[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.23 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk104-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk104-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk104.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.0 = TGCTGCTCAACACGCC-1

using 20055 reads

====================================================================================

graph has 6678 edges initially, 60 edges after simplification

total ucounts = 722
nonsolo ucounts = 342[2^154, 3^55, 4^27, 5^18, 6^8, 7^7, 8^2, 9^3, 10^3, 11, 14^2, 17, 18, 20, 28, 66, 80, 94, 119, 156, 157, 165, 187, 234, 240^2, 246, 247, 249, 254^2, 258, 259^2, 260, 267, 277, 290, 295, 303, 308, 311, 312, 314, 317, 319, 324^2, 328, 329, 331, 336^2, 338, 352, 353, 355, 362, 366, 371, 374, 376, 386, 387, 395, 397, 420, 421, 450, 472, 655, 883, 954]
surviving nonsolo ucounts = 56[28, 66, 119, 156, 157, 165, 187, 234, 240^2, 246, 247, 249, 254^2, 258, 259^2, 260, 267, 277, 290, 295, 303, 308, 311, 312, 314, 317, 319, 324^2, 328, 329, 331, 336^2, 338, 352, 353, 355, 362, 371, 374, 376, 386, 387, 395, 397, 420, 421, 450, 472, 655, 883, 954]
ids = [366, 590, 126, 701, 214, 523, 402, 107, 17, 356, ...]

====================================================================================

UMI info for barcode TGCTGCTCAACACGCC-1 contig 1 = TGGGGAGGAG...
umi AAAAAGCACA = 300 reads: +388 validated
umi AAATAATACC = 243 reads: +388 validated
umi AAGATATCTG = 250 reads: +388 validated
umi ACACTTTGAC = 325 reads: +388 validated
umi ACCACACCCG = 352 reads: +388 validated
umi AGAAAGCGCA = 235 reads: +388 validated
umi AGCATTGGGC = 334 reads: +107 -1XX +280 invalidated
umi AGGCGGTCAC = 336 reads: +388 validated
umi AGTAAAATCC = 304 reads: +388 validated
umi AGTCTCCGGG = 262 reads: +388 validated
umi ATAGTCATCC = 249 reads: +388 validated
umi ATCCTCCGTC = 398 reads: +388 validated
umi ATGCAACCAG = 657 reads: -198X +190 invalidated
umi CAAAATCCGT = 258 reads: +388 validated
umi CATGAGTCTC = 312 reads: +388 validated
umi CATTTACTTA = 327 reads: +388 validated
umi CCACTGTGTT = 322 reads: +388 validated
umi CCAGAACCCC = 322 reads: +388 validated
umi CCATGCCCTA = 246 reads: +388 validated
umi CCTAGCTCTT = 252 reads: +388 validated
umi CCTCTGCCGC = 255 reads: +388 validated
umi CGATCTGGGG = 377 reads: +388 validated
umi CGCTTACACT = 339 reads: +388 validated
umi CGTGCCGATA = 415 reads: +388 validated
umi CTCACGACCC = 355 reads: +388 validated
umi CTCCTTCCCC = 239 reads: +388 validated
umi CTCTTCTGAG = 293 reads: +388 validated
umi CTCTTTTCAG = 308 reads: +388 validated
umi GATATCTGCA = 187 reads: +388 validated
umi GATCCACTAG = 308 reads: +388 validated
umi GCAATTGGTT = 282 reads: +388 validated
umi GCCACATATG = 396 reads: +169 -1XX +218 invalidated
umi GCCCTAGCCT = 420 reads: +388 validated
umi GTAAATACCG = 328 reads: +388 validated
umi TAAACCCGGG = 448 reads: -29X +359 invalidated
umi TAATTGATCT = 360 reads: +388 validated
umi TATCATGACC = 345 reads: +388 validated
umi TATCGACGCC = 290 reads: +388 validated
umi TATGTCGCTA = 387 reads: +388 validated
umi TCCCACTCTG = 380 reads: -8 +380 non-validated
umi TCCGCCACTC = 341 reads: +388 validated
umi TCCTCTCGCT = 263 reads: +388 validated
umi TTGGGATCGG = 157 reads: +388 validated
umi TTGGGTACTC = 473 reads: +388 validated

UMI info for barcode TGCTGCTCAACACGCC-1 contig 2 = GGGGGAATCC...
umi AACGTATCTC = 238 reads: +427 validated
umi AAGCATTTCT = 335 reads: +427 validated
umi ACATCGCTTT = 406 reads: +427 validated
umi CTGCTTATAA = 22 reads: +215 -18 +10 -1 +1 -1 +173 -8 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 44 umis using 2347 reads
cdr3 = CQQSYSTPWTF at 359, score = 9 + 8
umis assigned: [0, 8, 22, 56, 67, 107, 119, 137, 141, 150] and 34 others
of which 44 are surviving nonsolos
reads assigned: 13948
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=550]
21-379 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=3)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
448-550 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 106 reads
cdr3 = CARTTPLYGEAPAFDYW at 366, score = 7 + 7
umis assigned: [17, 25, 62, 366]
of which 4 are surviving nonsolos
reads assigned: 978
start codons at 21, 177, 244, 247, 327, 336, 466, 527
confident = true

REJECT CONTIGS

TIG 1[bases=655]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
406-444 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
444-655 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [126, 127, 214, 275, 455, 460, 523, 590, 597]
of which 8 are surviving nonsolos
reads assigned: 3187
start codons at 51, 205, 208, 259, 358, 385
confident = false
did not find CDR3
now this is a cell
paired!

GACACAGCCACGTATTACTGTGCACGGACTACCCCACTCTACGGTGAAGCCCCTGCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.9 = TGCTGCTCAAGTCATC-1

using 193 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 188]
surviving nonsolo ucounts = 1[188]
ids = [2]

====================================================================================

UMI info for barcode TGCTGCTCAAGTCATC-1 contig 1 = GTCAGTCTCA...
umi ATCCGGTTTC = 168 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
379-411 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQSYSTPQTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.12 = TGCTGCTCAATCCGAT-1

using 339 reads

====================================================================================

graph has 124 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[17, 61, 254]
surviving nonsolo ucounts = 3[17, 61, 254]
ids = [6, 5, 0]

====================================================================================

UMI info for barcode TGCTGCTCAATCCGAT-1 contig 1 = GCTGTGCTGT...
umi AAGGGTGGAT = 240 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=538]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-538 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSADSSGTFVVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.17 = TGCTGCTCACAGATTC-1

using 247 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 5, 232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode TGCTGCTCACAGATTC-1 contig 1 = CTTGGGAGAA...
umi GCGCTCGACG = 202 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
0-34 ==> 25-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
34-387 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=34)
404-452 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
452-524 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARLLSLRWDSLDYW at 376, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 34, 232, 237, 254, 257, 269, 331, 399, 506
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.19 = TGCTGCTCACAGGCCT-1

using 341 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 326]
surviving nonsolo ucounts = 1[326]
ids = [7]

====================================================================================

UMI info for barcode TGCTGCTCACAGGCCT-1 contig 1 = CAGAGCTCTG...
umi TCGAGTACCT = 298 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=485]
0-45 ==> 7-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
45-393 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
408-430 ==> 15-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
430-485 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGLSPRTF at 369, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 45, 253, 256, 379, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.24 = TGCTGCTCACCAGGCT-1

using 40 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 28]
surviving nonsolo ucounts = 1[28]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.43 = TGCTGCTCAGCGATCC-1

using 186 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 9, 167]
surviving nonsolo ucounts = 1[167]
ids = [1]

====================================================================================

UMI info for barcode TGCTGCTCAGCGATCC-1 contig 1 = GAGTCAGACT...
umi CTTCATACGC = 146 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-492 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.65 = TGCTGCTCATGACGGA-1

using 86 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[80]
surviving nonsolo ucounts = 1[80]
ids = [0]

====================================================================================

UMI info for barcode TGCTGCTCATGACGGA-1 contig 1 = GCTCTGCTTC...
umi ACACGGGCGG = 75 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=465]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
442-465 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQSFDSSLSATVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 51, 205, 208, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.83 = TGCTGCTGTAGCGTGA-1

using 1082 reads

====================================================================================

graph has 503 edges initially, 8 edges after simplification

total ucounts = 42
nonsolo ucounts = 28[2^5, 3^4, 4^3, 5^2, 6^3, 7^4, 8^2, 9, 12, 15, 457, 469]
surviving nonsolo ucounts = 2[457, 469]
ids = [22, 1]

====================================================================================

UMI info for barcode TGCTGCTGTAGCGTGA-1 contig 1 = GGGGTCACAA...
umi AATCTCTACT = 467 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=8)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CCSYAGSRTFVF at 362, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 461
start codons at 38, 177, 246, 372
confident = false

REJECT CONTIGS

TIG 1[bases=420]
3-84 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-351 ==> 0-324 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
umis assigned: [22]
of which 1 are surviving nonsolos
reads assigned: 451
start codons at 27, 33, 89, 102
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.84 = TGCTGCTGTAGGCTGA-1

using 220 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [0]

====================================================================================

UMI info for barcode TGCTGCTGTAGGCTGA-1 contig 1 = ACCCAAAAAC...
umi TTGTACATAA = 217 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=555]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-555 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.106 = TGCTGCTGTCTCCCTA-1

using 82 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[82]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.117 = TGCTGCTGTGATGCCC-1

using 133 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[133]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.124 = TGCTGCTGTGGCAAAC-1

using 261 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 6, 10, 242]
surviving nonsolo ucounts = 1[242]
ids = [3]

====================================================================================

UMI info for barcode TGCTGCTGTGGCAAAC-1 contig 1 = GGTCTGCTTC...
umi TTATTTAATA = 243 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=650]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=22)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
442-650 ==> 0-208 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSILTGWAF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.133 = TGCTGCTGTTACCGAT-1

using 501 reads

====================================================================================

graph has 278 edges initially, 36 edges after simplification

total ucounts = 17
nonsolo ucounts = 10[2, 3^2, 4, 6^2, 10, 13, 218, 229]
surviving nonsolo ucounts = 2[218, 229]
ids = [8, 9]

====================================================================================

UMI info for barcode TGCTGCTGTTACCGAT-1 contig 1 = GGCTGGGGTC...
umi GATACGGCTT = 248 reads: +145 -1XX +245 invalidated

UMI info for barcode TGCTGCTGTTACCGAT-1 contig 2 = GGCTGGGGTC...
umi CTCAAATCCA = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=552]
42-374 ==> 0-332 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=15)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
433-552 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSYTSSSAPWVF at 366, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 42, 199, 250, 253
confident = false

TIG 2[bases=560]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
436-560 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSYTSSSTLFYVF at 366, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 42, 199, 243, 250, 253, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.136 = TGCTGCTGTTATGCGT-1

using 23 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.158 = TGCTGCTTCACAATGC-1

using 969 reads

====================================================================================

graph has 674 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[967]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.163 = TGCTGCTTCACGGTTA-1

using 15777 reads

====================================================================================

graph has 8880 edges initially, 192 edges after simplification

total ucounts = 2527
nonsolo ucounts = 1170[2^541, 3^250, 4^141, 5^65, 6^49, 7^29, 8^28, 9^8, 10^9, 11^2, 12^5, 13^2, 14, 15^4, 17, 18, 51, 61, 80, 87, 130, 149, 151, 156, 173, 205, 208, 220, 225, 242, 251, 252, 267, 277, 278, 287, 301, 312, 333, 343, 350, 374, 381, 432, 512, 513, 556, 715, 849, 877]
surviving nonsolo ucounts = 34[51, 61, 80, 87, 130, 149, 151, 156, 173, 205, 208, 220, 225, 242, 251, 252, 267, 277, 278, 287, 301, 312, 333, 343, 350, 374, 381, 432, 512, 513, 556, 715, 849, 877]
ids = [2058, 851, 534, 1270, 1475, 1748, 1628, 690, 998, 2021, ...]

====================================================================================

UMI info for barcode TGCTGCTTCACGGTTA-1 contig 1 = GGAGGAGTCA...
umi CACGCACCCC = 154 reads: +388 validated
umi CCTAACTGTA = 381 reads: +388 validated
umi CTCATCCTCG = 244 reads: +388 validated
umi GCCTGTTCGC = 129 reads: +388 validated
umi GGTCCCTCCT = 313 reads: +388 validated
umi GGTTTAAGCA = 151 reads: +388 validated
umi GTACCACCGT = 306 reads: +388 validated
umi GTTTAACGGC = 154 reads: -3 +385 non-validated
umi TCCGGGAGTC = 353 reads: +388 validated
umi TCTTGTGCGG = 276 reads: +388 validated
umi TTATGACTCT = 286 reads: +388 validated
umi TTCTGCAGGC = 333 reads: +388 validated

UMI info for barcode TGCTGCTTCACGGTTA-1 contig 2 = GGAGTCTCCC...
umi ACTCTGTTAG = 284 reads: +421 validated
umi ATACCGCGGC = 252 reads: +421 validated
umi ATCTGTCACG = 69 reads: +421 validated
umi CATGCTATTT = 247 reads: +421 validated
umi CCAGCTTACG = 46 reads: -104X +1 -1 +17 -1 +5 -1 +291 invalidated
umi CCTCCGGCGG = 324 reads: +421 validated
umi CCTTGAGGCC = 156 reads: +421 validated
umi CGGCATTAAC = 194 reads: +398 -23 non-validated
umi CTACGCTCGA = 344 reads: +421 validated
umi CTGTGTGAGA = 87 reads: +421 validated
umi TCCACGTATC = 209 reads: +416 -5 non-validated
umi TCCTGTTGTG = 50 reads: +382 -39 non-validated
umi TGACCAGGCC = 269 reads: +421 validated
umi TTACACATCA = 222 reads: +417 -4 non-validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=5)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 460 reads
cdr3 = CLQDYNYPQTF at 356, score = 9 + 8
umis assigned: [690, 964, 1181, 1475, 1611, 1628, 1644, 1748, 2041, 2142] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3019
start codons at 29, 35, 91, 104, 186, 240, 459
confident = true

TIG 2[bases=551]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=15)
431-480 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 179 reads
cdr3 = CARRGAVVARGCFDPW at 401, score = 8 + 7
umis assigned: [308, 451, 534, 794, 851, 978, 998, 1088, 1139, 1270] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2713
start codons at 59, 276, 392
confident = true

REJECT CONTIGS

TIG 1[bases=550]
1-55 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
39-71 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
55-71 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
55-79 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
101-125 ==> 0-24 on segment before IGLVI-70 exon 2 [len=128] (mis=0)
283-384 ==> 210-311 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=21)
285-303 ==> 215-233 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
414-452 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
452-550 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSTWDCSLSVWVF at 385, score = 5 + 8
umis assigned: [2348, 2460]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 55, 116, 268, 384, 393
confident = false
not full
full length stopped transcript of length 550
frameshifted full length stopped transcript of length 550
VJ delta = 4
not full
now this is a cell
paired!

