[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.34 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk018-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk018-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk018.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.0 = CACATTTCAAGTAGTA-1

using 14242 reads

====================================================================================

graph has 7987 edges initially, 96 edges after simplification

total ucounts = 1382
nonsolo ucounts = 862[2^231, 3^165, 4^116, 5^78, 6^62, 7^44, 8^31, 9^25, 10^16, 11^17, 12^8, 13^10, 14^4, 15^3, 16^4, 17^4, 18, 19, 20^3, 25, 26, 35, 65, 95, 107, 114, 147, 169, 194^2, 195, 222, 223, 225, 239, 249, 251, 259^2, 267, 270, 272, 273, 280, 283, 284, 291, 309, 314, 319, 325, 334, 355, 361, 366, 422, 445, 792]
surviving nonsolo ucounts = 37[4, 26, 65, 95, 107, 114, 147, 169, 194^2, 195, 222, 223, 225, 239, 249, 251, 259^2, 267, 270, 272, 273, 283, 284, 291, 309, 314, 319, 325, 334, 355, 361, 366, 422, 445, 792]
ids = [891, 931, 716, 1068, 1292, 302, 1255, 420, 490, 989, ...]

====================================================================================

UMI info for barcode CACATTTCAAGTAGTA-1 contig 1 = AGGAGTCAGA...
umi AGCCAAGCCT = 221 reads: +388 validated
umi AGCCATAGTC = 229 reads: +388 validated
umi CGGACTTACA = 285 reads: +388 validated
umi GACCGTTTAT = 242 reads: +388 validated
umi GATAAGGTTG = 247 reads: +388 validated
umi TAAACCCGTT = 357 reads: +388 validated
umi TCGCTCTCCG = 224 reads: +388 validated
umi TCGGATGGGT = 280 reads: +388 validated
umi TGACCGGACG = 366 reads: +388 validated
umi TGCCCATCCA = 279 reads: +388 validated
umi TGTGGTCTCT = 146 reads: +388 validated
umi TTAATACTCA = 22 reads: -88 +1 -1X +3 -1XX +8 -1XX +10 -1XX +22 -1XX +3 -1XX +5 -4XX +4 -2XX +1 -2XX +1 -3XX +1 -224X invalidated
umi TTGTTGGAGC = 286 reads: +388 validated

UMI info for barcode CACATTTCAAGTAGTA-1 contig 2 = AGTGACTCCT...
umi AGATCCCCGT = 211 reads: +415 -9 non-validated
umi ATCATATTCT = 428 reads: +424 validated
umi CACTAAGTGC = 96 reads: +7 -1 +416 non-validated
umi CCCAGTTAGG = 171 reads: +424 validated
umi CCTACCTCCT = 175 reads: +424 validated
umi CCTATTCTCG = 270 reads: +424 validated
umi CTCATTCCTA = 221 reads: +424 validated
umi CTGGGGTCCT = 194 reads: +424 validated
umi GAGCCACCCT = 66 reads: +409 -15 non-validated
umi GCGTAGGAAC = 220 reads: +424 validated
umi GCTAAGTGGG = 301 reads: +290 -1XX +1 -1XX +131 invalidated
umi TAACCCATCA = 225 reads: +424 validated
umi TACCTAACGG = 161 reads: +424 validated
umi TATTGTGTAT = 359 reads: +424 validated
umi TCAATCTGCT = 446 reads: +424 validated
umi TCAGCCCCTT = 295 reads: +424 validated
umi TCAGTGCCCC = 96 reads: +424 validated
umi TCTAGTGTGT = 803 reads: +424 validated
umi TGCCCGCAAT = 326 reads: -254 +170 non-validated
umi TGTTGACTTT = 272 reads: +424 validated
umi TTAACAAATC = 253 reads: +424 validated
umi TTATGCCCAC = 94 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 490 reads
cdr3 = CQQYNSYPITF at 354, score = 8 + 8
umis assigned: [142, 144, 545, 706, 724, 960, 1116, 1122, 1175, 1196] and 3 others
of which 12 are surviving nonsolos
reads assigned: 3116
start codons at 27, 33, 89, 102, 334, 457
confident = true

TIG 2[bases=546]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=4)
381-444 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=1)
444-546 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 20 umis using 550 reads
cdr3 = CAHLRDYYYYYYMDVW at 365, score = 7 + 7
umis assigned: [134, 201, 302, 420, 490, 495, 618, 652, 716, 791] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5561
start codons at 20, 64, 243, 246, 326, 335, 401, 462, 523
confident = true
now this is a cell
paired!

