[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.33 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk020-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk020-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk020.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.0 = CACCAGGGTCGGATCC-1

using 251 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.32 = CACCAGGTCCTAGTGA-1

using 294 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 289]
surviving nonsolo ucounts = 1[289]
ids = [3]

====================================================================================

UMI info for barcode CACCAGGTCCTAGTGA-1 contig 1 = AGGAGTCAGA...
umi GTAGGTCGCA = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.33 = CACCAGGTCCTATGTT-1

using 144 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 137]
surviving nonsolo ucounts = 1[137]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=499]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
0-73 ==> 5927-6000 on rc of segment after IGHV3-21 exon 1 [len=6000] (mis=0)
41-112 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=9)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
443-499 ==> 0-56 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
cdr3 = CARDSSSWGIYYYYYGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 73, 229, 376, 463
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.40 = CACCAGGTCGACCAGC-1

using 318 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^3, 4, 306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode CACCAGGTCGACCAGC-1 contig 1 = GAATCAGTCC...
umi CATACTGGGA = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-503 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.57 = CACCTTGAGACTGGGT-1

using 235 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^4, 3^2, 6, 209]
surviving nonsolo ucounts = 2[3, 209]
ids = [2, 3]

====================================================================================

UMI info for barcode CACCTTGAGACTGGGT-1 contig 1 = GGGGTCTCAG...
umi CGTGTATGGG = 3 reads: -196 +1 -1 +1 -5 +3 -1 +3 -2 +1 -1 +1 -1 +2 -1 +6 -1 +1 -1 +6 -1 +4 -1 +7 -1 +3 -10 +56 -70 non-validated
umi CGTTTAGGGG = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-579 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 205
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.66 = CACCTTGAGCGACGTA-1

using 36 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^2, 4, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.68 = CACCTTGAGCGTTTAC-1

using 17 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.70 = CACCTTGAGCTACCGC-1

using 103 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2, 3^3, 4, 5^2, 7, 68]
surviving nonsolo ucounts = 1[68]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=318]
0-80 ==> 273-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=6)
85-136 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
136-318 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARGSTSWYDYW at 69, score = 8 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 24
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.77 = CACCTTGAGGTACTCT-1

using 159 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 31
nonsolo ucounts = 13[2^5, 3^2, 4^2, 6^2, 7, 98]
surviving nonsolo ucounts = 1[98]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.79 = CACCTTGAGTAGCCGA-1

using 280 reads

====================================================================================

graph has 92 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 5, 13, 252]
surviving nonsolo ucounts = 1[252]
ids = [6]

====================================================================================

UMI info for barcode CACCTTGAGTAGCCGA-1 contig 1 = ATCACATAAC...
umi CTTCAGTTCA = 231 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=502]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
446-497 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CARKGGGSGSYYTHLYNWFDPW at 400, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.80 = CACCTTGAGTAGGCCA-1

using 1041 reads

====================================================================================

graph has 464 edges initially, 6 edges after simplification

total ucounts = 20
nonsolo ucounts = 13[2^5, 3, 4^2, 7, 223, 237, 249, 297]
surviving nonsolo ucounts = 4[223, 237, 249, 297]
ids = [1, 9, 18, 13]

====================================================================================

UMI info for barcode CACCTTGAGTAGGCCA-1 contig 1 = GGGGAGGAAC...
umi ACCGTGCACC = 225 reads: +382 validated
umi GAACGATCGT = 296 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 85 reads
cdr3 = CQQYNNWPETF at 357, score = 9 + 8
umis assigned: [1, 13]
of which 2 are surviving nonsolos
reads assigned: 514
start codons at 36, 105, 241, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.84 = CACCTTGAGTTGAGAT-1

using 331 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 10[2, 3^2, 4^4, 5, 7, 286]
surviving nonsolo ucounts = 1[286]
ids = [6]

====================================================================================

UMI info for barcode CACCTTGAGTTGAGAT-1 contig 1 = AGAGCTCTGG...
umi CGCTAATTGT = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
432-514 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYGSSPRVTF at 368, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 44, 252, 378, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.85 = CACCTTGAGTTGCAGG-1

using 104 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 94]
surviving nonsolo ucounts = 1[94]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=373]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-32 ==> 5705-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
31-373 ==> 0-342 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 31, 239, 365
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.94 = CACCTTGCAATAGAGT-1

using 46 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^3, 3, 4, 7, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.99 = CACCTTGCACACGCTG-1

using 281 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3^2, 265]
surviving nonsolo ucounts = 1[265]
ids = [6]

====================================================================================

UMI info for barcode CACCTTGCACACGCTG-1 contig 1 = AGAGCTGCTC...
umi GAATACCTCT = 266 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSFTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 31, 239, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.103 = CACCTTGCACATCTTT-1

using 350 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^2, 3, 4, 29, 302]
surviving nonsolo ucounts = 1[302]
ids = [12]