TCGGACACCGCCATGTATTACTGTGCGAGACGAGGGGCGGTTGTAGCTCGGGGGTGCTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.166 = TGCTGCTTCAGAGCTT-1

using 1009 reads

====================================================================================

graph has 354 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 189, 251, 277, 284]
surviving nonsolo ucounts = 3[189, 251, 284]
ids = [7, 10, 8]

====================================================================================

UMI info for barcode TGCTGCTTCAGAGCTT-1 contig 1 = GCTCTGCTTC...
umi ACACAATTCT = 25 reads: -157 +1 -2XX +2 -2XX +6 -1XX +6 -3XX +2 -1XX +2 -5XX +1 -1XX +20 -6XX +3 -2XX +2 -1XX +2 -1XX +1 -1XX +1 -3XX +8 -1XX +1 -149 invalidated
umi GGGCCCCTAG = 191 reads: +394 validated
umi TATATTCGCA = 287 reads: +394 validated
umi TGCGTATCGT = 252 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 109 reads
cdr3 = CQSYDSSLSALYVF at 375, score = 8 + 8
umis assigned: [1, 7, 8, 10]
of which 3 are surviving nonsolos
reads assigned: 746
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.175 = TGCTGCTTCATTGCGA-1

using 395 reads

====================================================================================

graph has 192 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[7, 9, 106, 265]
surviving nonsolo ucounts = 2[106, 265]
ids = [7, 2]

====================================================================================

UMI info for barcode TGCTGCTTCATTGCGA-1 contig 1 = GATCAGGACT...
umi CCGTTCGGCA = 262 reads: +397 validated

UMI info for barcode TGCTGCTTCATTGCGA-1 contig 2 = GGAGAAGAGC...
umi TGGCGACCTC = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYGSSPPWSF at 360, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.185 = TGCTGCTTCCCGACTT-1

using 60 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^5, 46]
surviving nonsolo ucounts = 1[46]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.197 = TGCTGCTTCCTGTAGA-1

using 83 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[80]
surviving nonsolo ucounts = 1[80]
ids = [0]

====================================================================================

UMI info for barcode TGCTGCTTCCTGTAGA-1 contig 1 = CCCTCCTTGG...
umi AGCTTAGTGG = 69 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=503]
0-39 ==> 20-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
39-392 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
441-475 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
475-503 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 381, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 66
start codons at 39, 237, 242, 259, 303, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.199 = TGCTGCTTCCTTGACC-1

using 34 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.200 = TGCTGCTTCCTTTACA-1

using 538 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 526]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.203 = TGCTGCTTCGCCAGCA-1

using 641 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 4, 148, 477]
surviving nonsolo ucounts = 2[148, 477]
ids = [0, 7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=750]
0-22 ==> 5978-6000 on segment before IGLV4-60 exon 1 [len=6000] (mis=0)
16-40 ==> 2912-2936 on segment before IGLVV-58 exon 1 [len=3104] (mis=1)
22-68 ==> 0-46 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=0)
51-96 ==> 2953-2998 on segment before IGLVV-58 exon 1 [len=3104] (mis=3)
71-191 ==> 0-120 on segment before IGLV4-69 exon 2 [len=120] (mis=0)
188-501 ==> 46-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=6)
501-539 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
539-750 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQTWGTDIHVVF at 475, score = 8 + 8
umis assigned: [0, 7]
of which 2 are surviving nonsolos
reads assigned: 619
start codons at 22, 77, 128, 137, 171, 303, 343, 359, 458, 500
confident = false
not full
full length stopped transcript of length 750
frameshifted full length stopped transcript of length 750
VJ delta = -104
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.206 = TGCTGCTTCGGATGTT-1

using 6429 reads

====================================================================================

graph has 5301 edges initially, 88 edges after simplification

total ucounts = 1441
nonsolo ucounts = 674[2^291, 3^163, 4^90, 5^49, 6^25, 7^12, 8^8, 9^5, 10^8, 11^2, 12, 13^2, 14^2, 15^2, 43, 78, 130, 132, 168, 191, 197, 239, 255, 310, 338, 358, 403, 603]
surviving nonsolo ucounts = 12[43, 78, 130, 168, 191, 197, 239, 310, 338, 358, 403, 603]
ids = [1087, 630, 784, 447, 1340, 395, 1229, 1085, 81, 912, ...]

====================================================================================

UMI info for barcode TGCTGCTTCGGATGTT-1 contig 1 = AGGAATCAGA...
umi AATTCTGTAC = 336 reads: +388 validated
umi ATACCTATCC = 603 reads: -177 +211 non-validated
umi GGCGGTGGGC = 361 reads: +388 validated
umi GGGTCTTTCT = 45 reads: -229 +2 -3XX +8 -7XX +5 -1XX +5 -1XX +2 -1XX +28 -1XX +6 -1XX +3 -1XX +8 -1XX +1 -1XX +3 -2XX +7 -15 +3 -3XX +2 -1XX +1 -1XX +3 -1XX +2 -1XX +3 -3XX +9 -1XX +12 invalidated
umi TACGCGAATG = 310 reads: +388 validated
umi TCTCGCGGAA = 243 reads: +388 validated

UMI info for barcode TGCTGCTTCGGATGTT-1 contig 2 = ACCCAAAAAC...
umi CACACATCTC = 20 reads: -395X +2 -8X +1 -2XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi CGTTCCGTCG = 78 reads: +418 -1X +5 invalidated
umi TACGGTGCCC = 42 reads: -424 non-validated
umi TTACCGCTAT = 190 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=10)
384-415 ==> 8-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 365 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [81, 278, 912, 928, 1085, 1229]
of which 5 are surviving nonsolos
reads assigned: 1868
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=660]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=17)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
478-660 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 45 reads
cdr3 = CARRRRFRDPVSDFDYW at 396, score = 8 + 7
umis assigned: [395, 630, 1087, 1340]
of which 4 are surviving nonsolos
reads assigned: 320
start codons at 54, 205, 252, 257, 274, 318, 351
confident = true

REJECT CONTIGS

TIG 1[bases=509]
0-20 ==> 59-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
0-20 ==> 5980-6000 on rc of segment after IGHV3-7 exon 1 [len=6000] (mis=0)
0-20 ==> 5829-5849 on rc of segment before IGHV3-53 exon 2 [len=5849] (mis=0)
5-59 ==> 6523-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
20-373 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=36)
390-438 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
438-509 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CVRGDGGGPHSFDYW at 362, score = 8 + 7
umis assigned: [447, 1344]
of which 2 are surviving nonsolos
reads assigned: 561
start codons at 20, 176, 255, 297
confident = false
full length stopped transcript of length 509
frameshifted full length stopped transcript of length 509
VJ delta = 8
not full
not full
now this is a cell
paired!

GACACGGCCGTGTACTACTGTGCGAGAAGACGGCGATTCAGGGATCCCGTTTCCGATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCACCAGCCTACAGCCTGAAGATTTTGCAACTTATTACTGCCAACAATATAATAGTTACCCTCCCACCTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.208 = TGCTGCTTCGTCGTTC-1

using 795 reads

====================================================================================

graph has 472 edges initially, 10 edges after simplification

total ucounts = 164
nonsolo ucounts = 74[2^38, 3^16, 4^6, 5^4, 6, 7^3, 8^2, 9, 11, 159, 315]
surviving nonsolo ucounts = 2[159, 315]
ids = [75, 132]

====================================================================================

UMI info for barcode TGCTGCTTCGTCGTTC-1 contig 1 = ATCAGACCCA...
umi TAACTAGAGG = 316 reads: +388 validated

UMI info for barcode TGCTGCTTCGTCGTTC-1 contig 2 = GCTCTGCTTC...
umi CCTACACGGG = 153 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=8)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=7)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYHNYPRTF at 350, score = 9 + 8
umis assigned: [132]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 23, 29, 85, 98, 234, 453
confident = false

TIG 2[bases=547]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-547 ==> 0-102 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [75]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.212 = TGCTGCTTCTAACTTC-1

using 316 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode TGCTGCTTCTAACTTC-1 contig 1 = GAAGAGCTGC...
umi CGACACCCAC = 279 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=493]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.225 = TGCTGCTTCTGCTGCT-1

using 314 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3^2, 303]
surviving nonsolo ucounts = 1[303]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
4-323 ==> 32-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
322-360 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
360-496 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSFSWTF at 299, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 34, 47, 183, 186, 279, 309, 402
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.234 = TGCTGCTTCTTGCCGT-1

using 396 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 390]
surviving nonsolo ucounts = 1[390]
ids = [3]

====================================================================================

UMI info for barcode TGCTGCTTCTTGCCGT-1 contig 1 = GAAGAGCTGC...
umi TCACTTCCTT = 391 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CHQYGSSPQTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.239 = TGGACGCAGAAGGCCT-1

using 2364 reads

====================================================================================

graph has 1724 edges initially, 26 edges after simplification

total ucounts = 417
nonsolo ucounts = 155[2^59, 3^39, 4^25, 5^12, 6^6, 7^2, 8^2, 9, 11^2, 17, 66, 223, 281, 299, 343, 380]
surviving nonsolo ucounts = 6[66, 223, 281, 299, 343, 380]
ids = [26, 329, 269, 123, 148, 54]

====================================================================================

UMI info for barcode TGGACGCAGAAGGCCT-1 contig 1 = GAGTCAGTCT...
umi ACTTATGGTG = 388 reads: +388 validated
umi CAAGTGTCGG = 297 reads: +388 validated
umi CATGCAGTCA = 349 reads: +388 validated

UMI info for barcode TGGACGCAGAAGGCCT-1 contig 2 = GAGCTCTGGG...
umi AATTCAGACA = 64 reads: +105 -1X +253 -24 +32 invalidated
umi GTCACGGTAC = 219 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=27)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 178 reads
cdr3 = CQQSYNSPYTF at 352, score = 7 + 8
umis assigned: [54, 123, 148]
of which 3 are surviving nonsolos
reads assigned: 1009
start codons at 25, 31, 87, 100, 215, 284, 455
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=2)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=40)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
495-572 ==> 0-77 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CAKDDGLRYYFEDW at 422, score = 9 + 7
umis assigned: [26, 329]
of which 2 are surviving nonsolos
reads assigned: 280
start codons at 80, 236, 294, 315, 383, 432
confident = true
now this is a cell
paired!

AGACCGGAGGACACGGCTGTATATTACTGCGCGAAAGATGACGGCCTGCGGTACTACTTTGAAGACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCGACTTGAAGATTTTGCAACTTATTACTGTCAACAGAGTTACAATAGCCCGTACACTTTTGGCCAGGGGACGAAGGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.241 = TGGACGCAGAATAGGG-1

using 294 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 289]
surviving nonsolo ucounts = 1[289]
ids = [3]

====================================================================================

UMI info for barcode TGGACGCAGAATAGGG-1 contig 1 = GGGGGCTTTC...
umi GTCTGTGGGA = 285 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=540]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARHSFFGGSGSYSPDYW at 384, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 18, 27, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.242 = TGGACGCAGACAAGCC-1

using 407 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 394]
surviving nonsolo ucounts = 1[394]
ids = [4]

====================================================================================

UMI info for barcode TGGACGCAGACAAGCC-1 contig 1 = GGAGTCAGGA...
umi GCTGACGTCA = 399 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
16-367 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
367-404 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
404-540 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNSYPLTF at 343, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 389
start codons at 16, 22, 78, 91, 227, 230, 323, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.244 = TGGACGCAGATAGCAT-1

using 276 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode TGGACGCAGATAGCAT-1 contig 1 = AAGAAGGGCT...
umi GGAACCCGGA = 273 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-64 ==> 22-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
64-417 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=3)
417-455 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
455-535 ==> 0-80 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSNLWVF at 391, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 64, 127, 218, 269, 401
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.247 = TGGACGCAGATCGATA-1

using 816 reads

====================================================================================

graph has 246 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 36, 237, 539]
surviving nonsolo ucounts = 3[36, 237, 539]
ids = [0, 4, 3]

====================================================================================

UMI info for barcode TGGACGCAGATCGATA-1 contig 1 = GTGGGTCCAG...
umi TATTTGAATT = 514 reads: +382 validated

UMI info for barcode TGGACGCAGATCGATA-1 contig 2 = GTCAGTCCCA...
umi TTCATGCGCA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=27)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
417-564 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 92 reads
cdr3 = CQSADSSASYWVF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 507
start codons at 35, 96, 165, 177, 183
confident = false

TIG 2[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.253 = TGGACGCAGCCGGTAA-1

using 351 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 6, 113, 228]
surviving nonsolo ucounts = 2[113, 228]
ids = [5, 0]

====================================================================================

UMI info for barcode TGGACGCAGCCGGTAA-1 contig 1 = GATCAGGACT...
umi ACGTCTTTTG = 209 reads: +397 validated

UMI info for barcode TGGACGCAGCCGGTAA-1 contig 2 = GGCTGGGGTC...
umi TACCACCTCA = 102 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-526 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQVLQTPRTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 30, 63, 99, 187, 206, 349, 369, 469
confident = false

TIG 2[bases=480]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-480 ==> 0-50 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.265 = TGGACGCAGGCGCTCT-1

using 295 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================

UMI info for barcode TGGACGCAGGCGCTCT-1 contig 1 = ATCAGTCCCA...
umi CTACCATTCC = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.271 = TGGACGCAGTTGAGAT-1

using 286 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 281]
surviving nonsolo ucounts = 1[281]
ids = [1]

====================================================================================

UMI info for barcode TGGACGCAGTTGAGAT-1 contig 1 = ACATGGGAAG...
umi TAAGTATCAA = 283 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=544]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARWVSPLSIAAVTYFDYW at 385, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 2, 25, 46, 90, 176, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.273 = TGGACGCCAACAACCT-1

using 216 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 9[3^2, 4^2, 7, 8, 12, 14, 152]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.281 = TGGACGCCAATGGACG-1

using 274 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode TGGACGCCAATGGACG-1 contig 1 = GAGTCAGTCC...
umi ACACGGACCT = 241 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-498 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLPRYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 25, 31, 87, 100, 239, 362, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.283 = TGGACGCCACAAGCCC-1

using 49 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[49]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.287 = TGGACGCCACAGATTC-1

using 376 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 370]
surviving nonsolo ucounts = 1[370]
ids = [1]

====================================================================================

UMI info for barcode TGGACGCCACAGATTC-1 contig 1 = GGGGAGGAAC...
umi ACGCGCTGTT = 339 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=489]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-489 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQRSNWPPYTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 36, 241, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.290 = TGGACGCCACCGCTAG-1

using 454 reads

====================================================================================

graph has 280 edges initially, 2 edges after simplification

total ucounts = 24
nonsolo ucounts = 16[2^2, 3^3, 4, 5^2, 6^3, 7^3, 9, 371]
surviving nonsolo ucounts = 1[371]
ids = [9]

====================================================================================

UMI info for barcode TGGACGCCACCGCTAG-1 contig 1 = GGGAGTCTCA...
umi CTCCGCCCCT = 375 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.293 = TGGACGCCACGAGGTA-1

using 13117 reads

====================================================================================

graph has 6219 edges initially, 72 edges after simplification

total ucounts = 901
nonsolo ucounts = 343[2^147, 3^70, 4^25, 5^16, 6^7, 7^8, 8^7, 9^3, 10^2, 11^3, 13, 14, 15, 16^2, 19, 33, 40, 42, 76^2, 109, 133^2, 154, 159, 163, 171, 174, 175, 177, 181, 182, 189, 190, 192, 198, 208, 213, 219^2, 232^2, 239, 246, 259, 262, 271, 272, 280, 282, 301, 306, 308, 312, 315, 319, 326, 329, 336, 348, 360, 378, 550, 679]
surviving nonsolo ucounts = 46[40, 76^2, 109, 133^2, 154, 159, 163, 171, 174, 175, 177, 181, 182, 189, 190, 192, 198, 208, 213, 219^2, 232^2, 239, 246, 259, 262, 271, 272, 280, 301, 306, 308, 312, 315, 319, 326, 329, 336, 348, 360, 378, 550, 679]
ids = [102, 492, 502, 536, 423, 841, 406, 326, 168, 784, ...]

