[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.38 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk001-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk001-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk001.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.0 = AACTCCCTCTAACTCT-1

using 4282 reads

====================================================================================

graph has 4325 edges initially, 96 edges after simplification

total ucounts = 814
nonsolo ucounts = 622[2^119, 3^74, 4^53, 5^50, 6^53, 7^48, 8^48, 9^38, 10^25, 11^28, 12^29, 13^15, 14^16, 15^9, 16^5, 17^4, 18^2, 20, 22^2, 24, 25, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.7 = AACTCCCTCTGAAAGA-1

using 338 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2^3, 3^2, 5, 10, 25, 280]
surviving nonsolo ucounts = 1[280]
ids = [2]

====================================================================================

UMI info for barcode AACTCCCTCTGAAAGA-1 contig 1 = GGAGAAGAGC...
umi CCAGTTCCAG = 276 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=471]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-347 ==> 0-311 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=7)
427-471 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQHYDTSSPRYSF at 360, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 36, 247, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.21 = AACTCTTAGAAGCCCA-1

using 420 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 4[4^2, 192, 208]
surviving nonsolo ucounts = 2[192, 208]
ids = [4, 11]

====================================================================================

UMI info for barcode AACTCTTAGAAGCCCA-1 contig 1 = GGAATCAGTC...
umi CAATTACTTT = 187 reads: +388 validated

UMI info for barcode AACTCTTAGAAGCCCA-1 contig 2 = AAAAACCACA...
umi GACACTCCCT = 208 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=456]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-456 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 26, 32, 101, 237
confident = false

TIG 2[bases=510]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-510 ==> 0-24 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.24 = AACTCTTAGAGCAATT-1

using 493 reads

====================================================================================

graph has 196 edges initially, 22 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 76, 140, 271]
surviving nonsolo ucounts = 3[76, 140, 271]
ids = [0, 4, 1]

====================================================================================

UMI info for barcode AACTCTTAGAGCAATT-1 contig 1 = AGGAGTCAGA...
umi AATGATGCTG = 71 reads: +388 validated

UMI info for barcode AACTCTTAGAGCAATT-1 contig 2 = GATCAGGACT...
umi TCGTTTCCCC = 136 reads: +397 validated

UMI info for barcode AACTCTTAGAGCAATT-1 contig 3 = GGAGGAGTCA...
umi ACCTACCCCG = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 70
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false

TIG 2[bases=499]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-499 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false

TIG 3[bases=489]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-489 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.26 = AACTCTTAGAGCTGGT-1

using 297 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 3[2, 92, 192]
surviving nonsolo ucounts = 2[92, 192]
ids = [5, 1]

====================================================================================

UMI info for barcode AACTCTTAGAGCTGGT-1 contig 1 = GAGGCAGCAC...
umi AAAAGACTGA = 189 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=525]
0-28 ==> 14-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
28-371 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=12)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-525 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CCSYAGTSTNWVF at 352, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 28, 167, 179, 185, 229, 236, 239, 335, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.27 = AACTCTTAGATAGGAG-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.29 = AACTCTTAGATCTGCT-1

using 288 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=509]
1-76 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
25-300 ==> 0-275 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=5)
301-377 ==> 275-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=6) [SHIFT!]
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 25, 31, 87, 100, 236, 336, 456
confident = false
not full
frameshifted full length stopped transcript of length 509
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.30 = AACTCTTAGATGGCGT-1

using 232 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 226]
surviving nonsolo ucounts = 1[226]
ids = [3]

====================================================================================

UMI info for barcode AACTCTTAGATGGCGT-1 contig 1 = AGGAGTCAGA...
umi TAGAGGCCGG = 222 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=459]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
409-459 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQANSFPF at 354, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 27, 33, 89, 102, 238, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.33 = AACTCTTAGCAGGTCA-1

using 316 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[313]
surviving nonsolo ucounts = 1[313]
ids = [2]

====================================================================================

UMI info for barcode AACTCTTAGCAGGTCA-1 contig 1 = AGGAACTGCT...
umi TGTTCCCCGC = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
420-501 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQHRSDWPPIFTF at 353, score = 10 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 32, 237, 240, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.45 = AACTCTTAGGAGCGTT-1

using 878 reads

====================================================================================

graph has 836 edges initially, 10 edges after simplification

total ucounts = 299
nonsolo ucounts = 138[2^56, 3^19, 4^22, 5^14, 6^10, 7^6, 8^3, 9^2, 10^2, 11, 12, 15, 188]
surviving nonsolo ucounts = 1[188]
ids = [82]

