[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.35 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk011-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk011-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk011.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.0 = AGCAGCCCAGGTGGAT-1

using 500 reads

====================================================================================

graph has 206 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 82, 187, 227]
surviving nonsolo ucounts = 2[187, 227]
ids = [4, 2]

====================================================================================

UMI info for barcode AGCAGCCCAGGTGGAT-1 contig 1 = GAGAGGAGCC...
umi CGGGTCCTGT = 227 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=539]
0-71 ==> 9-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
71-422 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=3)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
510-539 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARAEHVLRYFESVGPFSLDYW at 413, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 71, 222, 227, 285, 288, 306, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.2 = AGCAGCCCATCCTAGA-1

using 3584 reads

====================================================================================

graph has 2050 edges initially, 24 edges after simplification

total ucounts = 484
nonsolo ucounts = 178[2^90, 3^33, 4^17, 5^14, 6^6, 7^3, 8, 10^4, 14, 206, 223, 246, 288, 301, 315, 319, 403, 441]
surviving nonsolo ucounts = 9[206, 223, 246, 288, 301, 315, 319, 403, 441]
ids = [256, 354, 335, 179, 17, 189, 112, 220, 100]

====================================================================================

UMI info for barcode AGCAGCCCATCCTAGA-1 contig 1 = GACATGGGAA...
umi ACCAGGAGCA = 302 reads: +439 validated
umi CATCGAAGAT = 43 reads: -406X +1 -5XX +1 -2XX +3 -10XX +1 -2XX +1 -6XX +1 invalidated

UMI info for barcode AGCAGCCCATCCTAGA-1 contig 2 = AGAGCTCTGG...
umi CCAAATACAT = 319 reads: +385 validated
umi CGCCTTCTTT = 316 reads: +385 validated
umi CTAGTTATGG = 398 reads: +49 -1XX +3 -4XX +1 -2XX +1 -1XX +1 -7X +1 -288X +1 -13X +1 -5XX +2 -2XX +1 -1XX invalidated
umi CTTATGATCT = 207 reads: +385 validated
umi GTATTTTCTA = 249 reads: +385 validated
umi GTTGTCTCAC = 228 reads: +383 -2XX invalidated

GOOD CONTIGS

TIG 1[bases=553]
47-395 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=21)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
486-553 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARADTFSYDGYTYSGAFDVW at 392, score = 9 + 7
umis assigned: [17, 100]
of which 2 are surviving nonsolos
reads assigned: 340
start codons at 3, 47, 91, 417, 420, 447, 467
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 164 reads
cdr3 = CQQYVSSPRTF at 368, score = 9 + 8
umis assigned: [112, 189, 220, 256, 335, 354]
of which 6 are surviving nonsolos
reads assigned: 1692
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

TATTTCTGTGCGAGAGCCGATACATTTTCCTATGATGGTTATACTTACTCTGGCGCTTTTGATGTCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGTTAGCTCACCTAGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.9 = AGCAGCCCATTAACCG-1

using 5935 reads

====================================================================================

graph has 2372 edges initially, 46 edges after simplification

total ucounts = 401
nonsolo ucounts = 160[2^59, 3^25, 4^17, 5^10, 6^9, 7^4, 8^4, 9^3, 11, 12, 16, 18, 32, 33, 38, 111, 128, 133, 157, 159, 168, 179, 187, 189, 191, 193, 213, 219, 246, 270, 296, 309, 310, 328, 342, 368, 386]
surviving nonsolo ucounts = 23[32, 38, 111, 128, 133, 159, 168, 179, 187, 189, 191, 193, 213, 219, 246, 270, 296, 309, 310, 328, 342, 368, 386]
ids = [216, 123, 333, 141, 332, 64, 157, 346, 137, 316, ...]

====================================================================================

UMI info for barcode AGCAGCCCATTAACCG-1 contig 1 = GGGAGAGCCC...
umi ACGATCTGCT = 98 reads: +29 -2XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +319 -1 +19 invalidated
umi AGAACGAACG = 345 reads: +385 validated
umi CCCGTCGTCG = 17 reads: -373X +4 -1X +2 -1X +4 invalidated
umi CCCGTCGTCT = 124 reads: -354 +14 -5XX +4 -1XX +2 -1XX +4 invalidated
umi CCTGGTCTAG = 365 reads: +385 validated
umi CCTGTGATAC = 86 reads: +32 -2X +2 -1 +1 -5XX +1 -2XX +291 -1 +5 -1 +5 -1 +2 -1 +2 -1 +3 -1 +2 -1 +11 -1 +10 invalidated
umi CGTGGTGTAG = 170 reads: +385 validated
umi CTCGTGTACG = 272 reads: +385 validated
umi GACTTCGAGC = 220 reads: +385 validated
umi GCTCATGGAT = 310 reads: +385 validated
umi GCTGAAGAGT = 386 reads: +385 validated
umi GGAACCCAGC = 313 reads: +385 validated
umi GGCTGACTTG = 295 reads: +385 validated
umi TCCAGTAGTC = 101 reads: +32 -2XX +2 -1XX +1 -5XX +1 -2XX +200 -1X +82 -2 +2 -1 +2 -3 +8 -1 +37 invalidated
umi TCCTAACGTC = 191 reads: +385 validated
umi TCTCTTCTTC = 1 reads: -385 non-validated
umi TCTTTATCCT = 220 reads: +385 validated
umi TGATTTGTCA = 91 reads: +45 -1 +3 -1X +1 -1 +333 invalidated

GOOD CONTIGS

TIG 1[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 479 reads
cdr3 = CQQRSNWPPITF at 368, score = 9 + 8
umis assigned: [32, 45, 123, 124, 136, 137, 157, 175, 204, 240] and 8 others
of which 18 are surviving nonsolos
reads assigned: 3548
start codons at 47, 252, 255, 474
confident = true

REJECT CONTIGS

TIG 1[bases=528]
23-371 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=10)
394-457 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [64, 216, 389, 393]
of which 3 are surviving nonsolos
reads assigned: 469
start codons at 23, 67, 264, 290, 414
confident = false
frameshifted full length stopped transcript of length 528
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.11 = AGCAGCCCATTTCAGG-1

using 177 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [1]

====================================================================================

UMI info for barcode AGCAGCCCATTTCAGG-1 contig 1 = CAGTCCCAAC...
umi CCTGCGGTGA = 156 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=469]
27-275 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
409-469 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLHYDNRRRTF at 348, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 27, 83, 96, 235, 358, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.12 = AGCAGCCCATTTGCTT-1

using 1722 reads

====================================================================================

graph has 1519 edges initially, 18 edges after simplification

total ucounts = 418
nonsolo ucounts = 161[2^65, 3^36, 4^21, 5^15, 6^7, 7^5, 8, 10^3, 11^2, 12^2, 14, 16, 334, 543]
surviving nonsolo ucounts = 2[334, 543]
ids = [274, 223]

====================================================================================

UMI info for barcode AGCAGCCCATTTGCTT-1 contig 1 = GGGGAGGAAT...
umi GTGGATCTCC = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [274]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 31, 37, 106, 242, 461
confident = false

REJECT CONTIGS

TIG 1[bases=419]
0-79 ==> 5533-5612 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-79 ==> 0-49 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
78-250 ==> 188-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=7) [SHIFT!]
245-283 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
283-419 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [223]
of which 1 are surviving nonsolos
reads assigned: 533
start codons at 30, 63, 110, 209, 229, 236, 325
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.16 = AGCAGCCGTAAGAGGA-1

using 241 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 233]
surviving nonsolo ucounts = 1[233]
ids = [4]

====================================================================================

UMI info for barcode AGCAGCCGTAAGAGGA-1 contig 1 = TGGGGGGAGG...
umi TAACTCCTTC = 236 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=561]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYSTLALTF at 361, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 34, 40, 96, 109, 245, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.20 = AGCAGCCGTACTCTCC-1

using 833 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 7, 817]
surviving nonsolo ucounts = 1[817]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=398]
3-163 ==> 201-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
149-187 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
187-398 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLF at 126, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 809
start codons at 3, 10, 13
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.24 = AGCAGCCGTCATACTG-1

using 217 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode AGCAGCCGTCATACTG-1 contig 1 = TGAGCGCAGA...
umi AGATAGGTCG = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=470]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=6)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-470 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CGTWDSSLSTYVF at 357, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 36, 190, 241, 365, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.27 = AGCAGCCGTCCAGTTA-1

using 9 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.39 = AGCAGCCGTGGGTATG-1

using 253 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 12[2^5, 3^2, 4, 5, 8, 12, 205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode AGCAGCCGTGGGTATG-1 contig 1 = AGCTTCAGCT...
umi AGCCTTGCAG = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-541 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAVWDDSLNGVVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 47, 258, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.41 = AGCAGCCGTGTGAATA-1

using 230 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 224]
surviving nonsolo ucounts = 1[224]
ids = [3]

====================================================================================

UMI info for barcode AGCAGCCGTGTGAATA-1 contig 1 = GCTGGGGTCT...
umi TGCCTCTCGG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-509 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.44 = AGCAGCCGTGTTTGGT-1

using 7222 reads

====================================================================================

graph has 1766 edges initially, 18 edges after simplification

total ucounts = 252
nonsolo ucounts = 108[2^35, 3^11, 4^7, 5^2, 6^4, 7^2, 8^3, 10, 11^2, 13, 21, 23, 26, 35, 37, 43, 45, 50, 62, 73, 80, 89, 110, 113, 115, 125, 126, 138, 139, 144, 172, 182, 184, 188, 189, 194, 203, 204, 211, 218, 237, 242, 253, 259, 274, 303, 410, 425, 440, 448]
surviving nonsolo ucounts = 37[21, 26, 35, 37, 43, 45, 62, 73, 80, 89, 110, 113, 115, 125, 126, 138, 139, 144, 172, 182, 184, 188, 189, 194, 203, 204, 211, 218, 242, 253, 259, 274, 303, 410, 425, 440, 448]
ids = [204, 17, 60, 128, 244, 202, 82, 203, 245, 50, ...]

====================================================================================

UMI info for barcode AGCAGCCGTGTTTGGT-1 contig 1 = GGGATCACTC...
umi ACCTAATGGG = 179 reads: +406 validated
umi ACCTGTTGGG = 184 reads: +406 validated
umi AGCGTTGTGG = 205 reads: +406 validated
umi ATACCTTAGG = 34 reads: +321 -1 +84 non-validated
umi CACTAAGATT = 62 reads: +356 -3XX +1 -5X +1 -2 +2 -1 +12 -1 +15 -7 invalidated
umi CCTTGTGGCC = 116 reads: +406 validated
umi CTGCCTGGGT = 195 reads: +406 validated
umi TGTGGTACCC = 133 reads: +406 validated

UMI info for barcode AGCAGCCGTGTTTGGT-1 contig 2 = AGAGCTCTGG...
umi AACCGGGTAT = 305 reads: +385 validated
umi AAGGTATATG = 190 reads: +385 validated
umi AAGGTATATT = 27 reads: +251 -1 +38 -1 +73 -21 non-validated
umi AAGGTATGGA = 217 reads: +385 validated
umi ACGGGGCTAG = 246 reads: +385 validated
umi AGAAATGAAC = 112 reads: +385 validated
umi AGCCTTTGCT = 92 reads: +385 validated
umi ATGAGCTGGT = 24 reads: -357 +11 -5XX +4 -1XX +2 -1XX +4 invalidated
umi ATTAACCTGC = 193 reads: +385 validated
umi CACCGTCATA = 271 reads: +385 validated
umi CCAAGATCTG = 208 reads: +385 validated
umi CTGGTACGGT = 38 reads: +53 -12 +303 -17 non-validated
umi GCAACTACTG = 183 reads: +385 validated
umi GCATTTACCC = 428 reads: -263 +122 non-validated
umi GGACGGATCG = 252 reads: +385 validated
umi GGAGGGTTAA = 260 reads: +385 validated
umi TAAGAATGTT = 140 reads: +385 validated
umi TATTTTTTAC = 45 reads: +385 validated
umi TATTTTTTCC = 74 reads: +351 -5 +6 -1 +22 non-validated
umi TCGATACTGT = 109 reads: +385 validated
umi TGAGGGATGT = 145 reads: +385 validated
umi TGCCCAGCGC = 394 reads: -354X +14 -5XX +4 -1XX +2 -1XX +4 invalidated
umi TGCGCGCTAT = 129 reads: +385 validated
umi TTCACTGCAG = 114 reads: +385 validated
umi TTGGATGTCG = 173 reads: +385 validated
umi TTTAGGGGGG = 41 reads: -18 +337 -16 +14 non-validated
umi TTTCGGGGGG = 80 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
61-414 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=35)
421-467 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
467-565 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 7 umis using 116 reads
cdr3 = CVRRFLGFDSW at 403, score = 8 + 8
umis assigned: [33, 34, 53, 60, 82, 107, 123, 226]
of which 8 are surviving nonsolos
reads assigned: 1096
start codons at 61, 259, 264, 358, 521
confident = true

TIG 2[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 561 reads
cdr3 = CQHYHNWPPITF at 365, score = 9 + 8
umis assigned: [11, 16, 17, 18, 39, 46, 50, 67, 75, 81] and 17 others
of which 26 are surviving nonsolos
reads assigned: 4435
start codons at 44, 113, 186, 249, 471
confident = true

REJECT CONTIGS

TIG 1[bases=307]
49-118 ==> 6508-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=4)
125-307 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [9, 87, 204]
of which 3 are surviving nonsolos
reads assigned: 871
start codons at 79
confident = false
did not find CDR3
now this is a cell
paired!

AGTGGCCTGAGAGTTGAGGACACGGCCGTCTATTACTGTGTGAGGCGATTTTTGGGGTTCGACTCCTGGGGCCCGGGAACCCGGGTCAGCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCACTATCATAACTGGCCTCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.47 = AGCAGCCGTTATCGGT-1

using 229 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 224]
surviving nonsolo ucounts = 1[224]
ids = [3]

====================================================================================

UMI info for barcode AGCAGCCGTTATCGGT-1 contig 1 = TGGGGGCTTC...
umi TATCTACCCT = 220 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=582]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=5)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-582 ==> 0-137 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.48 = AGCAGCCGTTCAGACT-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.49 = AGCAGCCGTTCCAACA-1

using 1062 reads

====================================================================================

graph has 1207 edges initially, 18 edges after simplification

total ucounts = 417
nonsolo ucounts = 147[2^66, 3^30, 4^22, 5^11, 6^3, 7^2, 8^3, 9^3, 10^2, 11, 12^2, 13, 275]
surviving nonsolo ucounts = 1[275]
ids = [249]

====================================================================================

UMI info for barcode AGCAGCCGTTCCAACA-1 contig 1 = AGCTTCAGCT...
umi GCATTACCCT = 271 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=524]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-370 ==> 0-324 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=9)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-524 ==> 0-96 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CTAWDGSQRVF at 367, score = 7 + 8
umis assigned: [249]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 46, 257, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.51 = AGCAGCCGTTCCGGCA-1

using 323 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 316]
surviving nonsolo ucounts = 1[316]
ids = [5]

====================================================================================

UMI info for barcode AGCAGCCGTTCCGGCA-1 contig 1 = GGGAATCAGT...
umi TGTGCCCTCG = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.69 = AGCAGCCTCACGCATA-1

using 29057 reads

====================================================================================

graph has 8352 edges initially, 58 edges after simplification

total ucounts = 972
nonsolo ucounts = 408[2^141, 3^73, 4^34, 5^19, 6^12, 7^6, 8^4, 9^2, 10^2, 11^2, 12^2, 13^3, 15, 17^2, 18, 27, 67^2, 82, 83, 90, 94, 101, 103, 111, 119, 121, 124, 125^2, 134, 136, 145, 148, 153, 158, 160, 170, 172, 174, 186, 195, 205, 207^2, 213, 216, 217, 224, 228, 230, 232, 238, 239, 240, 244, 245, 246^2, 252^2, 253, 256, 259, 261, 267, 268, 271, 278^2, 279, 281, 283^2, 286^2, 290, 295^2, 306, 308, 315, 316, 318, 323^2, 325^2, 326, 332, 333, 335, 337, 339, 340, 341^2, 350^2, 352, 357, 360, 363, 366, 369, 370, 371, 375, 376, 378, 394, 405^2, 410, 413, 414, 465, 575, 604]
surviving nonsolo ucounts = 97[90, 101, 103, 119, 121, 124, 125^2, 134, 136, 145, 148, 153, 158, 160, 170, 172, 174, 186, 195, 205, 207^2, 213, 216, 217, 224, 228, 230, 232, 238, 239, 240, 244, 245, 246^2, 252^2, 253, 256, 259, 261, 267, 268, 271, 278^2, 279, 281, 283^2, 286^2, 290, 295^2, 306, 308, 315, 316, 318, 323^2, 325^2, 326, 332, 333, 335, 337, 339, 340, 341^2, 350^2, 352, 357, 360, 363, 366, 369, 370, 371, 375, 376, 378, 394, 405^2, 410, 413, 414, 465, 575, 604]
ids = [709, 493, 530, 843, 205, 875, 503, 624, 238, 952, ...]

====================================================================================

UMI info for barcode AGCAGCCTCACGCATA-1 contig 1 = AGTGCTTTCT...
umi AAGCATCCAA = 285 reads: +439 validated
umi AAGGACGGGA = 274 reads: +439 validated
umi ACTTGTTAAA = 171 reads: +439 validated
umi AGTCTTCAGG = 245 reads: +428 -5 +6 non-validated
umi ATAGCCCCCT = 267 reads: +439 validated
umi ATGCGGCCGT = 122 reads: +439 validated
umi ATGTCGCCCT = 394 reads: +439 validated
umi CAATCGTTAC = 242 reads: +439 validated
umi CAATTACTCT = 145 reads: -7 +432 non-validated
umi CACTCTCCTT = 350 reads: +439 validated
umi CATTCTGTCG = 175 reads: +439 validated
umi CGCTCGTTTT = 288 reads: +346 -1 +92 non-validated
umi CGTACCACAA = 255 reads: +439 validated
umi CTGCCGTTCT = 101 reads: +439 validated
umi CTGTCGGGTT = 161 reads: +387 -2 +50 non-validated
umi CTTCCAGCCA = 150 reads: +383 -38 +18 non-validated
umi CTTTCTCTAG = 106 reads: +439 validated
umi GAATAGCTAC = 277 reads: +193 -2X +243 -1 invalidated
umi GAGGCTAGAC = 204 reads: +439 validated
umi GCAACATGGT = 216 reads: +439 validated
umi GCAGATAATA = 262 reads: +439 validated
umi GGATTTCTTA = 171 reads: +439 validated
umi GTGCGGCGGA = 231 reads: +439 validated
umi TCAATTGGGC = 402 reads: +439 validated
umi TTGCTTCAAC = 240 reads: +439 validated
umi TTTTAACCTG = 457 reads: +439 validated

UMI info for barcode AGCAGCCTCACGCATA-1 contig 2 = TGGGGAGGAG...
umi AAATGTGGGT = 213 reads: +388 validated
umi AACATCTCCG = 294 reads: +388 validated
umi AAGATGCATT = 240 reads: +388 validated
umi AATCACGGTA = 328 reads: +388 validated
umi ACAGGTCCAC = 356 reads: +388 validated
umi ACCCCTTCTT = 284 reads: +388 validated
umi ACCTCATGAT = 282 reads: +388 validated
umi ACGTCTTCAA = 343 reads: +388 validated
umi ACTATCTTTC = 336 reads: +376 -1XX +1 -1XX +2 -3XX +2 -1XX +1 invalidated
umi AGCCATCTAG = 333 reads: +388 validated
umi AGTTAGCCAA = 272 reads: +388 validated
umi ATAATTGGGA = 306 reads: +388 validated
umi ATACTTACCG = 159 reads: +388 validated
umi ATTTTGGTCT = 241 reads: +388 validated
umi CAAATACAGG = 602 reads: +388 validated
umi CAACGGTGGC = 138 reads: +388 validated
umi CACACTATTA = 271 reads: +388 validated
umi CACGTTACTA = 345 reads: +388 validated
umi CAGCTCCGCC = 310 reads: +388 validated
umi CATTTAACGC = 417 reads: +388 validated
umi CCAAGATGGG = 335 reads: +388 validated
umi CCCGTGTTCG = 371 reads: +388 validated
umi CGCATTGGTC = 338 reads: +388 validated
umi CTAGACACCG = 373 reads: +388 validated
umi CTAGCCGAGG = 217 reads: +388 validated
umi CTCAACACGA = 346 reads: +388 validated
umi CTCCAACGGC = 318 reads: +388 validated
umi CTCTTCAAAA = 322 reads: +388 validated
umi CTCTTGGCTA = 370 reads: +388 validated
umi CTGCCAATCG = 371 reads: +388 validated
umi CTGCCGGGGC = 412 reads: +388 validated
umi CTGTGTAATT = 121 reads: +371 -1 +5 -1 +3 -1 +3 -1 +1 -1 non-validated
umi CTTGGCCCCG = 292 reads: +37 -1XX +350 invalidated
umi CTTGTAGGGC = 364 reads: +388 validated
umi GACATTCTTG = 148 reads: +388 validated
umi GACTCATTAT = 226 reads: +388 validated
umi GATGCTATCA = 207 reads: +388 validated
umi GATGTCAGGC = 230 reads: +388 validated
umi GCACTATCTA = 239 reads: +388 validated
umi GCTTTTCTAC = 230 reads: +388 validated
umi GGACACATCA = 125 reads: +388 validated
umi GGATCGTCAG = 322 reads: +388 validated
umi GGATGTCCGT = 324 reads: +388 validated
umi GGCCCGCTAG = 413 reads: +388 validated
umi GGCGCATGTC = 194 reads: +388 validated
umi GTCCTCCAGA = 252 reads: +388 validated
umi GTGCATATTC = 275 reads: +388 validated
umi GTGCTAGTCT = 257 reads: +388 validated
umi GTGGGGAGGT = 294 reads: +388 validated
umi TAATGCCCGT = 208 reads: +388 validated
umi TACATACCCT = 381 reads: +388 validated
umi TCAATTCGTT = 404 reads: +388 validated
umi TCCGACTGGG = 242 reads: +388 validated
umi TCCGGAATTA = 360 reads: +388 validated
umi TCTCAAGGGT = 334 reads: +388 validated
umi TCTGCCGGGT = 320 reads: +388 validated
umi TCTTACGAGC = 336 reads: +388 validated
umi TCTTTCCGTC = 120 reads: +388 validated
umi TGACTCCTCC = 339 reads: +345 -1XX +42 invalidated
umi TGGGTCAGGG = 123 reads: +388 validated
umi TGTCACCGTT = 371 reads: +388 validated
umi TGTCATAGTC = 302 reads: +388 validated
umi TTAAGGGATA = 286 reads: +388 validated
umi TTATGGCTTA = 244 reads: +388 validated
umi TTCAGGTTCT = 189 reads: +388 validated
umi TTGGACCGGT = 363 reads: +388 validated
umi TTGGGTTTGC = 348 reads: +388 validated
umi TTTACTTGCT = 137 reads: +388 validated
umi TTTGGCCATC = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=21)
422-456 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 25 umis using 470 reads
cdr3 = CARGTEQSGTIIIDSW at 377, score = 7 + 7
umis assigned: [30, 35, 129, 154, 170, 205, 214, 246, 249, 270] and 16 others
of which 26 are surviving nonsolos
reads assigned: 6083
start codons at 17, 38, 82, 168, 347
confident = true

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 67 umis using 3011 reads
cdr3 = CQQSDSSPRTF at 359, score = 9 + 8
umis assigned: [9, 18, 28, 45, 69, 81, 89, 106, 114, 137] and 59 others
of which 69 are surviving nonsolos
reads assigned: 19722
start codons at 32, 38, 94, 243, 462
confident = true
now this is a cell
paired!