====================================================================================

UMI info for barcode TGGACGCCACGAGGTA-1 contig 1 = TGGGGGAGTC...
umi AACCTGGCTG = 317 reads: +382 validated
umi ACCCTAATCG = 348 reads: +382 validated
umi ACGAAATACG = 274 reads: +382 validated
umi AGGCACTCGA = 330 reads: +382 validated
umi ATACGTTGGG = 176 reads: +382 validated
umi CACCGAAACG = 279 reads: +382 validated
umi CCATTGGCAT = 214 reads: +382 validated
umi CCCTAGTGGT = 308 reads: +382 validated
umi CTGGTATCCG = 210 reads: +382 validated
umi CTTCTTGTAA = 339 reads: +382 validated
umi GAAGGACTGA = 301 reads: +382 validated
umi GCCCGGCTCC = 319 reads: +382 validated
umi GGTTCATCCG = 311 reads: +382 validated
umi GTGCAACCTT = 316 reads: +382 validated
umi TCTGTAGGGT = 328 reads: +382 validated
umi TGAACAGCTT = 265 reads: +382 validated
umi TTCCAAACCT = 129 reads: +343 -27 +12 non-validated
umi TTTATACTAC = 384 reads: +382 validated
umi TTTGGATGGG = 217 reads: +382 validated

UMI info for barcode TGGACGCCACGAGGTA-1 contig 2 = AGCCCTCAGA...
umi ACGCCTTCTT = 40 reads: +295 -2 +32 -1 +70 -30 non-validated
umi ATACCTATGT = 166 reads: +430 validated
umi CATGGGCTTG = 189 reads: +430 validated
umi CCAGAAGTTA = 203 reads: +430 validated
umi CCAGTATCTA = 177 reads: +430 validated
umi CCCCACTTGC = 161 reads: +430 validated
umi CGGTAAAGGG = 664 reads: +1 -1XX +3 -1XX +2 -1XX +6 -1XX +2 -8XX +1 -376X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi CTACAGTCGT = 155 reads: +430 validated
umi CTCAACATTG = 130 reads: +185 -1XX +215 -24 +5 invalidated
umi CTCACGTCCT = 267 reads: +430 validated
umi GAATGCACCC = 77 reads: +367 -3 +58 -2 non-validated
umi GAATTTTCAT = 179 reads: +430 validated
umi GAGACCTGCA = 77 reads: +335 -15 +80 non-validated
umi GCATCTTCTT = 174 reads: +430 validated
umi GCCTGGGCAC = 114 reads: +398 -1 +2 -25 +4 non-validated
umi GGAAGCGTAG = 183 reads: +430 validated
umi GGCAGTGCGT = 542 reads: +1 -1XX +3 -1XX +2 -1XX +6 -1X +2 -8X +1 -376X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi GTTGCATAAA = 239 reads: +279 -1X +150 invalidated
umi TCGGTCTCGC = 221 reads: +430 validated
umi TCGTTAACAC = 193 reads: +430 validated
umi TCTATCCCCT = 239 reads: +430 validated
umi TGCATCCGCC = 177 reads: +430 validated
umi TTATAGCTTC = 191 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=554]
36-284 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 793 reads
cdr3 = CLHYDNRRRTF at 357, score = 9 + 8
umis assigned: [21, 91, 97, 140, 169, 260, 321, 333, 452, 467] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5263
start codons at 36, 92, 105, 244, 367, 460
confident = true

TIG 2[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=37)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 16 umis using 291 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [102, 168, 292, 308, 312, 326, 383, 406, 423, 426] and 13 others
of which 23 are surviving nonsolos
reads assigned: 4659
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGACTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGGCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.305 = TGGACGCCAGATTGCT-1

using 6017 reads

====================================================================================

graph has 3214 edges initially, 46 edges after simplification

total ucounts = 593
nonsolo ucounts = 266[2^115, 3^60, 4^26, 5^18, 6^9, 7^5, 8^2, 9^2, 10^3, 11^3, 12, 13^2, 17, 89, 117, 133, 138, 176, 211, 215, 247, 260, 268, 295, 298, 321^2, 326, 334, 339, 370, 387]
surviving nonsolo ucounts = 21[11, 13, 89, 117, 133, 138, 176, 211, 215, 247, 260, 268, 295, 298, 321^2, 326, 334, 339, 370, 387]
ids = [223, 308, 113, 577, 58, 505, 351, 212, 574, 536, ...]

====================================================================================

UMI info for barcode TGGACGCCAGATTGCT-1 contig 1 = GGGGATCACT...
umi ATGCACATGC = 92 reads: -24 +439 non-validated
umi CCCTTTCGAC = 325 reads: +459 -4 non-validated
umi TAGCGTTCAT = 261 reads: +463 validated
umi TTGATGGGGT = 287 reads: +463 validated
umi TTGTCACTAA = 217 reads: +463 validated
umi TTTACTGGTA = 108 reads: +463 validated

UMI info for barcode TGGACGCCAGATTGCT-1 contig 2 = CCTGGGTCAG...
umi AATGGGTGTG = 321 reads: +382 validated
umi ACACGCTGGC = 372 reads: +382 validated
umi ACTCACAGGT = 132 reads: +382 validated
umi CGACCGGCCT = 213 reads: +382 validated
umi GTCCCTCGCG = 318 reads: +382 validated
umi GTGAGCCCGG = 387 reads: +382 validated
umi TCTATTACCT = 133 reads: +382 validated
umi TGGCATTGGA = 301 reads: +382 validated
umi TGGCTTGGTG = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=596]
62-415 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
431-462 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=6)
468-525 ==> 6-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
525-596 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 60 reads
cdr3 = CARGLDSGRELRFLEWLYPPTDYYYGMDVW at 404, score = 9 + 7
umis assigned: [113, 185, 447, 567, 574, 577]
of which 6 are surviving nonsolos
reads assigned: 1267
start codons at 62, 213, 260, 265, 269, 297, 326, 359, 482
confident = true

TIG 2[bases=570]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
397-434 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 364 reads
cdr3 = CQQYGSSRTF at 376, score = 9 + 8
umis assigned: [25, 29, 58, 212, 392, 398, 505, 532, 536]
of which 9 are surviving nonsolos
reads assigned: 2395
start codons at 52, 260, 386, 476
confident = true

REJECT CONTIGS

TIG 1[bases=528]
5-39 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
18-361 ==> 0-343 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=0)
394-457 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [211]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 18, 39, 83, 169, 374, 414
confident = false
full length stopped transcript of length 528
frameshifted full length stopped transcript of length 528
did not find CDR3
now this is a cell
paired!

GGTCGTGAGTTACGATTTTTGGAGTGGTTATATCCCCCCACTGACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACGAACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.312 = TGGACGCCAGGCGATA-1

using 447 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[446]
surviving nonsolo ucounts = 1[446]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.313 = TGGACGCCAGGGAGAG-1

using 361 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[359]
surviving nonsolo ucounts = 1[359]
ids = [2]

====================================================================================

UMI info for barcode TGGACGCCAGGGAGAG-1 contig 1 = ATCAGTCCCA...
umi TGGCAACTAG = 366 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 61 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.314 = TGGACGCCAGGGATTG-1

using 255 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 109, 136]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.319 = TGGACGCCAGTTCCCT-1

using 1377 reads

====================================================================================

graph has 1610 edges initially, 14 edges after simplification

total ucounts = 585
nonsolo ucounts = 194[2^85, 3^45, 4^25, 5^15, 6^8, 7^5, 8^3, 9^2, 11^2, 14, 17, 98, 230]
surviving nonsolo ucounts = 1[230]
ids = [292]

====================================================================================

UMI info for barcode TGGACGCCAGTTCCCT-1 contig 1 = GGAATCAGTC...
umi CTGATGGATA = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-481 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [292]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.326 = TGGACGCCATTGCGGC-1

using 317 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[317]
surviving nonsolo ucounts = 1[317]
ids = [0]

====================================================================================

UMI info for barcode TGGACGCCATTGCGGC-1 contig 1 = GGGAGTCAGT...
umi ACTGATAATG = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTLLTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.335 = TGGACGCGTCAACATC-1

using 833 reads

====================================================================================

graph has 276 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 196, 316, 317]
surviving nonsolo ucounts = 3[196, 316, 317]
ids = [3, 2, 0]

====================================================================================

UMI info for barcode TGGACGCGTCAACATC-1 contig 1 = GGGGAGGAAC...
umi CAACCACTTC = 281 reads: +385 validated
umi GCGGCCATTG = 152 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=507]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-507 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 64 reads
cdr3 = CQHYHNWPPITF at 357, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 427
start codons at 36, 105, 178, 241, 463
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.336 = TGGACGCGTCACTTCC-1

using 384 reads

====================================================================================

graph has 171 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[161, 219]
surviving nonsolo ucounts = 2[161, 219]
ids = [5, 1]

====================================================================================

UMI info for barcode TGGACGCGTCACTTCC-1 contig 1 = GGAGTCAGTC...
umi CTATCTTCGA = 218 reads: +388 validated
umi TCACGGCTCA = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 64 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 376
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.337 = TGGACGCGTCATTAGC-1

using 320 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 5, 95, 214]
surviving nonsolo ucounts = 2[95, 214]
ids = [1, 2]

====================================================================================

UMI info for barcode TGGACGCGTCATTAGC-1 contig 1 = GAAGAGCTGC...
umi CATTAGATCA = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGSSPPWSF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.341 = TGGACGCGTCTTGTCC-1

using 65 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 1[62]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=384]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-74 ==> 0-27 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
76-255 ==> 174-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8) [SHIFT!]
252-290 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
290-384 ==> 0-94 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 223, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 50
start codons at 47, 206, 231, 236
confident = false
not full
frameshifted full length stopped transcript of length 384
VJ delta = 167
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.342 = TGGACGCGTGAAATCA-1

using 241 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

UMI info for barcode TGGACGCGTGAAATCA-1 contig 1 = GATCAGGACT...
umi ATCTAAATCA = 231 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-516 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.346 = TGGACGCGTGTTTGTG-1

using 469 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[468]
surviving nonsolo ucounts = 1[468]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=385]
27-215 ==> 163-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=12)
211-249 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
249-385 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSHRTF at 191, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 459
start codons at 24, 75, 96, 291
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.351 = TGGACGCGTTGATTGC-1

using 1286 reads

====================================================================================

graph has 572 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 285, 366, 629]
surviving nonsolo ucounts = 3[285, 366, 629]
ids = [5, 3, 0]

====================================================================================

UMI info for barcode TGGACGCGTTGATTGC-1 contig 1 = AGACCCAGTC...
umi AAAGAGGGCT = 632 reads: +388 validated
umi CGCGTATCAC = 367 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 171 reads
cdr3 = CQQYNSYPLTF at 347, score = 9 + 9
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 981
start codons at 20, 26, 82, 95, 231, 450
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.374 = TGGACGCTCCTTTCTC-1

using 631 reads

====================================================================================

graph has 221 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 290, 334]
surviving nonsolo ucounts = 2[290, 334]
ids = [3, 1]

====================================================================================

UMI info for barcode TGGACGCTCCTTTCTC-1 contig 1 = AGTGACTCCT...
umi CAATTCAATA = 283 reads: +433 validated

UMI info for barcode TGGACGCTCCTTTCTC-1 contig 2 = GTCAGTCCCA...
umi AGCAAATACC = 339 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=564]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-564 ==> 0-111 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false

TIG 2[bases=544]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-86 ==> 0-63 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
86-371 ==> 66-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=22)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQINSYPLTF at 347, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 23, 29, 180, 231, 450
confident = false
see deletion of 3 bases at pos 63 on |239|IGKV1-9|L-REGION+V-REGION|
>vscore_104.374_63.7%
ATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAGAGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGCAGGAGACAGAGTCACCATCACTTGTCGGGCCAGTCTGGACATTGACACTTATGTAGCCTGGTATCAGCAAAAACCAGGGAGAGCCCCTAAACTCCTAATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGGTCTGGGACACATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTACAACTTATTACTGTCAACAAATTAACAGTTATCCT
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.379 = TGGACGCTCGGCTACG-1

using 9471 reads

====================================================================================

graph has 7633 edges initially, 146 edges after simplification

total ucounts = 1451
nonsolo ucounts = 1143[2^164, 3^139, 4^133, 5^97, 6^114, 7^90, 8^69, 9^60, 10^60, 11^55, 12^41, 13^28, 14^22, 15^22, 16^11, 17^8, 18^7, 19^6, 20^3, 21^3, 23^2, 25, 30, 152, 154, 185, 199, 228, 293, 309]
surviving nonsolo ucounts = 7[152, 154, 185, 199, 228, 293, 309]
ids = [693, 151, 1269, 615, 1344, 1418, 684]

====================================================================================

UMI info for barcode TGGACGCTCGGCTACG-1 contig 1 = TGAGCGCAGA...
umi ACGAGATGAT = 156 reads: +388 validated
umi CTGTACTAAT = 152 reads: +388 validated
umi TTCAGAGTAG = 230 reads: +388 validated
umi TTTCGCGCTC = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 136 reads
cdr3 = CETWDSSLNAGVF at 357, score = 7 + 8
umis assigned: [151, 693, 1344, 1418]
of which 4 are surviving nonsolos
reads assigned: 817
start codons at 36, 184, 190, 241, 365, 382
confident = true

REJECT CONTIGS

TIG 1[bases=637]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
28-86 ==> 5638-5696 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=14)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [615, 684, 1269]
of which 3 are surviving nonsolos
reads assigned: 683
start codons at 40, 101, 239, 242, 338
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.381 = TGGACGCTCTACTATC-1

using 1472 reads

====================================================================================

graph has 2122 edges initially, 14 edges after simplification

total ucounts = 706
nonsolo ucounts = 302[2^146, 3^61, 4^29, 5^19, 6^18, 7^6, 8^8, 9^5, 10^5, 13^2, 15, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.390 = TGGACGCTCTGCCAGG-1

using 234 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 228]
surviving nonsolo ucounts = 1[228]
ids = [1]

====================================================================================

UMI info for barcode TGGACGCTCTGCCAGG-1 contig 1 = AAAAACCACA...
umi AACTAACCCA = 216 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-537 ==> 0-51 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.400 = TGGACGCTCTTTACAC-1

using 333 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 4, 319]
surviving nonsolo ucounts = 1[319]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=351]
3-37 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
16-170 ==> 0-154 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=1)
183-351 ==> 14-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 16, 37, 81, 167
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.403 = TGGACGCTCTTTCCTC-1

using 624 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6, 226, 388]
surviving nonsolo ucounts = 2[226, 388]
ids = [1, 4]

====================================================================================

UMI info for barcode TGGACGCTCTTTCCTC-1 contig 1 = AGCTGTGGGT...
umi GGGAGCGGGA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-41 ==> 73-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
41-394 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
429-546 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASWDDSLRGRVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 41, 195, 345, 370, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.416 = TGGCCAGAGCAATATG-1

using 871 reads

====================================================================================

graph has 236 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 4, 259, 272, 331]
surviving nonsolo ucounts = 3[259, 272, 331]
ids = [0, 3, 7]

====================================================================================

UMI info for barcode TGGCCAGAGCAATATG-1 contig 1 = GCTCTGCTTC...
umi CAAACCTACT = 259 reads: +394 validated
umi TTATGATGTA = 334 reads: -132 +1 -2X +1 -4XX +2 -2XX +1 -4XX +1 -1XX +243 invalidated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 113 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 7]
of which 2 are surviving nonsolos
reads assigned: 585
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.421 = TGGCCAGAGCTATGCT-1

using 358 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 5, 343]
surviving nonsolo ucounts = 1[343]
ids = [3]

====================================================================================