====================================================================================

UMI info for barcode AACTCTTAGGAGCGTT-1 contig 1 = GCTCTGCTTC...
umi CAGTAGTCGC = 187 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [82]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.46 = AACTCTTAGGCAAAGA-1

using 269 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTAGGCAAAGA-1 contig 1 = GTCAGACCCA...
umi CAAAGATAAC = 253 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=457]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
370-402 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
402-457 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQHYNSYF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 85, 98, 330, 393, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.47 = AACTCTTAGGCAGGTT-1

using 162 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=495]
0-323 ==> 11-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=23)
333-371 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
371-495 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQAWDSNAGIYVF at 304, score = 5 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 50, 137, 283, 287, 335
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.48 = AACTCTTAGGCATGTG-1

using 250 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[6, 7, 235]
surviving nonsolo ucounts = 1[235]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.54 = AACTCTTAGTAATCCC-1

using 254 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[10, 240]
surviving nonsolo ucounts = 1[240]
ids = [1]

====================================================================================

UMI info for barcode AACTCTTAGTAATCCC-1 contig 1 = GGAGAACTCA...
umi CGCGCTATAT = 227 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=469]
12-365 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=3)
374-424 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
424-469 ==> 0-45 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CAKSGPRRAFDIW at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 12, 163, 168, 315, 405, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.64 = AACTCTTAGTTACCCA-1

using 147 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 7, 130]
surviving nonsolo ucounts = 1[130]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTAGTTACCCA-1 contig 1 = AGAGAAGACA...
umi ACACCGGTCG = 127 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-31 ==> 83-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
31-384 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=20)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-528 ==> 0-109 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CASWDDSLYGVVF at 352, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 31, 242, 245, 335, 360, 365, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.71 = AACTCTTCAACACCTA-1

using 656 reads

====================================================================================

graph has 174 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 154, 488]
surviving nonsolo ucounts = 2[154, 488]
ids = [1, 6]

====================================================================================

UMI info for barcode AACTCTTCAACACCTA-1 contig 1 = GGAGTCAGAC...
umi ATCACCCCAT = 152 reads: +388 validated
umi CTTTGTGGCT = 460 reads: -348 +2 -5XX +1 -1XX +8 -1XX +5 -5XX +1 -1XX +2 -2XX +1 -1XX +4 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 603
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.74 = AACTCTTCAAGAAAGG-1

using 186 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 177]
surviving nonsolo ucounts = 1[177]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTCAAGAAAGG-1 contig 1 = TGGGGGAGTC...
umi CCACGTAGTT = 163 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-486 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.88 = AACTCTTCACATTAGC-1

using 268 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 260]
surviving nonsolo ucounts = 1[260]
ids = [6]

====================================================================================

UMI info for barcode AACTCTTCACATTAGC-1 contig 1 = GGAGTCAGAC...
umi TTATTGCATG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNSYSLTF at 353, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.92 = AACTCTTCACCGGAAA-1

using 212 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 6, 198]
surviving nonsolo ucounts = 1[198]
ids = [2]

====================================================================================

UMI info for barcode AACTCTTCACCGGAAA-1 contig 1 = ATCAGTCCCA...
umi CGATTTTAGC = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-468 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.104 = AACTCTTCAGACTCGC-1

using 282 reads

====================================================================================

graph has 132 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 5, 108, 159]
surviving nonsolo ucounts = 2[108, 159]
ids = [2, 8]

====================================================================================

UMI info for barcode AACTCTTCAGACTCGC-1 contig 1 = GAAGAGAGGC...
umi TAGTATATGT = 157 reads: +376 -1 +8 non-validated

UMI info for barcode AACTCTTCAGACTCGC-1 contig 2 = GCTTCAGCTG...
umi CAATGCCCAG = 101 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=521]
65-412 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
412-450 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
450-521 ==> 0-71 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CYSTDNSGRHSGMF at 380, score = 6 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 65, 126, 213, 260, 264, 363, 416
confident = false