GTGGACACAGCCACATATTACTGTGCACACTTGAGAGACTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.3 = CACATTTCAATAGCAA-1

using 79 reads

====================================================================================

graph has 59 edges initially, 4 edges after simplification

total ucounts = 25
nonsolo ucounts = 20[2^7, 3^5, 4^3, 5^2, 6, 7, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.9 = CACATTTCACAGGTTT-1

using 475 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 467]
surviving nonsolo ucounts = 1[467]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=491]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
6-58 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-82 ==> 0-49 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
78-321 ==> 102-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
318-355 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
355-491 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWLTF at 297, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 462
start codons at 33, 181, 184, 397
confident = false
not full
full length transcript of length 491
VJ delta = 70
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.13 = CACATTTCACCATCCT-1

using 239 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 7^2, 215]
surviving nonsolo ucounts = 1[215]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.18 = CACATTTCACTCGACG-1

using 3884 reads

====================================================================================

graph has 3744 edges initially, 64 edges after simplification

total ucounts = 1217
nonsolo ucounts = 724[2^205, 3^137, 4^107, 5^78, 6^56, 7^32, 8^31, 9^22, 10^13, 11^8, 12^10, 13^6, 14^6, 15^5, 16^2, 17, 19, 20, 21, 26, 36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.20 = CACATTTCAGATAATG-1

using 352 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 348]
surviving nonsolo ucounts = 1[348]
ids = [2]

====================================================================================

UMI info for barcode CACATTTCAGATAATG-1 contig 1 = GGAGGAACTG...
umi TTCACATCTT = 350 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.22 = CACATTTCAGCCACCA-1

using 553 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 6, 229, 314]
surviving nonsolo ucounts = 2[229, 314]
ids = [1, 0]

====================================================================================

UMI info for barcode CACATTTCAGCCACCA-1 contig 1 = GATCAGGACT...
umi CCGTAGGGTC = 229 reads: +397 validated

UMI info for barcode CACATTTCAGCCACCA-1 contig 2 = AACCACATCC...
umi AGTCCCGCGC = 285 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=483]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-483 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=497]
0-48 ==> 256-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
48-401 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=3)
419-469 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
469-497 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASRGGDIVEDAFDIW at 390, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 48, 204, 246, 312, 345, 421, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.30 = CACATTTCATAAGACA-1

using 620 reads

====================================================================================

graph has 302 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3^2, 4, 297, 303]
surviving nonsolo ucounts = 2[297, 303]
ids = [13, 7]

====================================================================================

UMI info for barcode CACATTTCATAAGACA-1 contig 1 = AGCTTCAGCT...
umi TCTCTCGTGT = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-537 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 47, 201, 351, 376, 381
confident = false

REJECT CONTIGS

TIG 1[bases=507]
0-254 ==> 99-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
278-325 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
325-507 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 243, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 52, 57, 204, 282
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.35 = CACATTTCATATGGTC-1

using 234 reads

====================================================================================

graph has 205 edges initially, 4 edges after simplification

total ucounts = 26
nonsolo ucounts = 19[2^2, 3^4, 4^2, 6^2, 7, 9^2, 10^4, 16, 110]
surviving nonsolo ucounts = 1[110]
ids = [1]

====================================================================================

UMI info for barcode CACATTTCATATGGTC-1 contig 1 = AAAAACCACA...
umi AATTCTAGCA = 109 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=486]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=16)
424-474 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
junction support: 1 umis using 10 reads
cdr3 = CARNFDLVAYGDALDMW at 392, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 50, 173, 201, 248, 253, 285, 314, 347, 420, 426, 437, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.36 = CACATTTCATCCGTGG-1

using 307 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 4, 5^2, 283]
surviving nonsolo ucounts = 1[283]
ids = [7]

====================================================================================