UMI info for barcode TGGCCAGAGCTATGCT-1 contig 1 = AGGAGTCAGA...
umi CACTCCCTTA = 341 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.431 = TGGCCAGAGGTAGCCA-1

using 423 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[418]
surviving nonsolo ucounts = 1[418]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-336 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 357, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 413
start codons at 36, 241, 463
confident = false
not full
full length stopped transcript of length 557
frameshifted full length stopped transcript of length 557
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.434 = TGGCCAGAGTACGTAA-1

using 274 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^3, 260]
surviving nonsolo ucounts = 1[260]
ids = [5]

====================================================================================

UMI info for barcode TGGCCAGAGTACGTAA-1 contig 1 = CCCAGCCCTG...
umi CAGGGCCTGG = 244 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=541]
0-63 ==> 173-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
63-416 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=23)
425-472 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
472-541 ==> 0-69 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CATLYHFGMEVW at 405, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 63, 219, 280, 429, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.436 = TGGCCAGAGTCCGTAT-1

using 629 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[291, 333]
surviving nonsolo ucounts = 2[291, 333]
ids = [1, 2]

====================================================================================

UMI info for barcode TGGCCAGAGTCCGTAT-1 contig 1 = GTCAGTCCCA...
umi CCGCCGCTAC = 292 reads: +388 validated
umi CGCTTTCGGT = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 98 reads
cdr3 = CQQYDNLLWTF at 350, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 614
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.441 = TGGCCAGAGTGTTAGA-1

using 1122 reads

====================================================================================

graph has 1194 edges initially, 36 edges after simplification

total ucounts = 457
nonsolo ucounts = 180[2^86, 3^33, 4^26, 5^10, 6^7, 7^5, 8^2, 9^2, 10^3, 11^2, 12^2, 16, 217]
surviving nonsolo ucounts = 1[217]
ids = [153]

====================================================================================

UMI info for barcode TGGCCAGAGTGTTAGA-1 contig 1 = AGCTTCAGCT...
umi CGCATATCGG = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-563 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [153]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.445 = TGGCCAGAGTTCCACA-1

using 327 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode TGGCCAGAGTTCCACA-1 contig 1 = GGGGAGGAAC...
umi TGATTCCCTT = 328 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.455 = TGGCCAGCAAGGGTCA-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.459 = TGGCCAGCAATGTTGC-1

using 12 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.463 = TGGCCAGCACCTCGTT-1

using 299 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[295]
surviving nonsolo ucounts = 1[295]
ids = [3]

====================================================================================

UMI info for barcode TGGCCAGCACCTCGTT-1 contig 1 = GCTCTGCTTC...
umi TTCGCCGCGG = 265 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=578]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-578 ==> 0-136 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.482 = TGGCCAGCATTATCTC-1

using 6035 reads

====================================================================================

graph has 3659 edges initially, 78 edges after simplification

total ucounts = 794
nonsolo ucounts = 320[2^142, 3^59, 4^46, 5^23, 6^8, 7^10, 8^5, 9^2, 10^2, 11^3, 12^3, 13, 16, 22, 30, 63, 145, 148, 208, 215, 223, 238, 310, 368, 409, 682, 690, 755]
surviving nonsolo ucounts = 12[63, 148, 208, 215, 223, 238, 310, 368, 409, 682, 690, 755]
ids = [360, 120, 561, 69, 179, 79, 112, 383, 76, 478, ...]

====================================================================================

UMI info for barcode TGGCCAGCATTATCTC-1 contig 1 = AGAGCTCTGG...
umi AATGTGTACC = 794 reads: -350 +1 -2XX +1 -2XX +1 -2XX +1 -1XX +7 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ACCAGCTGTA = 217 reads: +394 validated
umi ACCGTGTCTC = 237 reads: +394 validated
umi ACTGTAGTCA = 315 reads: +394 validated
umi AGACAAAGGC = 104 reads: +37 -5X +1 -3XX +348 invalidated
umi AGATCTTTGC = 703 reads: -358X +2 -1XX +7 -4XX +9 -1XX +1 -1XX +10 invalidated
umi ATAGTTGGAC = 226 reads: +394 validated
umi CTCTCACTTT = 62 reads: +394 validated
umi GTGATATACA = 209 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=627]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=15)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
416-627 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 230 reads
cdr3 = CQTWDTGTRIF at 355, score = 8 + 9
umis assigned: [50, 69, 79, 112, 120, 126, 179, 360, 561]
of which 9 are surviving nonsolos
reads assigned: 2742
start codons at 22, 183, 239, 338, 548
confident = true

REJECT CONTIGS

TIG 1[bases=458]
5-325 ==> 165-485 on rc of segment before IGHD6-25 exon 1 [len=485] (mis=1)
339-387 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
387-458 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [76]
of which 1 are surviving nonsolos
reads assigned: 402
start codons at 31, 139
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.483 = TGGCCAGCATTGTGCA-1

using 994 reads

====================================================================================

graph has 390 edges initially, 52 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[121, 272, 597]
surviving nonsolo ucounts = 3[121, 272, 597]
ids = [4, 3, 1]

====================================================================================

UMI info for barcode TGGCCAGCATTGTGCA-1 contig 1 = AGTCAGGACA...
umi TGGCCAAGCC = 117 reads: +1 -1 +53 -1XX +1 -1XX +3 -2XX +26 -1XX +3 -2XX +15 -1XX +277 invalidated

UMI info for barcode TGGCCAGCATTGTGCA-1 contig 2 = GGAGTCAGGA...
umi AGCATTCTCT = 284 reads: +115 -1XX +3 -1XX +268 invalidated

UMI info for barcode TGGCCAGCATTGTGCA-1 contig 3 = AGGAGTCAGT...
umi ACTGTCATGT = 596 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
14-365 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=29)
364-402 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
402-538 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYNGQSRAF at 341, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 14, 20, 76, 89, 225, 228, 321, 354, 444
confident = false

TIG 2[bases=540]
16-367 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=7)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
404-540 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQKYNSVPWTF at 343, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 16, 22, 78, 91, 227, 326, 446
confident = false

TIG 3[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 84 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 589
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.497 = TGGCCAGGTCCAGTGC-1

using 453 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[3, 201, 241]
surviving nonsolo ucounts = 2[201, 241]
ids = [8, 6]

====================================================================================

UMI info for barcode TGGCCAGGTCCAGTGC-1 contig 1 = ATACTTTCTG...
umi TCTCCCCTTA = 201 reads: +400 validated

UMI info for barcode TGGCCAGGTCCAGTGC-1 contig 2 = GTCAGACCCA...
umi CGTATCCGGG = 214 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=508]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-245 ==> 0-208 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
245-381 ==> 214-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=3)
386-437 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
437-508 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CASLTTYWFDPW at 370, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 37, 81
confident = false
see deletion of 6 bases at pos 208 on |194|IGHV4-59|L-REGION+V-REGION|

TIG 2[bases=506]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQANSFPLVTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.500 = TGGCCAGGTCGAGATG-1

using 10142 reads

====================================================================================

graph has 3904 edges initially, 64 edges after simplification

total ucounts = 649
nonsolo ucounts = 243[2^100, 3^40, 4^28, 5^19, 6^13, 7^6, 8^5, 10, 12^2, 13, 16, 17^2, 59, 82, 116, 169, 233, 245, 269, 274, 297, 310^2, 313, 324, 327, 350, 351, 354, 362, 366, 389, 416, 421, 590, 954, 1071]
surviving nonsolo ucounts = 23[116, 169, 233, 245, 269, 274, 297, 310^2, 313, 324, 327, 350, 351, 354, 362, 366, 389, 416, 421, 590, 954, 1071]
ids = [373, 602, 485, 19, 55, 159, 88, 364, 381, 83, ...]

====================================================================================

UMI info for barcode TGGCCAGGTCGAGATG-1 contig 1 = AGCTCTGGGA...
umi AACGTCACAG = 228 reads: +439 validated
umi ACCATAGTCC = 230 reads: +439 validated
umi ATTGTACCGT = 260 reads: +439 validated
umi GCATGCACCG = 107 reads: +439 validated
umi TTAGAGTTGT = 151 reads: +439 validated

UMI info for barcode TGGCCAGGTCGAGATG-1 contig 2 = GAGGACCCAG...
umi AGAATTTGGT = 314 reads: +379 validated
umi AGATTGAAGC = 294 reads: +379 validated
umi CACCCGCCCA = 363 reads: +379 validated
umi CATATGTCTT = 349 reads: +379 validated
umi CTGTTTCCTG = 367 reads: +379 validated
umi GCAATTGCCT = 311 reads: +379 validated
umi GCTTTTTCAG = 421 reads: +379 validated
umi GGAATCACGG = 400 reads: +258 -1XX +120 invalidated
umi GTTTGCCGAC = 331 reads: +379 validated
umi TACACCTTTG = 235 reads: +379 validated
umi TGAACGTTTC = 345 reads: +379 validated
umi TTCCTACGCC = 413 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=576]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=8)
468-519 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
519-576 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 85 reads
cdr3 = CTRDVDYGSSENDHYGMDVW at 428, score = 8 + 7
umis assigned: [19, 55, 159, 373, 602]
of which 5 are surviving nonsolos
reads assigned: 961
start codons at 80, 133, 236, 360, 389, 438, 476, 537
confident = true

TIG 2[bases=533]
18-363 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
358-397 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
397-533 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 724 reads
cdr3 = CQQYNDWYTF at 339, score = 9 + 8
umis assigned: [83, 88, 176, 193, 313, 364, 399, 404, 471, 485] and 2 others
of which 12 are surviving nonsolos
reads assigned: 4073
start codons at 18, 87, 223, 352, 439
confident = true

REJECT CONTIGS

TIG 1[bases=359]
0-87 ==> 5527-5614 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
36-86 ==> 0-50 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
84-188 ==> 256-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
184-223 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
223-359 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [170, 372, 381, 436]
of which 4 are surviving nonsolos
reads assigned: 1543
start codons at 36, 69, 147, 167, 265
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTACTAGAGATGTCGACTACGGTAGCTCCGAAAACGACCACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATGACTGGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.501 = TGGCCAGGTCGAGTTT-1

using 533 reads

====================================================================================

graph has 240 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 8, 253, 264]
surviving nonsolo ucounts = 2[253, 264]
ids = [8, 5]

====================================================================================

UMI info for barcode TGGCCAGGTCGAGTTT-1 contig 1 = AGGAATCAGT...
umi TCTGATGGCC = 254 reads: +388 validated

UMI info for barcode TGGCCAGGTCGAGTTT-1 contig 2 = GCTGGGGTCT...
umi CTGGTCCATG = 255 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=557]
0-41 ==> 1-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
41-384 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=12)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-557 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CCSYAGTSTNWVF at 365, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 41, 180, 192, 198, 242, 249, 252, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.515 = TGGCCAGGTGGTAACG-1

using 659 reads

====================================================================================

graph has 244 edges initially, 30 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[8, 319, 326]
surviving nonsolo ucounts = 2[319, 326]
ids = [1, 3]

====================================================================================

UMI info for barcode TGGCCAGGTGGTAACG-1 contig 1 = GGAGTCAGAC...
umi GGCTAGAGTA = 326 reads: +388 validated

UMI info for barcode TGGCCAGGTGGTAACG-1 contig 2 = GGGAGTCTCA...
umi CCAGGTAACG = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
26-379 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSFPYTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 26, 32, 88, 101, 164, 237, 456
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQTYSTPLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.528 = TGGCCAGTCAACACAC-1

using 349 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[349]
surviving nonsolo ucounts = 1[349]
ids = [0]

====================================================================================

UMI info for barcode TGGCCAGTCAACACAC-1 contig 1 = GGACTGATCA...
umi CCTCTACATC = 348 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CMQALQTPPTF at 371, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.536 = TGGCCAGTCAGTGTTG-1

using 34 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[34]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.538 = TGGCCAGTCATAAAGG-1

using 457 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 449]
surviving nonsolo ucounts = 1[449]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=446]
0-26 ==> 5-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
0-26 ==> 7774-7800 on rc of segment before IGKV2-28 exon 2 [len=7800] (mis=0)
11-81 ==> 8895-8965 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=7)
11-81 ==> 8904-8974 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=7)
11-81 ==> 8903-8973 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=7)
26-116 ==> 0-90 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
116-273 ==> 194-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1) [SHIFT!]
271-310 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
310-446 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQKYNSAPYTF at 249, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 26, 32, 88, 101, 133, 232, 352
confident = false
not full
frameshifted full length stopped transcript of length 446
VJ delta = 119
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.542 = TGGCCAGTCCAATGGT-1

using 243 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 4, 5, 226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================

UMI info for barcode TGGCCAGTCCAATGGT-1 contig 1 = AGTCTGGGCC...
umi ACGTACGACG = 225 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-360 ==> 0-320 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=34)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CHIFDKDSDRVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 40, 91, 124, 242, 245, 338
confident = false
>vscore_104.542_84.9%
ATGGCCTGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGACTCTATGACGTCCTTTGTGCTGACTCAGCCACCCTCAATGTCAGTGGCCCCAGGACAGACGGCCAGACTTCCCTGTGAGGGAGACAACATTGGCGGTAAAAGTGTGCACTGGTATCAGCACAAGGCAGGCCAGGCCCCTGTGTTGGTCATTTATTATGATGCCGCCCGACTCTCAGGAATCCCTGAGCGATTCTCTGCTTCCAATTCTGGGAACGCGGCCACCCTGACCATCAGCGGGGTCGAAGCCGGGGATGAAGCCGACTATTATTGTCACATTTTCGATAAGGACTCTGATCGTGTGGTT
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.549 = TGGCCAGTCCGCGGTA-1

using 908 reads

====================================================================================

graph has 1328 edges initially, 10 edges after simplification

total ucounts = 466
nonsolo ucounts = 158[2^70, 3^43, 4^11, 5^8, 6^8, 7^3, 8^3, 10^3, 11^2, 12, 13^3, 14, 16, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.551 = TGGCCAGTCCGGGTGT-1

using 357 reads

====================================================================================

graph has 526 edges initially, 21 edges after simplification

total ucounts = 204
nonsolo ucounts = 73[2^36, 3^18, 4^5, 5^9, 6, 7^3, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.553 = TGGCCAGTCCTACAGA-1

using 697 reads

====================================================================================

graph has 252 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 313, 370]
surviving nonsolo ucounts = 2[313, 370]
ids = [0, 11]

====================================================================================

UMI info for barcode TGGCCAGTCCTACAGA-1 contig 1 = GAGAGAGGAG...
umi ACATTGGCAT = 305 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=602]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-602 ==> 0-105 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.557 = TGGCCAGTCGCAGGCT-1

using 553 reads

====================================================================================

graph has 246 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 5, 538]
surviving nonsolo ucounts = 1[538]
ids = [1]

====================================================================================

UMI info for barcode TGGCCAGTCGCAGGCT-1 contig 1 = GCAGGAGTCA...
umi ACTCTTAGGG = 547 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-29 ==> 2-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 79 reads
cdr3 = CQQYDNLPTF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 534
start codons at 29, 35, 91, 104, 243, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.558 = TGGCCAGTCGCCAAAT-1

using 405 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[399]
surviving nonsolo ucounts = 1[399]
ids = [1]

====================================================================================

UMI info for barcode TGGCCAGTCGCCAAAT-1 contig 1 = GGAGAAGAGC...
umi CCCTAATGCG = 399 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYGRSPWTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 395
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.566 = TGGCCAGTCTAGAGTC-1

using 162 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.569 = TGGCCAGTCTCTGCTG-1

using 133 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[125]
surviving nonsolo ucounts = 1[125]
ids = [1]

====================================================================================