TIG 2[bases=454]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 100
start codons at 46, 200, 203, 254, 353, 380, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.111 = AACTCTTCAGGCTCAC-1

using 160 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 150]
surviving nonsolo ucounts = 1[150]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=491]
0-34 ==> 22-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
34-80 ==> 0-46 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=0)
77-217 ==> 168-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=8) [SHIFT!]
242-280 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
280-491 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 34, 120, 213
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.126 = AACTCTTCATGGTCTA-1

using 5194 reads

====================================================================================

graph has 3521 edges initially, 69 edges after simplification

total ucounts = 1178
nonsolo ucounts = 877[2^175, 3^142, 4^107, 5^98, 6^86, 7^55, 8^58, 9^41, 10^25, 11^20, 12^23, 13^16, 14^8, 15^4, 16^6, 17^6, 18^2, 19, 20, 21^2, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.128 = AACTCTTCATTAGCCA-1

using 598 reads

====================================================================================

graph has 838 edges initially, 22 edges after simplification

total ucounts = 265
nonsolo ucounts = 110[2^47, 3^26, 4^11, 5^9, 6^6, 7^3, 8, 10, 13, 15, 16, 18, 20, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.135 = AACTCTTGTACATGTC-1

using 145 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[145]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.140 = AACTCTTGTAGAGCTG-1

using 220 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 21, 190]
surviving nonsolo ucounts = 1[190]
ids = [7]

====================================================================================

UMI info for barcode AACTCTTGTAGAGCTG-1 contig 1 = GTCAGTCTCA...
umi AAGATTGGCT = 9 reads: +22 -1XX +18 -1XX +6 -1XX +3 -1XX +9 -1X +47 -1XX +13 -1XX +22 -2X +5 -2X +1 -3X +5 -28X +9 -1X +3 -1X +3 -1X +17 -1XX +25 -1X +3 -2X +9 -119 invalidated
umi TTTCGTACAC = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-459 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYSTPLSF at 350, score = 9 + 8
umis assigned: [0, 7]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.161 = AACTCTTGTCTAGCCG-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.164 = AACTCTTGTCTCCCTA-1

using 976 reads

====================================================================================

graph has 266 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 969]
surviving nonsolo ucounts = 1[969]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=344]
2-98 ==> 257-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=5)
95-133 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
133-344 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 66, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 952
start codons at 49, 74, 79
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.176 = AACTCTTGTGTTGAGG-1

using 248 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.180 = AACTCTTGTTCCCTTG-1

using 229 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTGTTCCCTTG-1 contig 1 = GCTACAACAG...
umi ACGTTTGGGT = 231 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYYGSPRTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 25, 28, 83, 97, 350, 380, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.181 = AACTCTTGTTCCTCCA-1

using 6085 reads

====================================================================================

graph has 3121 edges initially, 30 edges after simplification

total ucounts = 745
nonsolo ucounts = 335[2^136, 3^83, 4^41, 5^23, 6^15, 7^6, 8^4, 9^2, 10^3, 17, 82, 100, 106, 138, 147, 217, 218, 219, 222, 238, 242, 244, 245, 255, 263, 264, 266, 288^2, 300, 304]
surviving nonsolo ucounts = 19[100, 106, 138, 217, 218, 219, 222, 238, 242, 244, 245, 255, 263, 264, 266, 288^2, 300, 304]
ids = [739, 170, 398, 676, 192, 21, 323, 400, 117, 308, ...]

====================================================================================

UMI info for barcode AACTCTTGTTCCTCCA-1 contig 1 = AATTAGGACT...
umi AAACATCCAC = 262 reads: +397 validated
umi AACCATATCA = 229 reads: +124 -1XX +272 invalidated
umi AATTTGTGCG = 262 reads: +397 validated
umi ACCAAAGGCA = 301 reads: +397 validated
umi AGCAAGGGTA = 238 reads: +397 validated
umi AGTAACCACA = 263 reads: +397 validated
umi ATGTGTACTG = 104 reads: +397 validated
umi ATTACTTAGC = 309 reads: +397 validated
umi ATTATATCTT = 249 reads: +397 validated
umi ATTGCAGGGT = 215 reads: +397 validated
umi CCTTACTACT = 243 reads: +397 validated
umi CGAATATCAA = 288 reads: +397 validated
umi CGACATTCGT = 220 reads: +397 validated
umi CTTACATGCC = 135 reads: +397 validated
umi CTTAGCGCTG = 237 reads: +397 validated
umi GCACACACTC = 255 reads: +397 validated
umi TGTGTTCCCG = 213 reads: +397 validated
umi TTTTGGCTGA = 100 reads: +397 validated
umi TTTTGTCAGC = 287 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=5)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 500 reads
cdr3 = CMQATQSPWTF at 366, score = 9 + 8
umis assigned: [3, 21, 51, 69, 117, 130, 170, 179, 183, 192] and 9 others
of which 19 are surviving nonsolos
reads assigned: 4359
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.186 = AACTCTTGTTGAGGTG-1