====================================================================================

UMI info for barcode CACCTTGCACATCTTT-1 contig 1 = GAAAACAGAG...
umi TGCCAATGTG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-589 ==> 0-162 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CSSWDSSLSAWVF at 360, score = 7 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 39, 178, 250, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.110 = CACCTTGCAGAAGCAC-1

using 50 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2^2, 3^3, 7, 8, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.111 = CACCTTGCAGACAAGC-1

using 301 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 291]
surviving nonsolo ucounts = 1[291]
ids = [4]

====================================================================================

UMI info for barcode CACCTTGCAGACAAGC-1 contig 1 = GCTCTGCTTC...
umi CGGTCATACA = 288 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=594]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-594 ==> 0-149 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.116 = CACCTTGCAGATGGGT-1

using 43 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^5, 4, 7, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.117 = CACCTTGCAGCAGTTT-1

using 15324 reads

====================================================================================

graph has 6136 edges initially, 78 edges after simplification

total ucounts = 887
nonsolo ucounts = 435[2^171, 3^89, 4^55, 5^31, 6^13, 7^11, 8^6, 9^5, 10^2, 11, 12, 14, 17, 31, 77, 80, 89, 97, 100, 102, 121, 122, 125, 137, 144, 152, 157, 175, 190, 201, 206^2, 220, 224, 229^2, 235, 259, 269, 275, 277, 281, 285, 296, 309, 315, 316, 329, 342, 345, 350, 377, 396, 413, 420, 535, 633, 651, 672, 690, 882]
surviving nonsolo ucounts = 44[77, 80, 89, 97, 100, 102, 121, 122, 125, 137, 152, 157, 175, 190, 201, 206^2, 220, 224, 229^2, 235, 259, 269, 275, 277, 281, 285, 309, 316, 329, 342, 345, 350, 377, 396, 413, 420, 535, 633, 651, 672, 690, 882]
ids = [752, 328, 849, 639, 203, 108, 870, 562, 622, 10, ...]

====================================================================================

UMI info for barcode CACCTTGCAGCAGTTT-1 contig 1 = TGGGGGATCA...
umi AAATGCACTT = 136 reads: +400 validated
umi AGGAGTGGCC = 205 reads: +400 validated
umi CACGATTGGA = 281 reads: +400 validated
umi CCAAAAGTTT = 284 reads: +400 validated
umi CCCTAGCCGT = 350 reads: +400 validated
umi CCTTGCGCAT = 235 reads: +400 validated
umi CGTCTATATG = 312 reads: +400 validated
umi CTACGTGGTT = 323 reads: +400 validated
umi CTAGTATTTA = 288 reads: +400 validated
umi CTCTCTTAAG = 342 reads: +400 validated
umi GAGATCGCGT = 275 reads: +400 validated
umi GCACTGAGCA = 220 reads: +400 validated
umi GTAGTACATC = 120 reads: +400 validated
umi TACTTCAGTA = 355 reads: +400 validated
umi TAGCTTCGGG = 236 reads: +400 validated
umi TTATAATTAG = 260 reads: +400 validated
umi TTGCAGGGCT = 232 reads: +400 validated

UMI info for barcode CACCTTGCAGCAGTTT-1 contig 2 = CGAGCCCAGC...
umi AAACGGTTTC = 159 reads: +436 validated
umi ACATGACATG = 273 reads: +427 -1 +5 -2 +1 non-validated
umi AGCTTTAGGG = 99 reads: +391 -1 +8 -1 +22 -13 non-validated
umi ATATCTATCC = 220 reads: +406 -1 +2 -1 +7 -1 +1 -17 non-validated
umi CAACCACCGT = 99 reads: +414 -2 +20 non-validated
umi CCATCGCGTG = 206 reads: +435 -1 non-validated
umi CGACGTAACA = 79 reads: +353 -1 +2 -1 +7 -1 +3 -1 +4 -1 +2 -1 +10 -7 +1 -1 +40 non-validated
umi GAACCTCCTG = 310 reads: +433 -3 non-validated
umi GTCTCTTCCT = 146 reads: +421 -15 non-validated
umi TACATTGGTA = 120 reads: +436 validated
umi TAGCAGTTCT = 96 reads: +436 validated
umi TCGATATCGG = 212 reads: +436 validated
umi TCTGGCAGTT = 188 reads: +436 validated
umi TGACACCGGC = 76 reads: +412 -24 non-validated
umi TTGATCGTTC = 89 reads: +406 -30 non-validated
umi TTTCTATCCT = 117 reads: +420 -16 non-validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 654 reads
cdr3 = CMQALQTPNLTF at 371, score = 9 + 9
umis assigned: [10, 111, 222, 266, 289, 320, 373, 388, 392, 414] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4388
start codons at 35, 68, 104, 192, 354, 374, 477
confident = true