UMI info for barcode TGGCCAGTCTCTGCTG-1 contig 1 = ACCCAAAAAC...
umi AGATAAAACG = 113 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=529]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-529 ==> 0-39 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.571 = TGGCCAGTCTGGCGAC-1

using 56 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[13, 42]
surviving nonsolo ucounts = 1[42]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.573 = TGGCCAGTCTGTCAAG-1

using 116 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[111]
surviving nonsolo ucounts = 1[111]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.577 = TGGCGCAAGAAGAAGC-1

using 297 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 286]
surviving nonsolo ucounts = 1[286]
ids = [1]

====================================================================================

UMI info for barcode TGGCGCAAGAAGAAGC-1 contig 1 = GGGAATCAGT...
umi ATTCATGGCC = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.578 = TGGCGCAAGAATTGTG-1

using 273 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [0]

====================================================================================

UMI info for barcode TGGCGCAAGAATTGTG-1 contig 1 = GCTCTGCTTC...
umi AACCTATGCA = 247 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=609]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
448-609 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGSKVVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.582 = TGGCGCAAGACTACAA-1

using 486 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[484]
surviving nonsolo ucounts = 1[484]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=501]
0-34 ==> 63-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
7-59 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
34-83 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
79-325 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=2)
326-365 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
365-501 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQDYNLLQYTF at 301, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 472
start codons at 34, 185, 407
confident = false
not full
full length transcript of length 501
VJ delta = 72
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.594 = TGGCGCAAGCGTGAGT-1

using 327 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 323]
surviving nonsolo ucounts = 1[323]
ids = [0]

====================================================================================

UMI info for barcode TGGCGCAAGCGTGAGT-1 contig 1 = GAGCCCAGCC...
umi AGGTTCCCTA = 268 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=501]
0-66 ==> 13-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
66-419 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 23 reads
cdr3 = CAKFYSSSWQENDYW at 408, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 66, 217, 222, 369, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.598 = TGGCGCAAGCTGTCTA-1

using 17485 reads

====================================================================================

graph has 5986 edges initially, 38 edges after simplification

total ucounts = 744
nonsolo ucounts = 319[2^113, 3^68, 4^31, 5^22, 6^9, 7^5, 8^3, 10, 11^2, 12, 13, 15, 16, 17, 74, 75, 112, 128, 133, 139, 172, 181, 184, 196, 197, 204^3, 206, 213, 214, 225^2, 229, 230, 231, 233, 234, 240, 246, 249^2, 250^2, 252^2, 253, 254^2, 256, 257, 258, 261, 262, 265, 267, 277, 284, 289^2, 293, 297, 298, 309, 310, 324, 331, 332, 347, 351, 474, 614, 756, 985]
surviving nonsolo ucounts = 58[112, 128, 133, 139, 172, 181, 184, 196, 197, 204^3, 206, 213, 214, 225^2, 229, 230, 231, 233, 234, 240, 246, 249^2, 250^2, 252^2, 253, 254^2, 256, 257, 258, 261, 262, 265, 267, 277, 284, 289^2, 293, 297, 298, 309, 310, 324, 331, 332, 347, 351, 474, 614, 756, 985]
ids = [216, 449, 138, 576, 666, 589, 199, 269, 373, 370, ...]

====================================================================================

UMI info for barcode TGGCGCAAGCTGTCTA-1 contig 1 = AGCTTCAGCT...
umi AAACACGCGG = 223 reads: +391 validated
umi AAATTCTACG = 265 reads: +391 validated
umi AAATTTCCGA = 218 reads: +391 validated
umi AATATTTCGC = 325 reads: -8 +3 -2X +1 -2X +2 -2X +1 -1XX +1 -2XX +1 -2XX +1 -12XX +1 -1XX +348 invalidated
umi AATCGTTTTC = 251 reads: +391 validated
umi ACCCGCGACT = 292 reads: +391 validated
umi ACCGACGGTG = 256 reads: +391 validated
umi ACTGTCGGCT = 230 reads: +391 validated
umi ACTTCTGCTC = 255 reads: +391 validated
umi ACTTGTAATC = 255 reads: +391 validated
umi AGAGATTACG = 264 reads: +391 validated
umi AGTAAAGCGG = 277 reads: +391 validated
umi ATACCGACTG = 134 reads: +391 validated
umi ATATGGATCA = 245 reads: +391 validated
umi ATCTGATCCA = 254 reads: +391 validated
umi ATGATACTTG = 259 reads: +391 validated
umi ATGTAACCCG = 1001 reads: -355X +4 -1XX +31 invalidated
umi ATGTAATAGC = 292 reads: +391 validated
umi CAAATACGCA = 262 reads: +391 validated
umi CAAATGCCTT = 232 reads: +391 validated
umi CAACTATATT = 181 reads: +391 validated
umi CACGGATGGT = 255 reads: +391 validated
umi CACTATACGT = 113 reads: +391 validated
umi CATAATTTGT = 227 reads: +391 validated
umi CCGGTAATCG = 265 reads: +391 validated
umi CTGGCTTATG = 203 reads: +391 validated
umi CTTAAAATCG = 198 reads: +391 validated
umi CTTAGTATTA = 768 reads: -344X +1 -10XX +4 -1XX +31 invalidated
umi CTTGGTGGGT = 289 reads: +391 validated
umi CTTTTCACCG = 279 reads: +391 validated
umi GAAAGCCGTC = 225 reads: +391 validated
umi GATGCATGAG = 221 reads: +391 validated
umi GATTACGTCT = 203 reads: +391 validated
umi GATTTGGAGG = 205 reads: +391 validated
umi GTCAAAGGGT = 628 reads: +391 validated
umi GTCATACTCT = 211 reads: +391 validated
umi GTCGCTGTCA = 318 reads: +391 validated
umi GTTGCCCGCT = 244 reads: +391 validated
umi TAAATCACCT = 308 reads: +391 validated
umi TATTCTGTTC = 266 reads: +391 validated
umi TCACTACCAT = 141 reads: +391 validated
umi TCCCGATTGC = 178 reads: +391 validated
umi TCTACTTAAC = 203 reads: +391 validated
umi TCTCAACATA = 244 reads: +391 validated
umi TCTTCTGCAG = 338 reads: +391 validated
umi TGAGCCCTTC = 350 reads: +391 validated
umi TGTCCGCACC = 174 reads: +391 validated
umi TGTTGTGGTC = 295 reads: +391 validated
umi TTGAATTGGA = 252 reads: +391 validated
umi TTGCCTGTGC = 253 reads: +391 validated
umi TTTTTCCTCC = 477 reads: +391 validated

UMI info for barcode TGGCGCAAGCTGTCTA-1 contig 2 = AGCTCTGGGA...
umi AAGGTTCGCG = 257 reads: +412 validated
umi AATTAACCCA = 304 reads: +412 validated
umi CACCCGTTCT = 346 reads: +412 validated
umi CCCCGCGTGT = 194 reads: +412 validated
umi CGCTTTAGAG = 237 reads: +412 validated
umi GCTCGATCAA = 129 reads: +412 validated
umi TACGTAACCT = 320 reads: +52 -8X +352 invalidated

GOOD CONTIGS

TIG 1[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 49 umis using 1931 reads
cdr3 = CAAWDDSLSGPGVF at 367, score = 7 + 8
umis assigned: [2, 11, 13, 39, 44, 72, 73, 100, 102, 103] and 41 others
of which 51 are surviving nonsolos
reads assigned: 14050
start codons at 46, 200, 350, 375, 380
confident = true

TIG 2[bases=563]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=8)
455-492 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 135 reads
cdr3 = CARGVGAEAPDYW at 422, score = 9 + 7
umis assigned: [31, 50, 209, 269, 315, 449, 546]
of which 7 are surviving nonsolos
reads assigned: 1744
start codons at 80, 236, 383
confident = true
now this is a cell
paired!

CTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGGTGTGGGAGCTGAAGCCCCGGATTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCCGGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.599 = TGGCGCAAGCTGTTCA-1

using 847 reads

====================================================================================

graph has 222 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 327, 512]
surviving nonsolo ucounts = 2[327, 512]
ids = [5, 0]

====================================================================================

UMI info for barcode TGGCGCAAGCTGTTCA-1 contig 1 = GGAGGAACTG...
umi TTCTATCTGT = 270 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDSWPPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 34, 103, 176, 365, 381, 461
confident = false

REJECT CONTIGS

TIG 1[bases=463]
0-214 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
214-252 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
252-463 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 182, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 505
start codons at 12, 15, 66, 165, 192, 216, 384
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.602 = TGGCGCAAGGATATAC-1

using 573 reads

====================================================================================

graph has 300 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2, 3^2, 6, 7, 12, 166, 367]
surviving nonsolo ucounts = 1[367]
ids = [1]

====================================================================================

UMI info for barcode TGGCGCAAGGATATAC-1 contig 1 = AGCTCTGAGA...
umi ACAGTGCATC = 370 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=574]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=12)
468-503 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAKGLSIVATRGRLDFW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 79, 230, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.608 = TGGCGCAAGTCCTCCT-1

using 724 reads

====================================================================================

graph has 314 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 9, 324, 385]
surviving nonsolo ucounts = 2[324, 385]
ids = [0, 1]

====================================================================================

UMI info for barcode TGGCGCAAGTCCTCCT-1 contig 1 = AGCTCTCAGA...
umi CGCAAGCTTT = 387 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=556]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=11)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGGNYFDYW at 421, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 79, 230, 235, 382
confident = false

REJECT CONTIGS

TIG 1[bases=436]
0-273 ==> 77-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=29)
312-365 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=4)
365-436 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CVRHTNFDIVTAYYTIGYWYLDLW at 262, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 68, 196, 232
confident = false
VJ delta = 13
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.609 = TGGCGCAAGTCGATAA-1

using 302 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 297]
surviving nonsolo ucounts = 1[297]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=561]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-78 ==> 0-48 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=1)
78-389 ==> 49-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=21) [SHIFT!]
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 30, 63, 98, 186, 249, 348, 368, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.610 = TGGCGCAAGTGAACGC-1

using 367 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 357]
surviving nonsolo ucounts = 1[357]
ids = [0]

====================================================================================

UMI info for barcode TGGCGCAAGTGAACGC-1 contig 1 = GGGAATCAGT...
umi ATGCACTATA = 361 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.615 = TGGCGCAAGTTATCGC-1

using 418 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 412]
surviving nonsolo ucounts = 1[412]
ids = [4]

====================================================================================

UMI info for barcode TGGCGCAAGTTATCGC-1 contig 1 = AGTCCCAACC...
umi GGACCTCATT = 343 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYDNLPLTF at 347, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 20, 26, 82, 95, 234, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.631 = TGGCGCACACGGTTTA-1

using 317 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 308]
surviving nonsolo ucounts = 1[308]
ids = [2]

====================================================================================

UMI info for barcode TGGCGCACACGGTTTA-1 contig 1 = TGGGGTCTCA...
umi TATAGCGGAT = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=638]
0-39 ==> 2-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CSSYTSSSTVVF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 39, 196, 240, 247
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.637 = TGGCGCACAGCTCCGA-1

using 214 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3^2, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode TGGCGCACAGCTCCGA-1 contig 1 = GGAGTCAGTC...
umi AGCAGGGATC = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.644 = TGGCGCACAGTCACTA-1

using 1026 reads

====================================================================================

graph has 342 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 309, 321, 389]
surviving nonsolo ucounts = 2[309, 321]
ids = [6, 3]

====================================================================================

UMI info for barcode TGGCGCACAGTCACTA-1 contig 1 = GGAGTCAGAC...
umi ATGGAGGTAT = 80 reads: -336 +2 -1XX +1 -2XX +1 -1XX +1 -2XX +6 -1XX +3 -3XX +9 -1XX +12 invalidated
umi CCCGGGTCGG = 319 reads: +382 validated
umi TCTTATTCAG = 305 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 93 reads
cdr3 = CQQYYSYPLTF at 353, score = 9 + 9
umis assigned: [1, 3, 6]
of which 2 are surviving nonsolos
reads assigned: 696
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.654 = TGGCGCACATGCGCAC-1

using 260 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode TGGCGCACATGCGCAC-1 contig 1 = AGCTGTGGGC...
umi TCTTAAGGGG = 239 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=581]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-581 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.665 = TGGCGCATCACATACG-1

using 568 reads

====================================================================================

graph has 255 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 261, 301]
surviving nonsolo ucounts = 2[261, 301]
ids = [2, 4]

====================================================================================

UMI info for barcode TGGCGCATCACATACG-1 contig 1 = AGTCTGGGCC...
umi ATTCTCCCTT = 236 reads: +382 validated

UMI info for barcode TGGCGCATCACATACG-1 contig 2 = AGCTCTGAGA...
umi CGAATATTTC = 298 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=585]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-585 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 40, 235, 242, 338, 383
confident = false

TIG 2[bases=593]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
491-593 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CANLAVQYYFDYW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 79, 230, 235, 382, 509, 570
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.666 = TGGCGCATCACCCTCA-1

using 525 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 214, 302]
surviving nonsolo ucounts = 2[214, 302]
ids = [2, 3]

====================================================================================

UMI info for barcode TGGCGCATCACCCTCA-1 contig 1 = GTCAGACTCA...
umi CGTTCCCCTT = 216 reads: +388 validated
umi GTCTTCCGTA = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 67 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 509
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.669 = TGGCGCATCAGCACAT-1

using 661 reads

====================================================================================

graph has 248 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[238, 420]
surviving nonsolo ucounts = 2[238, 420]
ids = [4, 1]

====================================================================================

UMI info for barcode TGGCGCATCAGCACAT-1 contig 1 = GAATCAGTCC...
umi TTGTATGCCA = 243 reads: +388 validated

UMI info for barcode TGGCGCATCAGCACAT-1 contig 2 = GGGGAGGAAC...
umi ATGCTAGGTT = 418 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYNNWPRSF at 357, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 412
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.675 = TGGCGCATCCCAAGAT-1

using 1586 reads

====================================================================================

graph has 1927 edges initially, 18 edges after simplification

total ucounts = 683
nonsolo ucounts = 265[2^120, 3^55, 4^39, 5^17, 6^11, 7^7, 8^3, 9^3, 10^2, 11^2, 12^2, 16, 18, 21, 235]
surviving nonsolo ucounts = 1[235]
ids = [242]

====================================================================================

UMI info for barcode TGGCGCATCCCAAGAT-1 contig 1 = GGGAGGAACT...
umi CGACTATCCT = 235 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQRSNWPLTF at 356, score = 9 + 9
umis assigned: [242]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 35, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.682 = TGGCGCATCGAACTGT-1

using 1229 reads

====================================================================================

graph has 1363 edges initially, 30 edges after simplification

total ucounts = 526
nonsolo ucounts = 192[2^95, 3^38, 4^26, 5^13, 6^5, 7^2, 8^4, 9^2, 11^2, 12^2, 13, 16, 253]
surviving nonsolo ucounts = 1[253]
ids = [290]

====================================================================================

REJECT CONTIGS

TIG 1[bases=522]
4-321 ==> 36-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
345-392 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
392-522 ==> 0-130 on |43|IGHG2|C-REGION| [len=977] (mis=0)
cdr3 = CARDRAATARLGGMDVW at 310, score = 9 + 7
umis assigned: [290]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 119, 124, 271, 349
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.685 = TGGCGCATCGTACCGG-1

using 258 reads

====================================================================================

graph has 88 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[118, 136]
surviving nonsolo ucounts = 2[118, 136]
ids = [2, 0]

====================================================================================

UMI info for barcode TGGCGCATCGTACCGG-1 contig 1 = GCTCTGCTTC...
umi AAGAGGTCAT = 124 reads: +397 validated

UMI info for barcode TGGCGCATCGTACCGG-1 contig 2 = GTCAGTCTCA...
umi AATCCTGTAT = 99 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
448-553 ==> 0-105 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSLSASEAVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 51, 205, 208, 259, 358, 385
confident = false

TIG 2[bases=451]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-451 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQTYSTLVTF at 350, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 23, 29, 85, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.710 = TGGCTGGAGATAGGAG-1

using 16778 reads

====================================================================================

graph has 7617 edges initially, 120 edges after simplification

total ucounts = 1385
nonsolo ucounts = 643[2^240, 3^140, 4^69, 5^46, 6^38, 7^14, 8^13, 9^12, 10^4, 11^2, 12^3, 13^4, 14, 19, 36, 61, 80, 111, 121, 126, 129, 141, 148, 150, 161, 185, 187, 198, 199, 217, 221, 222^3, 228, 231, 233, 237, 238, 240, 241, 242, 244^2, 245, 246, 249, 250, 254, 257^2, 261, 264, 267, 272, 286, 291, 304, 305, 306, 307, 313, 321, 343, 347, 378, 406, 415, 420, 830]
surviving nonsolo ucounts = 51[61, 80, 141, 148, 150, 161, 185, 187, 198, 199, 217, 221, 222^3, 228, 231, 233, 237, 238, 240, 241, 242, 244^2, 245, 246, 249, 250, 254, 257^2, 261, 264, 267, 272, 286, 291, 304, 305, 306, 307, 313, 321, 343, 347, 378, 406, 415, 420, 830]
ids = [1232, 570, 476, 1245, 645, 196, 42, 89, 167, 1257, ...]