GCGGACACGGCTGTGTATTGGTGTGCGAGGGGGACTGAGCAGTCTGGTACAATAATTATTGACTCTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTCGCAACTTACTACTGTCAACAGAGTGACAGTTCCCCCCGAACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.70 = AGCAGCCTCACTTACT-1

using 298 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[296]
surviving nonsolo ucounts = 1[296]
ids = [0]

====================================================================================

UMI info for barcode AGCAGCCTCACTTACT-1 contig 1 = GGGAGTCTCA...
umi ACGTTTGATG = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=447]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-447 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPLTF at 350, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 23, 29, 85, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.85 = AGCAGCCTCCCACTTG-1

using 10530 reads

====================================================================================

graph has 8709 edges initially, 228 edges after simplification

total ucounts = 1655
nonsolo ucounts = 1193[2^204, 3^144, 4^137, 5^99, 6^96, 7^73, 8^68, 9^73, 10^52, 11^45, 12^40, 13^37, 14^38, 15^16, 16^18, 17^13, 18^9, 19^7, 20^8, 21^2, 22, 27, 29, 32, 69, 79, 179, 205, 209, 214, 217, 261, 291, 309]
surviving nonsolo ucounts = 9[69, 79, 179, 209, 214, 217, 261, 291, 309]
ids = [137, 732, 215, 948, 1628, 1329, 1440, 1561, 674]

====================================================================================

UMI info for barcode AGCAGCCTCCCACTTG-1 contig 1 = AGAGGAGCCC...
umi ACTACTTCTG = 63 reads: +421 validated

UMI info for barcode AGCAGCCTCCCACTTG-1 contig 2 = GGGGTCACAA...
umi AGTATGTTCG = 177 reads: +388 validated
umi CGTTTGCTCG = 315 reads: +388 validated
umi GCTAAGGTTC = 211 reads: +388 validated
umi TCCGTCCGGT = 221 reads: +388 validated
umi TGGCACCACA = 263 reads: +388 validated
umi TTCTGATCCC = 292 reads: +388 validated
umi TTTCTCGACT = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-70 ==> 10-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
70-421 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=8)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 8 reads
cdr3 = CAKEGYSSGWGHFDYW at 412, score = 9 + 7
umis assigned: [137]
of which 1 are surviving nonsolos
reads assigned: 63
start codons at 70, 226, 284, 287, 373
confident = true

TIG 2[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 226 reads
cdr3 = CCSYAVSSTWVF at 362, score = 8 + 8
umis assigned: [215, 674, 948, 1329, 1440, 1561, 1628]
of which 7 are surviving nonsolos
reads assigned: 1663
start codons at 38, 177, 239, 246, 372
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAAAGAAGGGTATAGCAGTGGCTGGGGACACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTTCTGCTGCTCATATGCAGTTAGTAGCACTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.92 = AGCAGCCTCCTGCCAT-1

using 14 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.105 = AGCAGCCTCTACTCAT-1

using 24 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.125 = AGCAGCCTCTTCGGTC-1

using 281 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 274]
surviving nonsolo ucounts = 1[274]
ids = [2]

====================================================================================

UMI info for barcode AGCAGCCTCTTCGGTC-1 contig 1 = ATCCAACAAC...
umi GCGGAAATCC = 276 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=572]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-572 ==> 0-87 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 55, 211, 253, 319, 352, 442, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.131 = AGCATACAGACGACGT-1

using 138 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 6, 118]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.135 = AGCATACAGAGTACAT-1

using 142 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 128]
surviving nonsolo ucounts = 1[128]
ids = [2]

====================================================================================

UMI info for barcode AGCATACAGAGTACAT-1 contig 1 = GAGTCAGTCC...
umi CAAAGCCCTT = 119 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=479]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-479 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYDNLPPRLTF at 352, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 25, 31, 87, 100, 239, 362, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.137 = AGCATACAGATGGGTC-1

using 198 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 191]
surviving nonsolo ucounts = 1[191]
ids = [5]

====================================================================================

UMI info for barcode AGCATACAGATGGGTC-1 contig 1 = GATCAGGACT...
umi TACAGGCGGG = 192 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=488]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
424-488 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CMQGTHSVTF at 366, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 30, 63, 91, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.140 = AGCATACAGCAGCCTC-1

using 296 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[293]
surviving nonsolo ucounts = 1[293]
ids = [1]

====================================================================================

UMI info for barcode AGCATACAGCAGCCTC-1 contig 1 = AGTCTCAGTC...
umi GGGTGACGGT = 287 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
411-498 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQSYSTPPYTF at 347, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 20, 26, 82, 95, 231, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.144 = AGCATACAGCGTAGTG-1

using 353 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 347]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.149 = AGCATACAGGAGTTTA-1

using 2110 reads

====================================================================================

graph has 1580 edges initially, 51 edges after simplification

total ucounts = 464
nonsolo ucounts = 205[2^86, 3^43, 4^30, 5^10, 6^9, 7^7, 8^8, 9^3, 10^2, 11, 12, 14, 17, 243, 329, 540]
surviving nonsolo ucounts = 4[7, 243, 329, 540]
ids = [404, 371, 211, 97]

====================================================================================

UMI info for barcode AGCATACAGGAGTTTA-1 contig 1 = GAGAAGAGCT...
umi TCCCCTAGCA = 231 reads: +382 validated
umi TGCTAATCGG = 6 reads: -46 +56 -30 +56 -20 +115 -59 non-validated

GOOD CONTIGS

TIG 1[bases=497]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-190 ==> 0-155 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
190-380 ==> 158-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-497 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYGSSSFTF at 356, score = 8 + 8
umis assigned: [371, 404]
of which 2 are surviving nonsolos
reads assigned: 234
start codons at 35, 243, 336, 366, 459
confident = true
see deletion of 3 bases at pos 155 on |283|IGKV3-20|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.150 = AGCATACAGGCACATG-1

using 9051 reads

====================================================================================

graph has 4276 edges initially, 56 edges after simplification

total ucounts = 592
nonsolo ucounts = 262[2^89, 3^53, 4^40, 5^21, 6^12, 7^7, 8^5, 10^2, 11^2, 14, 15, 20, 24, 29, 33, 55, 155, 198, 202, 205, 217, 219, 243, 245, 257, 273, 284, 288, 299, 302, 311, 323, 327, 338, 357, 372, 438, 582, 636, 654]
surviving nonsolo ucounts = 24[33, 55, 155, 198, 202, 205, 217, 219, 243, 245, 257, 273, 284, 288, 299, 302, 323, 327, 338, 357, 372, 582, 636, 654]
ids = [157, 435, 303, 577, 367, 101, 36, 104, 168, 156, ...]

====================================================================================

UMI info for barcode AGCATACAGGCACATG-1 contig 1 = GAAGAGCTGC...
umi AAAACTTTGG = 327 reads: +385 validated
umi AAGTTGCCTA = 435 reads: +6 -1XX +7 -1XX +35 -1XX +1 -1XX +21 -1XX +10 -1XX +27 -1XX +39 -1XX +3 -8XX +1 -1X +6 -1XX +23 -1XX +13 -1XX +8 -1XX +20 -1XX +6 -1XX +44 -1XX +2 -1XX +12 -1XX +7 -1XX +15 -2XX +1 -1XX +1 -1XX +1 -2XX +1 -5XX +37 invalidated
umi ACAAATCGGC = 218 reads: +385 validated
umi CAAGCATGAA = 241 reads: +385 validated
umi CAATAACGAT = 32 reads: +74 -1 +310 non-validated
umi CACCCTGCAA = 237 reads: +385 validated
umi CACTGTACCA = 337 reads: +385 validated
umi CCGTTTAGGC = 252 reads: +385 validated
umi CCTTTCTTTC = 276 reads: +385 validated
umi GGAAAATATC = 204 reads: +385 validated
umi TAAGTTACAA = 307 reads: +385 validated
umi TCCAGACAGC = 326 reads: +385 validated
umi TCCTATGCTT = 640 reads: +385 validated
umi TTAGGTTCAG = 375 reads: +385 validated
umi TTGACCTGAA = 362 reads: +385 validated
umi TTTTCATCGG = 296 reads: +385 validated

UMI info for barcode AGCATACAGGCACATG-1 contig 2 = GATGCTTTCT...
umi ATAAGCTCGC = 204 reads: +454 validated
umi ATAGCCGCCA = 225 reads: +454 validated
umi CCCTAGCCGC = 477 reads: -421 +1 -3XX +1 -4XX +1 -1XX +1 -13XX +1 -2XX +1 -3XX +1 invalidated
umi CCTATTTCAG = 182 reads: +5 -1XX +3 -1XX +2 -2XX +6 -1XX +5 -1XX +20 -1XX +3 -1XX +4 -1XX +24 -1XX +7 -1XX +3 -1XX +3 -1XX +4 -1XX +8 -1XX +11 -1XX +20 -1XX +6 -1XX +6 -1XX +3 -1XX +4 -4XX +3 -1XX +3 -1XX +2 -1XX +4 -2XX +21 -1XX +20 -2XX +1 -1XX +3 -1XX +2 -1XX +7 -1XX +6 -1XX +10 -154 +7 -2XX +2 -1XX +11 -1XX +10 invalidated
umi CTCGTGAGCT = 286 reads: +454 validated
umi CTTTCGGGGG = 155 reads: +454 validated
umi TACCTGCGGT = 53 reads: -51 +403 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 678 reads
cdr3 = CQQYGSSEFTF at 357, score = 9 + 8
umis assigned: [1, 21, 36, 156, 157, 168, 174, 221, 234, 367] and 6 others
of which 15 are surviving nonsolos
reads assigned: 4749
start codons at 33, 241, 367, 460
confident = true

TIG 2[bases=653]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=10)
394-417 ==> 0-23 on |21|IGHD3-3|D-REGION| [len=31] (mis=4)
418-471 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
471-653 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 156 reads
cdr3 = CARQIFDFWSGSTWYFDLW at 383, score = 9 + 7
umis assigned: [101, 104, 209, 226, 281, 303, 435]
of which 6 are surviving nonsolos
reads assigned: 1525
start codons at 1, 17, 26, 38, 82
confident = true

REJECT CONTIGS

TIG 1[bases=652]
0-54 ==> 35-89 on segment before IGKV3OR2-268 exon 2 [len=221] (mis=1)
11-180 ==> 0-169 on rc of segment before IGKV3-7 exon 1 [len=169] (mis=0)
179-464 ==> 48-333 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=14)
478-516 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
516-652 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSEFTF at 455, score = 9 + 8
umis assigned: [577]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 22, 92, 147, 200, 339, 465, 558
confident = false
not full
VJ delta = 14
not full

TIG 2[bases=341]
52-209 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
207-270 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
270-341 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [497]
of which 1 are surviving nonsolos
reads assigned: 648
start codons at 59, 93, 132, 187, 227
confident = false
did not find CDR3
now this is a cell
paired!

GCTGTCTATTACTGTGCGAGACAAATTTTCGATTTTTGGAGTGGTTCCACTTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATCTTGCAGTGTATTACTGTCAGCAGTATGGTAGTTCAGAATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.151 = AGCATACAGGCTCTTA-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.154 = AGCATACAGTAACCCT-1

using 113 reads

====================================================================================

graph has 50 edges initially, 6 edges after simplification

total ucounts = 25
nonsolo ucounts = 19[3^2, 4^3, 5^2, 6^6, 7^5, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.160 = AGCATACAGTGTACTC-1

using 238 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^4, 226]
surviving nonsolo ucounts = 1[226]
ids = [4]

====================================================================================

UMI info for barcode AGCATACAGTGTACTC-1 contig 1 = AGGAGTCAGA...
umi AGTGTGCCCA = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-472 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.161 = AGCATACAGTTAGGTA-1

using 342 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.171 = AGCATACCACAACGCC-1

using 350 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [4]

====================================================================================

UMI info for barcode AGCATACCACAACGCC-1 contig 1 = AGACCCTGTC...
umi TAGCGGCCAC = 350 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=544]
0-26 ==> 27-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
26-371 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
380-408 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYYSYPRTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.176 = AGCATACCACCAACCG-1

using 386 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^4, 5, 7, 12, 31, 316]
surviving nonsolo ucounts = 2[31, 316]
ids = [15, 5]

====================================================================================

UMI info for barcode AGCATACCACCAACCG-1 contig 1 = GGGAGGAACT...
umi CGCTCTACAG = 316 reads: +379 validated
umi TTTACCAGGG = 3 reads: -240X +5 -1XX +11 -1XX +3 -1XX +1 -1XX +5 -1XX +20 -1XX +2 -2XX +4 -71 +1 -1X +4 -1X +2 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-374 ==> 0-339 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNLFTF at 356, score = 9 + 8
umis assigned: [5, 15]
of which 2 are surviving nonsolos
reads assigned: 313
start codons at 35, 240, 243, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.178 = AGCATACCACCCTATC-1

using 336 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[333]
surviving nonsolo ucounts = 1[333]
ids = [1]

====================================================================================

UMI info for barcode AGCATACCACCCTATC-1 contig 1 = GTTCAGGACT...
umi AAGTCATCCT = 335 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=1)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.181 = AGCATACCACTCGACG-1

using 5411 reads

====================================================================================

graph has 3249 edges initially, 30 edges after simplification

total ucounts = 557
nonsolo ucounts = 243[2^99, 3^54, 4^29, 5^16, 6^13, 7, 8^2, 9^3, 11^2, 13, 20, 21^2, 22, 84, 101, 119, 191, 192, 196^2, 202, 228, 235, 236, 237, 241, 250, 252, 265, 267, 292, 510]
surviving nonsolo ucounts = 19[20, 101, 119, 191, 192, 196^2, 202, 228, 235, 236, 237, 241, 250, 252, 265, 267, 292, 510]
ids = [9, 2, 16, 297, 117, 281, 469, 405, 276, 157, ...]

====================================================================================

UMI info for barcode AGCATACCACTCGACG-1 contig 1 = GAGCTCTGGG...
umi AAATTACTCT = 19 reads: +9 -1 +1 -1 +1 -4 +137 -31 +84 -49 +2 -1 +4 -1 +2 -1 +3 -2 +1 -1 +1 -1 +12 -1 +3 -1X +19 -59 invalidated
umi ATGTAACGGA = 189 reads: +352 -3X +1 -2X +1 -1X +1 -3X +2 -1 +2 -1 +1 -1 +2 -2 +2 -1 +1 -1 +2 -1 +3 -1 +5 -1 +4 -2 +2 -3 +1 -1 +3 -23 invalidated
umi GACATTGCAT = 241 reads: +415 -1 +1 -16 non-validated
umi GAGTTTGGCT = 230 reads: +430 -1 +1 -1 non-validated

UMI info for barcode AGCATACCACTCGACG-1 contig 2 = GGGGTCACAA...
umi AAACTGTTAC = 102 reads: +394 validated
umi AACTCATTAC = 120 reads: +394 validated
umi ACGCGCGGGT = 235 reads: +394 validated
umi AGCACTAGCA = 268 reads: +394 validated
umi CATGAACGAG = 236 reads: +394 validated
umi GCACAGCCAA = 150 reads: -10X +1 -1XX +1 -1XX +2 -1XX +1 -3XX +1 -1XX +1 -6XX +1 -9XX +2 -1XX +351 invalidated
umi GCCCAGCATA = 191 reads: +394 validated
umi GCTCAAAGGC = 250 reads: +394 validated
umi GGGGGCTTAG = 240 reads: +394 validated
umi TAGATTGGGG = 203 reads: +394 validated
umi TAGTTCCTTC = 262 reads: +394 validated
umi TCACAATCTA = 250 reads: +394 validated
umi TGCTACTTTC = 203 reads: +394 validated
umi TTAATACCAC = 300 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=516]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=5)
439-470 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=5)
465-513 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CAKVRGGAYDSSGYYYFDYW at 422, score = 9 + 7
umis assigned: [9, 117, 265, 276]
of which 4 are surviving nonsolos
reads assigned: 657
start codons at 80, 231, 236, 294, 297, 315, 383, 447
confident = true

TIG 2[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 431 reads
cdr3 = CCSYAGSSTFDVVF at 362, score = 8 + 8
umis assigned: [2, 16, 59, 81, 157, 281, 297, 309, 333, 405] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2954
start codons at 38, 177, 239, 246, 372, 393
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAAAGTCAGGGGGGGGGCCTATGATAGTAGTGGTTATTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTCGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.189 = AGCATACCAGCTCGCA-1

using 15168 reads

====================================================================================

graph has 4905 edges initially, 44 edges after simplification

total ucounts = 457
nonsolo ucounts = 195[2^62, 3^27, 4^23, 5^7, 6^8, 7^4, 8, 9^3, 10, 11^2, 12, 13, 15, 16^2, 17^2, 32, 65, 72, 88, 98, 116, 157, 176, 191, 213^2, 220, 225, 226, 237, 243, 248, 253, 264, 266, 275, 279, 282, 287^2, 290, 299, 300, 303, 309, 314, 315, 324, 326, 328^2, 329, 330, 332, 337, 343, 358, 382, 390, 391, 405, 424, 528, 602, 725]
surviving nonsolo ucounts = 47[88, 98, 116, 157, 176, 191, 213^2, 220, 225, 226, 237, 243, 248, 253, 264, 266, 275, 279, 282, 287^2, 290, 299, 300, 303, 309, 314, 315, 324, 326, 328^2, 329, 330, 332, 337, 343, 358, 382, 390, 391, 405, 424, 528, 602, 725]
ids = [326, 298, 304, 148, 45, 58, 358, 361, 340, 223, ...]

====================================================================================

UMI info for barcode AGCATACCAGCTCGCA-1 contig 1 = AGTGCTTTCT...
umi AACTCTGCCT = 302 reads: +442 validated
umi ACGTGGCCCT = 189 reads: +422 -20 non-validated
umi ACTACATTGG = 309 reads: +442 validated
umi AGCTCTGTCT = 205 reads: -378X +1 -4XX +1 -4XX +1 -5XX +1 -2XX +1 -7XX +37 invalidated
umi AGTATATTCG = 306 reads: -371X +1 -6XX +1 -4XX +1 -4XX +1 -5XX +1 -2XX +1 -7XX +37 invalidated
umi ATAGCTCTCC = 284 reads: +442 validated
umi ATGAAAATAC = 239 reads: +442 validated
umi CATTAATAGC = 279 reads: +442 validated
umi CCACACCTCG = 144 reads: +442 validated
umi CCGGAGTGAT = 293 reads: +442 validated
umi CTCAACCCTC = 335 reads: +442 validated
umi GACTTTATCC = 260 reads: +442 validated
umi GGTATCCCTT = 246 reads: +442 validated
umi GGTGATCCAT = 245 reads: +406 -1X +35 invalidated
umi GGTTCATCTA = 291 reads: +440 -1 +1 non-validated
umi GTCGTCTGCC = 98 reads: +431 -1 +10 non-validated
umi GTTCTAAGGT = 395 reads: +442 validated
umi TATGTAGTAA = 274 reads: +442 validated
umi TCAACAGAAT = 303 reads: +442 validated
umi TCAAGTCCAT = 355 reads: +442 validated
umi TCAGAGGACA = 206 reads: +442 validated
umi TCAGGATCTT = 256 reads: +277 -1XX +164 invalidated
umi TGTGTAATGC = 289 reads: +442 validated

UMI info for barcode AGCATACCAGCTCGCA-1 contig 2 = AGAGCTCTGG...
umi AACATCAATC = 223 reads: +385 validated
umi AACTGGCGCA = 341 reads: +385 validated
umi ACGCTACCCT = 321 reads: +385 validated
umi ATGGATTCAC = 273 reads: +385 validated
umi CACAACGTCT = 311 reads: +385 validated
umi CACGATGGGT = 381 reads: +385 validated
umi CCTTGGTATG = 723 reads: +385 validated
umi CGAACCTTAG = 334 reads: +385 validated
umi CTTTCATAGT = 330 reads: +385 validated
umi GAAACGTACC = 409 reads: +385 validated
umi GAGGGACTAC = 288 reads: +385 validated
umi GCGTGTTTTG = 268 reads: +385 validated
umi GTGTATTTGA = 119 reads: +385 validated
umi TAGGGGGATC = 2 reads: -237 +3 -3XX +6 -1XX +10 -1XX +11 -1XX +20 -92 invalidated
umi TCAGTACCGC = 216 reads: +385 validated
umi TTTGGATGAA = 386 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=530]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 21 umis using 516 reads
cdr3 = CARGRGGWYGGYYFDYW at 377, score = 9 + 7
umis assigned: [18, 58, 62, 75, 79, 90, 99, 139, 148, 160] and 13 others
of which 23 are surviving nonsolos
reads assigned: 6020
start codons at 17, 38, 82, 168
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 788 reads
cdr3 = CQQYGSSPFTF at 368, score = 9 + 8
umis assigned: [15, 20, 55, 104, 118, 123, 168, 170, 231, 233] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4861
start codons at 44, 252, 378, 471
confident = true

REJECT CONTIGS

TIG 1[bases=488]
13-285 ==> 2164-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
349-386 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
386-488 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [39, 45, 146, 161, 223, 274, 326, 341]
of which 8 are surviving nonsolos
reads assigned: 1896
start codons at 40, 46, 87, 323, 404, 465
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGGCCGCGGTGGCTGGTACGGTGGGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCCTTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.194 = AGCATACCAGTAACGG-1

using 225 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

UMI info for barcode AGCATACCAGTAACGG-1 contig 1 = GGGGATCAGT...
umi CGAGTTTTTG = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-362 ==> 0-335 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQHRTYPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 27, 33, 102, 184, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.201 = AGCATACCATCCGCGA-1

using 327 reads

====================================================================================

graph has 226 edges initially, 4 edges after simplification

total ucounts = 23
nonsolo ucounts = 17[2^2, 3^2, 4, 6^3, 7, 8, 9, 10^3, 12, 13, 210]
surviving nonsolo ucounts = 1[210]
ids = [6]

====================================================================================

UMI info for barcode AGCATACCATCCGCGA-1 contig 1 = GAGCTCTGGG...
umi CAATATTCCC = 209 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
468-516 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARESFAYCSADCHKYYFDYW at 422, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 80, 236, 287, 297, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.208 = AGCATACCATGTCGAT-1

using 171 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 166]
surviving nonsolo ucounts = 1[166]
ids = [1]

====================================================================================

UMI info for barcode AGCATACCATGTCGAT-1 contig 1 = TGGGGGTGCT...
umi CCATGCGGTT = 167 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=501]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
430-481 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
481-501 ==> 0-20 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 381, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 21, 42, 86, 172
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.209 = AGCATACCATTAGCCA-1

using 563 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[560]
surviving nonsolo ucounts = 1[560]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=408]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-79 ==> 0-49 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=1)
168-251 ==> 49-132 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=7) [SHIFT!]
247-272 ==> 13-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
272-408 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 553
start codons at 30, 63, 83, 90, 124, 127, 183, 314
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.211 = AGCATACCATTTGCCC-1

using 250 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[250]
surviving nonsolo ucounts = 1[250]
ids = [0]

====================================================================================

UMI info for barcode AGCATACCATTTGCCC-1 contig 1 = GAGTCAGTCT...
umi GAAATCATGG = 234 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=508]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-508 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTLPITF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 25, 31, 87, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.224 = AGCATACGTCGCATAT-1

using 293 reads

====================================================================================

graph has 149 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 289]
surviving nonsolo ucounts = 1[289]
ids = [0]

====================================================================================

UMI info for barcode AGCATACGTCGCATAT-1 contig 1 = AGTCTGGGCC...
umi CTTTGTGTCT = 276 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-383 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-486 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQVWDSSSDPYVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 40, 101, 239, 242, 338, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.226 = AGCATACGTCTGATCA-1

using 141 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[138]
surviving nonsolo ucounts = 1[138]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=438]
0-48 ==> 10-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
0-66 ==> 10074-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=6)
48-401 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=6)
cdr3 = CARGGW at 390, score = 9 + 4
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 48, 108, 199, 246, 283, 345
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.227 = AGCATACGTCTGCGGT-1

using 1063 reads

====================================================================================

graph has 1180 edges initially, 10 edges after simplification

total ucounts = 393
nonsolo ucounts = 150[2^74, 3^23, 4^20, 5^16, 6^8, 7^5, 8, 10, 18, 324]
surviving nonsolo ucounts = 1[324]
ids = [351]

====================================================================================

UMI info for barcode AGCATACGTCTGCGGT-1 contig 1 = AGGAGTCAGA...
umi TGTGTACTCG = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-497 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [351]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.228 = AGCATACGTCTGGTCG-1

using 317 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[22, 290]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.232 = AGCATACGTGGTGTAG-1

using 4484 reads

====================================================================================

graph has 2124 edges initially, 42 edges after simplification

total ucounts = 351
nonsolo ucounts = 157[2^47, 3^29, 4^20, 5^15, 6^15, 7^6, 8^2, 9^2, 10, 11, 15, 62, 72, 86, 97, 133, 155, 157, 161, 193, 202, 214, 222, 256, 265, 303, 320, 327, 527]
surviving nonsolo ucounts = 19[3, 15, 62, 72, 86, 97, 133, 155, 157, 193, 202, 214, 222, 256, 265, 303, 320, 327, 527]
ids = [282, 285, 91, 161, 18, 284, 26, 154, 190, 31, ...]

