
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.226 = CATTATCCATCACGTA-1

using 358 reads

====================================================================================

graph has 140 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 7, 343]
surviving nonsolo ucounts = 2[7, 343]
ids = [6, 5]

====================================================================================

UMI info for barcode CATTATCCATCACGTA-1 contig 1 = GGGAGGAACT...
umi GTCTTCTTTC = 344 reads: +385 validated
umi TAACATGCTT = 7 reads: -88 +4 -1X +3 -1XX +3 -1XX +9 -1XX +1 -1XX +37 -1X +2 -1X +3 -1 +12 -1X +37 -1X +2 -12 +6 -2X +38 -1XX +20 -95 invalidated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPMYTF at 356, score = 9 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 345
start codons at 35, 240, 243, 380, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.234 = CATTATCGTAAACACA-1

using 129 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 124]
surviving nonsolo ucounts = 1[124]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.239 = CATTATCGTAAGGGCT-1

using 424 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 187, 230]
surviving nonsolo ucounts = 2[187, 230]
ids = [3, 4]

====================================================================================

UMI info for barcode CATTATCGTAAGGGCT-1 contig 1 = AGGTCTCAGA...
umi CGGGGGGTTA = 178 reads: +430 validated

UMI info for barcode CATTATCGTAAGGGCT-1 contig 2 = GCTCTGCTTC...
umi CTATTCGGCT = 225 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=532]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=3)
432-463 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=8)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
509-532 ==> 0-23 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARVGYDFWSGYLVHFDYW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 79, 235, 296, 314, 382, 527
confident = false

TIG 2[bases=547]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-547 ==> 0-102 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.243 = CATTATCGTAGGAGTC-1

using 904 reads

====================================================================================

graph has 1306 edges initially, 10 edges after simplification

total ucounts = 440
nonsolo ucounts = 156[2^48, 3^31, 4^31, 5^16, 6^14, 7^4, 8^4, 9^4, 10, 12^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.253 = CATTATCGTCCTAGCG-1

using 10 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.256 = CATTATCGTCTCACCT-1

using 204 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4^2, 193]
surviving nonsolo ucounts = 1[193]
ids = [4]

====================================================================================

UMI info for barcode CATTATCGTCTCACCT-1 contig 1 = GCTGTGCTGT...
umi TCTCCCACAA = 1 reads: -182X +1 -2 +2 -1 +12 -2 +8 -1 +3 -1 +1 -1 +1 -1 +4 -1X +3 -1 +3 -1 +1 -149 invalidated
umi TCTCCCTCAT = 176 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=432]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 22 reads
cdr3 = CQSADSSGTSLVF at 358, score = 8 + 9
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.257 = CATTATCGTCTGCGGT-1

using 452 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 126, 320]
surviving nonsolo ucounts = 2[126, 320]
ids = [3, 1]

====================================================================================

UMI info for barcode CATTATCGTCTGCGGT-1 contig 1 = AGCTCTCAGA...
umi GCAAATAGTG = 126 reads: +406 validated

UMI info for barcode CATTATCGTCTGCGGT-1 contig 2 = GAGCTACAAC...
umi AGAGTATCAG = 321 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=497]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=31)
447-485 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CASARPTRAYW at 421, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 79, 235, 238, 356, 382
confident = false

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSTPLTF at 369, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.258 = CATTATCGTGCCTGGT-1

using 522 reads

====================================================================================

graph has 160 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 128, 384]
surviving nonsolo ucounts = 2[128, 384]
ids = [5, 6]

====================================================================================

UMI info for barcode CATTATCGTGCCTGGT-1 contig 1 = CAGTCCCACT...
umi TCCTAGTCAG = 126 reads: +388 validated

UMI info for barcode CATTATCGTGCCTGGT-1 contig 2 = GGGAGGAACT...
umi TTTATCTTCA = 385 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 6-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
21-372 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CLQYSSSPWTF at 348, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 21, 27, 96, 232, 451
confident = false

TIG 2[bases=556]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYNNWPSITF at 356, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 35, 104, 240, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.264 = CATTATCGTTCCCTTG-1

using 284 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [0]

====================================================================================

UMI info for barcode CATTATCGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi GTGGTACCAC = 272 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=471]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-471 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 27, 30, 85, 99, 352, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.265 = CATTATCGTTGATTGC-1

using 407 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 394]
surviving nonsolo ucounts = 1[394]
ids = [6]

====================================================================================

UMI info for barcode CATTATCGTTGATTGC-1 contig 1 = GAAGAGCTGC...
umi TACAGGTTAT = 398 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.271 = CATTATCTCAACTCTT-1

using 33 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 6, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.284 = CATTATCTCATGTGGT-1

using 390 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[387]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.291 = CATTATCTCCCTCAGT-1

using 370 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 362]
surviving nonsolo ucounts = 1[362]
ids = [3]

====================================================================================

UMI info for barcode CATTATCTCCCTCAGT-1 contig 1 = GAGTCAGTCT...
umi CTTTGCTTTC = 363 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.301 = CATTATCTCGAACGGA-1

using 1324 reads

====================================================================================

graph has 1796 edges initially, 8 edges after simplification

total ucounts = 484
nonsolo ucounts = 243[2^75, 3^47, 4^35, 5^26, 6^16, 7^15, 8^8, 9^4, 10^7, 11^2, 12, 13^2, 14^2, 15, 19, 29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 27.316 = CATTATCTCTCTTGAT-1

using 588 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[197, 388]
surviving nonsolo ucounts = 2[197, 388]
ids = [1, 0]

====================================================================================

UMI info for barcode CATTATCTCTCTTGAT-1 contig 1 = AGCTTCAGCT...
umi CGCCACGTCG = 186 reads: +388 validated

UMI info for barcode CATTATCTCTCTTGAT-1 contig 2 = GAGTGCTTTC...
umi AAATACGGGT = 349 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=442]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 23 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 47, 351, 381, 393
confident = false

TIG 2[bases=497]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
451-497 ==> 0-46 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGRGFGELLAYW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 18, 39, 83, 169, 469
confident = false
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk027-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk027-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.412 seconds used processing barcodes, peak mem = 0.23