====================================================================================

UMI info for barcode TGGCTGGAGATAGGAG-1 contig 1 = AGGTCTCAGA...
umi CAGACGCTTT = 408 reads: -132 +292 non-validated
umi GATATGCATT = 166 reads: -223 +201 non-validated
umi TAACTGCCGC = 286 reads: +352 -2XX +2 -17XX +1 -1XX +1 -1XX +1 -3XX +43 invalidated
umi TATCGGTAGT = 224 reads: +424 validated
umi TCGAGATGGG = 313 reads: +424 validated
umi TGGTCGTGTC = 360 reads: +141 -1XX +1 -4XX +2 -2XX +1 -7XX +1 -78XX +1 -3XX +2 -1XX +2 -9XX +96 -2XX +2 -17XX +1 -1XX +1 -1XX +1 -3XX +43 invalidated
umi TGGTCGTGTG = 64 reads: +141 -1XX +1 -4XX +2 -2X +1 -86X +1 -3X +2 -1X +2 -9X +96 -2XX +2 -20XX +1 -5X +42 invalidated
umi TTCTCTCCCG = 318 reads: +424 validated
umi TTCTTACCAG = 223 reads: +424 validated

UMI info for barcode TGGCTGGAGATAGGAG-1 contig 2 = GCTGGGGTCT...
umi AATTCCAACC = 183 reads: +388 validated
umi ACCTCGGGAG = 252 reads: +388 validated
umi ACGCATTGAC = 266 reads: +388 validated
umi ACGCCTGTTC = 188 reads: +388 validated
umi AGGTCATCCA = 248 reads: +388 validated
umi ATAATAGTAG = 201 reads: +388 validated
umi ATCGTTGCTT = 161 reads: +388 validated
umi CACTCGCCAT = 429 reads: +388 validated
umi CCAACAGCGG = 222 reads: +388 validated
umi CCCTAGAGTC = 292 reads: +388 validated
umi CCCTATATGC = 266 reads: +388 validated
umi CCTGCCCTTG = 144 reads: +388 validated
umi CTAATCACAG = 253 reads: +388 validated
umi CTACCTTCAA = 316 reads: +359 -2XX +1 -1 +25 invalidated
umi CTCAAGGTGT = 236 reads: +388 validated
umi CTGTCACCCT = 150 reads: +388 validated
umi CTTCACTTCT = 247 reads: +388 validated
umi GAGCCCTAGT = 241 reads: +388 validated
umi GGACATCTTT = 240 reads: +388 validated
umi GTTCTGTCCC = 259 reads: +388 validated
umi TCCAATGGTT = 242 reads: +388 validated
umi TCCGTAGGAT = 229 reads: +388 validated
umi TCTTACCACA = 244 reads: +388 validated
umi TGATGGACTT = 238 reads: +388 validated
umi TGTCCTTGTA = 150 reads: +388 validated
umi TTAAATCACG = 201 reads: +388 validated
umi TTAGTACGTA = 234 reads: +388 validated
umi TTATTGCACT = 223 reads: +388 validated
umi TTGAAGGGTT = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=2)
457-503 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 274 reads
cdr3 = CARDGYFDWFQARHDYW at 421, score = 9 + 7
umis assigned: [281, 728, 929, 1023, 1122, 1231, 1232, 1313, 1316]
of which 9 are surviving nonsolos
reads assigned: 2294
start codons at 79, 235, 296, 314, 382, 431, 461
confident = true

TIG 2[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 29 umis using 1033 reads
cdr3 = CSSYTSSSTVVF at 365, score = 8 + 8
umis assigned: [42, 76, 87, 89, 148, 167, 196, 274, 341, 419] and 19 others
of which 29 are surviving nonsolos
reads assigned: 6695
start codons at 41, 198, 242, 249
confident = true

REJECT CONTIGS

TIG 1[bases=559]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-383 ==> 0-353 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=6)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [218, 294, 499, 567, 570, 616, 714, 740, 773, 895] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3483
start codons at 30, 63, 99, 187, 250, 349, 369, 465
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATGGATATTTTGACTGGTTCCAGGCTAGACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.719 = TGGCTGGAGCCAGAAC-1

using 28991 reads

====================================================================================

graph has 10533 edges initially, 62 edges after simplification

total ucounts = 1397
nonsolo ucounts = 650[2^246, 3^133, 4^76, 5^37, 6^22, 7^19, 8^6, 9^8, 10^5, 11^3, 12^5, 13, 14, 15, 16, 17^2, 25, 42, 58, 65, 73, 76, 85, 92, 119, 124, 130, 138, 140, 146, 156, 159, 169^2, 170, 179, 210, 211, 213, 219^2, 227, 243, 244, 250, 255, 260, 270, 272, 276, 278, 285, 289, 295, 297, 298, 300, 303, 305, 307, 314, 321, 324, 326, 330^2, 338, 340^2, 349, 350, 352^2, 360, 366, 367^2, 368, 375, 378, 384, 385, 387, 388, 393, 396, 400, 411^2, 415^2, 448, 488, 511, 534, 689, 794, 836, 881, 1089]
surviving nonsolo ucounts = 78[58, 65, 85, 119, 124, 130, 138, 140, 146, 156, 159, 169^2, 170, 179, 210, 211, 213, 219^2, 227, 243, 244, 250, 255, 260, 270, 272, 276, 278, 285, 289, 295, 297, 298, 300, 303, 305, 307, 314, 321, 324, 326, 330^2, 338, 340^2, 349, 350, 352^2, 360, 366, 367^2, 368, 375, 378, 384, 385, 387, 388, 393, 396, 400, 411^2, 415^2, 448, 488, 511, 534, 689, 794, 881, 1089]
ids = [839, 1064, 448, 13, 1151, 876, 306, 804, 1186, 1348, ...]

====================================================================================

UMI info for barcode TGGCTGGAGCCAGAAC-1 contig 1 = TGGGGAGGAG...
umi AAAAACGTCC = 414 reads: +388 validated
umi AAAATCAATA = 392 reads: +388 validated
umi AAACGGGGCT = 122 reads: +388 validated
umi AAATTTTGTC = 304 reads: +388 validated
umi AACTGACCGC = 508 reads: +388 validated
umi AATCACGGCT = 285 reads: +388 validated
umi ACGAAACCGC = 398 reads: +388 validated
umi ACTCCACGTT = 290 reads: +388 validated
umi AGATTGTGTA = 275 reads: +388 validated
umi AGCACTTTGT = 387 reads: +388 validated
umi AGCGCATGTA = 372 reads: +388 validated
umi ATACTTTACA = 333 reads: +388 validated
umi ATAGAAGGGA = 141 reads: +388 validated
umi ATCCATAGGA = 271 reads: +388 validated
umi ATCCCTCGAT = 396 reads: +388 validated
umi ATGGGCCCAG = 457 reads: -160X +1 -1XX +3 -1XX +1 -14XX +1 -1XX +1 -1XX +3 -3XX +1 -1XX +195 invalidated
umi ATTATATTTT = 342 reads: +388 validated
umi CAACGGCCCT = 384 reads: +388 validated
umi CAGCATACCT = 331 reads: +388 validated
umi CATGCCAGGT = 261 reads: +388 validated
umi CCTGATTCCG = 357 reads: +388 validated
umi CGCCTCTATG = 328 reads: +388 validated
umi CTTACAGGGT = 349 reads: +388 validated
umi CTTCTCCATA = 373 reads: +388 validated
umi CTTGCCGCGC = 378 reads: +388 validated
umi CTTTCTCTTC = 298 reads: +388 validated
umi GCCAGGTAAC = 388 reads: +388 validated
umi GCCGCTCTCA = 366 reads: +388 validated
umi GCGGAGTGCT = 444 reads: +388 validated
umi GCTGTCACAG = 131 reads: +388 validated
umi GCTTAGGCTC = 348 reads: +188 -1XX +199 invalidated
umi TAATAGCACA = 307 reads: +388 validated
umi TACATTCATC = 329 reads: +388 validated
umi TAGTACAGTC = 298 reads: +388 validated
umi TCACGTGTCG = 395 reads: +388 validated
umi TCCCTCATCA = 415 reads: +388 validated
umi TCCGTATACC = 172 reads: +388 validated
umi TCGAGAACGC = 418 reads: +388 validated
umi TCGGTACCTC = 365 reads: +388 validated
umi TGGGATGCCA = 259 reads: +388 validated
umi TGTAGCGCGC = 348 reads: +388 validated
umi TGTGATCTTT = 321 reads: +388 validated
umi TTAAGTCGCG = 215 reads: +388 validated
umi TTATCAGGGA = 304 reads: +388 validated
umi TTATCCCGTG = 367 reads: +388 validated
umi TTCTCCCTTC = 277 reads: +388 validated
umi TTGGGAGCTA = 337 reads: +388 validated

UMI info for barcode TGGCTGGAGCCAGAAC-1 contig 2 = AGCTCTGGGA...
umi AAGTACGAAC = 199 reads: +419 -8 non-validated
umi ACCCTCTGCA = 219 reads: +427 validated
umi ACTATATTGG = 144 reads: +427 validated
umi AGCCACGAGC = 496 reads: +427 validated
umi AGGCGCTCGG = 242 reads: +427 validated
umi AGTCAAAACC = 170 reads: +427 validated
umi AGTCAGCCAC = 178 reads: +388 -1 +38 non-validated
umi ATCATTTGCG = 209 reads: +414 -13 non-validated
umi CACGCCTATC = 72 reads: +340 -1 +86 non-validated
umi CCCATCAATC = 216 reads: +427 validated
umi CCGCCTTCAC = 173 reads: +427 validated
umi CGACGGAATA = 249 reads: +427 validated
umi CGAGCGCACC = 371 reads: +427 validated
umi CGGCTTGCCT = 300 reads: +427 validated
umi GAGGGCCGGT = 140 reads: +412 -2 +1 -1 +2 -1 +1 -3 +3 -1 non-validated
umi GCCATCATCA = 55 reads: +367 -1 +3 -1 +31 -1 +3 -1 +7 -2 +10 non-validated
umi GCGCAAGGCA = 349 reads: +427 validated
umi TAATCATGCT = 228 reads: +347 -1X +2 -1 +76 invalidated
umi TATAAATTCG = 272 reads: +427 validated
umi TATCGCTCTA = 66 reads: +216 -10 +136 -13 +7 -1 +3 -3 +1 -1 +1 -1 +2 -1 +1 -1 +1 -2 +11 -1 +3 -1 +2 -1 +7 non-validated
umi TCGTTGCATT = 111 reads: +427 validated
umi TCTTGTACTG = 120 reads: +427 validated
umi TTCCTTATTT = 303 reads: +427 validated
umi TTCGTCACCC = 247 reads: +427 validated
umi TTGGACTCGG = 160 reads: +427 validated
umi TTGTGATCTT = 244 reads: +402 -1 +2 -1 +7 -1 +1 -1 +11 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 47 umis using 2605 reads
cdr3 = CQQSYSTPLTF at 359, score = 9 + 9
umis assigned: [1, 3, 13, 28, 48, 92, 170, 197, 234, 237] and 37 others
of which 47 are surviving nonsolos
reads assigned: 15278
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=578]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
456-507 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
507-578 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 22 umis using 387 reads
cdr3 = CAKDSVGMKGAGGWFDPW at 422, score = 9 + 7
umis assigned: [70, 156, 192, 241, 263, 285, 286, 326, 448, 529] and 16 others
of which 26 are surviving nonsolos
reads assigned: 5445
start codons at 80, 225, 231, 236, 315, 383, 443
confident = true

REJECT CONTIGS

TIG 1[bases=444]
1-106 ==> 5327-5432 on segment before IGLJ1 exon 1 [len=5432] (mis=0)
195-233 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
233-444 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [414, 444, 677, 748, 761, 915]
of which 5 are surviving nonsolos
reads assigned: 4596
start codons at 60, 103, 197, 365
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCTTGTATTACTGTGCAAAAGATTCTGTTGGCATGAAGGGTGCCGGGGGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.722 = TGGCTGGAGCCCTAAT-1

using 1566 reads

====================================================================================

graph has 1834 edges initially, 12 edges after simplification

total ucounts = 535
nonsolo ucounts = 219[2^96, 3^48, 4^28, 5^13, 6^12, 7^7, 8^2, 9^7, 10^2, 11, 21, 108, 377]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.724 = TGGCTGGAGCCTATGT-1

using 19 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.731 = TGGCTGGAGCTATGCT-1

using 71 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 13[2^3, 3^2, 4^4, 5^2, 9, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.733 = TGGCTGGAGCTGCCCA-1

using 566 reads

====================================================================================

graph has 288 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3, 5, 7, 10, 181, 354]
surviving nonsolo ucounts = 2[181, 354]
ids = [3, 5]

====================================================================================

UMI info for barcode TGGCTGGAGCTGCCCA-1 contig 1 = GAATCAGTCC...
umi GCAAGGGACG = 358 reads: +388 validated

UMI info for barcode TGGCTGGAGCTGCCCA-1 contig 2 = GCCCAGCACT...
umi ATGGTAGACA = 162 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=516]
0-64 ==> 157-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
64-414 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=10)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
488-516 ==> 0-28 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDILTGPNRGDAFDIW at 403, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 64, 220, 364, 373, 440, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.767 = TGGCTGGAGTTTGCGT-1

using 265 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 254]
surviving nonsolo ucounts = 1[254]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGAGTTTGCGT-1 contig 1 = AGGAGTCAGT...
umi CTTCAGGTAG = 238 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=477]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-477 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDNLPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.776 = TGGCTGGCAACGCACC-1

using 89 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 84]
surviving nonsolo ucounts = 1[84]
ids = [0]

====================================================================================

UMI info for barcode TGGCTGGCAACGCACC-1 contig 1 = CACTCAGGAC...
umi AAGATTCAGC = 79 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
15-366 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
365-403 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
403-499 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CLQYSSSPWTF at 342, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 15, 21, 90, 226, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.780 = TGGCTGGCAAGCCTAT-1

using 437 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 3, 424]
surviving nonsolo ucounts = 1[424]
ids = [1]

====================================================================================