====================================================================================

UMI info for barcode AGCATACGTGGTGTAG-1 contig 1 = AGGAGTCAGT...
umi AATATCGCTG = 85 reads: -367 +1 -1X +7 invalidated
umi ACCATGCGAG = 195 reads: +363 -2 +11 non-validated
umi CACCATATAT = 223 reads: +376 validated
umi CGTTAAAGCC = 219 reads: +376 validated
umi CTGCCGTAGT = 154 reads: +376 validated
umi GAAGACAGTG = 72 reads: +376 validated
umi GGATTTTCTA = 165 reads: -336 +1 -2X +1 -1X +2 -1X +3 -1X +4 -2XX +8 -2XX +2 -1XX +1 -1XX +7 invalidated
umi GGTAATCTCT = 318 reads: +376 validated
umi GTCCAATGTC = 263 reads: +376 validated
umi GTGCTATTGC = 326 reads: -337X +1 -2XX +4 -1XX +7 -2XX +5 -3XX +1 -1XX +2 -1XX +1 -1XX +2 -1XX +4 invalidated
umi GTTTCATTGA = 332 reads: +376 validated
umi TCCATGCCAA = 100 reads: +22 -1XX +18 -1XX +6 -1XX +3 -1XX +9 -1XX +47 -1XX +13 -1XX +22 -1XX +6 -2XX +2 -2XX +5 -3XX +4 -1XX +7 -2XX +20 -1XX +1 -1XX +1 -1XX +3 -1XX +17 -1XX +1 -1XX +23 -1XX +3 -2XX +15 -1XX +3 -1XX +7 -1X +2 -49X +1 -2X +2 -1XX +2 -1XX +4 -2XX +8 -1XX +3 -1XX +1 -1XX +7 invalidated
umi TCGAATCACG = 200 reads: +376 validated
umi TTAGTGACCG = 266 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=539]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-363 ==> 0-336 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=8)
365-403 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 330 reads
cdr3 = CQQGFTF at 354, score = 9 + 8
umis assigned: [18, 31, 90, 140, 154, 161, 190, 199, 211, 215] and 4 others
of which 13 are surviving nonsolos
reads assigned: 2860
start codons at 27, 33, 89, 102, 238, 445
confident = true

REJECT CONTIGS

TIG 1[bases=418]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-86 ==> 5638-5696 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-418 ==> 0-34 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [282, 284, 285]
of which 3 are surviving nonsolos
reads assigned: 107
start codons at 40, 235, 242, 338, 383
confident = false
not full
VJ delta = 26
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.233 = AGCATACGTGTATGGG-1

using 89 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 54
nonsolo ucounts = 18[2^14, 3, 4, 9^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.242 = AGCATACGTTCGCGAC-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.244 = AGCATACGTTGCGTTA-1

using 518 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[249, 266]
surviving nonsolo ucounts = 2[249, 266]
ids = [1, 0]

====================================================================================

UMI info for barcode AGCATACGTTGCGTTA-1 contig 1 = AGCTTCAGCT...
umi ATGGTCCCTT = 266 reads: +388 validated
umi CAGGGTTTTG = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 79 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 505
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.249 = AGCATACTCACGACTA-1

using 523 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 253, 263]
surviving nonsolo ucounts = 2[253, 263]
ids = [6, 4]

====================================================================================

UMI info for barcode AGCATACTCACGACTA-1 contig 1 = GGAGTCTCCC...
umi TCGGAAGGCT = 239 reads: +433 validated

UMI info for barcode AGCATACTCACGACTA-1 contig 2 = GGGAGTCAGT...
umi TAAAGGCCTG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=24)
450-492 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
492-518 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARGARGTLPHYFYYDLDVW at 401, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 59, 233, 257
confident = false

TIG 2[bases=511]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-511 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYTTPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.250 = AGCATACTCACGGTTA-1

using 41 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 1[41]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.264 = AGCATACTCCGCGCAA-1

using 80 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 77]
surviving nonsolo ucounts = 1[77]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.288 = AGCATACTCTGGCGAC-1

using 219 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 211]
surviving nonsolo ucounts = 1[211]
ids = [3]

====================================================================================

UMI info for barcode AGCATACTCTGGCGAC-1 contig 1 = GCTCTGCTTC...
umi GGTGCGAAGA = 207 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=525]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-525 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.291 = AGCATACTCTTTAGGG-1

using 81 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[79]
surviving nonsolo ucounts = 1[79]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.298 = AGCCTAAAGAGGTACC-1

using 284 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 271]
surviving nonsolo ucounts = 1[271]
ids = [6]

====================================================================================

UMI info for barcode AGCCTAAAGAGGTACC-1 contig 1 = GAGAGAGGAG...
umi TACGTTTTTT = 267 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=598]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-598 ==> 0-101 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.302 = AGCCTAAAGATGAGAG-1

using 4865 reads

====================================================================================

graph has 3319 edges initially, 34 edges after simplification

total ucounts = 595
nonsolo ucounts = 294[2^103, 3^62, 4^39, 5^22, 6^12, 7^11, 8^11, 9^4, 10^2, 11^8, 12^2, 13^2, 16^2, 30, 170, 216, 218, 226, 235, 237^2, 240, 243, 248, 249, 330, 564]
surviving nonsolo ucounts = 13[170, 216, 218, 226, 235, 237^2, 240, 243, 248, 249, 330, 564]
ids = [403, 315, 566, 185, 489, 68, 527, 446, 283, 378, ...]

====================================================================================

UMI info for barcode AGCCTAAAGATGAGAG-1 contig 1 = AGAAGGGCTG...
umi CCACCACGCC = 572 reads: -113 +278 non-validated
umi CCTACTCCAT = 231 reads: +391 validated
umi GATTACACTG = 219 reads: +391 validated
umi GTAGTAGATA = 249 reads: +391 validated
umi GTATCGCCCT = 252 reads: +391 validated
umi TATGTCCGGA = 240 reads: +391 validated
umi TTAAACTGGG = 233 reads: +391 validated
umi TTGGTCTCCT = 218 reads: +391 validated

UMI info for barcode AGCCTAAAGATGAGAG-1 contig 2 = GAGCTCTGGG...
umi AGTCCTTTGG = 232 reads: +427 validated
umi CTTCGTTTCG = 236 reads: +427 validated
umi GTTCTTCAGA = 166 reads: +427 validated
umi TCTCTTAGGG = 233 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=665]
0-63 ==> 23-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
63-416 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=16)
416-454 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
454-665 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 394 reads
cdr3 = CQSYDGNNHVVF at 390, score = 6 + 8
umis assigned: [161, 185, 315, 378, 380, 446, 527, 566]
of which 8 are surviving nonsolos
reads assigned: 2167
start codons at 63, 217, 268, 400, 403, 415
confident = true

TIG 2[bases=596]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=28)
454-507 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
507-596 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 4 umis using 68 reads
cdr3 = CARDPRGSGWSDWYFGLW at 422, score = 8 + 7
umis assigned: [68, 283, 403, 489]
of which 4 are surviving nonsolos
reads assigned: 849
start codons at 80, 133, 231, 236, 294, 297, 383, 413, 561
confident = true
now this is a cell
paired!

ACGGCTATGTATTACTGTGCGCGAGATCCCCGGGGCAGTGGCTGGTCGGACTGGTACTTCGGTCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> TCTGGACTGAGGACTGAAGACGAGGCTGATTACTACTGTCAGTCTTATGATGGCAACAATCATGTGGTTTTCGGCGGGGGGACCAAGGTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.306 = AGCCTAAAGCCACCTG-1

using 185 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[181]
surviving nonsolo ucounts = 1[181]
ids = [3]

====================================================================================

UMI info for barcode AGCCTAAAGCCACCTG-1 contig 1 = ACAAGAGGCA...
umi TGGGCTCTGC = 161 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=528]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-528 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDINLIGVIF at 355, score = 7 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 31, 94, 185, 188, 239, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.308 = AGCCTAAAGCCCTAAT-1

using 249 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [3]

====================================================================================

UMI info for barcode AGCCTAAAGCCCTAAT-1 contig 1 = AGGAGTCAGA...
umi GTATACTGGA = 244 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-344 ==> 0-317 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=4)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CHHTNNFPRITF at 354, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.310 = AGCCTAAAGCGTAATA-1

using 450 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[445]
surviving nonsolo ucounts = 1[445]
ids = [1]

====================================================================================

UMI info for barcode AGCCTAAAGCGTAATA-1 contig 1 = GAGGAACTGC...
umi AATTTCACCG = 400 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=506]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=39)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-506 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CLQYYNYPRTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 396
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.323 = AGCCTAAAGTGCGATG-1

using 1504 reads

====================================================================================

graph has 2280 edges initially, 10 edges after simplification

total ucounts = 693
nonsolo ucounts = 290[2^110, 3^79, 4^27, 5^27, 6^17, 7^6, 8^6, 9^7, 10^2, 11, 12^3, 13, 14, 15^2, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.324 = AGCCTAAAGTGTGGCA-1

using 265 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [0]

====================================================================================

UMI info for barcode AGCCTAAAGTGTGGCA-1 contig 1 = CCACATCCCT...
umi CCCAAGTACT = 252 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=480]
42-395 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=66)
417-463 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
junction support: 1 umis using 28 reads
cdr3 = CGRDPDYGDFYLLDHW at 384, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 42, 262
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.327 = AGCCTAAAGTTTAGGA-1

using 452 reads

====================================================================================

graph has 114 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[7, 55, 385]
surviving nonsolo ucounts = 2[55, 385]
ids = [4, 5]

====================================================================================

UMI info for barcode AGCCTAAAGTTTAGGA-1 contig 1 = TCAGTCAGGA...
umi CTGCTATTAA = 1 reads: -2X +3 -2 +3 -1 +1 -2X +7 -2 +1 -2 +1 -2 +2 -1 +1 -2X +6 -1 +5 -341 invalidated
umi CTGGTATTAT = 50 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
16-369 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
367-404 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
404-468 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 6 reads
cdr3 = CQQSYTTLLTF at 343, score = 9 + 9
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 50
start codons at 16, 22, 78, 91, 227, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.331 = AGCCTAACAACACCTA-1

using 39499 reads

====================================================================================

graph has 12148 edges initially, 52 edges after simplification

total ucounts = 1418
nonsolo ucounts = 665[2^232, 3^127, 4^69, 5^39, 6^31, 7^16, 8^10, 9^10, 10, 11^5, 12, 13^4, 15, 17, 22, 55, 116, 125, 143, 145, 154, 162, 185, 190, 194, 204, 207, 215, 221, 228, 232, 238, 239, 240, 242, 246, 249, 251^2, 252, 256, 260, 264^2, 265, 268, 273, 274, 276, 277, 278, 280^2, 287^2, 288, 289, 290, 291^2, 293, 297, 298, 299, 302^3, 304^3, 305, 306, 307, 308^4, 309, 311, 316, 320^3, 326, 327^3, 332, 333, 337, 338, 339^2, 340, 342, 346, 348^2, 349^2, 350, 351^2, 353^3, 354, 363, 372^2, 375, 376, 379, 389, 390, 393, 395, 397, 403, 404, 405, 406, 407, 410, 416, 425, 436, 440, 462, 555, 765, 859]
surviving nonsolo ucounts = 114[116, 125, 145, 162, 185, 190, 194, 204, 207, 215, 221, 228, 232, 238, 239, 240, 242, 246, 249, 251^2, 252, 256, 260, 264^2, 265, 268, 273, 274, 276, 277, 278, 280^2, 287^2, 288, 289, 290, 291^2, 293, 297, 298, 299, 302^3, 304^3, 305, 306, 307, 308^4, 309, 311, 316, 320^3, 326, 327^3, 332, 333, 337, 338, 339^2, 340, 342, 346, 348^2, 349^2, 350, 351^2, 353^3, 354, 363, 372^2, 375, 376, 379, 389, 390, 393, 395, 397, 403, 404, 405, 406, 407, 410, 416, 425, 436, 440, 462, 555, 765, 859]
ids = [1162, 328, 1023, 467, 436, 366, 1170, 658, 1384, 363, ...]

====================================================================================

UMI info for barcode AGCCTAACAACACCTA-1 contig 1 = GGGAGAGCCC...
umi AACCGCCACA = 274 reads: +385 validated
umi AATCTTCTTT = 238 reads: +385 validated
umi ACATAACATT = 307 reads: +385 validated
umi ACATGTTCTC = 292 reads: +385 validated
umi ACCGACGGGG = 410 reads: +385 validated
umi ACCTTTGTTC = 353 reads: +385 validated
umi ACGGTCCTGT = 371 reads: +385 validated
umi ACTCCATTGA = 324 reads: +385 validated
umi ACTTCTTCAC = 400 reads: +385 validated
umi AGGCTTACGA = 346 reads: +385 validated
umi AGGGCTATCC = 392 reads: +385 validated
umi AGTCCTCTCA = 355 reads: +385 validated
umi ATACTCTAAC = 255 reads: +385 validated
umi ATCGCGCTTG = 438 reads: +385 validated
umi ATGCTTGCGC = 296 reads: +385 validated
umi ATTGATCTGT = 216 reads: +385 validated
umi CAACAGGGTC = 340 reads: +385 validated
umi CACATGTCTG = 361 reads: +385 validated
umi CACCCTTCTT = 303 reads: +385 validated
umi CACCGCCGCA = 292 reads: +385 validated
umi CACTTGCTAA = 185 reads: +385 validated
umi CACTTTACAC = 323 reads: +385 validated
umi CAGTATTCAA = 379 reads: +385 validated
umi CAGTTAATAC = 295 reads: +385 validated
umi CAGTTGTCAA = 344 reads: +385 validated
umi CATACGTTCA = 265 reads: +385 validated
umi CATGTCGTCT = 346 reads: +260 -1XX +124 invalidated
umi CCACGCAGTA = 349 reads: +385 validated
umi CCAGGGGTCT = 307 reads: +385 validated
umi CCATTCATAG = 311 reads: +385 validated
umi CCCCTTAGAC = 307 reads: +385 validated
umi CCGTGGAAAC = 275 reads: +385 validated
umi CCTCATAGCC = 306 reads: +385 validated
umi CGAATTACAC = 307 reads: +385 validated
umi CGCACATTAT = 308 reads: +385 validated
umi CGCTTGTTCT = 411 reads: +385 validated
umi CGGGCATTTC = 275 reads: +385 validated
umi CTACAAAGTT = 250 reads: +385 validated
umi CTAGCATTTA = 401 reads: +385 validated
umi CTCTCAGGGC = 411 reads: +385 validated
umi CTGTTTATAG = 305 reads: +385 validated
umi CTTAACGACG = 353 reads: +385 validated
umi CTTTATGATT = 298 reads: +385 validated
umi GAACATCCGC = 339 reads: +385 validated
umi GACAATCCTC = 350 reads: +385 validated
umi GACTCCCGGT = 289 reads: +385 validated
umi GATCGTCGTC = 434 reads: +385 validated
umi GATTTCGCCT = 269 reads: +385 validated
umi GCATATTCAA = 553 reads: +385 validated
umi GCATGCCCCT = 219 reads: +385 validated
umi GCCCAACCAC = 376 reads: +385 validated
umi GCCTCCACTG = 305 reads: +385 validated
umi GCGAATATGA = 338 reads: +385 validated
umi GCTCTATCTA = 465 reads: +385 validated
umi GCTTCCCTTA = 279 reads: +385 validated
umi GGAGTCATCT = 237 reads: +385 validated
umi GGCAGTCATC = 772 reads: +385 validated
umi GGCATGCCTT = 300 reads: +385 validated
umi GGGCTAGTTT = 283 reads: +175 -1XX +209 invalidated
umi GGTATTTACC = 394 reads: +385 validated
umi GGTTACTCCT = 327 reads: +385 validated
umi GTAACACTTT = 398 reads: +385 validated
umi GTACAAGGCC = 327 reads: +385 validated
umi GTACGTAATT = 301 reads: +385 validated
umi GTCCGATTCT = 340 reads: +385 validated
umi GTCTCGTTAT = 249 reads: +385 validated
umi GTGTACCCAG = 349 reads: +385 validated
umi GTTTCCGCGT = 311 reads: +385 validated
umi GTTTTTACGA = 289 reads: +385 validated
umi TAAATTACCT = 411 reads: +385 validated
umi TACACCATGG = 325 reads: +385 validated
umi TACCGCTAAT = 253 reads: +385 validated
umi TATCTCGCCT = 282 reads: +385 validated
umi TATGACCCAA = 296 reads: +385 validated
umi TCAACGACTC = 378 reads: +385 validated
umi TCATTACCAT = 324 reads: +385 validated
umi TCCATATATT = 364 reads: +385 validated
umi TCCCGGTATG = 195 reads: +385 validated
umi TCCGACGCGA = 308 reads: +385 validated
umi TCCGGTCTGC = 289 reads: +385 validated
umi TCCTGACGGT = 421 reads: +385 validated
umi TCGAATATAC = 289 reads: +385 validated
umi TCTACCCTTA = 274 reads: +385 validated
umi TCTACGTCAG = 302 reads: +385 validated
umi TCTTCATCTT = 319 reads: +385 validated
umi TCTTCTTCCG = 405 reads: +385 validated
umi TGAGCGAGAT = 356 reads: +385 validated
umi TGATCACATA = 336 reads: +385 validated
umi TGTCATTGAG = 357 reads: +385 validated
umi TTCAAACCAT = 350 reads: +385 validated
umi TTCAGACGCG = 393 reads: +385 validated
umi TTCATATCGA = 414 reads: +385 validated
umi TTCGCCATAC = 345 reads: +385 validated
umi TTGATATCCC = 377 reads: +385 validated
umi TTGGTAACGA = 203 reads: +385 validated
umi TTTCTCCGCA = 252 reads: +385 validated

UMI info for barcode AGCCTAACAACACCTA-1 contig 2 = AGCTCTGAGA...
umi AGCGCCAGGT = 219 reads: +433 validated
umi ATCGTGACAA = 117 reads: +433 validated
umi ATTGGTCCGG = 189 reads: +433 validated
umi CACTATACTT = 318 reads: +433 validated
umi CCTCTTAAGG = 693 reads: -386X +4 -3XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CGGGTCACTA = 255 reads: +418 -15 non-validated
umi CGTACTTGGG = 188 reads: +426 -7 non-validated
umi CTCACCCGTT = 328 reads: +433 validated
umi CTGACCGGCT = 257 reads: +418 -1 +14 non-validated
umi GGACAATCAT = 226 reads: +433 validated
umi GGCCCAGTGC = 213 reads: +405 -1 +27 non-validated
umi GGTTGATCGA = 213 reads: +433 validated
umi GTATAAGTTA = 307 reads: +433 validated
umi GTCGGTAAGT = 133 reads: +372 -1 +1 -1 +57 -1 non-validated
umi TATATCCCTT = 206 reads: +433 validated
umi TCCATCCCTT = 120 reads: +433 validated
umi TTGCACGCGG = 68 reads: -386X +4 -3XX +3 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated

GOOD CONTIGS

TIG 1[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 96 umis using 5040 reads
cdr3 = CQQRSNWPPITF at 368, score = 9 + 8
umis assigned: [42, 79, 111, 115, 135, 157, 172, 186, 206, 245] and 86 others
of which 96 are surviving nonsolos
reads assigned: 31248
start codons at 47, 252, 255, 474
confident = true

TIG 2[bases=614]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=2)
435-466 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=5)
466-512 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
512-614 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 11 umis using 159 reads
cdr3 = CARSPLYCSSTSCYGGGDYW at 421, score = 9 + 7
umis assigned: [230, 328, 366, 429, 597, 652, 658, 715, 740, 929] and 7 others
of which 17 are surviving nonsolos
reads assigned: 3984
start codons at 79, 235, 382, 461, 530, 591
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGATCACCCCTATATTGTAGTAGTACCAGCTGCTATGGGGGTGGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.333 = AGCCTAACAAGTTGTC-1

using 395 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[9, 10, 371]
surviving nonsolo ucounts = 1[371]
ids = [4]

====================================================================================

UMI info for barcode AGCCTAACAAGTTGTC-1 contig 1 = ACAAGAGGCA...
umi GAGATCTAGT = 345 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=575]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-575 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 31, 115, 188, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.334 = AGCCTAACAATACGCT-1

using 254 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode AGCCTAACAATACGCT-1 contig 1 = AGGAGTCAGA...
umi AAGCTAGTCA = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.335 = AGCCTAACAATCCAAC-1

using 256 reads

====================================================================================

graph has 81 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

UMI info for barcode AGCCTAACAATCCAAC-1 contig 1 = GATGCTTTCT...
umi CGCATACAAA = 245 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=564]
17-374 ==> 0-357 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=45)
419-465 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
465-564 ==> 0-99 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CAQSGSSLTSSSGFDDW at 383, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 1, 17, 26, 38, 82, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.348 = AGCCTAACACTACAGT-1

using 234 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [3]

====================================================================================

UMI info for barcode AGCCTAACACTACAGT-1 contig 1 = GGGAGAGGAG...
umi TCACTCAGCT = 226 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=624]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-403 ==> 0-330 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=27)
457-506 ==> 0-49 on |52|IGHJ3|J-REGION| [len=49] (mis=5)
506-624 ==> 0-118 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CASSRITVVQGVFGVGGFETW at 412, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 73, 298, 305, 373, 487, 560
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.358 = AGCCTAACAGGGTATG-1

using 329 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 322]
surviving nonsolo ucounts = 1[322]
ids = [1]

====================================================================================

UMI info for barcode AGCCTAACAGGGTATG-1 contig 1 = GCTGGGGTCA...
umi ACGTGTATAG = 321 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=575]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-575 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CCSYAGSRTPNWVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 41, 180, 242, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.359 = AGCCTAACAGTAACGG-1

using 9507 reads

====================================================================================

graph has 4244 edges initially, 48 edges after simplification

total ucounts = 722
nonsolo ucounts = 284[2^104, 3^62, 4^32, 5^27, 6^12, 7^4, 8^4, 10^3, 12, 15, 18, 21, 37, 72, 87, 90, 96, 120, 168, 169, 181, 183, 194, 202, 224, 229, 241, 255, 256, 262, 269, 270, 272, 286, 297, 309^2, 324, 325^2, 349, 400, 552, 831]
surviving nonsolo ucounts = 32[37, 72, 87, 90, 96, 120, 168, 169, 181, 183, 194, 202, 224, 229, 241, 255, 256, 262, 269, 270, 272, 286, 297, 309^2, 324, 325^2, 349, 400, 552, 831]
ids = [41, 16, 560, 681, 19, 504, 135, 205, 620, 634, ...]