using 641 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[641]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=367]
1-72 ==> 3079-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=7)
118-156 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
156-367 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 632
start codons at 6, 14, 99
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.198 = AACTCTTTCAAGGCTT-1

using 297 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2, 3^3, 277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTTCAAGGCTT-1 contig 1 = ATACTTTCTG...
umi AAGACCATGA = 272 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=539]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=8)
399-449 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
449-539 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CARDNGWVNAFDIW at 376, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 37, 81, 337, 389, 401, 430
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.205 = AACTCTTTCAGAGACG-1

using 182 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3, 7, 161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================

UMI info for barcode AACTCTTTCAGAGACG-1 contig 1 = ACTGCCCAGC...
umi ATTCACAGCA = 156 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=538]
0-47 ==> 12-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
47-400 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
419-465 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
465-538 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARPYNSYWLGFDYW at 389, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 47, 221, 519
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.211 = AACTCTTTCATGGTCA-1

using 11771 reads

====================================================================================

graph has 11708 edges initially, 174 edges after simplification

total ucounts = 3097
nonsolo ucounts = 1456[2^604, 3^318, 4^188, 5^126, 6^75, 7^49, 8^28, 9^15, 10^10, 11^8, 12^6, 13^6, 14^3, 15, 17, 20, 98, 131, 186, 192, 211, 217, 228, 239, 253, 266, 296, 320, 326, 399, 414, 600, 625]
surviving nonsolo ucounts = 19[2^2, 6, 98, 131, 186, 192, 211, 217, 228, 239, 266, 296, 320, 326, 399, 414, 600, 625]
ids = [619, 1361, 2258, 2095, 2260, 1884, 937, 1441, 1207, 1668, ...]

====================================================================================

UMI info for barcode AACTCTTTCATGGTCA-1 contig 1 = GGGGAGGAGT...
umi CATGTGGAGT = 190 reads: +388 validated
umi CCATTTTCGT = 323 reads: +388 validated
umi CGACGGACCG = 325 reads: +388 validated
umi CTATGTGATG = 263 reads: +388 validated
umi CTCCGTTTTC = 212 reads: +388 validated
umi GGCAAACAGC = 298 reads: +388 validated
umi TGTACAACGG = 236 reads: +388 validated
umi TTTAATCCCT = 101 reads: +17 -1XX +4 -1XX +25 -1XX +2 -1XX +10 -1XX +27 -1XX +17 -1XX +1 -1XX +13 -1XX +1 -72 +2 -1XX +1 -1XX +3 -1XX +3 -1XX +1 -1XX +1 -1XX +3 -1XX +4 -1XX +4 -1XX +3 -2XX +20 -1XX +3 -2XX +15 -1XX +2 -1XX +3 -1XX +2 -67X +1 -1X +2 -1X +2 -1XX +4 -2XX +8 -1XX +3 -1XX +1 -1XX +5 -1XX +1 invalidated

UMI info for barcode AACTCTTTCATGGTCA-1 contig 2 = GAATTCTGGC...
umi GCTGCAGTGT = 186 reads: +415 validated
umi GTCCCCGGCC = 97 reads: +379 -36 non-validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 296 reads
cdr3 = CQQDDTLPGTF at 358, score = 9 + 8
umis assigned: [937, 1016, 1214, 1411, 1441, 1933, 2752, 3018]
of which 7 are surviving nonsolos
reads assigned: 1921
start codons at 31, 37, 93, 106, 245, 341, 368, 461
confident = true

TIG 2[bases=522]
0-40 ==> 12-52 on |206|IGHV6-1|5'UTR| [len=52] (mis=0)
40-405 ==> 0-365 on |207|IGHV6-1|L-REGION+V-REGION| [len=365] (mis=16)
409-455 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
455-522 ==> 0-67 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARGGPLDYW at 394, score = 9 + 7
umis assigned: [1884, 2095]
of which 2 are surviving nonsolos
reads assigned: 280
start codons at 40, 84, 182, 281, 287, 509
confident = true