UMI info for barcode TGGCTGGCAAGCCTAT-1 contig 1 = AGGAGTCAGA...
umi ATTTGCCATA = 428 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQYNNYSPYTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 421
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.781 = TGGCTGGCAAGCGAGT-1

using 284 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 274]
surviving nonsolo ucounts = 2[3, 274]
ids = [6, 5]

====================================================================================

UMI info for barcode TGGCTGGCAAGCGAGT-1 contig 1 = GGATGCTTTC...
umi TGTTTCTTTG = 249 reads: +448 validated
umi TGTTTCTTTT = 3 reads: -78 +1 -1 +3 -2X +1 -1X +2 -1 +2 -1 +4 -2X +1 -2X +5 -1 +1 -2 +2 -2 +4 -1 +1 -2 +8 -2 +1 -10 +62 -1 +18 -1 +3 -219 invalidated

GOOD CONTIGS

TIG 1[bases=547]
18-393 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=30)
413-466 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=4)
466-547 ==> 0-81 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CACLKKGNWGDWYFDLW at 384, score = 9 + 7
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 248
start codons at 2, 18, 27, 39, 83, 172, 520, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.797 = TGGCTGGCACCCTATC-1

using 137 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.808 = TGGCTGGCAGATCGGA-1

using 242 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [1]

====================================================================================

UMI info for barcode TGGCTGGCAGATCGGA-1 contig 1 = GGGGTCTCAG...
umi GTTTCTCGTT = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-558 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.821 = TGGCTGGCAGTGACAG-1

using 126 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 119]
surviving nonsolo ucounts = 1[119]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGCAGTGACAG-1 contig 1 = AGGACTCCTC...
umi CAGAGCTCAA = 114 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=511]
0-26 ==> 4-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
26-386 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-511 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CMQGTHWPWTF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 26, 59, 87, 95, 183, 345, 365, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.822 = TGGCTGGCATACGCTA-1

using 271 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 258]
surviving nonsolo ucounts = 1[258]
ids = [7]

====================================================================================

UMI info for barcode TGGCTGGCATACGCTA-1 contig 1 = GGGGGGGGTC...
umi TCAGTATCTT = 252 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=638]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-390 ==> 0-348 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
396-427 ==> 7-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CCSYAGSYSSF at 366, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.834 = TGGCTGGCATGTTCCC-1

using 378 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[374]
surviving nonsolo ucounts = 1[374]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGCATGTTCCC-1 contig 1 = GAGTCAGTCT...
umi GCCAGCTTGA = 301 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=493]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
378-410 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
410-493 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYSTPLF at 352, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.851 = TGGCTGGGTAGCCTCG-1

using 299 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGGTAGCCTCG-1 contig 1 = GTCAGTCTCA...
umi CCTCTTTCGA = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTLWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.852 = TGGCTGGGTAGCGTCC-1

using 17 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.855 = TGGCTGGGTAGTACCT-1

using 275 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode TGGCTGGGTAGTACCT-1 contig 1 = GAGCCCCAGC...
umi ACCGTAGGAG = 239 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=516]
0-67 ==> 169-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
67-420 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=9)
423-451 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=4)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
491-516 ==> 0-25 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAREGAYCGGECYFDFW at 409, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 67, 223, 278, 284, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.858 = TGGCTGGGTATCAGTC-1

using 1351 reads

====================================================================================

graph has 1788 edges initially, 30 edges after simplification

total ucounts = 684
nonsolo ucounts = 261[2^110, 3^68, 4^36, 5^15, 6^11, 7^6, 8^3, 9^2, 10^2, 11, 13^3, 14, 15, 17, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.866 = TGGCTGGGTCCGTTAA-1

using 173 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 167]
surviving nonsolo ucounts = 1[167]
ids = [1]

====================================================================================

UMI info for barcode TGGCTGGGTCCGTTAA-1 contig 1 = AGAGAGGTGC...
umi CAAGTTTTCG = 169 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=585]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=2)
422-453 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
465-514 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
514-585 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARFICSSTSCYVWGYQYGMDVW at 414, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 72, 223, 228, 375, 448, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.867 = TGGCTGGGTCCTCTTG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.869 = TGGCTGGGTCGCGGTT-1

using 316 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^3, 307]
surviving nonsolo ucounts = 1[307]
ids = [3]

====================================================================================

UMI info for barcode TGGCTGGGTCGCGGTT-1 contig 1 = GATCAGGACT...
umi GGATTTTACG = 294 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=506]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-506 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.877 = TGGCTGGGTGAACCTT-1

using 809 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 152, 307, 342]
surviving nonsolo ucounts = 3[152, 307, 342]
ids = [7, 0, 1]

====================================================================================

UMI info for barcode TGGCTGGGTGAACCTT-1 contig 1 = GGAATCAGTC...
umi AACTGTGACC = 305 reads: +388 validated
umi AATTCTCCTA = 344 reads: +388 validated
umi TCAGTAAAAC = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 144 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0, 1, 7]
of which 3 are surviving nonsolos
reads assigned: 791
start codons at 26, 32, 101, 237, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.881 = TGGCTGGGTGATGCCC-1

using 31 reads

====================================================================================

graph has 2 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.883 = TGGCTGGGTGCACGAA-1

using 239 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGGTGCACGAA-1 contig 1 = AGTCTGGGCC...
umi TCAGAGACAG = 234 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.885 = TGGCTGGGTGCAGGTA-1

using 669 reads

====================================================================================

graph has 256 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 57, 604]
surviving nonsolo ucounts = 2[57, 604]
ids = [0, 6]

====================================================================================

UMI info for barcode TGGCTGGGTGCAGGTA-1 contig 1 = TGGGAGGAAT...
umi AAATGTTATG = 56 reads: +388 validated
umi GCTAGGAATC = 606 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 109 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 651
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.890 = TGGCTGGGTGCTAGCC-1

using 5694 reads

====================================================================================

graph has 3525 edges initially, 64 edges after simplification

total ucounts = 830
nonsolo ucounts = 331[2^149, 3^68, 4^41, 5^16, 6^17, 7^8, 8^3, 9^3, 10, 11^3, 12, 13, 16, 20, 53, 63, 100, 140, 155, 198, 209, 213, 234, 242, 245, 246, 286, 322, 326, 358, 366, 380]
surviving nonsolo ucounts = 16[53, 100, 140, 155, 198, 209, 213, 242, 245, 246, 286, 322, 326, 358, 366, 380]
ids = [259, 229, 706, 643, 756, 804, 800, 281, 513, 512, ...]

====================================================================================

UMI info for barcode TGGCTGGGTGCTAGCC-1 contig 1 = AGAGCTCTGG...
umi AGTATACACC = 368 reads: +385 validated
umi ATTTACTCCG = 358 reads: +385 validated
umi CAAAGGCATT = 99 reads: +385 validated
umi CACCGCATTC = 52 reads: +326 -11 +48 non-validated
umi CATCACGGGT = 241 reads: +385 validated
umi CATGCGCTCA = 286 reads: +385 validated
umi CCGTCTTTGA = 138 reads: +26 -5X +1 -2XX +2 -1XX +1 -5XX +2 -1XX +339 invalidated
umi GCACAGTCTG = 327 reads: +385 validated
umi GGATCATTCC = 244 reads: +385 validated
umi GGTCAAGAGG = 328 reads: +385 validated
umi GTTGAGGGTC = 379 reads: +385 validated
umi TATCGCATCC = 158 reads: +385 validated
umi TTGGACGGTC = 214 reads: +385 validated
umi TTGGCATAGG = 212 reads: +385 validated

UMI info for barcode TGGCTGGGTGCTAGCC-1 contig 2 = AGCTCTGGGA...
umi GGATACTCTA = 235 reads: +427 validated
umi TCGTGGTTAT = 132 reads: +426 -1 non-validated
umi TGGTTTGTCT = 193 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 501 reads
cdr3 = CQQYGSSPRTF at 368, score = 9 + 8
umis assigned: [164, 218, 229, 259, 281, 288, 332, 454, 513, 530] and 4 others
of which 13 are surviving nonsolos
reads assigned: 3356
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=588]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=2)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=13)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
507-588 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 3 umis using 63 reads
cdr3 = CIRETGGSARYYIQYW at 428, score = 8 + 7
umis assigned: [512, 706, 756]
of which 3 are surviving nonsolos
reads assigned: 548
start codons at 80, 133, 231, 236, 303, 321, 360, 389, 561
confident = true
now this is a cell
paired!

GAGGACACAGCCCTGTATCACTGTATTAGAGAAACGGGTGGTTCGGCACGTTATTATATTCAGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTAGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.895 = TGGCTGGGTGTCCTCT-1

using 185 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^4, 3, 4, 163]
surviving nonsolo ucounts = 1[163]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.918 = TGGCTGGGTTGATTCG-1

using 39 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 6[2^2, 5, 8, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.932 = TGGCTGGTCAACACGT-1

using 527 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 6, 7, 506]
surviving nonsolo ucounts = 1[506]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=519]
0-270 ==> 86-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
270-308 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
308-519 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 238, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 499
start codons at 68, 71, 122, 221, 248, 272, 440
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.936 = TGGCTGGTCACATAGC-1

using 11 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.938 = TGGCTGGTCACCTTAT-1

using 147 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 136]
surviving nonsolo ucounts = 1[136]
ids = [3]

====================================================================================

UMI info for barcode TGGCTGGTCACCTTAT-1 contig 1 = GGAATCAGTC...
umi GATGCTCATC = 125 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-481 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.941 = TGGCTGGTCAGATAAG-1

using 118 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 108]
surviving nonsolo ucounts = 1[108]
ids = [0]

====================================================================================

UMI info for barcode TGGCTGGTCAGATAAG-1 contig 1 = ACAGCATGGA...
umi CCCTGGCTTA = 92 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
5-358 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
355-393 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
393-474 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQSYSTLRKF at 332, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 5, 11, 67, 80, 216, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.948 = TGGCTGGTCATCATTC-1

using 597 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 13, 579]
surviving nonsolo ucounts = 1[579]
ids = [2]

====================================================================================

UMI info for barcode TGGCTGGTCATCATTC-1 contig 1 = TGGGGAGGAA...
umi CAGCCACGTC = 572 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CQQYNNWPPVTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 564
start codons at 37, 106, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.962 = TGGCTGGTCCGAATGT-1

using 371 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 3^2, 4, 351]
surviving nonsolo ucounts = 1[351]
ids = [3]

====================================================================================

UMI info for barcode TGGCTGGTCCGAATGT-1 contig 1 = ACTAGAAGTC...
umi AGCATATTGC = 350 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
0-57 ==> 23-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
57-408 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=16)
416-447 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=7)
458-493 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
493-564 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAKDSFLDYDSSGYYGLLTGW at 399, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 57, 213, 274, 292, 360, 424
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.965 = TGGCTGGTCCGTCATC-1

using 24 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 15]
surviving nonsolo ucounts = 1[15]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1006 = TGGCTGGTCTGAGTGT-1

using 11829 reads

====================================================================================

graph has 4349 edges initially, 78 edges after simplification

total ucounts = 642
nonsolo ucounts = 305[2^121, 3^59, 4^28, 5^20, 6^12, 7^10, 8^7, 9^2, 10, 11^2, 14, 15, 17, 23, 32, 38, 53, 60, 76, 77, 110, 112, 121, 161, 190, 192, 196, 218, 227, 243, 251, 255^2, 258, 261, 272, 280, 283, 289, 291, 296, 297, 298, 312, 328, 333, 335, 337, 340, 388, 641, 684, 1153]
surviving nonsolo ucounts = 29[53, 77, 161, 190, 192, 196, 218, 227, 243, 251, 255^2, 258, 261, 272, 280, 289, 291, 297, 298, 312, 328, 333, 335, 337, 340, 388, 641, 1153]
ids = [415, 103, 422, 238, 42, 596, 413, 178, 614, 222, ...]

====================================================================================

UMI info for barcode TGGCTGGTCTGAGTGT-1 contig 1 = TGGGGAGGAG...
umi AGGCACTTGG = 76 reads: +369 -1 +1 -17 non-validated
umi ATGCAATGGC = 289 reads: +388 validated
umi CAGTGACAGG = 255 reads: +388 validated
umi CATTAACTCA = 228 reads: +388 validated
umi CCACTACACA = 341 reads: -117X +271 invalidated
umi CCCATCTTGC = 294 reads: +388 validated
umi CCCTACCCGC = 334 reads: +388 validated
umi CCGAATTCCT = 253 reads: +41 -1XX +10 -1XX +8 -1XX +27 -1XX +3 -1XX +46 -1XX +8 -1XX +5 -1XX +4 -2XX +2 -4XX +45 -3XX +2 -1XX +2 -1XX +5 -2XX +25 -1XX +20 -1XX +20 -1XX +5 -1XX +5 -1XX +14 -1XX +3 -27X +2 -1X +6 -2XX +15 -1XX +7 invalidated
umi CCGGTTTAGC = 253 reads: +388 validated
umi CCTTGTGCTA = 272 reads: +388 validated
umi CCTTTAGCCA = 200 reads: +388 validated
umi CGTTCCTGCC = 258 reads: +388 validated
umi CTACCCAACT = 347 reads: +388 validated
umi CTATTTTCGC = 256 reads: +388 validated
umi CTCACACCCG = 283 reads: +388 validated
umi CTCCATCCAT = 283 reads: +17 -1XX +23 -1XX +9 -2XX +83 -1XX +3 -1XX +6 -2XX +8 -1XX +54 -1XX +1 -1XX +8 -1XX +4 -1XX +3 -2XX +23 -1XX +20 -1XX +3 -1XX +13 -1XX +5 -1XX +7 -14X +2 -1XX +1 -5XX +2 -4XX +2 -3XX +2 -2XX +1 -2XX +1 -4XX +32 invalidated
umi CTTCACATTG = 334 reads: +388 validated
umi GACTGTGTGC = 290 reads: +388 validated
umi GGTATCGATA = 219 reads: +388 validated
umi GGTCAGCTGT = 55 reads: +110 -2XX +2 -1 +1 -1 +271 invalidated
umi GTACGTACTG = 160 reads: +388 validated
umi TAGCACCCTA = 315 reads: +388 validated
umi TCATACCGCA = 382 reads: +388 validated
umi TGAAAGGGCC = 330 reads: +388 validated
umi TGAAATCGAC = 256 reads: -108X +280 invalidated
umi TTAAAAGGAA = 201 reads: +56 -1XX +1 -1XX +4 -5XX +4 -20XX +1 -3XX +2 -12XX +278 invalidated
umi TTCATAGCCG = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 1099 reads
cdr3 = CQQSYSTPLTF at 359, score = 9 + 9
umis assigned: [103, 124, 161, 178, 187, 198, 205, 212, 222, 237] and 17 others
of which 25 are surviving nonsolos
reads assigned: 6855
start codons at 32, 38, 94, 107, 243, 462
confident = true

REJECT CONTIGS

TIG 1[bases=307]
10-35 ==> 4932-4957 on rc of segment before IGLL1 exon 1 [len=6445] (mis=0)
58-96 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
94-142 ==> 6397-6445 on rc of segment before IGLL1 exon 1 [len=6445] (mis=4)
96-307 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [202, 242, 591]
of which 2 are surviving nonsolos
reads assigned: 1871
start codons at 60, 228
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1007 = TGGCTGGTCTGATTCT-1

using 22 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1012 = TGGCTGGTCTGGTATG-1

using 260 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 255]
surviving nonsolo ucounts = 1[255]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=583]
19-387 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=2)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
424-583 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 19, 34, 43, 46, 71, 338, 341, 370
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1023 = TGGCTGGTCTTTACGT-1

using 18 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1026 = TGGGAAGAGACAAAGG-1

using 17 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1027 = TGGGAAGAGACGCAAC-1

using 446 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 194, 250]
surviving nonsolo ucounts = 2[194, 250]
ids = [0, 2]

====================================================================================

UMI info for barcode TGGGAAGAGACGCAAC-1 contig 1 = GGGGGGGGTC...
umi GCCGCGGTGT = 190 reads: +388 validated

UMI info for barcode TGGGAAGAGACGCAAC-1 contig 2 = GAGAGTCCTG...
umi TTGGTAGTCC = 236 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=571]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-393 ==> 0-351 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
430-571 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CCSYAGSYTVVF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false

TIG 2[bases=498]
0-28 ==> 117-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
28-378 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=32)
389-440 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
440-498 ==> 0-58 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARGQRVFNYFDPW at 367, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 28, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1028 = TGGGAAGAGAGACTAT-1

using 3551 reads

====================================================================================

graph has 1732 edges initially, 20 edges after simplification

total ucounts = 326
nonsolo ucounts = 128[2^43, 3^27, 4^15, 5^12, 6^8, 7^4, 8, 9^2, 10, 11, 13, 14, 23, 108, 174, 177, 179, 183, 193, 221, 265, 371, 416, 606]
surviving nonsolo ucounts = 11[23, 108, 174, 177, 179, 183, 221, 265, 371, 416, 606]
ids = [302, 167, 290, 201, 9, 39, 83, 231, 163, 63, ...]