====================================================================================

UMI info for barcode AGCCTAACAGTAACGG-1 contig 1 = AGCTGTGGGC...
umi AACTCAGGAA = 242 reads: +382 validated
umi AATCCTCCAC = 224 reads: +382 validated
umi AATTAGGTCT = 837 reads: -222X +160 invalidated
umi AATTCTAGGT = 259 reads: +382 validated
umi ATATAACAAC = 268 reads: +382 validated
umi CATTAAAAGA = 167 reads: +382 validated
umi CATTAGGCAT = 228 reads: +382 validated
umi CCGTGAGGAC = 257 reads: +382 validated
umi GATAATCGCT = 552 reads: +382 validated
umi TAAGCACAAC = 122 reads: +382 validated
umi TAGTCCCACT = 205 reads: +382 validated
umi TCAAAAACCA = 270 reads: +382 validated
umi TCGTCCATGC = 310 reads: +382 validated
umi TGCTGAAACC = 186 reads: +382 validated
umi TGTATCTGAC = 185 reads: +382 validated
umi TTAAGCTGCT = 298 reads: +382 validated
umi TTGATTTTTG = 289 reads: +382 validated

UMI info for barcode AGCCTAACAGTAACGG-1 contig 2 = TGGGGAATCC...
umi AAGCCTATTC = 72 reads: +436 -6 +3 non-validated
umi AAGTTCCGAA = 94 reads: -305 +95 -1 +1 -16 +2 -1 +1 -1 +1 -1X +20 invalidated
umi ACAAATGACA = 38 reads: +356 -33 +56 non-validated
umi AGGTCGGGGT = 353 reads: +445 validated
umi ATAAGACTGT = 269 reads: +445 validated
umi CATGTTCTTT = 326 reads: +47 -1XX +1 -2XX +1 -2XX +1 -18XX +1 -1XX +2 -1XX +1 -2XX +1 -24X +2 -1XX +2 -15XX +1 -4XX +1 -1XX +312 invalidated
umi CGCGATTATC = 320 reads: +445 validated
umi GCCATTCCGA = 169 reads: +445 validated
umi GCTAGTATCT = 216 reads: +445 validated
umi TGGTACAGAG = 350 reads: +445 validated
umi TGTTAAAACC = 329 reads: +445 validated
umi TTCTCTTATT = 89 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 17 umis using 839 reads
cdr3 = CNSRDSSGNHVVF at 355, score = 8 + 8
umis assigned: [11, 29, 34, 38, 116, 205, 209, 239, 379, 504] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4815
start codons at 40, 159, 188, 239, 338, 383
confident = true

TIG 2[bases=537]
21-379 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=4)
386-417 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=2)
416-466 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 248 reads
cdr3 = CARYLIGYYDFWSGYQTYGMDVW at 366, score = 7 + 7
umis assigned: [16, 19, 41, 100, 109, 203, 266, 401, 417, 632] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2585
start codons at 21, 177, 244, 247, 327, 336, 423
confident = true

REJECT CONTIGS

TIG 1[bases=644]
1-88 ==> 5924-6011 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
42-67 ==> 0-25 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
67-377 ==> 26-336 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=24) [SHIFT!]
374-394 ==> 0-20 on segment before IGLV3-4 exon 1 [len=986] (mis=0)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [135, 476, 560]
of which 3 are surviving nonsolos
reads assigned: 519
start codons at 42, 180, 192, 198, 242, 252, 320
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCACGATACCTCATCGGGTATTACGATTTTTGGAGTGGTTATCAAACCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.360 = AGCCTAACAGTTCCCT-1

using 268 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=478]
2-204 ==> 151-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=11)
246-296 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
296-478 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CAKVVAYFYDSRAKKTPCDAFDVW at 193, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 2, 7, 68, 154, 218, 248, 257, 277
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.364 = AGCCTAACATCCTAGA-1

using 660 reads

====================================================================================

graph has 674 edges initially, 4 edges after simplification

total ucounts = 168
nonsolo ucounts = 78[2^33, 3^15, 4^9, 5^10, 6^3, 7^2, 8^2, 9^2, 17, 290]
surviving nonsolo ucounts = 2[6, 290]
ids = [141, 151]

====================================================================================

UMI info for barcode AGCCTAACATCCTAGA-1 contig 1 = AAAAACCACA...
umi TTACCCTTCA = 279 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=552]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-552 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [151]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.365 = AGCCTAACATGGATGG-1

using 33 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 5, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.384 = AGCCTAAGTCATATGC-1

using 202 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode AGCCTAAGTCATATGC-1 contig 1 = CACATGGGAA...
umi CTAGCTGACC = 193 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=507]
0-47 ==> 17-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
47-400 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=0)
408-436 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=1)
436-489 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
junction support: 1 umis using 21 reads
cdr3 = CAREANQHIVVVIAIPDWYFDLW at 389, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 3, 26, 47, 91
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.386 = AGCCTAAGTCGCGGTT-1

using 327 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 323]
surviving nonsolo ucounts = 1[323]
ids = [1]

====================================================================================

UMI info for barcode AGCCTAAGTCGCGGTT-1 contig 1 = GCAGGAGTCA...
umi CAATTTCTTA = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=14)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQDYTYPWTF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 29, 35, 91, 104, 186, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.390 = AGCCTAAGTCTCCACT-1

using 16 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.399 = AGCCTAAGTTATGTGC-1

using 310 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 1[309]
ids = [1]

====================================================================================

UMI info for barcode AGCCTAAGTTATGTGC-1 contig 1 = GATCAGGACT...
umi GGTTTCTTAT = 310 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQALQIRETF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.400 = AGCCTAAGTTCCCTTG-1

using 643 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[312, 331]
surviving nonsolo ucounts = 2[312, 331]
ids = [0, 1]

====================================================================================

UMI info for barcode AGCCTAAGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi ATCATTAGGT = 312 reads: +363 -1XX +36 invalidated
umi GACCCCCCTT = 333 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 639
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.401 = AGCCTAAGTTCGAATC-1

using 302 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [2]

====================================================================================

UMI info for barcode AGCCTAAGTTCGAATC-1 contig 1 = GGAGTCAGAC...
umi TTTCTTCCGC = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
414-482 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYDGYSPTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.402 = AGCCTAAGTTCGTCTC-1

using 2303 reads

====================================================================================

graph has 1769 edges initially, 10 edges after simplification

total ucounts = 414
nonsolo ucounts = 188[2^70, 3^62, 4^18, 5^15, 6^5, 7^4, 8^2, 9, 11^2, 12^2, 16, 81, 136, 202, 333, 340, 367]
surviving nonsolo ucounts = 5[136, 202, 333, 340, 367]
ids = [264, 134, 242, 277, 405]

====================================================================================

UMI info for barcode AGCCTAAGTTCGTCTC-1 contig 1 = GAGCTACAAC...
umi CATATTATCG = 201 reads: -354X +46 invalidated
umi GGGTCTCACC = 339 reads: +400 validated
umi GTGGTCTTCC = 136 reads: +400 validated
umi TAATCTGTTC = 336 reads: +400 validated
umi TTTCTATCCT = 367 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 192 reads
cdr3 = CQQYYTTPVTF at 369, score = 9 + 8
umis assigned: [134, 242, 264, 277, 405]
of which 5 are surviving nonsolos
reads assigned: 1360
start codons at 30, 172, 472
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.404 = AGCCTAAGTTCTGTTT-1

using 1017 reads

====================================================================================

graph has 1480 edges initially, 12 edges after simplification

total ucounts = 463
nonsolo ucounts = 229[2^95, 3^63, 4^30, 5^16, 6^12, 7^4, 8^3, 9^3, 11, 12, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.406 = AGCCTAATCAACACCA-1

using 329 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.420 = AGCCTAATCCCAGGTG-1

using 96 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 13[2^2, 3^2, 4^2, 6, 7^2, 9^2, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.430 = AGCCTAATCGCACTCT-1

using 279 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode AGCCTAATCGCACTCT-1 contig 1 = GTGGGCTCAG...
umi CTTTGATGGA = 264 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=507]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-507 ==> 0-87 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.437 = AGCCTAATCGTCGTTC-1

using 145 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 133]
surviving nonsolo ucounts = 1[133]
ids = [5]

====================================================================================

UMI info for barcode AGCCTAATCGTCGTTC-1 contig 1 = GTAAGAGGTT...
umi CTATGGAGTC = 130 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=510]
0-19 ==> 9-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=0)
19-388 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=3)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-510 ==> 0-88 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CMIWHSSAWVF at 361, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 19, 161, 293, 305, 344, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.443 = AGCCTAATCTAGCACA-1

using 491 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 222, 263]
surviving nonsolo ucounts = 2[222, 263]
ids = [0, 3]

====================================================================================

UMI info for barcode AGCCTAATCTAGCACA-1 contig 1 = ACTTGGTGAT...
umi GATTGACCCT = 242 reads: +457 validated

UMI info for barcode AGCCTAATCTAGCACA-1 contig 2 = GGAGTCTCCC...
umi ACTGTATACA = 222 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=518]
0-35 ==> 44-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
35-388 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
388-416 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=3)
429-492 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
492-518 ==> 0-26 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARETYCGGDCYPENANAYYYYYGMDVW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 35, 191, 252, 270, 338, 449, 510
confident = false

TIG 2[bases=514]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=13)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
489-514 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARPGYSGAWSRRDTFNIW at 401, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 59, 233, 257, 392, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.445 = AGCCTAATCTGATACG-1

using 277 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 266]
surviving nonsolo ucounts = 1[266]
ids = [5]

====================================================================================

UMI info for barcode AGCCTAATCTGATACG-1 contig 1 = TGAGCGCAGA...
umi TTATCCTTAC = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=561]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-170 ==> 0-134 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
170-356 ==> 140-326 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=17)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-561 ==> 0-137 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CGTWDGSLRTGHYVF at 351, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 36, 184, 364, 388, 556
confident = false
see deletion of 6 bases at pos 134 on |331|IGLV1-51|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.446 = AGCCTAATCTGCAGTA-1

using 239 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 7, 226]
surviving nonsolo ucounts = 1[226]
ids = [3]

====================================================================================

UMI info for barcode AGCCTAATCTGCAGTA-1 contig 1 = GGGGATGCTT...
umi TACGCTACAC = 212 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=506]
20-377 ==> 0-357 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=45)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
468-506 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAQSGSSLTSSSGFDDW at 386, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 4, 20, 29, 41, 85, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.451 = AGCGGTCAGAAACGAG-1

using 32 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 1[28]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.453 = AGCGGTCAGACCACGA-1

using 260 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 251]
surviving nonsolo ucounts = 1[251]
ids = [3]

====================================================================================

UMI info for barcode AGCGGTCAGACCACGA-1 contig 1 = GTCATGGACC...
umi TCTTGAATCA = 219 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
3-374 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
391-439 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
439-564 ==> 0-125 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CARAHGDYYTLLDCW at 363, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 3, 24, 68, 154, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.464 = AGCGGTCAGATGCCAG-1

using 309 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCAGATGCCAG-1 contig 1 = GAGGAACTGC...
umi GCACCAGGAC = 306 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSKWPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.466 = AGCGGTCAGCAACGGT-1

using 298 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[296]
surviving nonsolo ucounts = 1[296]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCAGCAACGGT-1 contig 1 = TCTCCAAACA...
umi GGACGGGTTT = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-584 ==> 0-154 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.468 = AGCGGTCAGCAGCCTC-1

using 83 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3^2, 68]
surviving nonsolo ucounts = 1[68]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=445]
0-308 ==> 26-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
312-350 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
350-445 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQAWDSTEVVF at 289, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 268, 272
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.470 = AGCGGTCAGCATGGCA-1

using 208 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 4, 11, 186]
surviving nonsolo ucounts = 1[186]
ids = [3]

====================================================================================

UMI info for barcode AGCGGTCAGCATGGCA-1 contig 1 = TGAGCGCAGA...
umi ACAAAGCGTT = 1 reads: -43 +21 -3X +4 -1X +5 -2X +4 -1X +7 -1X +1 -1X +1 -1X +2 -293X invalidated
umi GATATCCGTT = 173 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=570]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-570 ==> 0-143 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CGTWDSSLSALYVF at 357, score = 7 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 36, 190, 241, 365, 391, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.471 = AGCGGTCAGCGACGTA-1

using 618 reads

====================================================================================

graph has 242 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[284, 331]
surviving nonsolo ucounts = 2[284, 331]
ids = [0, 3]

====================================================================================

UMI info for barcode AGCGGTCAGCGACGTA-1 contig 1 = GAACTGCTCA...
umi ATACCAGCTC = 286 reads: +385 validated

UMI info for barcode AGCGGTCAGCGACGTA-1 contig 2 = AATTAGGACT...
umi TGGATATCCC = 331 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 17-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
30-375 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQRSNWPPLTF at 351, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 235, 238, 457
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=0)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CMQATQFPLTF at 366, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.474 = AGCGGTCAGCGGCTTC-1

using 623 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[618]
surviving nonsolo ucounts = 1[618]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
2-216 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
216-254 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
254-465 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 184, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 608
start codons at 14, 17, 68, 167, 194, 218, 386
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.477 = AGCGGTCAGCTGATAA-1

using 303 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 294]
surviving nonsolo ucounts = 1[294]
ids = [3]

====================================================================================

UMI info for barcode AGCGGTCAGCTGATAA-1 contig 1 = GGAGTCAGTC...
umi ATTAACTGTT = 297 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPSF at 353, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 26, 32, 88, 101, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.478 = AGCGGTCAGCTGGAAC-1

using 226 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.479 = AGCGGTCAGGACCACA-1

using 95 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[3^2, 4^2, 5^2, 6^3, 7^2, 9, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.485 = AGCGGTCAGTACGTAA-1

using 350 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 8, 337]
surviving nonsolo ucounts = 1[337]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCAGTACGTAA-1 contig 1 = ACAACAGGCA...
umi CCCCACTGTT = 339 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
393-425 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYYGTPQTF at 364, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 25, 94, 347, 377, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.487 = AGCGGTCAGTATTGGA-1

using 519 reads

====================================================================================

graph has 266 edges initially, 18 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2, 5^2, 7, 10, 15, 228, 243]
surviving nonsolo ucounts = 2[228, 243]
ids = [11, 3]

====================================================================================

UMI info for barcode AGCGGTCAGTATTGGA-1 contig 1 = GCTCTGCTTC...
umi TTTTGTAGGC = 214 reads: +391 validated

UMI info for barcode AGCGGTCAGTATTGGA-1 contig 2 = GGGGGGTCTC...
umi CATATTGCGT = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=581]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-581 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 51, 205, 208, 259, 358, 385
confident = false

TIG 2[bases=570]
40-386 ==> 0-346 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=15)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
431-570 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CSSYTTSNDLEVF at 364, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 40, 197, 251, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.488 = AGCGGTCAGTCATGCT-1

using 252 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3^2, 7, 232]
surviving nonsolo ucounts = 1[232]
ids = [8]

====================================================================================

UMI info for barcode AGCGGTCAGTCATGCT-1 contig 1 = AAAAACCACA...
umi TGCACATACG = 218 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=578]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-578 ==> 0-92 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.490 = AGCGGTCAGTCCTCCT-1

using 14 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.497 = AGCGGTCCAACGATCT-1

using 10 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.506 = AGCGGTCCACACCGCA-1

using 14 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.516 = AGCGGTCCAGACGCAA-1

using 330 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 318]
surviving nonsolo ucounts = 1[318]
ids = [4]

====================================================================================

UMI info for barcode AGCGGTCCAGACGCAA-1 contig 1 = GAGTCAGTCT...
umi TAACATGTGC = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.521 = AGCGGTCCAGCAGTTT-1

using 261 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[5^3, 244]
surviving nonsolo ucounts = 1[244]
ids = [1]

====================================================================================

UMI info for barcode AGCGGTCCAGCAGTTT-1 contig 1 = TCAGCTTCAG...
umi ACCATGTAAC = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=576]
0-49 ==> 65-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
49-402 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-576 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASWDDSLRGRVF at 370, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 49, 203, 353, 378, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.524 = AGCGGTCCAGGTGGAT-1

using 303 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 298]
surviving nonsolo ucounts = 1[298]
ids = [3]

====================================================================================

UMI info for barcode AGCGGTCCAGGTGGAT-1 contig 1 = GGGAATCAGT...
umi GTTTCTATTG = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CLQHNSYPPTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 27, 33, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.526 = AGCGGTCCAGTCGTGC-1

using 250 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 5, 242]
surviving nonsolo ucounts = 1[242]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.532 = AGCGGTCCATCGGACC-1

using 321 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 311]
surviving nonsolo ucounts = 1[311]
ids = [5]

====================================================================================

UMI info for barcode AGCGGTCCATCGGACC-1 contig 1 = GCAGGAGTCA...
umi CTTAATGTTT = 316 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=559]
0-29 ==> 152-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
29-380 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQHYNSFFLRYIF at 356, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 29, 35, 91, 104, 240, 336, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.535 = AGCGGTCCATGTCTCC-1

using 63 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[3, 4^2, 5^2, 6^2, 7, 8, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.538 = AGCGGTCCATTGGTAC-1

using 161 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 156]
surviving nonsolo ucounts = 1[156]
ids = [1]

====================================================================================

UMI info for barcode AGCGGTCCATTGGTAC-1 contig 1 = ACCCAAAAAC...
umi CTAAGGGGCT = 137 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=540]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=19)
442-490 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
490-540 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKYYRDPYYHDSGAVDYW at 396, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.539 = AGCGGTCCATTTGCCC-1

using 538 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 175, 357]
surviving nonsolo ucounts = 2[175, 357]
ids = [5, 1]

====================================================================================

UMI info for barcode AGCGGTCCATTTGCCC-1 contig 1 = GGGTCAGTCC...
umi AGCTTTCCCT = 356 reads: +382 validated

UMI info for barcode AGCGGTCCATTTGCCC-1 contig 2 = GGGGTCACAA...
umi TTGCAGCCCG = 161 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 31, 87, 100, 239, 362, 455
confident = false

TIG 2[bases=512]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-512 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.545 = AGCGGTCGTAGTAGTA-1

using 325 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 321]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.546 = AGCGGTCGTATCGCAT-1

using 161 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

UMI info for barcode AGCGGTCGTATCGCAT-1 contig 1 = TCAGTCAGGA...
umi CGCATAGCCT = 137 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=410]
16-367 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 22 reads
cdr3 = CQQYDSFSWTF at 343, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 16, 22, 78, 91, 227, 230, 323, 353
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.547 = AGCGGTCGTATGAATG-1

using 352 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 340]
surviving nonsolo ucounts = 1[340]
ids = [6]

====================================================================================

UMI info for barcode AGCGGTCGTATGAATG-1 contig 1 = GGAGAAGAGC...
umi TGAAAACCGG = 345 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYDSSWTF at 360, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 36, 244, 247, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.554 = AGCGGTCGTCTGATTG-1

using 211 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 8, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCGTCTGATTG-1 contig 1 = CAGTCTCAGT...
umi CACTTTTCAG = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 2-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
21-374 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
370-409 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSYSTPYTF at 348, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 21, 27, 83, 96, 232, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.558 = AGCGGTCGTTAAAGTG-1

using 199 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[196]
surviving nonsolo ucounts = 1[196]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCGTTAAAGTG-1 contig 1 = AGTCCCAGTC...
umi TACCTAAAGG = 170 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=3)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
408-498 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQLNSYLFTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.563 = AGCGGTCGTTCCACTC-1

using 309 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^2, 3^2, 4^2, 5, 8, 11, 12, 14, 235]
surviving nonsolo ucounts = 1[235]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=452]
0-340 ==> 11-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
339-377 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
377-452 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNGQSRAF at 316, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 64, 200, 203, 296, 329, 419
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.564 = AGCGGTCGTTCCCTTG-1

using 68 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[68]
surviving nonsolo ucounts = 1[68]
ids = [0]

====================================================================================

UMI info for barcode AGCGGTCGTTCCCTTG-1 contig 1 = TCACCATGGA...
umi CTATGCATTC = 65 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=437]
5-358 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
363-414 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
414-437 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARGSTSWYDYW at 347, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 61
start codons at 5, 156, 203, 208, 240, 302
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.567 = AGCGGTCTCAAACCGT-1

using 150 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 142]
surviving nonsolo ucounts = 1[142]
ids = [1]

====================================================================================

UMI info for barcode AGCGGTCTCAAACCGT-1 contig 1 = GGGGGCTGGG...
umi CTTATTGAGA = 131 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
45-406 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
433-538 ==> 0-105 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTLVF at 369, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 45, 202, 246, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.568 = AGCGGTCTCAAAGACA-1

using 491 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 200, 282]
surviving nonsolo ucounts = 2[200, 282]
ids = [3, 1]

====================================================================================

UMI info for barcode AGCGGTCTCAAAGACA-1 contig 1 = GGAGTCAGTC...
umi CCAAATCTTA = 200 reads: +382 validated

UMI info for barcode AGCGGTCTCAAAGACA-1 contig 2 = ATCACATAAC...
umi AAGTCGATCA = 246 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=550]
32-280 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CLHYDNRRRTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 32, 88, 101, 240, 363, 419, 456
confident = false

TIG 2[bases=566]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-350 ==> 0-292 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=17)
438-488 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
488-566 ==> 0-78 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSHCGGGSCRPLSYGMDVW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 58, 209, 256, 355, 445, 542
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.571 = AGCGGTCTCACAGGCC-1

using 78 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 15[2^2, 3^3, 4^2, 5^3, 6, 7^3, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.572 = AGCGGTCTCACGATGT-1

using 245 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 6, 7^2, 218]
surviving nonsolo ucounts = 1[218]
ids = [2]

====================================================================================

UMI info for barcode AGCGGTCTCACGATGT-1 contig 1 = GGCACAAGAG...
umi CTCATCCTCT = 219 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=639]
0-34 ==> 17-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
34-390 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
428-639 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 358, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 34, 188, 191, 242, 341, 368, 392, 560
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.574 = AGCGGTCTCACTCCTG-1

using 985 reads

====================================================================================

graph has 1279 edges initially, 28 edges after simplification

total ucounts = 460
nonsolo ucounts = 155[2^61, 3^35, 4^17, 5^16, 6^6, 7^5, 8^5, 9, 10^2, 11, 12^2, 13, 17, 26, 74]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.579 = AGCGGTCTCATCATTC-1

using 128 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 119]
surviving nonsolo ucounts = 1[119]
ids = [1]

====================================================================================

UMI info for barcode AGCGGTCTCATCATTC-1 contig 1 = AGCTTCAGCT...
umi AGAGGGATTC = 116 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-555 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.589 = AGCGGTCTCGAATGGG-1

using 461 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 195, 262]
surviving nonsolo ucounts = 2[195, 262]
ids = [1, 4]

====================================================================================

UMI info for barcode AGCGGTCTCGAATGGG-1 contig 1 = GGGGTCACAA...
umi TTTATGTCAT = 265 reads: +388 validated

UMI info for barcode AGCGGTCTCGAATGGG-1 contig 2 = GTCTCCCTCA...
umi GTGATAATGA = 190 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CCSYAGSSTWVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 38, 177, 239, 246, 372
confident = false

TIG 2[bases=538]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
448-498 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
498-538 ==> 0-40 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CARQMSRQILLITAAVRGAFDMW at 398, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 56, 230, 254, 389, 410, 461, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.592 = AGCGGTCTCGCAAGCC-1

using 304 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [0]

====================================================================================

UMI info for barcode AGCGGTCTCGCAAGCC-1 contig 1 = AGGAATCAGA...
umi AATCGCTGTA = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=10)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYDSYPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 27, 33, 89, 102, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.598 = AGCGGTCTCGGAGGTA-1

using 194 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 186]
surviving nonsolo ucounts = 1[186]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=525]
7-89 ==> 0-82 on rc of segment before IGHV4-61 exon 1 [len=82] (mis=0)
89-399 ==> 46-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=18)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
488-525 ==> 0-37 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CAKKRPTYSINRVFYDASAFDIW at 388, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 5, 30, 38, 133, 254, 260, 469
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.603 = AGCGGTCTCGTTTAGG-1

using 951 reads

====================================================================================

graph has 1281 edges initially, 10 edges after simplification

total ucounts = 459
nonsolo ucounts = 171[2^63, 3^34, 4^37, 5^14, 6^9, 8^3, 9^5, 10, 11, 12^2, 13, 36]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.610 = AGCGGTCTCTGATTCT-1

using 480 reads

====================================================================================

graph has 206 edges initially, 36 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 212, 258]
surviving nonsolo ucounts = 2[212, 258]
ids = [0, 3]

====================================================================================

UMI info for barcode AGCGGTCTCTGATTCT-1 contig 1 = CACTCAGGAC...
umi ACGCGTCTTA = 257 reads: +388 validated

UMI info for barcode AGCGGTCTCTGATTCT-1 contig 2 = GTCTCAGTCA...
umi AAACAAAGAT = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
15-366 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
365-403 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 342, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 15, 21, 90, 226, 445
confident = false

TIG 2[bases=543]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYTTLLTF at 346, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.621 = AGCGTATAGACAGACC-1

using 249 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 243]
surviving nonsolo ucounts = 1[243]
ids = [3]

====================================================================================

UMI info for barcode AGCGTATAGACAGACC-1 contig 1 = AGGAATCAGT...
umi CGCGCTGTGC = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.623 = AGCGTATAGAGGTAGA-1

using 320 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 122, 190]
surviving nonsolo ucounts = 2[122, 190]
ids = [2, 0]

====================================================================================

UMI info for barcode AGCGTATAGAGGTAGA-1 contig 1 = GAGGAGTCAG...
umi CAAGGCTCCA = 184 reads: +388 validated

UMI info for barcode AGCGTATAGAGGTAGA-1 contig 2 = GGGGGGATCT...
umi CGCTTTGCTT = 115 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=499]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-499 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYSTPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 28, 34, 90, 103, 239, 458
confident = false

TIG 2[bases=486]
41-379 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
432-486 ==> 0-54 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CSSYTNSTTPGVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 41, 177, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.627 = AGCGTATAGATTACCC-1

using 368 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [2]

====================================================================================

UMI info for barcode AGCGTATAGATTACCC-1 contig 1 = GGAGAAGAGC...
umi TCGCTAACAT = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
392-424 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
424-510 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPGKTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.636 = AGCGTATAGGAATTAC-1

using 1431 reads

====================================================================================

graph has 2216 edges initially, 30 edges after simplification

total ucounts = 651
nonsolo ucounts = 306[2^126, 3^69, 4^43, 5^25, 6^14, 7^12, 8^8, 9^2, 10^4, 12, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.637 = AGCGTATAGGACTGGT-1

using 143 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATAGGACTGGT-1 contig 1 = CTCGGGACGT...
umi GCATACTTTT = 139 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=450]
17-357 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
411-450 ==> 0-39 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CCSEAGGGVPGLLF at 341, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 17, 171
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.639 = AGCGTATAGGATGTAT-1

using 11028 reads

====================================================================================

graph has 6492 edges initially, 82 edges after simplification

total ucounts = 1025
nonsolo ucounts = 531[2^189, 3^116, 4^57, 5^46, 6^36, 7^13, 8^15, 9^11, 11, 12^2, 13, 16^2, 17, 21, 42, 56, 77, 85^2, 95, 104, 112, 114, 116, 119, 124, 143, 165, 170, 171, 172, 174^2, 176, 190^2, 214, 215^3, 238, 241, 244, 253, 255, 264, 286, 308, 331, 348, 425, 438, 597, 765]
surviving nonsolo ucounts = 38[56, 77, 85^2, 95, 104, 112, 114, 116, 124, 143, 165, 170, 171, 172, 174^2, 176, 190^2, 214, 215^3, 238, 241, 244, 253, 255, 264, 286, 308, 331, 348, 425, 438, 597, 765]
ids = [331, 89, 107, 786, 589, 456, 191, 850, 274, 505, ...]