REJECT CONTIGS

TIG 1[bases=342]
65-222 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=0)
221-271 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
271-342 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [632, 2471]
of which 2 are surviving nonsolos
reads assigned: 994
start codons at 149, 187, 223, 252
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGCTCTGTGAGTCCCGAGGACACGGCTGTATATTACTGTGCAAGAGGGGGGCCTCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCGACAGCCTGCAGCCTGAGGATGTTGCAACATATTACTGTCAACAGGATGATACTCTCCCTGGCACTTTCGGCCCTGGGACCAAAGTGTATATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.220 = AACTCTTTCCCAACGG-1

using 6173 reads

====================================================================================

graph has 3731 edges initially, 42 edges after simplification

total ucounts = 937
nonsolo ucounts = 433[2^153, 3^113, 4^48, 5^38, 6^27, 7^11, 8^12, 9^3, 10^3, 11, 12, 13, 14^2, 16, 17, 25^2, 27, 28, 30, 55, 102, 130, 145, 160, 161, 220, 238, 270, 275, 285, 682, 1295]
surviving nonsolo ucounts = 11[55, 130, 160, 161, 220, 238, 270, 275, 285, 682, 1295]
ids = [217, 774, 165, 779, 857, 724, 747, 480, 512, 349, ...]

====================================================================================

UMI info for barcode AACTCTTTCCCAACGG-1 contig 1 = GGGAGTCTCA...
umi ATCGGGGACA = 159 reads: +391 validated
umi CCTTATTCGC = 572 reads: -356X +3 -1XX +2 -1XX +5 -1XX +5 -2XX +10 -1XX +2 -1XX +1 invalidated
umi GAAGTTTGGT = 277 reads: +391 validated
umi GCAACGACTT = 287 reads: +391 validated
umi TCCCGCTGGC = 237 reads: +391 validated
umi TCTGATTAGA = 1135 reads: -356X +3 -1XX +2 -1XX +5 -1XX +5 -2XX +10 -1XX +2 -1XX +1 invalidated
umi TCTTCACGCT = 132 reads: +391 validated
umi TCTTTGAGTG = 165 reads: +391 validated
umi TTCAAACGGG = 217 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 225 reads
cdr3 = CQQSYSTPFYTF at 350, score = 9 + 8
umis assigned: [165, 349, 480, 512, 724, 767, 774, 779, 857]
of which 9 are surviving nonsolos
reads assigned: 3133
start codons at 23, 29, 85, 98, 255, 456
confident = true

REJECT CONTIGS

TIG 1[bases=452]
0-323 ==> 25-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=13)
354-402 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
402-452 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CARQHCGGGNCSPYDYW at 320, score = 9 + 7
umis assigned: [217]
of which 1 are surviving nonsolos
reads assigned: 54
start codons at 19, 198, 360
confident = false
VJ delta = 0
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.226 = AACTCTTTCCTACAGA-1

using 2266 reads

====================================================================================

graph has 3260 edges initially, 42 edges after simplification

total ucounts = 994
nonsolo ucounts = 483[2^176, 3^112, 4^64, 5^61, 6^36, 7^19, 8^7, 9^3, 10^2, 11, 13, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.228 = AACTCTTTCCTCTAGC-1

using 292 reads

====================================================================================

graph has 114 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 19, 262]
surviving nonsolo ucounts = 2[19, 262]
ids = [1, 8]

====================================================================================

UMI info for barcode AACTCTTTCCTCTAGC-1 contig 1 = GGAGTCAGTC...
umi TGCCACCAAT = 253 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=482]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-482 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.229 = AACTCTTTCCTGCAGG-1

using 191 reads

====================================================================================

graph has 89 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[5^3, 7, 164]
surviving nonsolo ucounts = 1[164]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=507]
3-202 ==> 5801-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
202-507 ==> 0-305 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 30, 107, 147, 202, 410
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.230 = AACTCTTTCGAATGGG-1

using 285 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode AACTCTTTCGAATGGG-1 contig 1 = GAATCAGTCC...
umi ACGCTCATCG = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.233 = AACTCTTTCGATAGAA-1

using 12504 reads

====================================================================================

graph has 4040 edges initially, 54 edges after simplification

total ucounts = 606
nonsolo ucounts = 285[2^101, 3^62, 4^28, 5^20, 6^12, 7^7, 8^4, 9^3, 10^3, 12^2, 15, 21, 35, 56, 117, 141, 142, 152, 155, 172, 192, 218, 221, 226, 230, 245, 248^2, 249, 256, 257, 258, 262, 270, 271, 278, 282, 288, 290, 293^2, 296, 301^2, 302, 303, 308, 316, 339, 367, 455, 557, 1123]
surviving nonsolo ucounts = 39[117, 141, 142, 152, 155, 172, 192, 218, 221, 226, 230, 245, 248^2, 249, 256, 257, 258, 262, 270, 271, 278, 282, 288, 290, 293^2, 296, 301^2, 302, 303, 308, 316, 339, 367, 455, 557, 1123]
ids = [487, 114, 379, 304, 93, 593, 147, 349, 280, 239, ...]