TIG 2[bases=574]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=1)
446-503 ==> 6-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 40 reads
cdr3 = CARGAFSVVQGVNYYYGMDVW at 409, score = 9 + 7
umis assigned: [5, 59, 108, 158, 203, 275, 328, 446, 576, 622] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2443
start codons at 67, 218, 223, 281, 284, 370, 460
confident = true

REJECT CONTIGS

TIG 1[bases=589]
18-376 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
377-401 ==> 0-24 on |20|IGHD3-22|D-REGION| [len=31] (mis=3)
424-487 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
487-589 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [307, 424]
of which 2 are surviving nonsolos
reads assigned: 535
start codons at 18, 62, 241, 244, 324, 333, 385, 444, 505, 566
confident = false
full length stopped transcript of length 589
frameshifted full length stopped transcript of length 589
did not find CDR3

TIG 2[bases=497]
5-249 ==> 1857-2101 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
248-286 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
286-497 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [76, 80, 251, 472, 509, 535, 573, 867, 876]
of which 9 are surviving nonsolos
reads assigned: 5221
start codons at 98, 105, 176, 204
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAGAGGTGCTTTTTCTGTGGTTCAGGGAGTGAACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCGAACCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.126 = CACCTTGCAGGCAGTA-1

using 564 reads

====================================================================================

graph has 290 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 4, 8, 19, 190, 334]
surviving nonsolo ucounts = 3[19, 190, 334]
ids = [4, 6, 1]

====================================================================================

UMI info for barcode CACCTTGCAGGCAGTA-1 contig 1 = ACCCAAAAAC...
umi CTGACACCGC = 16 reads: +118 -6X +6 -6X +10 -10X +80 -75 +1 -1 +3 -1X +5 -1X +25 -1 +20 -7 +56 -4 invalidated
umi CTGGCACCGC = 187 reads: +436 validated

UMI info for barcode CACCTTGCAGGCAGTA-1 contig 2 = GGGAATCAGT...
umi CAGTCTTCAT = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=594]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-594 ==> 0-104 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4, 6]
of which 2 are surviving nonsolos
reads assigned: 199
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.128 = CACCTTGCAGTCAGAG-1

using 349 reads

====================================================================================

graph has 137 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^4, 331]
surviving nonsolo ucounts = 1[331]
ids = [4]

====================================================================================

UMI info for barcode CACCTTGCAGTCAGAG-1 contig 1 = AGGAATCAGT...
umi ATGTCATTAG = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.130 = CACCTTGCATCACAAC-1

using 292 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 57, 226]
surviving nonsolo ucounts = 2[57, 226]
ids = [3, 2]

====================================================================================

UMI info for barcode CACCTTGCATCACAAC-1 contig 1 = GCTCTGCTTC...
umi ACATTCTGGC = 229 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=532]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-532 ==> 0-87 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.139 = CACCTTGGTAATCACC-1

using 529 reads

====================================================================================

graph has 536 edges initially, 2 edges after simplification

total ucounts = 162
nonsolo ucounts = 61[2^32, 3^14, 4^7, 5^2, 6, 7^3, 8, 249]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.153 = CACCTTGGTCAAAGAT-1

using 329 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[329]
surviving nonsolo ucounts = 1[329]
ids = [0]

====================================================================================

UMI info for barcode CACCTTGGTCAAAGAT-1 contig 1 = AGGAATCAGT...
umi AGCCCTCCCT = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=7)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-514 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHKSYPFTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.156 = CACCTTGGTCATGCCG-1

using 44 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 7, 9, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.160 = CACCTTGGTCCCTACT-1

using 6974 reads

====================================================================================

graph has 4549 edges initially, 79 edges after simplification

total ucounts = 1170
nonsolo ucounts = 522[2^221, 3^120, 4^57, 5^42, 6^23, 7^17, 8^8, 9^3, 10^2, 11^3, 12, 16, 23, 26, 48, 54, 104, 147, 160^2, 175, 179^2, 183, 185, 196, 202, 206, 207, 225, 233, 275, 276, 313, 371, 529]
surviving nonsolo ucounts = 21[54, 104, 147, 160^2, 175, 179^2, 183, 185, 196, 202, 206, 207, 225, 233, 275, 276, 313, 371, 529]
ids = [186, 1137, 887, 307, 664, 316, 118, 170, 169, 369, ...]