====================================================================================

UMI info for barcode AGCGTATAGGATGTAT-1 contig 1 = AGCTCTGGGA...
umi ACCTTGTTGA = 85 reads: +428 -11 non-validated
umi ACTACTTCGT = 250 reads: +439 validated
umi ATATCTACTT = 187 reads: +411 -2X +7 -1 +3 -1 +1 -1X +12 invalidated
umi CCAATGGCTT = 52 reads: +368 -71 non-validated
umi CGAAAGCTTC = 239 reads: +432 -7 non-validated
umi CTTACGCGCT = 103 reads: +439 validated
umi GCATTGGCTA = 192 reads: +439 validated
umi GCCCATTGCA = 154 reads: +67 -3XX +3 -2XX +2 -6XX +2 -28XX +1 -1XX +1 -1XX +1 -3XX +318 invalidated
umi GTGTTACGCT = 171 reads: +407 -2 +8 -5 +4 -13 non-validated
umi TACTCAAGGG = 163 reads: +439 validated
umi TCAATCACTG = 84 reads: +400 -39 non-validated
umi TCCTATTTGC = 168 reads: +439 validated
umi TCTGCAGGCT = 113 reads: -205X +37 -29 +168 invalidated

UMI info for barcode AGCGTATAGGATGTAT-1 contig 2 = CTGGGCCTCA...
umi AAAATGATTG = 170 reads: +379 validated
umi AAAATGGTCT = 598 reads: -342X +1 -1XX +3 -1XX +31 invalidated
umi ACATTAGAGT = 76 reads: +379 validated
umi ACGCGGGTGC = 255 reads: +379 validated
umi ATAGACCAGA = 111 reads: +379 validated
umi ATAGGTCTCC = 265 reads: +379 validated
umi ATATCATTTG = 763 reads: -341X +1 -2XX +3 -1XX +31 invalidated
umi ATTTAGTATG = 236 reads: +379 validated
umi CAATTACGCG = 115 reads: +379 validated
umi CCACGTGTGG = 218 reads: +379 validated
umi CCATTTTGTC = 216 reads: +379 validated
umi CGTTGCCCGC = 103 reads: +379 validated
umi CTCTACTCAT = 165 reads: +379 validated
umi GAGTACCTCG = 424 reads: -331 +1 -9XX +1 -2XX +3 -1XX +31 invalidated
umi GCGACTCTAA = 211 reads: +379 validated
umi GCGCCTTCAG = 92 reads: +379 validated
umi GGATGAACCA = 282 reads: +379 validated
umi GTTCCTCGCC = 439 reads: -324 +4 -13XX +1 -2XX +3 -1XX +31 invalidated
umi GTTGAGGCCT = 216 reads: +379 validated
umi TAACCCTACA = 254 reads: +379 validated
umi TACGTAGGTC = 170 reads: +379 validated
umi TAGGACCCGT = 175 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=590]
0-80 ==> 0-80 on |166|IGHV3-73|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |167|IGHV3-73|L-REGION+V-REGION| [len=359] (mis=4)
445-466 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=1)
468-519 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
519-590 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 81 reads
cdr3 = CTRVGFGIAAAGTNYGMDVW at 428, score = 8 + 7
umis assigned: [107, 119, 205, 331, 398, 505, 573, 577, 683, 736] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1914
start codons at 80, 236, 321, 360, 389, 476
confident = true

TIG 2[bases=627]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-375 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 18 umis using 501 reads
cdr3 = CQAWDSSTDVVF at 352, score = 6 + 8
umis assigned: [6, 7, 89, 112, 191, 197, 204, 248, 274, 335] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5479
start codons at 37, 42, 98, 185, 331, 335, 377
confident = true

REJECT CONTIGS

TIG 1[bases=535]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
13-68 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
22-88 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
41-217 ==> 0-176 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=1)
324-535 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [797, 882, 1005]
of which 3 are surviving nonsolos
reads assigned: 968
start codons at 41, 180, 269, 319
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTACCAGAGTGGGATTCGGTATAGCAGCAGCTGGTACCAACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCGGGACCCAGGCTATGGATGAGGCTGACTATTATTGTCAGGCGTGGGACAGCAGCACCGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.642 = AGCGTATAGTAAGTAC-1

using 294 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode AGCGTATAGTAAGTAC-1 contig 1 = GATCAGGACT...
umi AAGGAGTCCT = 274 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=452]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
427-452 ==> 0-25 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CMQALQTLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.649 = AGCGTATAGTCTCCTC-1

using 76 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 70]
surviving nonsolo ucounts = 1[70]
ids = [3]

====================================================================================

UMI info for barcode AGCGTATAGTCTCCTC-1 contig 1 = AGTGCTTTCT...
umi TATCCTTTAC = 65 reads: +426 -1 +33 non-validated

GOOD CONTIGS

TIG 1[bases=500]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-500 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.656 = AGCGTATAGTGTTTGC-1

using 1059 reads

====================================================================================

graph has 1360 edges initially, 12 edges after simplification

total ucounts = 390
nonsolo ucounts = 186[2^81, 3^47, 4^22, 5^12, 6^10, 7^2, 8^3, 10, 11^2, 12^4, 17, 209]
surviving nonsolo ucounts = 1[209]
ids = [317]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.658 = AGCGTATAGTTAGCGG-1

using 539 reads

====================================================================================

graph has 178 edges initially, 6 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[177, 361]
surviving nonsolo ucounts = 2[177, 361]
ids = [0, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=428]
0-249 ==> 111-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
254-292 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
292-428 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPPGFTF at 225, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 46, 208, 228, 334
confident = false
not full
VJ delta = 14
not full

TIG 2[bases=497]
0-34 ==> 63-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
7-59 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
34-83 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
79-325 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=2)
322-361 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
361-497 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 34, 185, 403
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.659 = AGCGTATAGTTCGCGC-1

using 199 reads

====================================================================================

graph has 67 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATAGTTCGCGC-1 contig 1 = GAGTCAGACC...
umi AAGTCCCTTC = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=423]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 33 reads
cdr3 = CQQYNSYSPTF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 25, 31, 87, 100, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.663 = AGCGTATCAAGAAGAG-1

using 9776 reads

====================================================================================

graph has 4781 edges initially, 85 edges after simplification

total ucounts = 1082
nonsolo ucounts = 641[2^184, 3^118, 4^91, 5^68, 6^39, 7^28, 8^20, 9^17, 10^14, 11^14, 12^4, 13^4, 14^3, 15^2, 16, 17^2, 20, 22, 24, 27, 42, 53, 54, 130, 152, 164, 177, 195, 204, 219^2, 231, 237^2, 239, 245, 254, 257, 260, 277, 281, 287, 288, 294, 296, 313, 444, 508]
surviving nonsolo ucounts = 27[27, 54, 130, 152, 164, 177, 195, 204, 219^2, 231, 237^2, 239, 245, 254, 257, 260, 277, 281, 287, 288, 294, 296, 313, 444, 508]
ids = [466, 489, 104, 264, 5, 977, 281, 855, 64, 555, ...]

====================================================================================

UMI info for barcode AGCGTATCAAGAAGAG-1 contig 1 = GGGGTCACAA...
umi AAAACTTCCT = 233 reads: +373 validated
umi AACAGCTTGC = 287 reads: +373 validated
umi AATTTGTATT = 296 reads: +373 validated
umi ACCCCCACTC = 224 reads: +216 -1XX +156 invalidated
umi ACTTGCCTGC = 127 reads: +373 validated
umi ATATTACCTT = 238 reads: +373 validated
umi CAAATCCTTT = 508 reads: -126X +247 invalidated
umi CATACAAATA = 156 reads: +373 validated
umi CATCAACTGA = 195 reads: +373 validated
umi CCAATATCAA = 278 reads: +373 validated
umi CCGACTCTCT = 261 reads: +373 validated
umi CCTATAATCC = 315 reads: +373 validated
umi CTAGGTCCAA = 56 reads: +373 validated
umi CTGTTCGTCA = 244 reads: +373 validated
umi GAAAAGTATT = 219 reads: +373 validated
umi GATCATAAAG = 288 reads: +373 validated
umi GGTTGGCCAT = 442 reads: +373 validated
umi GTCGCGCCCG = 229 reads: +373 validated
umi GTTTGAGAAA = 289 reads: +373 validated
umi TCCCATCTCA = 210 reads: +373 validated
umi TCTTTGCCTT = 274 reads: +373 validated
umi TGTGCCTTAT = 238 reads: +373 validated
umi TGTGTTTTGG = 176 reads: +373 validated
umi TTAGGCTCAG = 278 reads: +373 validated

UMI info for barcode AGCGTATCAAGAAGAG-1 contig 2 = GAGTCTCCCT...
umi AAATCGTCGC = 164 reads: +421 validated
umi CGTTATCTAG = 24 reads: -9 +267 -1 +11 -1 +1 -1 +4 -1 +1 -45 +74 -1 +2 -1 +1 non-validated
umi GGAATGGTAT = 23 reads: -383X +1 -4XX +3 -1XX +2 -8XX +1 -2XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated

GOOD CONTIGS

TIG 1[bases=622]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-173 ==> 0-135 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=1)
173-363 ==> 150-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=18)
373-411 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
411-622 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 24 umis using 1145 reads
cdr3 = CSSNAGTTTLLF at 347, score = 7 + 9
umis assigned: [1, 7, 42, 64, 104, 156, 205, 264, 281, 308] and 14 others
of which 24 are surviving nonsolos
reads assigned: 5947
start codons at 38, 231, 357
confident = true
see deletion of 15 bases at pos 135 on |343|IGLV2-23|L-REGION+V-REGION|

TIG 2[bases=597]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
479-597 ==> 0-118 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARRSRYNFNWYLDSW at 400, score = 8 + 7
umis assigned: [5, 466, 671]
of which 3 are surviving nonsolos
reads assigned: 208
start codons at 58, 232, 256, 265, 322, 391
confident = true
now this is a cell
paired!

TCGGACACCGCCATGTATTACTGTGCGAGACGGTCTCGGTATAATTTCAACTGGTATCTTGACTCCTGGGGCCAGGGAACCCAGGTCACCGTCTCCTCAG <==> TCTGGACTCCAGACTGAGGACGAGGCTGATTATTACTGCTCCTCAAATGCAGGCACTACCACTTTACTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.679 = AGCGTATCAGTCAGAG-1

using 312 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 3^2, 4, 5^2, 283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=521]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-521 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 350, score = 4 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 30, 63, 99, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 521
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.683 = AGCGTATCATATACCG-1

using 61 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 10[2^2, 3^2, 4^2, 5^2, 7, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.684 = AGCGTATCATATGGTC-1

using 334 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 24
nonsolo ucounts = 12[2^3, 3^5, 4, 9, 12, 276]
surviving nonsolo ucounts = 1[276]
ids = [10]

====================================================================================

UMI info for barcode AGCGTATCATATGGTC-1 contig 1 = GGGGAGTCAG...
umi CGGGCCCTCC = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYNPPPTF at 355, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.687 = AGCGTATCATCGGTTA-1

using 603 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 299, 300]
surviving nonsolo ucounts = 2[299, 300]
ids = [0, 2]

====================================================================================

UMI info for barcode AGCGTATCATCGGTTA-1 contig 1 = GAATCAGTCC...
umi GTACACCACC = 300 reads: +388 validated
umi TAGGTCAAGC = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 101 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 587
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.689 = AGCGTATCATCTCCCA-1

using 252 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[9, 238]
surviving nonsolo ucounts = 1[238]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATCATCTCCCA-1 contig 1 = GGAGTCTCCC...
umi AACTTGACCT = 239 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=560]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARLSGGSTSYQDDAFDIW at 401, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 59, 233, 257, 392, 438, 441, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.691 = AGCGTATCATGGATGG-1

using 278 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 5, 6, 258]
surviving nonsolo ucounts = 1[258]
ids = [2]

====================================================================================

UMI info for barcode AGCGTATCATGGATGG-1 contig 1 = CCTGGGTCAG...
umi CGGGATATGC = 255 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=570]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
396-434 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYGSSRTF at 376, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 52, 260, 386, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.692 = AGCGTATCATGGGAAC-1

using 223 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[5, 9, 11, 195]
surviving nonsolo ucounts = 1[195]
ids = [6]

====================================================================================

UMI info for barcode AGCGTATCATGGGAAC-1 contig 1 = AGTGCTTTCT...
umi TTTACTGCCG = 186 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=519]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-519 ==> 0-51 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 17, 38, 82, 168, 255
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.696 = AGCGTATGTAAGGGAA-1

using 27 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.705 = AGCGTATGTCCGAATT-1

using 280 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 273]
surviving nonsolo ucounts = 1[273]
ids = [3]

====================================================================================

UMI info for barcode AGCGTATGTCCGAATT-1 contig 1 = GGAGGACAAT...
umi TCTGCACTAA = 258 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=567]
17-357 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
370-408 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
408-567 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQSYDKSLRGAVF at 341, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 17, 101, 174, 324, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.712 = AGCGTATGTGGACGAT-1

using 123 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[121]
surviving nonsolo ucounts = 1[121]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATGTGGACGAT-1 contig 1 = AGCTTCAGCT...
umi ATGTTTTTTC = 121 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=441]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=14)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 14 reads
cdr3 = CATWDDSLKGPYVF at 367, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 46, 200, 350, 375, 380, 401
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.713 = AGCGTATGTGGTGTAG-1

using 183 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 1[182]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATGTGGTGTAG-1 contig 1 = GCTGTGGGTC...
umi ACATTACTCC = 179 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
423-634 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSADSSGTYHWVF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 38, 99, 168, 186
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.717 = AGCGTATGTTACCAGT-1

using 126 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[125]
surviving nonsolo ucounts = 1[125]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=467]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
0-73 ==> 7073-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-73 ==> 7067-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
42-109 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=1)
423-454 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=5)
cdr3 = CARDYYDSS at 415, score = 9 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 73, 224, 229, 282, 287, 290, 308, 376, 431
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.722 = AGCGTATTCAAACCGT-1

using 451 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 205, 241]
surviving nonsolo ucounts = 2[205, 241]
ids = [3, 1]

====================================================================================

UMI info for barcode AGCGTATTCAAACCGT-1 contig 1 = AGCTCTGAGA...
umi ACCACCTTTA = 239 reads: +424 validated
umi CCTATTAGCC = 206 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=615]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-615 ==> 0-112 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 431
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.732 = AGCGTATTCAGGCCCA-1

using 186 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [1]

====================================================================================

UMI info for barcode AGCGTATTCAGGCCCA-1 contig 1 = GAGCTACAAC...
umi CATCGACCAG = 184 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CHQYYSLLSF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 30, 352, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.735 = AGCGTATTCATCACCC-1

using 1328 reads

====================================================================================

graph has 430 edges initially, 12 edges after simplification

total ucounts = 53
nonsolo ucounts = 16[2^6, 3^2, 6, 11, 16, 91, 218, 237, 343, 351]
surviving nonsolo ucounts = 5[91, 218, 237, 343, 351]
ids = [24, 46, 42, 50, 7]

====================================================================================

UMI info for barcode AGCGTATTCATCACCC-1 contig 1 = GAGAAGAGCT...
umi AGGCGCCATA = 351 reads: +385 validated
umi TCCGTATTCA = 238 reads: +346 -3XX +36 invalidated
umi TTACATCCTT = 225 reads: +346 -3XX +36 invalidated
umi TTGCTGCCGT = 339 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CQQYGSSPWTF at 359, score = 9 + 8
umis assigned: [7, 42, 46, 50]
of which 4 are surviving nonsolos
reads assigned: 1138
start codons at 35, 243, 369, 462
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.742 = AGCGTATTCCTTTACA-1

using 17 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.747 = AGCGTATTCGCGTAGC-1

using 134 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[41, 90]
surviving nonsolo ucounts = 2[41, 90]
ids = [3, 0]

====================================================================================

UMI info for barcode AGCGTATTCGCGTAGC-1 contig 1 = TGGGGGCTGG...
umi CTAATATTCT = 81 reads: +388 validated
umi CTATATTCTT = 1 reads: -37 +56 -295 non-validated

GOOD CONTIGS

TIG 1[bases=438]
46-407 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSTLVF at 370, score = 8 + 9
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 46, 203, 247, 254, 257
confident = false

REJECT CONTIGS

TIG 1[bases=393]
0-274 ==> 79-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
271-309 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
309-393 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 242, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 31
start codons at 75, 225, 250, 255
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.749 = AGCGTATTCGTCTGCT-1

using 168 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 162]
surviving nonsolo ucounts = 1[162]
ids = [0]

====================================================================================

UMI info for barcode AGCGTATTCGTCTGCT-1 contig 1 = AGGAGTCAGA...
umi AATTGATCCT = 162 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.751 = AGCGTATTCTAAGCCA-1

using 252 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[5, 241]
surviving nonsolo ucounts = 1[241]
ids = [6]

====================================================================================

UMI info for barcode AGCGTATTCTAAGCCA-1 contig 1 = AGCATCATCC...
umi GTGTTTGTTC = 233 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=561]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=28)
407-434 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
435-485 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
485-561 ==> 0-76 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CARIMVRGVIMAPFDIW at 403, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 61, 148, 259, 325, 358, 388, 415, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.753 = AGCGTATTCTACTATC-1

using 260 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [1]

====================================================================================

UMI info for barcode AGCGTATTCTACTATC-1 contig 1 = GGGATCACAC...
umi GATGTAGTGA = 259 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=552]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=3)
414-434 ==> 8-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=1)
433-481 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CATRVVVTAISYFDYW at 402, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 60, 216, 258, 280, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.754 = AGCGTATTCTATCGCC-1

using 168 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 165]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.758 = AGCGTATTCTGCTTGC-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.785 = AGCGTCGCATCCTAGA-1

using 28 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 23]
surviving nonsolo ucounts = 2[4, 23]
ids = [0, 1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.789 = AGCGTCGCATGGGACA-1

using 3866 reads

====================================================================================

graph has 3159 edges initially, 64 edges after simplification

total ucounts = 978
nonsolo ucounts = 627[2^201, 3^150, 4^81, 5^56, 6^39, 7^15, 8^4, 9^6, 10^5, 11^2, 12^4, 13^4, 14^5, 16^4, 17^3, 18^3, 19^4, 20, 21^4, 22^3, 23^4, 24^2, 25^3, 26^5, 27^4, 28^3, 29^2, 30, 31, 32, 33^2, 39, 40, 42, 50, 52]
surviving nonsolo ucounts = 82[4, 5, 6^4, 7^5, 8, 9, 10^5, 12^3, 13^4, 14^5, 16^3, 17^3, 18^3, 19^4, 20, 21^4, 22^3, 23^4, 24^2, 25^3, 26^4, 27^4, 28^3, 29^2, 30, 31, 32, 33, 39, 40, 42, 50, 52]
ids = [690, 544, 172, 325, 689, 911, 265, 305, 334, 556, ...]

====================================================================================

UMI info for barcode AGCGTCGCATGGGACA-1 contig 1 = GAAAACAGAG...
umi AACATTCGGG = 14 reads: -98 +98 -6 +186 non-validated
umi ACAGATTGTA = 11 reads: -111 +60 -1X +118 -7 +14 -1 +69 -7 invalidated
umi ACCCTTGCTC = 24 reads: +282 -57 +21 -1 +27 non-validated
umi ACTTATGCTT = 40 reads: -259 +129 non-validated
umi ATACACCTCT = 21 reads: +37 -6 +246 -74 +25 non-validated
umi ATACTTGGGC = 24 reads: +281 -4 +103 non-validated
umi ATAGACTGCG = 7 reads: -19 +82 -22 +2 -1 +53 -36 +1 -1 +4 -1 +4 -2 +3 -1 +7 -1 +31 -2 +2 -1 +5 -2X +2 -2 +9 -4 +4 -1 +3 -1 +1 -78 invalidated
umi ATTAGTTCCA = 18 reads: +149 -1 +64 -33 +141 non-validated
umi ATTCCTTCAT = 8 reads: -37 +76 -1 +4 -2 +1 -1 +7 -2 +3 -3 +2 -1 +6 -6X +2 -1X +3 -24 +62 -57 +56 -31 invalidated
umi CAACGTTCGT = 17 reads: -24 +126 -2 +2 -1 +136 -52 +45 non-validated
umi CAATTCTATT = 27 reads: +11 -27 +350 non-validated
umi CACCTAAATG = 26 reads: +276 -17 +12 -1 +43 -1 +1 -1 +36 non-validated
umi CAGAGTTCGT = 21 reads: -19 +131 -6 +232 non-validated
umi CAGCAGTGCC = 7 reads: +26 -72 +56 -1 +65 -1 +7 -1 +30 -1 +17 -111 non-validated
umi CCACAAGCTT = 7 reads: +71 -50 +71 -51 +56 -76 +13 non-validated
umi CCAGTTCATA = 25 reads: +69 -8 +308 -1 +2 non-validated
umi CCCACGTTGA = 6 reads: +11 -1 +35 -6 +56 -159 +4 -1 +4 -1 +4 -1 +3 -1 +4 -1 +3 -1 +1 -1 +6 -2 +18 -64 non-validated
umi CCCGACCTGC = 7 reads: -10 +56 -7 +140 -26 +56 -93 non-validated
umi CCCTTATCAA = 21 reads: -1 +9 -1 +5 -1 +3 -1 +3 -1 +1 -3 +194 -19 +146 non-validated
umi CCGCTAGAAC = 19 reads: +47 -7 +326 -8 non-validated
umi CGATGCTCTT = 30 reads: +214 -1 +102 -1 +70 non-validated
umi CGTACGGCTA = 10 reads: +55 -1 +15 -56 +56 -22 +60 -55 +40 -1X +15 -4 +8 invalidated
umi CGTAGGTTGA = 10 reads: +28 -9 +201 -59 +80 -11 non-validated
umi CTAATTCGGT = 28 reads: +4 -1 +1 -1 +3 -1 +1 -1 +1 -1 +2 -2 +1 -1 +1 -1 +7 -1X +6 -2 +2 -2X +345 invalidated
umi CTCCACTTAC = 19 reads: +71 -5 +217 -95 non-validated
umi CTCCCCTCCG = 28 reads: +7 -1 +163 -11 +206 non-validated
umi CTCGCCCTCG = 13 reads: -5 +241 -33 +109 non-validated
umi CTTAGAGTCC = 41 reads: +24 -7 +3 -1 +3 -1 +289 -1 +59 non-validated
umi CTTCACCGTT = 17 reads: -2 +314 -27 +45 non-validated
umi CTTCGTCTCG = 12 reads: +31 -33 +2 -1 +5 -1 +2 -2 +2 -1 +1 -3 +1 -1 +190 -11 +44 -1 +11 -28 +17 non-validated
umi GACGCAGGGG = 5 reads: -89 +134 -148 +17 non-validated
umi GATTCATTCT = 26 reads: -274 +56 -7 +3 -1 +14 -1 +18 -1 +13 non-validated
umi GCGCAAAGTC = 5 reads: -388 non-validated
umi GCGTACTCTA = 13 reads: +9 -14 +186 -14 +4 -1 +2 -2 +7 -1 +5 -1 +13 -1 +4 -1 +14 -68 +41 non-validated
umi GGATCATCCT = 14 reads: -2 +59 -1X +14 -1 +1 -2 +2 -1 +1 -2 +1 -1 +1 -1 +19 -1 +1 -1 +1 -1 +28 -1X +165 -1 +2 -1 +11 -24 +41 invalidated
umi GGCGTGGCAA = 14 reads: -42 +19 -1X +249 -1 +61 -15 invalidated
umi GGGCTATCGT = 21 reads: +200 -1 +14 -1 +41 -18 +101 -12 non-validated
umi GTCGTCTTTA = 6 reads: -13 +56 -61 +163 -95 non-validated
umi GTCGTCTTTT = 4 reads: -45 +94 -100 +56 -54X +4 -1X +4 -2 +2 -1 +2 -1X +1 -1 +2 -2 +1 -3 +1 -1 +1 -2 +3 -2 +1 -1 invalidated
umi TAACAAGTAC = 16 reads: -47 +118 -49 +11 -1 +162 non-validated
umi TAGTATATAA = 25 reads: +308 -1 +2 -1 +76 non-validated
umi TCATAGCAAA = 8 reads: -28 +56 -28 +118 -1 +31 -35 +83 -8 non-validated
umi TCGCCGCCAA = 12 reads: +308 -1 +28 -25 +26 non-validated
umi TTACAGCATC = 21 reads: -15 +18 -1 +184 -36 +5 -2 +116 -11 non-validated
umi TTCAATTACA = 12 reads: +55 -1 +67 -1 +126 -32 +15 -1 +12 -1 +15 -1 +11 -24 +26 non-validated
umi TTCCCCCCCA = 22 reads: +33 -1 +16 -7 +167 -54 +65 -27 +18 non-validated
umi TTCCGACGCG = 16 reads: -67 +162 -1 +5 -1 +1 -8 +119 -24 non-validated
umi TTCTACAGGC = 26 reads: +55 -37 +219 -1 +20 -1 +48 -6X +1 invalidated
umi TTTACTGCTG = 18 reads: -4 +56 -14 +4 -2 +3 -1X +7 -1 +16 -2 +20 -13 +57 -2 +186 invalidated
umi TTTTACCTTT = 13 reads: +105 -23 +79 -16 +104 -1X +19 -20 +21 invalidated