UMI info for barcode CACATTTCATCCGTGG-1 contig 1 = GGAATCAGTC...
umi TACTTCCGCT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=461]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-461 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.38 = CACATTTCATGCTAGT-1

using 222 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3^2, 5, 6, 199]
surviving nonsolo ucounts = 1[199]
ids = [3]

====================================================================================

UMI info for barcode CACATTTCATGCTAGT-1 contig 1 = ATCACATAAC...
umi GAGTACGCTC = 199 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=535]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-535 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 400, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.40 = CACATTTCATGGGAAC-1

using 298 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^2, 4^2, 5^2, 10, 260]
surviving nonsolo ucounts = 1[260]
ids = [3]

====================================================================================

UMI info for barcode CACATTTCATGGGAAC-1 contig 1 = ACAAGAGGCA...
umi ATTTTTATAT = 248 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=586]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
425-586 ==> 0-161 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSLSGLYVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 31, 185, 188, 239, 338, 365, 389, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.41 = CACATTTCATGTTCCC-1

using 918 reads

====================================================================================

graph has 366 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3^2, 5, 902]
surviving nonsolo ucounts = 1[902]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=305]
3-132 ==> 222-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
131-169 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
169-305 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQHNSYPFTF at 108, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 892
start codons at 211
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.44 = CACATTTCATTGGGCC-1

using 90 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3, 4, 6, 72]
surviving nonsolo ucounts = 1[72]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.45 = CACATTTCATTTGCCC-1

using 1862 reads

====================================================================================

graph has 2450 edges initially, 62 edges after simplification

total ucounts = 655
nonsolo ucounts = 345[2^110, 3^67, 4^49, 5^31, 6^23, 7^22, 8^8, 9^14, 10^5, 11^2, 12, 13, 14^4, 16^4, 18^2, 21, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.65 = CACATTTGTCCCTACT-1

using 631 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 620]
surviving nonsolo ucounts = 1[620]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.66 = CACATTTGTCCCTTGT-1

using 41 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 36]
surviving nonsolo ucounts = 1[36]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.70 = CACATTTGTCGCATCG-1

using 8768 reads

====================================================================================

graph has 3762 edges initially, 56 edges after simplification

total ucounts = 463
nonsolo ucounts = 237[2^89, 3^37, 4^28, 5^20, 6^10, 7^4, 8^2, 9^2, 10, 11^2, 12^3, 13^2, 14^2, 16, 17, 33, 61, 63, 77, 97, 102, 106, 110, 119, 126, 136, 152, 159, 171, 177, 205, 213, 218, 220, 226, 242, 248, 257, 261, 276, 297, 302, 330, 339, 483, 522, 568, 867]
surviving nonsolo ucounts = 31[61, 63, 77, 97, 102, 106, 110, 119, 126, 136, 152, 159, 171, 177, 205, 213, 218, 220, 226, 242, 248, 257, 261, 276, 297, 302, 330, 339, 483, 522, 568]
ids = [40, 295, 161, 404, 397, 437, 268, 333, 210, 288, ...]

====================================================================================

UMI info for barcode CACATTTGTCGCATCG-1 contig 1 = AAATTCAGGG...
umi AATACACCTT = 47 reads: -402 +8 -1X +4 invalidated
umi ATCCGTACGG = 180 reads: +415 validated
umi CGTTAAATGG = 127 reads: +415 validated
umi GATTGAGTGT = 171 reads: +415 validated
umi TAAATCTGCA = 141 reads: +415 validated
umi TCATCGAGTC = 478 reads: -193 +222 non-validated
umi TGGAACTACT = 260 reads: +415 validated
umi TTAGGTATTT = 287 reads: -258 +157 non-validated
umi TTCCTCATGT = 285 reads: +415 validated

UMI info for barcode CACATTTGTCGCATCG-1 contig 2 = TGAGCGCAGA...
umi AGAGCTACAA = 223 reads: +394 validated
umi CGTTGGTAGC = 213 reads: +394 validated
umi GGTTGACTAG = 95 reads: +37 -6XX +267 -2 +82 invalidated
umi TGCCCTGCGG = 103 reads: +394 validated
umi TGCCTGGCAC = 246 reads: -344X +1 -4XX +1 -6XX +38 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-64 ==> 0-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
64-417 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=3)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 197 reads
cdr3 = CASRTPPYDAFDIW at 406, score = 9 + 8
umis assigned: [40, 117, 210, 258, 323, 369, 409, 432, 442]
of which 9 are surviving nonsolos
reads assigned: 1949
start codons at 20, 43, 64, 108, 428, 431, 460
confident = true