====================================================================================

UMI info for barcode AACTCTTTCGATAGAA-1 contig 1 = AGGAGTCAGA...
umi ACCACATTCC = 287 reads: +385 validated
umi ACTATACCTT = 312 reads: +385 validated
umi ATTCAGTCTT = 373 reads: +330 -6XX +1 -1XX +1 -2XX +1 -2XX +1 -2X +1 -1X +1 -1X +1 -21X +2 -3XX +2 -4XX +1 invalidated
umi CACCATCTGA = 276 reads: +385 validated
umi CATCCGCAGG = 159 reads: +385 validated
umi CATTGGAATA = 257 reads: +385 validated
umi CCAAAATCGG = 138 reads: +385 validated
umi CCATATGACC = 246 reads: +385 validated
umi CCATCCGCTC = 305 reads: +385 validated
umi CCCACTGCTC = 252 reads: +385 validated
umi CCCCACCAGC = 189 reads: +385 validated
umi CGAACATGTT = 270 reads: +385 validated
umi CGATAATGGA = 306 reads: +385 validated
umi CGATCTCGCG = 304 reads: +385 validated
umi CTAACAATCT = 293 reads: +385 validated
umi CTACACTTTT = 227 reads: +385 validated
umi CTCAATCTGT = 255 reads: +385 validated
umi CTGGACTAGT = 221 reads: +385 validated
umi CTTATTCAGC = 257 reads: +385 validated
umi CTTTTATATT = 152 reads: +385 validated
umi GCTTACTGTA = 218 reads: +385 validated
umi GGCAAACTTT = 246 reads: +385 validated
umi GGTATATCAT = 299 reads: +385 validated
umi GGTGACTCAT = 231 reads: +385 validated
umi GTACCTGTCC = 246 reads: +385 validated
umi GTAGACAATC = 139 reads: +385 validated
umi GTTTTCCCCT = 551 reads: +385 validated
umi TACCATCCCG = 291 reads: +385 validated
umi TACCTCTACA = 289 reads: +385 validated
umi TCAACTCGTG = 414 reads: -348X +1 -5X +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TCCCCACCCG = 287 reads: +385 validated
umi TCCTATATAG = 117 reads: +385 validated
umi TCCTTCCGTA = 16 reads: -322X +1 -2XX +2 -5XX +1 -1XX +2 -9XX +1 -2XX +1 -1XX +1 -2XX +32 invalidated
umi TCTCCTGGCA = 1037 reads: -343X +2 -3XX +1 -5XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TTAGAATTCA = 250 reads: +385 validated
umi TTCCCCGTCT = 280 reads: +385 validated
umi TTCTAATACC = 268 reads: +385 validated
umi TTCTTATTAG = 307 reads: +385 validated
umi TTTATCAACC = 173 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 35 umis using 1280 reads
cdr3 = CQQYNSYSGF at 354, score = 8 + 7
umis assigned: [13, 21, 38, 59, 93, 110, 114, 132, 137, 143] and 29 others
of which 39 are surviving nonsolos
reads assigned: 10597
start codons at 27, 33, 89, 102, 334, 454
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.234 = AACTCTTTCGCAGGCT-1

using 79 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 11[2, 3, 4^3, 5^2, 7, 8, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.241 = AACTCTTTCGTCCGTT-1

using 167 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.253 = AACTCTTTCTCTGTCG-1

using 53 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3, 4, 5, 6, 7, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.256 = AACTCTTTCTGGTTCC-1

using 272 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[2^2, 4^2, 5, 245]
surviving nonsolo ucounts = 1[245]
ids = [1]

====================================================================================

UMI info for barcode AACTCTTTCTGGTTCC-1 contig 1 = CTGCTTCAGC...
umi ACCACTTTTG = 238 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=563]
0-48 ==> 3-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
48-404 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
439-563 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDINLIGVIF at 372, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 48, 111, 202, 205, 256, 355, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.269 = AACTGGTAGACTAGGC-1

using 410 reads

====================================================================================

graph has 226 edges initially, 22 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 153, 252]
surviving nonsolo ucounts = 2[153, 252]
ids = [4, 3]

====================================================================================