GOOD CONTIGS

TIG 1[bases=638]
39-391 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 81 reads
cdr3 = CSAWDSSLNVWVF at 360, score = 7 + 8
umis assigned: [13, 60, 76, 110, 163, 170, 172, 211, 214, 232] and 40 others
of which 49 are surviving nonsolos
reads assigned: 841
start codons at 39, 178, 368, 385
confident = true

REJECT CONTIGS

TIG 1[bases=566]
0-76 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
31-391 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 351, score = 4 + 8
umis assigned: [27, 29, 64, 77, 92, 130, 137, 168, 177, 181] and 14 others
of which 24 are surviving nonsolos
reads assigned: 603
start codons at 31, 64, 100, 188, 350, 370, 472
confident = false
not full
frameshifted full length transcript of length 566
VJ delta = 30
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.792 = AGCGTCGCATTCTCAT-1

using 26 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 1[26]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.798 = AGCGTCGGTCGGATCC-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.819 = AGCTCCTAGACAGAGA-1

using 294 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 285]
surviving nonsolo ucounts = 1[285]
ids = [2]

====================================================================================

UMI info for barcode AGCTCCTAGACAGAGA-1 contig 1 = GATCAGGACT...
umi CACCCTTCGC = 269 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=523]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-523 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.822 = AGCTCCTAGACGCACA-1

using 420 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 5[2^2, 4, 32, 369]
surviving nonsolo ucounts = 2[32, 369]
ids = [14, 6]

====================================================================================

UMI info for barcode AGCTCCTAGACGCACA-1 contig 1 = GAAGAGCTGC...
umi CCGAGGGCCT = 370 reads: +385 validated
umi TTCTTTACAT = 34 reads: +1 -3 +1 -1 +2 -1 +1 -1 +2 -1 +1 -2X +2 -1 +1 -1 +1 -1 +1 -1 +1 -1 +1 -2 +2 -1 +1 -1 +293 -2 +7 -47 invalidated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [6, 14]
of which 2 are surviving nonsolos
reads assigned: 397
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.824 = AGCTCCTAGACTCGGA-1

using 185 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 180]
surviving nonsolo ucounts = 1[180]
ids = [0]

====================================================================================

UMI info for barcode AGCTCCTAGACTCGGA-1 contig 1 = GGGGAAGCTC...
umi ATAACTCTGT = 177 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=539]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
56-407 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=4)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
438-539 ==> 0-101 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAAWDDSLRVF at 377, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 56, 210, 360, 385, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.829 = AGCTCCTAGAGCTGCA-1

using 222 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 1[221]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.832 = AGCTCCTAGAGTACAT-1

using 70 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[4, 6, 7, 10^2, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.842 = AGCTCCTAGCGATAGC-1

using 286 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 278]
surviving nonsolo ucounts = 1[278]
ids = [3]

====================================================================================

UMI info for barcode AGCTCCTAGCGATAGC-1 contig 1 = TGGGGTCACA...
umi CACGGTTATA = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
427-559 ==> 0-132 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSYAATTTYVF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 39, 178, 190, 240, 247, 373, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.845 = AGCTCCTAGCGCTTAT-1

using 3015 reads

====================================================================================

graph has 3785 edges initially, 26 edges after simplification

total ucounts = 1320
nonsolo ucounts = 616[2^248, 3^131, 4^80, 5^55, 6^35, 7^20, 8^15, 9^15, 10^6, 11^2, 12^2, 13^3, 14, 17, 22, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.850 = AGCTCCTAGGATGGAA-1

using 329 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 323]
surviving nonsolo ucounts = 1[323]
ids = [5]

====================================================================================

UMI info for barcode AGCTCCTAGGATGGAA-1 contig 1 = GAGTCAGACC...
umi TTGTTTGCTT = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNSHSQTF at 352, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.853 = AGCTCCTAGGGAGTAA-1

using 2085 reads

====================================================================================

graph has 2871 edges initially, 24 edges after simplification

total ucounts = 801
nonsolo ucounts = 410[2^152, 3^77, 4^62, 5^32, 6^29, 7^19, 8^12, 9^9, 10^7, 11^2, 12^3, 13, 14, 16, 18, 26, 52]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.859 = AGCTCCTAGTAGGTGC-1

using 391 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 388]
surviving nonsolo ucounts = 1[388]
ids = [0]

====================================================================================

UMI info for barcode AGCTCCTAGTAGGTGC-1 contig 1 = GGAGAAGAGC...
umi ACGACTAACG = 357 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-372 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYRNSITF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 36, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.861 = AGCTCCTAGTCGTTTG-1

using 439 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 16[2^3, 3^2, 5^2, 6, 7^4, 8^2, 9, 349]
surviving nonsolo ucounts = 1[349]
ids = [13]

====================================================================================

UMI info for barcode AGCTCCTAGTCGTTTG-1 contig 1 = GAGCTGCTCA...
umi CGCTAAGATA = 349 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=545]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
371-409 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYGSSRF at 354, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 30, 238, 364, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.865 = AGCTCCTAGTGTACGG-1

using 146 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
0-81 ==> 11262-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
35-351 ==> 0-316 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=14)
380-418 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
418-496 ==> 0-78 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 35, 96, 183, 234, 296, 333
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.867 = AGCTCCTAGTGTCCAT-1

using 236 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 226]
surviving nonsolo ucounts = 1[226]
ids = [2]

====================================================================================

UMI info for barcode AGCTCCTAGTGTCCAT-1 contig 1 = GATCAGGACT...
umi AGTCACGGCA = 224 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-382 ==> 0-352 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALPSRYTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.872 = AGCTCCTAGTTCGCGC-1

using 349 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[349]
surviving nonsolo ucounts = 1[349]
ids = [0]

====================================================================================

UMI info for barcode AGCTCCTAGTTCGCGC-1 contig 1 = AGGAGTCAGA...
umi ATTCACCCGG = 346 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-498 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNSYSPTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.878 = AGCTCCTCAAGACGTG-1

using 18050 reads

====================================================================================

graph has 7080 edges initially, 80 edges after simplification

total ucounts = 1283
nonsolo ucounts = 658[2^234, 3^128, 4^83, 5^44, 6^37, 7^20, 8^16, 9^10, 10^6, 11^10, 12, 13^7, 14^4, 15^4, 16, 18^3, 26^2, 27, 31, 51, 83, 109, 192, 202, 211, 239, 248, 250^2, 253, 259, 265, 269, 279, 283, 300, 304, 310, 315^2, 323, 325, 326, 336^2, 343, 344, 347, 349, 353, 357, 361, 365, 366, 370, 381, 382, 384, 395, 403, 406, 421, 506, 685, 721]
surviving nonsolo ucounts = 44[109, 192, 202, 211, 239, 248, 250^2, 253, 259, 265, 269, 279, 283, 300, 304, 310, 315^2, 323, 325, 326, 336^2, 343, 344, 347, 349, 353, 357, 361, 365, 366, 370, 381, 382, 384, 395, 403, 406, 421, 506, 685, 721]
ids = [1121, 1033, 908, 698, 1210, 1171, 29, 393, 1223, 1151, ...]

====================================================================================

UMI info for barcode AGCTCCTCAAGACGTG-1 contig 1 = TGGGGAGAGC...
umi AAAGCTCTCT = 380 reads: +382 validated
umi AACTAATCTC = 248 reads: +382 validated
umi ACTTTATCAA = 325 reads: +382 validated
umi AGCGGTAGCT = 341 reads: +382 validated
umi AGCGTGTCTT = 303 reads: +382 validated
umi AGCGTTCTCT = 319 reads: +382 validated
umi AGGCGGCGGA = 316 reads: +382 validated
umi CACCGTTTTC = 388 reads: +382 validated
umi CATATAGCCT = 253 reads: +382 validated
umi CCATTAGCCG = 727 reads: +382 validated
umi CCCAAAGGTC = 382 reads: +382 validated
umi CCTTCCGCCA = 332 reads: +382 validated
umi CCTTTATGCC = 343 reads: +382 validated
umi CGACTGGTGC = 320 reads: +382 validated
umi CGGGCACCGC = 263 reads: +382 validated
umi CGTAATTTCG = 362 reads: +382 validated
umi CTATATATCG = 309 reads: +382 validated
umi CTTGTAGGAA = 399 reads: +382 validated
umi GACATCAATA = 208 reads: +382 validated
umi GCTAAGTATA = 508 reads: +382 validated
umi GGAGACTTCG = 452 reads: +202 -1XX +1 -13XX +1 -9XX +1 -25 +1 -9XX +1 -1XX +1 -3XX +1 -6XX +106 invalidated
umi GGTGTGACGG = 364 reads: +382 validated
umi GTCCTTGATA = 344 reads: +382 validated
umi TACCTTACTG = 401 reads: +382 validated
umi TCACGCTTTC = 343 reads: +64 -2XX +316 invalidated
umi TCCGAGGGGT = 370 reads: +49 -5XX +1 -2XX +1 -17XX +1 -9X +2 -3XX +2 -4XX +1 -1XX +1 -3XX +280 invalidated
umi TCCGCATAAG = 369 reads: +382 validated
umi TCTCATTCTC = 365 reads: +382 validated
umi TGAGTAATAG = 404 reads: +382 validated
umi TGAGTGAGTG = 108 reads: +382 validated
umi TGCGGGGAGC = 348 reads: +382 validated
umi TGGCGTATGA = 258 reads: +382 validated
umi TGTTAACCCT = 247 reads: +382 validated
umi TTAATTCCTT = 681 reads: -240X +142 invalidated
umi TTATTCCGGG = 241 reads: -261 +121 non-validated
umi TTATTGGTAT = 353 reads: +382 validated
umi TTCCTACCGC = 250 reads: -316 +66 non-validated
umi TTCGTTAGGT = 350 reads: +382 validated

UMI info for barcode AGCTCCTCAAGACGTG-1 contig 2 = TGGGGAGGCT...
umi ACCCATAACA = 308 reads: +424 validated
umi GTCATTTCCC = 277 reads: +424 validated
umi GTGATTTAGT = 203 reads: +424 validated
umi TACCTCTTTA = 282 reads: +413 -1 +1 -9 non-validated
umi TTCACTTTTC = 275 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=567]
49-396 ==> 0-347 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=26)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 37 umis using 2230 reads
cdr3 = CQQRSDWKYTF at 370, score = 8 + 8
umis assigned: [5, 29, 161, 186, 189, 190, 205, 360, 393, 437] and 28 others
of which 38 are surviving nonsolos
reads assigned: 13014
start codons at 49, 254, 257, 473
confident = true

TIG 2[bases=537]
42-342 ==> 0-300 on |742|IGHV4-38-2|L-REGION+V-REGION| [len=345] (mis=39)
415-466 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=7)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 91 reads
cdr3 = CARESGVSVFSGWFDPW at 384, score = 8 + 6
umis assigned: [115, 893, 908, 983, 1215]
of which 5 are surviving nonsolos
reads assigned: 1325
start codons at 21, 42, 86, 172, 190
confident = true
now this is a cell
paired!

GACACGGCCATATATTATTGTGCGAGAGAGTCGGGGGTGAGTGTCTTCTCGGGGTGGTTCGACCCCTGGGGCCAGGGAATCCCGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGGATTTTATTACTGTCAGCAGCGTAGCGACTGGAAGTACACTTTTGGCCAGGGGACCAGGCTGGACATCAGAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.883 = AGCTCCTCAAGTTCTG-1

using 509 reads

====================================================================================

graph has 204 edges initially, 36 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^2, 4, 16, 65, 88, 326]
surviving nonsolo ucounts = 3[65, 88, 326]
ids = [5, 12, 3]

====================================================================================

UMI info for barcode AGCTCCTCAAGTTCTG-1 contig 1 = GAGGAATCAG...
umi GATTCGTTGT = 67 reads: +388 validated
umi TTCCAAACGT = 90 reads: +388 validated

UMI info for barcode AGCTCCTCAAGTTCTG-1 contig 2 = GGGGGAGTCA...
umi GATATCTACT = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 23 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5, 12]
of which 2 are surviving nonsolos
reads assigned: 152
start codons at 28, 34, 103, 239, 458
confident = true

TIG 2[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYTTLLTF at 356, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 29, 35, 91, 104, 240, 459
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.901 = AGCTCCTCACGACTCG-1

using 332 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 319]
surviving nonsolo ucounts = 1[319]
ids = [9]

====================================================================================

UMI info for barcode AGCTCCTCACGACTCG-1 contig 1 = GGGAATCAGT...
umi TTAATCGTAT = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.902 = AGCTCCTCACGGACAA-1

using 618 reads

====================================================================================

graph has 240 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 4, 5, 251, 347]
surviving nonsolo ucounts = 2[251, 347]
ids = [1, 2]

====================================================================================

UMI info for barcode AGCTCCTCACGGACAA-1 contig 1 = GAATCAGTCC...
umi AGGAGATTCA = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 25, 31, 100, 236, 455
confident = false

REJECT CONTIGS

TIG 1[bases=589]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
378-589 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 38, 177, 239, 246, 372
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.906 = AGCTCCTCACTGAAGG-1

using 520 reads

====================================================================================

graph has 168 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3^2, 5, 504]
surviving nonsolo ucounts = 2[5, 504]
ids = [4, 5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.907 = AGCTCCTCAGACAAGC-1

using 189 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.909 = AGCTCCTCAGAGCCAA-1

using 17 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.926 = AGCTCCTCAGTGGAGT-1

using 258 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[2^3, 4^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [13]

====================================================================================

UMI info for barcode AGCTCCTCAGTGGAGT-1 contig 1 = ACCCAAAAAC...
umi CTGACAGCAC = 221 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=562]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-562 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.930 = AGCTCCTCATCACCCT-1

using 124 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[124]
surviving nonsolo ucounts = 1[124]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.969 = AGCTCCTGTCCCTACT-1

using 129 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 121]
surviving nonsolo ucounts = 1[121]
ids = [4]

====================================================================================

UMI info for barcode AGCTCCTGTCCCTACT-1 contig 1 = GGAGTCAGTC...
umi GACACGCAAC = 113 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=461]
32-280 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-461 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLHYDNRRRTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.981 = AGCTCCTGTGCCTTGG-1

using 22 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.989 = AGCTCCTGTTAAAGTG-1

using 20 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.996 = AGCTCCTGTTCCCTTG-1

using 345 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[10, 334]
surviving nonsolo ucounts = 1[334]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1003 = AGCTCCTGTTGAGTTC-1

using 196 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 186]
surviving nonsolo ucounts = 1[186]
ids = [3]

====================================================================================

UMI info for barcode AGCTCCTGTTGAGTTC-1 contig 1 = TGGGGGACTC...
umi TCGTAATGGG = 183 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=497]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
405-455 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
455-497 ==> 0-42 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 367, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 22, 66, 245, 248, 251, 337, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1011 = AGCTCCTTCAACACCA-1

using 76 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 11, 50]
surviving nonsolo ucounts = 1[50]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1012 = AGCTCCTTCAAGGCTT-1

using 16 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1033 = AGCTCCTTCATGTCTT-1

using 278 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [2]

====================================================================================

UMI info for barcode AGCTCCTTCATGTCTT-1 contig 1 = AGTCCCACTC...
umi CACAGGTAGG = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1036 = AGCTCCTTCCAGAAGG-1

using 325 reads

====================================================================================

graph has 202 edges initially, 6 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^2, 3^2, 5, 68, 109, 127]
surviving nonsolo ucounts = 3[68, 109, 127]
ids = [11, 10, 5]

====================================================================================

UMI info for barcode AGCTCCTTCCAGAAGG-1 contig 1 = ACCCAAAAAC...
umi GCTATAACGA = 126 reads: +436 validated

UMI info for barcode AGCTCCTTCCAGAAGG-1 contig 2 = GAGCTCTGGG...
umi GATCAGACGA = 1 reads: -55 +1 -1 +1 -1 +5 -3 +1 -1 +1 -1 +1 -2 +2 -1 +4 -1 +5 -2 +6 -1 +4 -1 +7 -1 +2 -295 non-validated
umi GTTCAGTCGA = 97 reads: +406 validated

UMI info for barcode AGCTCCTTCCAGAAGG-1 contig 3 = GGAGTCAGTC...
umi TCACAAAAGA = 62 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=486]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=28)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 10 reads
cdr3 = CARENDAFDIW at 422, score = 8 + 8
umis assigned: [2, 10]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 80, 140, 231, 236, 294, 297, 383, 467
confident = false

TIG 3[bases=430]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-430 ==> 0-19 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 60
start codons at 26, 32, 88, 101, 240, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1038 = AGCTCCTTCCGAGCCA-1

using 311 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 3, 296]
surviving nonsolo ucounts = 1[296]
ids = [1]

====================================================================================

UMI info for barcode AGCTCCTTCCGAGCCA-1 contig 1 = GAATCAGTCC...
umi ATATCTCTAC = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1044 = AGCTCCTTCGCAAGCC-1

using 496 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^2, 4^2, 5, 125, 345]
surviving nonsolo ucounts = 2[125, 345]
ids = [11, 10]

====================================================================================

UMI info for barcode AGCTCCTTCGCAAGCC-1 contig 1 = GGAACTGCTC...
umi TAGGATCCCG = 341 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRNNWPPLTF at 352, score = 9 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 31, 236, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1045 = AGCTCCTTCGCCAAAT-1

using 47 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[47]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1049 = AGCTCCTTCGCGTTTC-1

using 66 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 52]
surviving nonsolo ucounts = 1[52]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=447]
0-350 ==> 3-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
373-421 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
421-447 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARGAGITTRAYYFDYW at 339, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 41
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1064 = AGCTCCTTCTCTTGAT-1

using 271 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3^2, 255]
surviving nonsolo ucounts = 1[255]
ids = [7]

====================================================================================

UMI info for barcode AGCTCCTTCTCTTGAT-1 contig 1 = AGCTGCTCAG...
umi TAAGCTGTGG = 253 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-29 ==> 23-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
29-377 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYVSSPFTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 29, 237, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1065 = AGCTCCTTCTGAAAGA-1

using 235 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 228]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode AGCTCCTTCTGAAAGA-1 contig 1 = GATCACTCAA...
umi GCTCTCCTTG = 231 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=539]
59-412 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=13)
434-468 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CATGLLAGPIYW at 401, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 226
start codons at 59, 210, 257, 262, 266, 294, 323, 341, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1077 = AGCTCCTTCTTGCCGT-1

using 1747 reads

====================================================================================

graph has 2095 edges initially, 32 edges after simplification

total ucounts = 698
nonsolo ucounts = 305[2^131, 3^69, 4^34, 5^26, 6^13, 7^11, 8^5, 9^6, 10^2, 11^2, 12, 14^2, 19^2, 250]
surviving nonsolo ucounts = 1[250]
ids = [95]

====================================================================================

UMI info for barcode AGCTCCTTCTTGCCGT-1 contig 1 = ACCCAAAAAC...
umi AGATACAGCA = 250 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=526]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=28)
438-484 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
484-526 ==> 0-42 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGYCTDDVCYHRANDYW at 396, score = 8 + 7
umis assigned: [95]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 54, 123, 205, 252, 257, 274, 289, 318, 351, 418, 421, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1110 = AGCTCTCAGGTACTCT-1

using 324 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 319]
surviving nonsolo ucounts = 1[319]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1113 = AGCTCTCAGGTGCAAC-1

using 363 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 351]
surviving nonsolo ucounts = 1[351]
ids = [4]

====================================================================================

UMI info for barcode AGCTCTCAGGTGCAAC-1 contig 1 = GGGGAGGAAC...
umi GGTTAATTAA = 343 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
421-481 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNNWPPITF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1119 = AGCTCTCAGTCAATAG-1

using 215 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode AGCTCTCAGTCAATAG-1 contig 1 = GCTCTGCTTC...
umi ACCTTCCGGA = 200 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=464]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGPGVVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1122 = AGCTCTCAGTGACATA-1

using 314 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode AGCTCTCAGTGACATA-1 contig 1 = GTCAGACTCA...
umi GCGATGACTA = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1140 = AGCTCTCCAATGACCT-1

using 10972 reads

====================================================================================

graph has 6252 edges initially, 80 edges after simplification

total ucounts = 1135
nonsolo ucounts = 557[2^212, 3^127, 4^53, 5^43, 6^27, 7^24, 8^17, 9^7, 10^2, 11, 12^2, 16, 25, 30, 36, 44, 54, 61, 76, 77, 82, 101, 164, 178, 188, 190, 193, 194, 197, 199, 204, 205, 208, 212, 217, 221, 228, 229, 242, 249, 266, 276^2, 284, 286, 291, 295, 307, 309^2, 311, 332, 716]
surviving nonsolo ucounts = 39[30, 36, 44, 54, 61, 76, 77, 101, 164, 178, 188, 190, 193, 194, 197, 199, 204, 205, 208, 212, 217, 221, 228, 229, 242, 249, 266, 276^2, 284, 286, 291, 295, 307, 309^2, 311, 332, 716]
ids = [1014, 767, 473, 1120, 19, 23, 1079, 629, 856, 313, ...]