TIG 2[bases=641]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 88 reads
cdr3 = CGTWDSSLSAGNWVF at 357, score = 7 + 8
umis assigned: [69, 214, 288, 397, 398]
of which 5 are surviving nonsolos
reads assigned: 857
start codons at 36, 190, 241, 365
confident = true

REJECT CONTIGS

TIG 1[bases=661]
0-60 ==> 26-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
0-60 ==> 5940-6000 on segment before IGLV6-57 exon 1 [len=6000] (mis=0)
52-93 ==> 5820-5861 on segment before IGLV2-34 exon 1 [len=6000] (mis=4)
60-413 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
412-450 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
450-661 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [7, 107, 130, 225, 268, 273, 295]
of which 6 are surviving nonsolos
reads assigned: 1945
start codons at 60, 123, 214, 265, 397, 412
confident = false
did not find CDR3

TIG 2[bases=567]
5-80 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [65, 80, 116, 135, 204, 226, 314]
of which 7 are surviving nonsolos
reads assigned: 2149
start codons at 35, 68, 104, 192, 354, 374, 473
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGCCGTACCCCTCCGTATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> CAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGCAATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.83 = CACATTTGTGTCCTCT-1

using 272 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[4, 10, 250]
surviving nonsolo ucounts = 1[250]
ids = [5]

====================================================================================

UMI info for barcode CACATTTGTGTCCTCT-1 contig 1 = GGAATCAGTC...
umi CTTAATTCGT = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-491 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.84 = CACATTTGTGTGACCC-1

using 2126 reads

====================================================================================

graph has 3024 edges initially, 20 edges after simplification

total ucounts = 932
nonsolo ucounts = 422[2^155, 3^96, 4^47, 5^43, 6^35, 7^15, 8^13, 9^7, 10^3, 11, 12^3, 13^2, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.92 = CACATTTGTTCCCTTG-1

using 641 reads

====================================================================================

graph has 516 edges initially, 6 edges after simplification

total ucounts = 91
nonsolo ucounts = 41[2^14, 3^7, 4^8, 5^5, 6, 7, 8, 10, 12, 149, 293]
surviving nonsolo ucounts = 2[149, 293]
ids = [26, 70]

====================================================================================

UMI info for barcode CACATTTGTTCCCTTG-1 contig 1 = CCCACTCAGG...
umi TCATCCACTG = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
17-368 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
405-484 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 344, score = 9 + 8
umis assigned: [70]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 17, 23, 92, 228, 447
confident = false

REJECT CONTIGS

TIG 1[bases=366]
11-258 ==> 106-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=52)
11-223 ==> 106-318 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=26)
284-332 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=7)
332-366 ==> 0-34 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CATAGGSGTNRHVYFDYW at 247, score = 9 + 7
umis assigned: [26, 42]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 61, 119, 122, 182, 208, 281
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.106 = CACATTTTCACCAGGC-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.109 = CACATTTTCAGTACGT-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.131 = CACATTTTCTCAAACG-1

using 73 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 4, 6, 8, 45]
surviving nonsolo ucounts = 1[45]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.144 = CACATTTTCTTCCTTC-1

using 551 reads

====================================================================================

graph has 922 edges initially, 4 edges after simplification

total ucounts = 279
nonsolo ucounts = 112[2^50, 3^25, 4^17, 5^9, 7^3, 8^3, 9^3, 11, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.151 = CACCACTAGACGCACA-1

using 98 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[21, 77]
surviving nonsolo ucounts = 2[21, 77]
ids = [1, 0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.158 = CACCACTAGCACGCCT-1

using 25 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.159 = CACCACTAGCAGACTG-1

using 194 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[190]
surviving nonsolo ucounts = 1[190]
ids = [3]

====================================================================================