====================================================================================

UMI info for barcode CACCTTGGTCCCTACT-1 contig 1 = AGCTTCAGCT...
umi ACGGGCGTTC = 181 reads: +385 validated
umi AGCCACGATT = 186 reads: +385 validated
umi AGCCACTCAT = 178 reads: +385 validated
umi AGTGCTAGGT = 275 reads: +385 validated
umi ATCGCTCGCA = 264 reads: +75 -1XX +64 -1XX +12 -1XX +9 -2XX +40 -1XX +67 -1XX +35 -1XX +31 -3X +1 -3XX +37 invalidated
umi ATGCAAGCCC = 193 reads: +385 validated
umi CAATACCCTA = 161 reads: +385 validated
umi CACCCCCGGC = 135 reads: +26 -1 +2 -12XX +1 -1XX +32 -1XX +64 -1XX +12 -1XX +9 -2XX +40 -1XX +67 -1XX +35 -1XX +29 -5X +1 -3X +6 -1 +30 invalidated
umi CAGCCAGCGG = 371 reads: +385 validated
umi CATTGATAGA = 189 reads: +75 -1XX +64 -1XX +12 -1XX +9 -2XX +40 -1XX +67 -1XX +35 -1XX +41 -2X +1 -1X +30 invalidated
umi CGGCCCCGCT = 207 reads: +385 validated
umi GCCGAGACGT = 158 reads: +385 validated
umi GGATATGCAT = 210 reads: +385 validated
umi GGGTCTCCGT = 224 reads: +385 validated
umi TATCACCCAC = 142 reads: +385 validated
umi TCCTTGACTA = 527 reads: +385 validated
umi TTTATGTTTG = 108 reads: +193 -1XX +191 invalidated
umi TTTTTTCCTC = 195 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=642]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
431-642 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 15 umis using 465 reads
cdr3 = CAAWDDSLSGVF at 367, score = 7 + 8
umis assigned: [118, 169, 170, 197, 243, 252, 307, 316, 337, 369] and 8 others
of which 18 are surviving nonsolos
reads assigned: 3786
start codons at 46, 200, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=439]
2-279 ==> 2212-2489 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=0)
305-368 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
368-439 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [445, 874]
of which 2 are surviving nonsolos
reads assigned: 583
start codons at 18, 34, 40, 68, 106, 287, 325
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.168 = CACCTTGGTGCGATAG-1

using 364 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^2, 3, 4, 6, 10, 329]
surviving nonsolo ucounts = 1[329]
ids = [7]

====================================================================================

UMI info for barcode CACCTTGGTGCGATAG-1 contig 1 = GATCAGGACT...
umi CGCTTGAGGG = 326 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=480]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-480 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.177 = CACCTTGGTTACCGAT-1

using 251 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 7, 233]
surviving nonsolo ucounts = 1[233]
ids = [9]

====================================================================================

UMI info for barcode CACCTTGGTTACCGAT-1 contig 1 = GATCAGGACT...
umi TCTACTGATT = 231 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=6)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-495 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CMQGTHWPGVTF at 366, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 30, 63, 91, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.181 = CACCTTGGTTCCGGCA-1

using 223 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 5, 212]
surviving nonsolo ucounts = 1[212]
ids = [2]

====================================================================================

UMI info for barcode CACCTTGGTTCCGGCA-1 contig 1 = AGCTTCAGCT...
umi ATCCTGGCTA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=591]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-591 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.199 = CACCTTGTCACATAGC-1

using 385 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 12[2^6, 3^3, 4, 5, 344]
surviving nonsolo ucounts = 1[344]
ids = [13]

====================================================================================

UMI info for barcode CACCTTGTCACATAGC-1 contig 1 = GAGGAATCAG...
umi CTCCTGGTCA = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.202 = CACCTTGTCAGCCTAA-1

using 267 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 4, 47, 205]
surviving nonsolo ucounts = 2[47, 205]
ids = [2, 10]

====================================================================================

UMI info for barcode CACCTTGTCAGCCTAA-1 contig 1 = CTCTCAGGAG...
umi TTTATTCTCT = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
35-396 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
423-493 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSTLVF at 359, score = 8 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 35, 192, 236, 243, 246
confident = false

REJECT CONTIGS

TIG 1[bases=346]
10-172 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
172-210 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
210-346 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 46
start codons at 35, 40, 153, 252
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 20.210 = CACCTTGTCATTTGGG-1

using 486 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^2, 3^2, 13, 139, 316]
surviving nonsolo ucounts = 2[139, 316]
ids = [11, 4]

====================================================================================

UMI info for barcode CACCTTGTCATTTGGG-1 contig 1 = AAAAACCACA...
umi TCCAGAATGG = 140 reads: +436 validated

UMI info for barcode CACCTTGTCATTTGGG-1 contig 2 = TGGGAGGAAT...
umi CACGACTATG = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-517 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 50, 248, 253, 270, 314, 347
confident = false

TIG 2[bases=495]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-495 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk020-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk020-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

6.726 seconds used processing barcodes, peak mem = 0.23