====================================================================================

UMI info for barcode AGCTCTCCAATGACCT-1 contig 1 = GGGAAACAGA...
umi AGACACCGTC = 308 reads: +388 validated
umi ATATCGTCTA = 209 reads: +388 validated
umi ATGATATCCT = 292 reads: +388 validated
umi CTCGACGTAA = 278 reads: +388 validated
umi GCCCGAACTA = 102 reads: +388 validated
umi GGAGCGCTCG = 269 reads: +388 validated
umi GTGTGTTGTG = 33 reads: -321X +1 -1X +2 -2XX +1 -10XX +3 -3XX +2 -1XX +1 -2XX +38 invalidated
umi TCCTTCATGA = 331 reads: +388 validated
umi TCGTTTTCTG = 287 reads: +388 validated
umi TGCACTTCGG = 251 reads: +388 validated
umi TGTAACCGTG = 233 reads: +388 validated
umi TTATCAGCCG = 33 reads: -316 +4 -1XX +1 -1XX +2 -2XX +1 -10XX +3 -3XX +2 -1XX +1 -2XX +38 invalidated
umi TTTCGTGGCG = 53 reads: +388 validated

UMI info for barcode AGCTCTCCAATGACCT-1 contig 2 = AGCTCTGGGA...
umi AACCTTTCAC = 73 reads: +424 validated
umi AATTCGTCCC = 206 reads: +424 validated
umi AATTCGTCCG = 209 reads: +424 validated
umi ACATACCGGA = 203 reads: +409 -15 non-validated
umi AGCGTATGGG = 210 reads: +424 validated
umi ATATTCACCC = 195 reads: +424 validated
umi CACGGCACTG = 200 reads: +406 -18 non-validated
umi CACTGCTGAA = 171 reads: +424 validated
umi CCCTTGCCAT = 217 reads: +424 validated
umi CCTTGAAGTT = 233 reads: +424 validated
umi CGTCGATTCG = 226 reads: +424 validated
umi CTACGTTATG = 45 reads: +409 -15 non-validated
umi GGACTTGTTA = 188 reads: +424 validated
umi GTGCGTCATA = 38 reads: +70 -1 +20 -1 +2 -1 +3 -1 +279 -1 +1 -1 +7 -1 +7 -1 +10 -1 +4 -1X +8 -3X invalidated
umi TAGATGTTAT = 187 reads: +424 validated
umi TATGCTTTAG = 162 reads: +416 -8 non-validated
umi TGGGAGGGTT = 30 reads: +374 -1 +13 -1 +24 -11 non-validated
umi TTAGCAAGAG = 221 reads: +404 -1 +19 non-validated
umi TTCTTACCGC = 72 reads: +335 -89 non-validated

GOOD CONTIGS

TIG 1[bases=639]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=4)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
428-639 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 448 reads
cdr3 = CSAWDSSLSAWVF at 361, score = 8 + 8
umis assigned: [147, 215, 244, 497, 629, 685, 773, 920, 939, 996] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2640
start codons at 40, 179, 369
confident = true

TIG 2[bases=575]
0-80 ==> 0-80 on |166|IGHV3-73|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |167|IGHV3-73|L-REGION+V-REGION| [len=359] (mis=2)
456-504 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 152 reads
cdr3 = CTRSAVTTVVSFDYW at 428, score = 8 + 7
umis assigned: [23, 62, 63, 82, 166, 216, 303, 313, 381, 423] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3005
start codons at 80, 236, 321, 360, 389
confident = true

REJECT CONTIGS

TIG 1[bases=571]
3-84 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
37-397 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [39, 738, 823, 882, 908, 985]
of which 6 are surviving nonsolos
reads assigned: 2176
start codons at 37, 70, 98, 106, 194, 356, 376, 477
confident = false
did not find CDR3
now this is a cell
paired!

ACCGAGGACACGGCCGTGTATTACTGTACTAGAAGCGCGGTGACTACGGTGGTATCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1142 = AGCTCTCCAATTGCTG-1

using 612 reads

====================================================================================

graph has 184 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 297, 311]
surviving nonsolo ucounts = 2[297, 311]
ids = [3, 0]

====================================================================================

UMI info for barcode AGCTCTCCAATTGCTG-1 contig 1 = GGGGAGTCAG...
umi GCTCGTGTGG = 300 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 28, 34, 90, 103, 239, 455
confident = false

REJECT CONTIGS

TIG 1[bases=565]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-173 ==> 0-145 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
174-392 ==> 145-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=6) [SHIFT!]
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYNAPRTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 28, 97, 351, 384, 471
confident = false
not full
frameshifted full length stopped transcript of length 565
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1152 = AGCTCTCCACGACTCG-1

using 19 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1159 = AGCTCTCCACTCGACG-1

using 37 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1167 = AGCTCTCCAGCCACCA-1

using 23 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1168 = AGCTCTCCAGCTCCGA-1

using 2367 reads

====================================================================================

graph has 3109 edges initially, 38 edges after simplification

total ucounts = 963
nonsolo ucounts = 422[2^162, 3^104, 4^58, 5^41, 6^19, 7^11, 8^9, 9^7, 10^2, 11, 12, 13, 14, 16^3, 17, 292]
surviving nonsolo ucounts = 1[292]
ids = [477]

====================================================================================

UMI info for barcode AGCTCTCCAGCTCCGA-1 contig 1 = GTCAGACTCA...
umi CTTCTGCCTT = 281 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=489]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYISDSPWTF at 350, score = 8 + 7
umis assigned: [477]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 23, 29, 85, 98, 234, 237, 330, 407, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1178 = AGCTCTCCATAGGATA-1

using 1255 reads

====================================================================================

graph has 430 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2, 14, 330, 334, 566]
surviving nonsolo ucounts = 3[330, 334, 566]
ids = [6, 10, 13]

====================================================================================

REJECT CONTIGS

TIG 1[bases=543]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-341 ==> 0-305 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=13)
341-361 ==> 313-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1) [SHIFT!]
369-407 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQERGGWWTF at 349, score = 3 + 8
umis assigned: [6, 10, 13]
of which 3 are surviving nonsolos
reads assigned: 1210
start codons at 36, 244, 449
confident = false
not full
frameshifted full length transcript of length 543
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1193 = AGCTCTCGTACTTAGC-1

using 99 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[99]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1213 = AGCTCTCGTCTCTTAT-1

using 1008 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4, 5^2, 9, 978]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=310]
13-38 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
61-99 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
97-145 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
99-310 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 970
start codons at 63, 231
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1214 = AGCTCTCGTCTTGTCC-1

using 226 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^4, 211]
surviving nonsolo ucounts = 1[211]
ids = [11]

====================================================================================

UMI info for barcode AGCTCTCGTCTTGTCC-1 contig 1 = AGTCTGGGCC...
umi TTGCTAATGG = 210 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=498]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-384 ==> 0-344 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-498 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQVWDSSSDHYVVF at 355, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 40, 101, 239, 242, 338, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1217 = AGCTCTCGTGGCTCCA-1

using 16 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1220 = AGCTCTCGTGGTCTCG-1

using 8971 reads

====================================================================================

graph has 7845 edges initially, 114 edges after simplification

total ucounts = 1573
nonsolo ucounts = 1177[2^219, 3^155, 4^142, 5^103, 6^99, 7^81, 8^71, 9^68, 10^41, 11^48, 12^38, 13^19, 14^25, 15^20, 16^9, 17^6, 18^11, 19^2, 20^7, 21^4, 23, 25, 41, 84, 86, 118, 208, 258, 408]
surviving nonsolo ucounts = 8[4, 17, 84, 86, 118, 208, 258, 408]
ids = [185, 486, 252, 238, 514, 1004, 1411, 1360]

====================================================================================

UMI info for barcode AGCTCTCGTGGTCTCG-1 contig 1 = AGCTCTGGGA...
umi CCCGCGGAGT = 113 reads: +409 -6 non-validated
umi TGTCCCACCC = 239 reads: +415 validated

UMI info for barcode AGCTCTCGTGGTCTCG-1 contig 2 = GGAGAAGAGC...
umi AGTTACACAT = 85 reads: +388 validated
umi ATACAGTTGC = 84 reads: +388 validated
umi GGTAGTTCAG = 209 reads: +388 validated
umi TGCCCGACGA = 407 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=29)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
495-521 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CAKGSVANYYFDYW at 422, score = 9 + 7
umis assigned: [514, 1411]
of which 2 are surviving nonsolos
reads assigned: 346
start codons at 80, 225, 231, 236, 315, 383
confident = true

TIG 2[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 122 reads
cdr3 = CQQYGSSPGWTF at 360, score = 9 + 8
umis assigned: [238, 252, 1004, 1360]
of which 4 are surviving nonsolos
reads assigned: 774
start codons at 36, 244, 370, 466
confident = true
now this is a cell
paired!

AGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGGATCGGTGGCTAATTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGGGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1222 = AGCTCTCGTGTGAATA-1

using 26 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1223 = AGCTCTCGTGTGACCC-1

using 228 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[7, 10, 207]
surviving nonsolo ucounts = 1[207]
ids = [6]

====================================================================================

UMI info for barcode AGCTCTCGTGTGACCC-1 contig 1 = GCTCTGCTTC...
umi TTTTTTCACT = 204 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
442-588 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSFDRSLSGWVF at 375, score = 6 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 51, 205, 208, 259, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1235 = AGCTCTCGTTCGTGAT-1

using 70 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[70]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1239 = AGCTCTCTCAATCACG-1

using 188 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[6, 176]
surviving nonsolo ucounts = 1[176]
ids = [4]

====================================================================================

UMI info for barcode AGCTCTCTCAATCACG-1 contig 1 = GGGGTCTCCC...
umi CTTTACTCAT = 179 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=506]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
451-501 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 9 reads
cdr3 = CARQMSRQILLITAAVRGAFDMW at 401, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 59, 233, 257, 392, 413, 464, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1247 = AGCTCTCTCAGTCAGT-1

using 663 reads

====================================================================================

graph has 278 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[189, 191, 277]
surviving nonsolo ucounts = 3[189, 191, 277]
ids = [7, 4, 5]

====================================================================================

UMI info for barcode AGCTCTCTCAGTCAGT-1 contig 1 = GGAATCAGTC...
umi CAATTCCCGA = 194 reads: +388 validated
umi CCCCATGTCA = 282 reads: +388 validated
umi TTGATATTGA = 189 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 94 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4, 5, 7]
of which 3 are surviving nonsolos
reads assigned: 648
start codons at 26, 32, 101, 237, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1249 = AGCTCTCTCATACGGT-1

using 245 reads

====================================================================================

graph has 99 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [0]

====================================================================================

UMI info for barcode AGCTCTCTCATACGGT-1 contig 1 = GTCAGTCTCA...
umi TCTCGGGTCA = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-502 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1251 = AGCTCTCTCATCACCC-1

using 7421 reads

====================================================================================

graph has 5125 edges initially, 70 edges after simplification

total ucounts = 1073
nonsolo ucounts = 466[2^199, 3^95, 4^54, 5^34, 6^17, 7^10, 8^10, 9^6, 10, 12^5, 13, 14^2, 15, 16, 19^2, 24, 44, 55, 71, 80, 84, 99, 115, 116, 131, 147, 154, 159, 160, 166, 183, 184, 212, 215, 223, 229, 230, 233, 247, 254, 279, 309, 856]
surviving nonsolo ucounts = 24[44, 55, 80, 84, 115, 116, 147, 154, 159, 160, 166, 183, 184, 212, 215, 223, 229, 230, 233, 247, 254, 279, 309, 856]
ids = [143, 1034, 932, 594, 909, 651, 686, 956, 81, 1052, ...]

====================================================================================

UMI info for barcode AGCTCTCTCATCACCC-1 contig 1 = GGAGCAGAGC...
umi CCACCTCATC = 279 reads: +397 validated
umi TACGTACACG = 308 reads: +397 validated
umi TTATATTAGC = 212 reads: +397 validated
umi TTCCTACAAG = 212 reads: +397 validated
umi TTTACTTCAA = 858 reads: -213X +184 invalidated

UMI info for barcode AGCTCTCTCATCACCC-1 contig 2 = AGCTCTGGGA...
umi AACCTATGAC = 223 reads: +422 -23 non-validated
umi AATTCTCGTT = 241 reads: +83 -2XX +1 -2XX +1 -1XX +1 -1XX +2 -1XX +3 -1XX +6 -1XX +309 -30 invalidated
umi ACAATATCTT = 160 reads: +445 validated
umi ACATGCTGTA = 253 reads: +430 -15 non-validated
umi ACTATATACT = 18 reads: -99 +13 -1XX +21 -1XX +8 -1XX +3 -1XX +3 -1XX +1 -3XX +3 -2XX +8 -95 +17 -2XX +1 -2XX +1 -1XX +6 -1XX +1 -3XX +23 -1XX +1 -1XX +13 -107 invalidated
umi ACTCGACTAT = 44 reads: +275 -1 +2 -1 +1 -1 +5 -1 +108 -50 non-validated
umi ATGTTGCCTT = 161 reads: +445 validated
umi CAGGATCCTT = 250 reads: +426 -1 +9 -6 +3 non-validated
umi CCAGGGTAAC = 229 reads: +416 -29 non-validated
umi CTCCGTTCTG = 175 reads: +445 validated
umi GCCCCTCTGC = 222 reads: +445 validated
umi GCGCTTCGGT = 83 reads: +368 -1 +6 -8 +62 non-validated
umi GCTTTCGAAC = 181 reads: +404 -41 non-validated
umi GGCTATCATT = 89 reads: -55 +1 -1 +11 -1 +276 -1XX +99 invalidated
umi GTAAACTGCC = 149 reads: +311 -1 +129 -4 non-validated
umi TCTGGGTCAG = 112 reads: +445 validated
umi TGACCTACAT = 79 reads: +388 -57 non-validated
umi TGGCACTGAG = 149 reads: +428 -17 non-validated
umi TTGCATCCCT = 56 reads: +438 -7 non-validated
umi TTTCAGTTAT = 157 reads: +443 -2 non-validated

GOOD CONTIGS

TIG 1[bases=635]
27-389 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=0)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 343 reads
cdr3 = CETWDSNTQVF at 363, score = 7 + 8
umis assigned: [329, 779, 994, 1013, 1048]
of which 5 are surviving nonsolos
reads assigned: 1847
start codons at 27, 191, 231, 346
confident = true

TIG 2[bases=596]
0-80 ==> 0-80 on |166|IGHV3-73|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |167|IGHV3-73|L-REGION+V-REGION| [len=359] (mis=5)
469-525 ==> 7-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
525-596 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 49 reads
cdr3 = CKGPCGGDCSKSGPYYYGMDVW at 428, score = 8 + 7
umis assigned: [28, 73, 81, 100, 140, 143, 235, 303, 333, 452] and 10 others
of which 19 are surviving nonsolos
reads assigned: 2962
start codons at 80, 236, 321, 360, 389, 482
confident = true
now this is a cell
paired!

TACTGTAAAGGGCCTTGTGGTGGTGATTGCTCAAAATCCGGTCCCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCTCCAACCTCCAGTTTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1264 = AGCTCTCTCCTTGGTC-1

using 120 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[3^2, 104]
surviving nonsolo ucounts = 1[104]
ids = [12]

====================================================================================

UMI info for barcode AGCTCTCTCCTTGGTC-1 contig 1 = GAGCCCCAGC...
umi TTGGTTACGG = 104 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=502]
0-67 ==> 169-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
67-398 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
439-476 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
476-502 ==> 0-26 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CTNLYHFGSEVW at 409, score = 9 + 7
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 67, 223, 284
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1281 = AGCTCTCTCTCTTGAT-1

using 10996 reads

====================================================================================

graph has 5911 edges initially, 52 edges after simplification

total ucounts = 1163
nonsolo ucounts = 601[2^241, 3^123, 4^78, 5^45, 6^31, 7^16, 8^10, 9^6, 10^2, 11^2, 12, 13, 14^3, 17^2, 23, 34, 43, 59, 66, 70, 92, 99, 118, 135, 151, 152, 168, 200^2, 201, 202, 217, 218, 224, 229^2, 230, 238, 251, 256^2, 286, 287, 291^2, 297, 299, 300, 307, 323, 332, 336, 348, 413]
surviving nonsolo ucounts = 36[43, 59, 66, 70, 92, 99, 118, 135, 151, 152, 200^2, 201, 202, 217, 218, 229^2, 230, 238, 251, 256^2, 286, 287, 291^2, 297, 299, 300, 307, 323, 332, 336, 348, 413]
ids = [800, 846, 295, 952, 834, 65, 262, 317, 261, 1123, ...]

====================================================================================

UMI info for barcode AGCTCTCTCTCTTGAT-1 contig 1 = GGAGGAGTCA...
umi AATTCCCTTG = 298 reads: +388 validated
umi ACAGGATTTA = 307 reads: +388 validated
umi ACATACAACT = 201 reads: +388 validated
umi ACCAGGAGAA = 202 reads: +388 validated
umi ACGCTACATG = 198 reads: +388 validated
umi AGTGCCACAT = 326 reads: +388 validated
umi CACCCCGGGA = 65 reads: +388 validated
umi CACTGGGTCT = 213 reads: +388 validated
umi CATCCTTTTT = 284 reads: +388 validated
umi CATGTCGTTC = 348 reads: +388 validated
umi GCAATGGTGG = 216 reads: +388 validated
umi GGTTTCCTCC = 257 reads: +388 validated
umi GTCAAATGGG = 338 reads: +388 validated
umi TAAGATCGTG = 228 reads: +388 validated
umi TAATGGGTTC = 292 reads: +388 validated
umi TATATATCGA = 304 reads: +388 validated
umi TGGATACGGC = 301 reads: +388 validated
umi TTATACAGCA = 233 reads: +388 validated
umi TTCGGTTTGG = 328 reads: +388 validated
umi TTCGTCTCTC = 257 reads: +388 validated
umi TTGAACTATC = 252 reads: +388 validated

UMI info for barcode AGCTCTCTCTCTTGAT-1 contig 2 = AGGTCTCAGA...
umi ACAATTCGCT = 98 reads: +419 -2 non-validated
umi ACATGTTAGT = 203 reads: +421 validated
umi ATTGTTTCGC = 144 reads: +407 -1 +2 -3 +2 -1 +5 non-validated
umi ATTGTTTCGT = 118 reads: +421 validated
umi CACTTTGGAT = 132 reads: +409 -1 +11 non-validated
umi CATCCCACTA = 416 reads: +5 -1XX +1 -1XX +413 invalidated
umi GCCACCCTCC = 287 reads: +417 -2X +2 invalidated
umi GTTCACCTTA = 42 reads: +363 -58 non-validated
umi TAATTAATCT = 91 reads: +398 -23 non-validated
umi TACCACGCCG = 59 reads: +372 -22 +27 non-validated
umi TAGATGTAGG = 237 reads: +410 -1 +10 non-validated
umi TCAAATGATA = 293 reads: +421 validated
umi TCGCTACCCG = 72 reads: +21 -1XX +272 -1 +24 -23 +70 -9 invalidated
umi TGTACTTCCG = 3 reads: -366X +1 -1X +1 -2X +5 -2X +2 -1XX +3 -2XX +14 -1XX +20 invalidated
umi TTGGTTTGCG = 153 reads: +390 -1 +15 -1 +14 non-validated

GOOD CONTIGS

TIG 1[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 909 reads
cdr3 = CQQSYSTPYTF at 356, score = 9 + 8
umis assigned: [56, 75, 78, 94, 116, 180, 295, 312, 335, 342] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5385
start codons at 29, 35, 91, 104, 240, 459
confident = true

TIG 2[bases=571]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
449-500 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 117 reads
cdr3 = CARDSFSSSWYWFDPW at 421, score = 9 + 7
umis assigned: [65, 85, 261, 262, 317, 331, 642, 800, 834, 846] and 5 others
of which 14 are surviving nonsolos
reads assigned: 2280
start codons at 79, 235, 296, 314, 382
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGACTCTTTTAGCAGCAGCTGGTACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1285 = AGCTCTCTCTGGCGAC-1

using 344 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 334]
surviving nonsolo ucounts = 1[334]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=430]
0-291 ==> 80-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=10)
313-359 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
359-430 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARGAARSGTVTLDYW at 280, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 71, 176
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1286 = AGCTCTCTCTGGTTCC-1

using 18 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1297 = AGCTTGAAGATGTGTA-1

using 355 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[12, 342]
surviving nonsolo ucounts = 1[342]
ids = [2]

====================================================================================

UMI info for barcode AGCTTGAAGATGTGTA-1 contig 1 = GAGTCAGTCT...
umi TCAAATGCCT = 321 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=476]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-476 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYSTPSATF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 25, 31, 87, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1306 = AGCTTGAAGGACACCA-1

using 1519 reads

====================================================================================

graph has 1822 edges initially, 24 edges after simplification

total ucounts = 595
nonsolo ucounts = 242[2^106, 3^42, 4^40, 5^20, 6^12, 7^8, 8^3, 9^4, 11, 13^2, 16, 17, 42, 268]
surviving nonsolo ucounts = 1[268]
ids = [174]

====================================================================================

UMI info for barcode AGCTTGAAGGACACCA-1 contig 1 = AGGAGTCAGA...
umi CACACCTCCG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-471 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [174]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1318 = AGCTTGACAAAGCGGT-1

using 136 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[134]
surviving nonsolo ucounts = 1[134]
ids = [1]

====================================================================================

UMI info for barcode AGCTTGACAAAGCGGT-1 contig 1 = AGCTTCAGCT...
umi CATCGATTCA = 128 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-554 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1323 = AGCTTGACAAGGGTCA-1

using 295 reads

====================================================================================

graph has 326 edges initially, 6 edges after simplification

total ucounts = 56
nonsolo ucounts = 39[2^8, 3^4, 4^4, 5^2, 6^2, 7^2, 8, 9^4, 10^3, 11^2, 12, 13^2, 14, 15, 17, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1325 = AGCTTGACAATCTGCA-1

using 176 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode AGCTTGACAATCTGCA-1 contig 1 = GGAGTGCTTT...
umi ACATACAGCA = 166 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=479]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
455-479 ==> 0-24 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARYFAFVNYYFDKW at 379, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 19, 40, 84
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1336 = AGCTTGACAGACTCGC-1

using 81 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4^2, 68]
surviving nonsolo ucounts = 1[68]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=442]
0-349 ==> 2-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
348-386 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
386-442 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 325, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 4, 73, 209, 428
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1338 = AGCTTGACAGCGTTCG-1

using 317 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode AGCTTGACAGCGTTCG-1 contig 1 = AGTCAGACTC...
umi CTTATCTCGT = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNSYPLTF at 351, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 24, 30, 86, 99, 235, 238, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1340 = AGCTTGACAGGCGATA-1

using 452 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 450]
surviving nonsolo ucounts = 1[450]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1347 = AGCTTGACATACCATG-1

using 1142 reads

====================================================================================

graph has 1462 edges initially, 34 edges after simplification

total ucounts = 507
nonsolo ucounts = 184[2^83, 3^52, 4^12, 5^14, 6^8, 7^4, 8^4, 9, 10, 11, 12^2, 14, 203]
surviving nonsolo ucounts = 1[203]
ids = [114]

====================================================================================

UMI info for barcode AGCTTGACATACCATG-1 contig 1 = CAGCTTCAGC...
umi ATTTCGAACG = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
436-507 ==> 0-71 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 369, score = 8 + 8
umis assigned: [114]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 48, 202, 352, 377, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1362 = AGCTTGAGTACGAAAT-1

using 135 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 128]
surviving nonsolo ucounts = 1[128]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=384]
0-129 ==> 6458-6587 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=4)
80-245 ==> 0-165 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=2)
246-326 ==> 273-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=4) [SHIFT!]
337-384 ==> 0-47 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
cdr3 = CAREGYSGYGLDPW at 315, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 80, 276, 340
confident = false
VJ delta = 118
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1367 = AGCTTGAGTAGCTGCC-1

using 295 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 4^3, 276]
surviving nonsolo ucounts = 1[276]
ids = [2]

====================================================================================

UMI info for barcode AGCTTGAGTAGCTGCC-1 contig 1 = GGAGGAACTG...
umi CACCTGCTAT = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=505]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-505 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNWPPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1371 = AGCTTGAGTCAAAGAT-1

using 183 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 179]
surviving nonsolo ucounts = 1[179]
ids = [1]

====================================================================================

UMI info for barcode AGCTTGAGTCAAAGAT-1 contig 1 = ATCACACAAC...
umi AGTTCCTGCA = 178 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=567]
0-57 ==> 3-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
57-410 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-567 ==> 0-101 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CVTDLATTVDYW at 399, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 57, 213, 255, 277, 292, 321, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1376 = AGCTTGAGTCGATTGT-1

using 80 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^2, 3^2, 4^2, 9^2, 10, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1379 = AGCTTGAGTCTTGTCC-1

using 232 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 226]
surviving nonsolo ucounts = 1[226]
ids = [1]

====================================================================================

UMI info for barcode AGCTTGAGTCTTGTCC-1 contig 1 = GATCAGGACT...
umi GCACGGTTTG = 222 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=469]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-469 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1382 = AGCTTGAGTGATAAGT-1

using 7882 reads

====================================================================================

graph has 6770 edges initially, 80 edges after simplification

total ucounts = 1501
nonsolo ucounts = 767[2^269, 3^163, 4^115, 5^65, 6^55, 7^23, 8^18, 9^11, 10^11, 11^7, 12^2, 13^3, 14, 15, 16^2, 17, 19, 22, 25, 28, 71, 157, 168, 202, 220, 238, 240, 269, 281, 290, 297, 326, 333, 362, 363^2]
surviving nonsolo ucounts = 17[28, 71, 157, 168, 202, 220, 238, 240, 269, 281, 290, 297, 326, 333, 362, 363^2]
ids = [79, 190, 1221, 164, 889, 1095, 601, 1178, 297, 518, ...]