UMI info for barcode CACCACTAGCAGACTG-1 contig 1 = GCTGGGGTCT...
umi CCAATAATAC = 180 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=490]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-391 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
432-490 ==> 0-58 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTCWVF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.162 = CACCACTAGCATGGCA-1

using 2915 reads

====================================================================================

graph has 3710 edges initially, 60 edges after simplification

total ucounts = 981
nonsolo ucounts = 482[2^190, 3^104, 4^58, 5^45, 6^27, 7^18, 8^11, 9^4, 10^8, 11^4, 12^3, 13^4, 15, 17, 19, 54, 212, 326]
surviving nonsolo ucounts = 3[54, 212, 326]
ids = [923, 325, 384]

====================================================================================

UMI info for barcode CACCACTAGCATGGCA-1 contig 1 = GTCAGTCCCA...
umi CCAATGTCCC = 216 reads: +385 validated
umi TTCCGGCCGG = 54 reads: +53 -3 +314 -15 non-validated

UMI info for barcode CACCACTAGCATGGCA-1 contig 2 = AGAGCTCTGG...
umi CCTTCTAACT = 330 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [325, 923]
of which 2 are surviving nonsolos
reads assigned: 264
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false

TIG 2[bases=562]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-381 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDRSWTF at 368, score = 9 + 8
umis assigned: [384]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 44, 378, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.164 = CACCACTAGCGCTTAT-1

using 164 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 18[2, 3^2, 4, 6^2, 7^3, 9^2, 11, 12, 13^2, 15, 18^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.166 = CACCACTAGCTAGTCT-1

using 579 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 236, 335]
surviving nonsolo ucounts = 1[335]
ids = [3]

====================================================================================

UMI info for barcode CACCACTAGCTAGTCT-1 contig 1 = GAAGAGCTGC...
umi CATCCACACC = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-519 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.176 = CACCACTAGTATGACA-1

using 789 reads

====================================================================================

graph has 252 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[276, 508]
surviving nonsolo ucounts = 2[276, 508]
ids = [6, 4]

====================================================================================

UMI info for barcode CACCACTAGTATGACA-1 contig 1 = TGGGGAGGAA...
umi TAATTGGAGA = 264 reads: +388 validated

UMI info for barcode CACCACTAGTATGACA-1 contig 2 = GCTGGGGTCT...
umi GTAACAACGG = 506 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-517 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 32, 38, 107, 243, 462
confident = false

TIG 2[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-389 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CSSYTSSSGWVF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 501
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.180 = CACCACTAGTCTTGCA-1

using 12 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.181 = CACCACTAGTGGACGT-1

using 170 reads

====================================================================================

graph has 56 edges initially, 6 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 162]
surviving nonsolo ucounts = 1[162]
ids = [0]

====================================================================================

UMI info for barcode CACCACTAGTGGACGT-1 contig 1 = AGCTTCAGCT...
umi TAACGCTGCC = 158 reads: +388 validated
umi TCTGCATCGG = 3 reads: -349X +3 -1XX +3 -1XX +2 -1XX +5 -1XX +7 -1XX +1 -1XX +12 invalidated

GOOD CONTIGS

TIG 1[bases=492]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-492 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.184 = CACCACTAGTTACGGG-1

using 215 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode CACCACTAGTTACGGG-1 contig 1 = AGCTGTGGGC...
umi GACAGTCTTC = 210 reads: +361 validated

GOOD CONTIGS

TIG 1[bases=499]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-363 ==> 0-323 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=9)
363-401 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
401-499 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CNSSVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.187 = CACCACTCAAATTGCC-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.189 = CACCACTCAAGCCGCT-1

using 604 reads

====================================================================================

graph has 880 edges initially, 16 edges after simplification

total ucounts = 293
nonsolo ucounts = 127[2^58, 3^34, 4^12, 5^10, 6^3, 7^6, 8^2, 9, 37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.191 = CACCACTCAATCACAC-1

using 97 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 93]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 18.194 = CACCACTCAATGGAGC-1

using 230 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 7, 213]
surviving nonsolo ucounts = 1[213]
ids = [4]

====================================================================================

UMI info for barcode CACCACTCAATGGAGC-1 contig 1 = AGCTTCAGCT...
umi TCGATACCAC = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-485 ==> 0-50 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk018-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk018-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7.640 seconds used processing barcodes, peak mem = 0.23