UMI info for barcode AACTGGTAGACTAGGC-1 contig 1 = GTCAGTCTCA...
umi TCACTGTACT = 239 reads: +388 validated
umi TTATTGTCCG = 65 reads: +41 -1XX +10 -1XX +8 -2XX +26 -1XX +3 -2XX +15 -1XX +29 -1XX +8 -2XX +2 -2XX +2 -1XX +2 -2XX +2 -5XX +1 -218X invalidated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPWTF at 350, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 300
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.274 = AACTGGTAGCAATATG-1

using 52 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[52]
surviving nonsolo ucounts = 1[52]
ids = [0]

====================================================================================

UMI info for barcode AACTGGTAGCAATATG-1 contig 1 = GGGGAGGAAT...
umi TGTTTGGCTC = 49 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=440]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-440 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 31, 37, 106, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.277 = AACTGGTAGCGAAGGG-1

using 107 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 16[2^2, 3^3, 4, 5^2, 6^2, 7, 8, 9, 12, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.278 = AACTGGTAGCGATATA-1

using 160 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 147]
surviving nonsolo ucounts = 1[147]
ids = [4]

====================================================================================

UMI info for barcode AACTGGTAGCGATATA-1 contig 1 = GAGTCAGACC...
umi CGTCGTGCCT = 142 reads: +385 validated
umi TAAACACAAC = 5 reads: -33 +29 -1X +31 -1X +15 -1X +22 -2 +9 -103 +10 -1X +34 -1X +18 -1X +26 -1X +3 -1X +2 -1X +1 -5X +1 -32X invalidated

GOOD CONTIGS

TIG 1[bases=447]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
410-447 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYNSYRSF at 352, score = 8 + 7
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 25, 31, 87, 100, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.282 = AACTGGTAGCTAGTTC-1

using 251 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode AACTGGTAGCTAGTTC-1 contig 1 = GAAGAGCTGC...
umi TTCTTGGCTT = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-517 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSPGYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.283 = AACTGGTAGCTATGCT-1

using 219 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[5, 207]
surviving nonsolo ucounts = 1[207]
ids = [1]

====================================================================================

UMI info for barcode AACTGGTAGCTATGCT-1 contig 1 = GCTTCAGCTG...
umi ACTTGAGTAC = 198 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=533]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
440-533 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 370, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 46, 200, 203, 254, 353, 380, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.284 = AACTGGTAGCTCCTCT-1

using 347 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 342]
surviving nonsolo ucounts = 1[342]
ids = [0]

====================================================================================

UMI info for barcode AACTGGTAGCTCCTCT-1 contig 1 = GTCAGACTCA...
umi CCTCAACACC = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-456 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 23, 29, 98, 234, 237, 330, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.292 = AACTGGTAGTACGTTC-1

using 76 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[76]
surviving nonsolo ucounts = 1[76]
ids = [0]

====================================================================================

UMI info for barcode AACTGGTAGTACGTTC-1 contig 1 = GAGCTACAAC...
umi TAGGCTCCAC = 68 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=430]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
junction support: 1 umis using 12 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 27, 30, 85, 99, 352, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.295 = AACTGGTAGTCCATAC-1

using 1680 reads

====================================================================================

graph has 2012 edges initially, 36 edges after simplification

total ucounts = 673
nonsolo ucounts = 349[2^129, 3^71, 4^49, 5^32, 6^21, 7^22, 8^8, 9^6, 10^5, 11^2, 12^2, 17, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.309 = AACTGGTCACATGGGA-1

using 155 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 145]
surviving nonsolo ucounts = 1[145]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
0-370 ==> 1-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
402-450 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
cdr3 = CARGSGILVIAIEDYYFDHW at 359, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 20, 64, 150, 237
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.313 = AACTGGTCACCCTATC-1

using 417 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[412]
surviving nonsolo ucounts = 1[412]
ids = [3]

====================================================================================

UMI info for barcode AACTGGTCACCCTATC-1 contig 1 = GAGTCAGACT...
umi GCGTTGTCTG = 399 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=490]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=24)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-490 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQHYYRDSPRTF at 352, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 25, 31, 87, 100, 236, 239, 332, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.316 = AACTGGTCACTAGTAC-1

using 307 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 299]
surviving nonsolo ucounts = 1[299]
ids = [5]

====================================================================================