====================================================================================

UMI info for barcode AGCTTGAGTGATAAGT-1 contig 1 = GGGAGTCTCA...
umi AGTGTCAGTG = 71 reads: +388 validated
umi ATCTGCGATA = 362 reads: +388 validated
umi ATGAGGCCCT = 360 reads: +388 validated
umi CAACGCCTTT = 273 reads: +388 validated
umi CATTCTAGGC = 299 reads: +388 validated
umi CCGAAATCCG = 285 reads: +388 validated
umi CGATAAGAGA = 236 reads: +388 validated
umi CTGGTGTCTG = 327 reads: +388 validated
umi GCCAGCTTTG = 203 reads: +388 validated
umi GTTTATTCCT = 365 reads: +388 validated
umi TAACGGTCTA = 220 reads: +388 validated
umi TCAATTACAG = 241 reads: +388 validated
umi TCCTAGGGTG = 154 reads: +388 validated
umi TCTTACGATA = 290 reads: +388 validated
umi TTGGCTTTTT = 332 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 595 reads
cdr3 = CQQSYSTPWQF at 350, score = 8 + 7
umis assigned: [190, 239, 245, 297, 428, 518, 601, 769, 889, 1081] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3953
start codons at 23, 29, 85, 98, 234, 453
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1400 = AGCTTGATCCATGAGT-1

using 205 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[202]
surviving nonsolo ucounts = 1[202]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1402 = AGCTTGATCCGTACAA-1

using 537 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 529]
surviving nonsolo ucounts = 1[529]
ids = [4]

====================================================================================

UMI info for barcode AGCTTGATCCGTACAA-1 contig 1 = AGCTTCAGCT...
umi CGTCCGATAG = 521 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
434-569 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CAAWDDSLSGPVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 511
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1404 = AGCTTGATCCTACAGA-1

using 413 reads

====================================================================================

graph has 212 edges initially, 28 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 190, 216]
surviving nonsolo ucounts = 2[190, 216]
ids = [4, 0]

====================================================================================

UMI info for barcode AGCTTGATCCTACAGA-1 contig 1 = TGCTTCAGCT...
umi CACTTCCTTT = 30 reads: +9 -1XX +4 -1XX +2 -1XX +2 -1XX +5 -1XX +20 -1XX +2 -1XX +6 -3XX +1 -1XX +1 -1XX +2 -1XX +4 -1XX +5 -1XX +1 -1XX +3 -309 +1 -1X invalidated
umi TCGCTTATGT = 180 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=575]
0-47 ==> 4-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
47-403 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
403-441 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
441-575 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 371, score = 7 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 203
start codons at 47, 201, 204, 255, 354, 381, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1410 = AGCTTGATCGCATGGC-1

using 347 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[345]
surviving nonsolo ucounts = 1[345]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=571]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 30, 99, 352, 477
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1435 = AGGCCACAGAGTAATC-1

using 344 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode AGGCCACAGAGTAATC-1 contig 1 = GCTCTGCTTC...
umi CAACCACGCC = 323 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=560]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
436-560 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQSYDSSLSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1436 = AGGCCACAGAGTACAT-1

using 269 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[261]
surviving nonsolo ucounts = 1[261]
ids = [6]

====================================================================================

UMI info for barcode AGGCCACAGAGTACAT-1 contig 1 = GTCAGACCCA...
umi CTGTGGATCC = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 23, 29, 85, 98, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1445 = AGGCCACAGCAATATG-1

using 437 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3, 5, 6, 7^2, 403]
surviving nonsolo ucounts = 1[403]
ids = [3]

====================================================================================

UMI info for barcode AGGCCACAGCAATATG-1 contig 1 = GGAGAAGAGC...
umi CACCTTATGC = 363 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
421-499 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYGSSPPTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1446 = AGGCCACAGCACAGGT-1

using 301 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACAGCACAGGT-1 contig 1 = CACATTCCTC...
umi GCTGAAGCTT = 284 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-45 ==> 13-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
45-398 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
399-417 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
418-481 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
481-531 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 387, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 45, 196, 243, 342, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1447 = AGGCCACAGCACCGCT-1

using 339 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 328]
surviving nonsolo ucounts = 1[328]
ids = [4]

====================================================================================

UMI info for barcode AGGCCACAGCACCGCT-1 contig 1 = AGAAGTCTCT...
umi GGATGATTTT = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-27 ==> 4-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-509 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQKYNSAPYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1451 = AGGCCACAGCCCAATT-1

using 861 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 855]
surviving nonsolo ucounts = 1[855]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1459 = AGGCCACAGCTGTCTA-1

using 259 reads

====================================================================================

graph has 111 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[8, 244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode AGGCCACAGCTGTCTA-1 contig 1 = AGCTTCAGCT...
umi ACGGCACGGG = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=18)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CAAWDASLIGVVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 47, 252, 333, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1467 = AGGCCACAGGGTATCG-1

using 23 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1469 = AGGCCACAGGTGCAAC-1

using 52 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 46]
surviving nonsolo ucounts = 1[46]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1471 = AGGCCACAGTACGCCC-1

using 102 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[101]
surviving nonsolo ucounts = 1[101]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=443]
0-352 ==> 6-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
367-415 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
415-443 ==> 0-28 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARRRSPWFGALDYW at 339, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 38, 217, 220, 300, 309, 359
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1479 = AGGCCACCAACACCCG-1

using 79 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 14[2^4, 3^2, 4^2, 6, 7, 8^2, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1485 = AGGCCACCAAGTTAAG-1

using 232 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACCAAGTTAAG-1 contig 1 = CCCAGCCCTG...
umi CATAAACGCA = 217 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=560]
0-63 ==> 173-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
63-416 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=23)
425-472 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
472-560 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CATLYHFGMEVW at 405, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 63, 219, 280, 429, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1492 = AGGCCACCACAAGCCC-1

using 116 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1493 = AGGCCACCACCAGCAC-1

using 313 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 304]
surviving nonsolo ucounts = 1[304]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACCACCAGCAC-1 contig 1 = GAGGAGTCAG...
umi AAAGGGCCTG = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=24)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQTHSSPRTF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1497 = AGGCCACCACCTCGTT-1

using 1415 reads

====================================================================================

graph has 2060 edges initially, 18 edges after simplification

total ucounts = 759
nonsolo ucounts = 274[2^126, 3^69, 4^35, 5^16, 6^5, 7^6, 8^6, 9^2, 10, 11^3, 12, 14^3, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1498 = AGGCCACCACGAAACG-1

using 235 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 1[233]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACCACGAAACG-1 contig 1 = TGAGCGCAGA...
umi TAGATTTCAT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-541 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CGTWDSGLSAVVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1507 = AGGCCACCAGAGTGTG-1

using 304 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode AGGCCACCAGAGTGTG-1 contig 1 = GTCAGTCCCA...
umi ACGTTCGCTG = 302 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1510 = AGGCCACCAGCCTATA-1

using 34 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 26]
surviving nonsolo ucounts = 1[26]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=349]
2-270 ==> 64-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=23)
288-326 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
326-349 ==> 0-23 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHLVTHPISF at 265, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 18
start codons at 149, 152
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1511 = AGGCCACCAGCGTTCG-1

using 366 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 358]
surviving nonsolo ucounts = 1[358]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACCAGCGTTCG-1 contig 1 = AGAGCTGCTC...
umi GGGCAGTAAT = 360 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=561]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSLSGRFTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 31, 239, 365, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1515 = AGGCCACCAGGAACGT-1

using 767 reads

====================================================================================

graph has 298 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 4^2, 189, 283^2]
surviving nonsolo ucounts = 3[189, 283^2]
ids = [5, 3, 4]

====================================================================================

UMI info for barcode AGGCCACCAGGAACGT-1 contig 1 = GAGCTCTGGG...
umi CGCTACGAGC = 282 reads: +445 validated

UMI info for barcode AGGCCACCAGGAACGT-1 contig 2 = AAAAACCACA...
umi TATTTGGGCT = 177 reads: +436 validated

UMI info for barcode AGGCCACCAGGAACGT-1 contig 3 = GGAATCAGTC...
umi CGTCGGGAGG = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=614]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=14)
479-525 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
525-614 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDAPYMIGGGTAQWVPMGMDVW at 422, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 80, 231, 236, 294, 297, 306, 383, 432, 443, 466, 476, 482, 506, 579
confident = false

TIG 2[bases=575]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-575 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false

TIG 3[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1516 = AGGCCACCAGGTCGTC-1

using 220 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[12, 204]
surviving nonsolo ucounts = 1[204]
ids = [3]

====================================================================================

UMI info for barcode AGGCCACCAGGTCGTC-1 contig 1 = GTCAGACTCA...
umi GGGTCTCAGC = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1518 = AGGCCACCAGTGACAG-1

using 260 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 253]
surviving nonsolo ucounts = 1[253]
ids = [3]

====================================================================================

UMI info for barcode AGGCCACCAGTGACAG-1 contig 1 = ACCCAAAAAC...
umi CAATTTGTGG = 244 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-564 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1521 = AGGCCACCAGTTTACG-1

using 297 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 287]
surviving nonsolo ucounts = 1[287]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACCAGTTTACG-1 contig 1 = AGGAATCAGT...
umi ATAAGTTCGT = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1532 = AGGCCACCATTAGGCT-1

using 252 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode AGGCCACCATTAGGCT-1 contig 1 = GCTGGGGTCT...
umi TACAATTAGC = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
41-385 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-468 ==> 0-39 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYISSTTLGF at 365, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 41, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1543 = AGGCCACGTCAGATAA-1

using 253 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [4]

====================================================================================

UMI info for barcode AGGCCACGTCAGATAA-1 contig 1 = AGGAGTCAGA...
umi TCTTCGGTGC = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-476 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 27, 33, 89, 102, 241, 259, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1549 = AGGCCACGTCGGCATC-1

using 181 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[179]
surviving nonsolo ucounts = 1[179]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACGTCGGCATC-1 contig 1 = CCAACAACCA...
umi TCCAAACCTG = 163 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=559]
0-53 ==> 251-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
53-406 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
435-483 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
483-559 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 395, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 53, 209, 251, 317, 350, 440, 537
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1553 = AGGCCACGTCTTCTCG-1

using 299 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACGTCTTCTCG-1 contig 1 = GAGGAGTCAG...
umi GACCTACTTC = 301 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=549]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1565 = AGGCCACGTTCCCTTG-1

using 304 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 294]
surviving nonsolo ucounts = 1[294]
ids = [1]

====================================================================================

UMI info for barcode AGGCCACGTTCCCTTG-1 contig 1 = ACAACAGGCA...
umi ACAATTTTGC = 297 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYGSPRTF at 364, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 22, 25, 80, 94, 347, 377, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1566 = AGGCCACGTTCGTCTC-1

using 293 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 11, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACGTTCGTCTC-1 contig 1 = GGGAATCAGT...
umi AGGCTTAGGA = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1569 = AGGCCACGTTTGACAC-1

using 323 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 5, 312]
surviving nonsolo ucounts = 1[312]
ids = [3]

====================================================================================

UMI info for barcode AGGCCACGTTTGACAC-1 contig 1 = GGAGTGCTTT...
umi TAGCCCCCAG = 315 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=637]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
455-637 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 46 reads
cdr3 = CARAHGDYYTLLDCW at 379, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 19, 40, 84, 170
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1573 = AGGCCACTCAACGGCC-1

using 261 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode AGGCCACTCAACGGCC-1 contig 1 = AGCTTCAGCT...
umi CCCATTGGCG = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-525 ==> 0-91 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1577 = AGGCCACTCAGCGACC-1

using 243 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACTCAGCGACC-1 contig 1 = GCTCTGCTTC...
umi CTGTATTCTT = 231 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=565]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-565 ==> 0-120 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1579 = AGGCCACTCATACGGT-1

using 272 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode AGGCCACTCATACGGT-1 contig 1 = GAGTCAGACC...
umi CACGCTCAGT = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
382-413 ==> 8-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYRSYSRDF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 25, 31, 87, 100, 151, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1581 = AGGCCACTCATCTGTT-1

using 1806 reads

====================================================================================

graph has 2645 edges initially, 24 edges after simplification

total ucounts = 879
nonsolo ucounts = 411[2^192, 3^95, 4^52, 5^28, 6^19, 7^13, 8^3, 9^3, 10^2, 11^3, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1582 = AGGCCACTCCACGACG-1

using 349 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 339]
surviving nonsolo ucounts = 1[339]
ids = [6]

====================================================================================

UMI info for barcode AGGCCACTCCACGACG-1 contig 1 = AGAAGAGCTG...
umi TTTCGCCATA = 338 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQHATSPFTF at 358, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 34, 242, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1584 = AGGCCACTCCCATTAT-1

using 222 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 15, 197]
surviving nonsolo ucounts = 1[197]
ids = [5]

====================================================================================

UMI info for barcode AGGCCACTCCCATTAT-1 contig 1 = GGGGTCACAA...
umi GTCACCTCCT = 195 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=530]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
432-530 ==> 0-98 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CCSYAGSSTIPYIF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 38, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1590 = AGGCCACTCCTTTACA-1

using 7218 reads

====================================================================================

graph has 3215 edges initially, 28 edges after simplification

total ucounts = 603
nonsolo ucounts = 261[2^101, 3^57, 4^31, 5^18, 6^11, 7^4, 8^4, 9^5, 12, 17, 23, 120, 129, 137, 140, 144, 153, 178, 187, 198^2, 207, 210, 218, 220, 226, 240, 247, 251, 265, 272, 282, 289, 291, 301, 308, 317, 338]
surviving nonsolo ucounts = 27[120, 129, 137, 140, 144, 153, 178, 187, 198^2, 207, 210, 218, 220, 226, 240, 247, 251, 265, 272, 282, 289, 291, 301, 308, 317, 338]
ids = [447, 598, 233, 13, 255, 554, 353, 523, 160, 300, ...]

====================================================================================

UMI info for barcode AGGCCACTCCTTTACA-1 contig 1 = GCTCTGCTTC...
umi AACATTTATC = 142 reads: +394 validated
umi AATCATCTGT = 318 reads: +394 validated
umi ACAGTCCCTA = 271 reads: +394 validated
umi ACGTCAACAT = 240 reads: +394 validated
umi ACTTGTCTCA = 294 reads: +394 validated
umi AGCCCGCAGT = 298 reads: +394 validated
umi ATCAATGCAG = 211 reads: +394 validated
umi CAACGAGGGG = 345 reads: +394 validated
umi CCCACGCCTA = 255 reads: +394 validated
umi CCTACGACCT = 135 reads: +394 validated
umi CGCATATATG = 141 reads: +394 validated
umi CGGGTCGTAA = 263 reads: +394 validated
umi CGGTTTCTAA = 287 reads: +394 validated
umi CTCGGCTTAA = 200 reads: +394 validated
umi CTCTTAGACG = 212 reads: +394 validated
umi GAAGCCAGTG = 283 reads: +394 validated
umi GCCGCTACCA = 180 reads: +394 validated
umi GCGAGCCCTA = 247 reads: +394 validated
umi TACCAATCGG = 306 reads: +394 validated
umi TAGCTCCACG = 120 reads: +394 validated
umi TCGGCACCTT = 218 reads: +394 validated
umi TGCCCTCACA = 188 reads: +394 validated
umi TTAGGCTATA = 218 reads: +394 validated
umi TTATCGGCTA = 156 reads: +394 validated
umi TTTTACGGCT = 224 reads: +394 validated
umi TTTTCTGTGC = 130 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 26 umis using 873 reads
cdr3 = CQSYDSSLSGSVVF at 375, score = 8 + 8
umis assigned: [13, 25, 35, 63, 76, 83, 111, 155, 213, 233] and 16 others
of which 26 are surviving nonsolos
reads assigned: 5783
start codons at 51, 205, 208, 259, 358, 385
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1591 = AGGCCACTCCTTTCGG-1

using 444 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 439]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1592 = AGGCCACTCGAGAACG-1

using 493 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3, 6, 10, 13, 221, 232]
surviving nonsolo ucounts = 3[13, 221, 232]
ids = [9, 0, 3]

====================================================================================

UMI info for barcode AGGCCACTCGAGAACG-1 contig 1 = AGCTGGGAAG...
umi ATCTGACCGC = 221 reads: +403 validated
umi CCGTTGAGGG = 232 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=644]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=8)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CVLNMGSGISVF at 369, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 447
start codons at 30, 45, 54, 57, 82, 352, 381
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1603 = AGGCCACTCTATCGCC-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1606 = AGGCCACTCTCCCTGA-1

using 193 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1610 = AGGCCACTCTGATACG-1

using 1770 reads

====================================================================================

graph has 2517 edges initially, 30 edges after simplification

total ucounts = 894
nonsolo ucounts = 379[2^175, 3^90, 4^55, 5^26, 6^12, 7^4, 8^7, 9^2, 10, 11^4, 12, 16, 29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1612 = AGGCCACTCTGTACGA-1

using 643 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 4, 232, 399]
surviving nonsolo ucounts = 2[232, 399]
ids = [8, 4]

====================================================================================

UMI info for barcode AGGCCACTCTGTACGA-1 contig 1 = GGTCTGCTTC...
umi CTATTATGCA = 389 reads: +394 validated
umi TCTCTAAGGT = 230 reads: +161 -1XX +232 invalidated

GOOD CONTIGS

TIG 1[bases=580]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-580 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 98 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4, 8]
of which 2 are surviving nonsolos
reads assigned: 606
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1614 = AGGCCACTCTGTTTGT-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1619 = AGGCCGTAGAACAATC-1

using 20639 reads

====================================================================================

graph has 8454 edges initially, 116 edges after simplification

total ucounts = 983
nonsolo ucounts = 469[2^175, 3^84, 4^45, 5^28, 6^19, 7^12, 8^9, 9^5, 10^6, 13^2, 15, 16, 18, 20, 22, 23, 29, 45^2, 65, 74, 76, 104, 106, 107, 120, 124, 127, 130, 135, 136, 143^3, 156, 167, 172, 179, 186, 187, 189, 200, 201, 203, 219, 224, 234, 239^2, 241, 245, 247^2, 249, 250^4, 254^2, 255, 257, 260, 265, 266, 269, 270, 274^2, 276, 278^2, 289, 291, 295, 296, 303, 307, 313, 314, 316, 320, 332^2, 348, 354, 364, 367, 391, 403, 415, 433, 490, 607]
surviving nonsolo ucounts = 74[45, 65, 76, 104, 106, 107, 124, 127, 130, 135, 136, 143^3, 156, 167, 172, 179, 186, 187, 189, 200, 201, 203, 219, 224, 234, 239^2, 241, 245, 247^2, 249, 250^4, 254^2, 255, 257, 260, 265, 266, 269, 270, 274^2, 276, 278^2, 289, 291, 295, 296, 303, 307, 313, 314, 316, 320, 332^2, 348, 354, 364, 367, 391, 403, 415, 433, 490, 607]
ids = [569, 286, 104, 382, 602, 303, 29, 527, 188, 41, ...]

====================================================================================

UMI info for barcode AGGCCGTAGAACAATC-1 contig 1 = TGAGCGCAGA...
umi AAACAACAGT = 328 reads: +267 -1XX +123 invalidated
umi AACTATTATC = 144 reads: +185 -2X +4 -1XX +199 invalidated
umi ACCAGACTAT = 246 reads: +391 validated
umi ACCCCCCCTT = 63 reads: +24 -1 +1 -2X +1 -5XX +1 -1XX +1 -6XX +283 -1 +1 -1 +8 -1 +5 -2X +3 -1 +20 -1 +7 -1 +1 -12 invalidated
umi ACTTGCACCT = 241 reads: +391 validated
umi AGCTCGGGGC = 339 reads: +391 validated
umi AGTGGAACGC = 99 reads: +26 -2XX +1 -5X +1 -1XX +1 -6XX +348 invalidated
umi ATACACTGGA = 274 reads: +391 validated
umi ATACTCACGC = 334 reads: +391 validated
umi CAACATCATC = 599 reads: +391 validated
umi CAAGGTCTCA = 277 reads: +391 validated
umi CACGGATTAC = 82 reads: +21 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +348 invalidated
umi CCGTGTAGCG = 102 reads: +391 validated
umi GACGGCTATC = 247 reads: +391 validated
umi GAGGGCTTTC = 319 reads: +391 validated
umi GATCCTCCCT = 241 reads: +391 validated
umi GCCTGACCGT = 142 reads: +391 validated
umi GCGGCCCCAG = 269 reads: -357X +1 -1XX +1 -2XX +1 -4XX +1 -3XX +1 -10XX +1 -1XX +1 -4XX +2 invalidated
umi GGAACTGATC = 106 reads: +391 validated
umi GGGACGTGTC = 300 reads: +391 validated
umi GTCCTTTAAA = 389 reads: -5XX +1 -86XX +2 -1XX +1 -1XX +1 -1XX +292 invalidated
umi TAAGGGCTGG = 251 reads: +391 validated
umi TACAGGTGGG = 292 reads: +391 validated
umi TACTCACTTA = 204 reads: +391 validated
umi TCACGCCAAT = 256 reads: +391 validated
umi TCTGCCGGAG = 248 reads: +391 validated
umi TGATCACCCT = 261 reads: +391 validated
umi TGCATTCTGC = 247 reads: +391 validated
umi TGCGTGAATC = 252 reads: +391 validated
umi TTACATCATC = 249 reads: +391 validated
umi TTGTCCGCAT = 181 reads: +391 validated

UMI info for barcode AGGCCGTAGAACAATC-1 contig 2 = AGCTCTGGGA...
umi AACCTAGATC = 121 reads: -18X +1 -2X +1 -3X +1 -3XX +4 -1XX +2 -1XX +1 -1XX +2 -3XX +377 invalidated
umi AAGTCCTACC = 276 reads: +421 validated
umi ATTATTATCG = 140 reads: -18X +1 -2XX +1 -3XX +1 -3XX +4 -1XX +2 -1XX +1 -1XX +2 -3XX +377 invalidated
umi ATTCGGCTTA = 233 reads: +421 validated
umi CAAGTTGGGG = 68 reads: +366 -55 non-validated
umi CCATAACCCC = 129 reads: +421 validated
umi CGGAATTCTC = 264 reads: +421 validated
umi GCATCGGTTA = 44 reads: +226 -4 +9 -1 +3 -1 +131 -46 non-validated
umi GTCCGACCTT = 269 reads: +421 validated
umi GTCCTGGCCC = 250 reads: +75 -1XX +345 invalidated
umi GTTTTAGTCT = 292 reads: +421 validated
umi TAACGCTGGG = 205 reads: +406 -1 +1 -1 +1 -1 +1 -1 +8 non-validated
umi TACAATTCCC = 257 reads: +421 validated
umi TGGGACTTTG = 161 reads: -379X +1 -1X +3 -2X +9 -1XX +2 -1XX +3 -2XX +17 invalidated

GOOD CONTIGS

TIG 1[bases=638]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 29 umis using 1114 reads
cdr3 = CGTWDSSLSVHWVF at 357, score = 7 + 8
umis assigned: [4, 41, 100, 104, 149, 173, 188, 194, 198, 275] and 21 others
of which 31 are surviving nonsolos
reads assigned: 7421
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=1)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 194 reads
cdr3 = CTRDVGSTYYFDYW at 428, score = 8 + 7
umis assigned: [29, 62, 252, 257, 286, 348, 419, 569, 665, 667] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2652
start codons at 80, 133, 231, 236, 303, 360, 389, 438
confident = true

REJECT CONTIGS

TIG 1[bases=549]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-35 ==> 5965-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [15, 132, 154, 225, 331, 338, 341, 428, 513, 527] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4274
start codons at 35, 243, 369, 455
confident = false
did not find CDR3

TIG 2[bases=757]
5-32 ==> 5973-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=0)
45-88 ==> 0-43 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=0)
91-203 ==> 0-112 on segment before IGLV10-54 exon 2 [len=112] (mis=0)
200-509 ==> 43-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=3) [SHIFT!]
508-546 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
546-757 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [5, 208, 265, 296, 365, 462, 503, 607, 674, 718] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3242
start codons at 45, 296, 486
confident = false
did not find CDR3
now this is a cell
paired!

AAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGATGTAGGCAGCACGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGTTCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 11.1626 = AGGCCGTAGCCCAATT-1

using 59 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 32
nonsolo ucounts = 10[2^3, 3^2, 4^2, 5^2, 7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.09
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk011-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk011-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

73.462 seconds used processing barcodes, peak mem = 0.25