UMI info for barcode AACTGGTCACTAGTAC-1 contig 1 = GAGGACCTGC...
umi GAATCGCGTA = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=1)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
421-463 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPPKTTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.318 = AACTGGTCAGACACTT-1

using 29 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3^2, 4, 9]
surviving nonsolo ucounts = 4[3^2, 4, 9]
ids = [2, 4, 13, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.321 = AACTGGTCAGATGAGC-1

using 321 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[131, 186]
surviving nonsolo ucounts = 2[131, 186]
ids = [3, 1]

====================================================================================

UMI info for barcode AACTGGTCAGATGAGC-1 contig 1 = TGGTGAGAGC...
umi CAGGGTGCTG = 179 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=506]
49-341 ==> 0-292 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
396-434 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
434-506 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQHSAWPLTF at 373, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 49, 257, 476
confident = false

REJECT CONTIGS

TIG 1[bases=467]
10-303 ==> 44-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
314-345 ==> 7-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
345-467 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CNSRDSSGNHPF at 281, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 85, 114, 165, 264
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.322 = AACTGGTCAGCTCCGA-1

using 802 reads

====================================================================================

graph has 996 edges initially, 2 edges after simplification

total ucounts = 378
nonsolo ucounts = 158[2^59, 3^36, 4^25, 5^18, 6^3, 7^7, 8^3, 9^2, 10^2, 11^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.323 = AACTGGTCAGCTGCAC-1

using 317 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 307]
surviving nonsolo ucounts = 1[307]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=459]
7-286 ==> 72-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
291-323 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
323-459 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPPTF at 262, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 10, 146, 365
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.325 = AACTGGTCAGGGCATA-1

using 174 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[174]
surviving nonsolo ucounts = 1[174]
ids = [0]

====================================================================================

UMI info for barcode AACTGGTCAGGGCATA-1 contig 1 = GAGTCTCCCT...
umi CGCGATGAGT = 172 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=494]
0-58 ==> 1-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
58-411 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CARHLGELTGDAFDIW at 400, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 58, 232, 256, 391, 431, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.341 = AACTGGTGTAGGCTGA-1

using 561 reads

====================================================================================

graph has 292 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 278^2]
surviving nonsolo ucounts = 2[278^2]
ids = [2, 4]

====================================================================================

UMI info for barcode AACTGGTGTAGGCTGA-1 contig 1 = GGAGAAGAGC...
umi CTGTAGCCCC = 260 reads: +385 validated

UMI info for barcode AACTGGTGTAGGCTGA-1 contig 2 = AGTCTGGGCC...
umi GCGCACATGC = 273 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=503]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
421-503 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPRTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 36, 244, 370, 463
confident = false

TIG 2[bases=552]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=1)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-552 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQVWDSSSDHVVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 40, 101, 239, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.345 = AACTGGTGTATCAGTC-1

using 368 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 7, 358]
surviving nonsolo ucounts = 1[358]
ids = [3]

====================================================================================

UMI info for barcode AACTGGTGTATCAGTC-1 contig 1 = GTCAGTCCCA...
umi TGGCCTGTCT = 356 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-526 ==> 0-115 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDNLLLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.350 = AACTGGTGTCATATGC-1

using 99 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 15[2^4, 3, 4, 5, 6^2, 7, 8^2, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.351 = AACTGGTGTCCGAGTC-1

using 287 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode AACTGGTGTCCGAGTC-1 contig 1 = GCTCTGCTTC...
umi ATCCAACACC = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=607]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-607 ==> 0-165 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.360 = AACTGGTGTCTCTTTA-1

using 824 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[824]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.362 = AACTGGTGTGATAAAC-1

using 386 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 4, 5, 158, 211]
surviving nonsolo ucounts = 2[158, 211]
ids = [4, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=471]
0-81 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=21)
374-400 ==> 0-26 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
399-471 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQTNTSPRTF at 351, score = 9 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 24, 30, 86, 99, 235, 441
confident = false
not full
VJ delta = 14
not full

TIG 2[bases=518]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-94 ==> 0-47 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
93-208 ==> 0-115 on segment before IGLV1-44 exon 2 [len=115] (mis=0)
209-515 ==> 47-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15) [SHIFT!]
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 47, 101, 133, 183, 466, 496, 508
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 1.369 = AACTGGTGTTAAGGGC-1

using 973 reads

====================================================================================

graph has 1358 edges initially, 10 edges after simplification

total ucounts = 424
nonsolo ucounts = 191[2^67, 3^39, 4^26, 5^20, 6^15, 7^9, 8^8, 9^5, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk001-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk001-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

12.608 seconds used processing barcodes, peak mem = 0.23