====================================================================================

UMI info for barcode TGGGAAGAGAGACTAT-1 contig 1 = GGGGGCTGGG...
umi AACCGCTAGA = 177 reads: +394 validated
umi ACTCAGAGCC = 158 reads: -10X +1 -1XX +1 -1XX +1 -6XX +1 -1XX +1 -6XX +1 -6XX +1 -3XX +1 -1XX +351 invalidated
umi ATCATCTCTA = 422 reads: -374X +1 -2X +17 invalidated
umi ATTACATACG = 185 reads: +17 -2XX +7 -1XX +13 -1XX +62 -1XX +26 -1XX +9 -1XX +5 -3XX +7 -2XX +6 -1XX +47 -1XX +1 -1XX +6 -1XX +62 -1XX +42 -1XX +8 -1XX +2 -1XX +1 -1XX +1 -2XX +1 -1XX +4 -1X +1 -3X +1 -1XX +36 invalidated
umi GCGCTTCACT = 177 reads: +394 validated
umi TACCTACCTT = 264 reads: +394 validated
umi TGTAAGCCTC = 178 reads: +394 validated
umi TTATGGCAGC = 23 reads: +323 -1 +5 -1 +6 -1 +1 -1 +5 -1 +3 -1 +1 -1 +1 -1 +3 -1 +2 -1 +4 -1 +29 non-validated

UMI info for barcode TGGGAAGAGAGACTAT-1 contig 2 = GGGGAATCCT...
umi ATTTAATGGC = 223 reads: +442 validated
umi CTATTGACCG = 374 reads: +442 validated
umi CTCCGGGTCA = 95 reads: -441X +1 invalidated
umi TCCTTGGTCA = 37 reads: -359X +1 -1XX +1 -6XX +1 -1XX +2 -3XX +2 -5XX +1 -2XX +2 -2XX +53 invalidated

GOOD CONTIGS

TIG 1[bases=650]
45-388 ==> 0-343 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
439-650 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 150 reads
cdr3 = CGSYTSTNTLDVVF at 369, score = 8 + 8
umis assigned: [9, 39, 63, 77, 201, 231, 290, 302]
of which 7 are surviving nonsolos
reads assigned: 1545
start codons at 45, 202, 246, 253, 256, 400
confident = true

TIG 2[bases=533]
20-378 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=5)
409-462 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 44 reads
cdr3 = CARASGFSSSWSKHLYYGMDVW at 365, score = 7 + 7
umis assigned: [83, 163, 167, 261]
of which 4 are surviving nonsolos
reads assigned: 720
start codons at 20, 176, 243, 246, 326, 335, 419
confident = true
now this is a cell
paired!

TACTGTGCACGGGCCTCAGGCTTTAGCAGCAGCTGGTCAAAACACCTCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCCAGGCTGAGGACGAGGCTGATTATTACTGCGGCTCATATACAAGCACCAACACTCTCGATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1030 = TGGGAAGAGCCGCCTA-1

using 493 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[490]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1035 = TGGGAAGAGGAACTGC-1

using 375 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [2]

====================================================================================

UMI info for barcode TGGGAAGAGGAACTGC-1 contig 1 = AGTCCCAACC...
umi GTATTGTACT = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-487 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CHQYESVPYTF at 347, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 20, 26, 82, 95, 234, 330, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1039 = TGGGAAGAGGATGGTC-1

using 1802 reads

====================================================================================

graph has 1204 edges initially, 30 edges after simplification

total ucounts = 338
nonsolo ucounts = 104[2^48, 3^22, 4^10, 5^7, 6^6, 7^5, 8, 9, 10, 185, 254, 794]
surviving nonsolo ucounts = 4[10, 185, 254, 794]
ids = [36, 311, 126, 144]

====================================================================================

UMI info for barcode TGGGAAGAGGATGGTC-1 contig 1 = AGCTCTCAGA...
umi ACTGTAGACC = 7 reads: +8 -1X +6 -1X +13 -1X +2 -3 +1 -1X +5 -2X +3 -1 +6 -1 +1 -2X +3 -1 +8 -1 +6 -1 +4 -42 +29 -3XX +3 -1XX +22 -1X +14 -18X +1 -2X +1 -1X +1 -4X +1 -2X +1 -1X +2 -1 +12 -1X +1 -1 +31 -1X +8 -1X +1 -1X +18 -112 invalidated
umi TTACTAGGCG = 155 reads: +421 validated

UMI info for barcode TGGGAAGAGGATGGTC-1 contig 2 = AGCTGTGGGC...
umi CGGTCACTAT = 255 reads: +382 validated
umi CTCTTATCAG = 810 reads: -334X +1 -1X +2 -2XX +1 -3XX +1 -2XX +3 -1XX +31 invalidated

GOOD CONTIGS

TIG 1[bases=507]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=10)
454-500 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
junction support: 1 umis using 10 reads
cdr3 = CARGGIWYDSSSGNYW at 421, score = 8 + 7
umis assigned: [36, 311]
of which 2 are surviving nonsolos
reads assigned: 160
start codons at 79, 235, 356, 382, 443
confident = true

TIG 2[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CNSRDSSGNHVVF at 355, score = 8 + 8
umis assigned: [126, 144]
of which 2 are surviving nonsolos
reads assigned: 1035
start codons at 40, 159, 188, 239, 338, 383
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGGAGGGATTTGGTATGATAGTAGTTCCGGAAACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1047 = TGGGAAGAGTTACCCA-1

using 276 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 270]
surviving nonsolo ucounts = 2[3, 270]
ids = [1, 2]

====================================================================================

UMI info for barcode TGGGAAGAGTTACCCA-1 contig 1 = GTCAGTCCCA...
umi AGTCGCTCCG = 3 reads: -101 +45 -1 +10 -15 +27 -1 +11 -1 +16 -160 non-validated
umi AGTCGCTCCT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQFDNLPLTF at 350, score = 9 + 9
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 268
start codons at 23, 29, 85, 98, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1052 = TGGGAAGCAACTGGCC-1

using 333 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [2]

====================================================================================

UMI info for barcode TGGGAAGCAACTGGCC-1 contig 1 = GAGTCAGTCT...
umi TCCCGCTAGG = 335 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1054 = TGGGAAGCAAGCTGAG-1

using 351 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [2]

====================================================================================

UMI info for barcode TGGGAAGCAAGCTGAG-1 contig 1 = GGGAATCAGT...
umi TATGTGGGGT = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1055 = TGGGAAGCAAGTCATC-1

using 164 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================

UMI info for barcode TGGGAAGCAAGTCATC-1 contig 1 = GAGAAGAGCT...
umi TGAGTACCGA = 159 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYGNSVWTF at 359, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 35, 246, 350, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1062 = TGGGAAGCACTTGGAT-1

using 743 reads

====================================================================================

graph has 282 edges initially, 36 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[254, 486]
surviving nonsolo ucounts = 2[254, 486]
ids = [3, 1]

====================================================================================

UMI info for barcode TGGGAAGCACTTGGAT-1 contig 1 = AGCTTCAGCT...
umi CGCAGGTGTG = 481 reads: -376 +1 -1X +8 -2XX invalidated
umi TCACCTCCTT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-356 ==> 0-310 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=13)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
434-645 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAPWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 718
start codons at 46, 197, 200, 350, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1064 = TGGGAAGCAGAGCCAA-1

using 453 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 7, 443]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1068 = TGGGAAGCAGGTGCCT-1

using 401 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 15, 380]
surviving nonsolo ucounts = 1[380]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1075 = TGGGAAGCATGTCTCC-1

using 338 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[336]
surviving nonsolo ucounts = 1[336]
ids = [2]

====================================================================================

UMI info for barcode TGGGAAGCATGTCTCC-1 contig 1 = AGGAGTCAGA...
umi AGAAACCCGA = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=2)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=33)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYHSYSPTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1077 = TGGGAAGGTACGACCC-1

using 12163 reads

====================================================================================

graph has 4186 edges initially, 44 edges after simplification

total ucounts = 375
nonsolo ucounts = 167[2^52, 3^18, 4^17, 5^9, 6^6, 7^4, 8^4, 9, 10, 11^2, 12, 13^2, 14, 15, 21, 33, 46, 49, 51, 58, 60, 62, 123, 160, 173, 181, 182, 188, 203, 208, 210, 222, 224, 236, 247, 248, 256^3, 269, 270^2, 272, 279, 297, 299, 300, 304^2, 314, 315, 318, 323, 324, 335, 336, 345, 353, 386, 399, 410, 505]
surviving nonsolo ucounts = 45[49, 51, 58, 60, 62, 123, 160, 173, 181, 182, 188, 203, 208, 210, 222, 224, 236, 247, 248, 256^3, 269, 270^2, 272, 279, 297, 299, 300, 304^2, 314, 315, 318, 323, 324, 335, 336, 345, 353, 386, 399, 410, 505]
ids = [274, 292, 199, 289, 70, 164, 211, 188, 326, 160, ...]

====================================================================================

UMI info for barcode TGGGAAGGTACGACCC-1 contig 1 = TGGGGGCTTT...
umi AAATCCCCTA = 252 reads: +460 validated
umi AAGTGTTGTC = 224 reads: +460 validated
umi ACAATAGACA = 239 reads: -407X +1 -2X +2 -1 +1 -3X +3 -2 +1 -3 +2 -1 +3 -1X +2 -1 +2 -1 +21 invalidated
umi AGCGTCACAG = 249 reads: -407 +7 -3XX +15 -1XX +27 invalidated
umi CATATGATGG = 212 reads: -2X +458 invalidated
umi CATGAAGGGA = 281 reads: +460 validated
umi CCCCCAGGCT = 310 reads: +460 validated
umi CGGATACGGT = 182 reads: +460 validated
umi CGTATGCCTT = 115 reads: -433X +27 invalidated
umi CTCGGATGTG = 270 reads: +460 validated
umi GCAAACTCAG = 160 reads: +460 validated
umi GCATAATTCC = 268 reads: +460 validated
umi GCCCGGTTAT = 214 reads: +460 validated
umi GCTACTGGCC = 303 reads: +460 validated
umi GGCAGATCCT = 283 reads: +460 validated
umi GGTGTGGAAC = 272 reads: +460 validated
umi GTCGACAGGC = 237 reads: +460 validated
umi GTTGCCAGCT = 259 reads: -2XX +458 invalidated
umi TAGATCAAGC = 299 reads: +460 validated
umi TAGTCATGCT = 48 reads: +389 -1 +1 -23 +23 -1 +22 non-validated
umi TCTTCAGGCC = 206 reads: -447 +13 non-validated
umi TTCAACTGAT = 185 reads: +460 validated
umi TTCGAACCTA = 128 reads: -428X +1 -8XX +1 -11XX +2 -1XX +1 -6XX +1 invalidated

UMI info for barcode TGGGAAGGTACGACCC-1 contig 2 = GGGAGAGCCC...
umi AAGTACGGTT = 509 reads: +382 validated
umi ACAGAATACG = 336 reads: +382 validated
umi ACAGTGCCTT = 300 reads: +382 validated
umi ACTTCCCTTT = 67 reads: +347 -17 +7 -1 +10 non-validated
umi AGGCTATCCA = 356 reads: +382 validated
umi ATGAAGGTCA = 270 reads: +382 validated
umi ATTTCACCCA = 337 reads: +382 validated
umi CACGTGGATG = 272 reads: +382 validated
umi CAGGAATCGC = 325 reads: +382 validated
umi CGATTCGGGC = 300 reads: +382 validated
umi CGTTCCCGCA = 403 reads: +382 validated
umi CTCGCTTTTC = 224 reads: +382 validated
umi CTTGATCGCC = 170 reads: +382 validated
umi GATACGAGCA = 235 reads: +382 validated
umi GTCTCTCTCT = 296 reads: +382 validated
umi TAATGCCCCA = 384 reads: +382 validated
umi TATATCGACT = 51 reads: -8 +374 non-validated

GOOD CONTIGS

TIG 1[bases=581]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
399-415 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=2)
426-479 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
479-581 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 17 umis using 351 reads
cdr3 = CARHPVHGDYLPPIYYGMDVW at 385, score = 9 + 7
umis assigned: [8, 29, 40, 80, 125, 127, 138, 160, 164, 177] and 13 others
of which 23 are surviving nonsolos
reads assigned: 5115
start codons at 19, 28, 40, 84, 436, 497, 558
confident = true

TIG 2[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 767 reads
cdr3 = CQQRSNWPITF at 368, score = 9 + 8
umis assigned: [28, 44, 47, 70, 86, 103, 109, 118, 123, 153] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4762
start codons at 47, 252, 255, 471
confident = true
now this is a cell
paired!

TATTACTGTGCGAGACATCCTGTCCACGGTGACTACCTCCCCCCCATCTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1081 = TGGGAAGGTAGGAGTC-1

using 267 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [1]

====================================================================================

UMI info for barcode TGGGAAGGTAGGAGTC-1 contig 1 = AGCTGTGGGC...
umi TATCTATTTC = 244 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=560]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
416-560 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CNSRDSSGWVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1083 = TGGGAAGGTATATCCG-1

using 458 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 218, 231]
surviving nonsolo ucounts = 2[218, 231]
ids = [5, 3]

====================================================================================

UMI info for barcode TGGGAAGGTATATCCG-1 contig 1 = GCTCTGAGAG...
umi GCGGGGTTTT = 213 reads: +424 validated

UMI info for barcode TGGGAAGGTATATCCG-1 contig 2 = GATCAGGACT...
umi CTGCGCCGAT = 231 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=555]
0-78 ==> 1-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
78-431 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
455-502 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
502-555 ==> 0-53 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDRAATARLGGMDVW at 420, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 78, 229, 234, 381, 459
confident = false

TIG 2[bases=563]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1085 = TGGGAAGGTATTACCG-1

using 121 reads

====================================================================================

graph has 120 edges initially, 6 edges after simplification

total ucounts = 22
nonsolo ucounts = 18[2^6, 4^4, 5^3, 6, 10^2, 16, 32]
surviving nonsolo ucounts = 1[32]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1088 = TGGGAAGGTCACTTCC-1

using 260 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 254]
surviving nonsolo ucounts = 1[254]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=527]
3-71 ==> 5672-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
5-77 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
5-77 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
5-77 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
20-373 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
352-391 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=17)
391-527 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 20, 26, 82, 95, 158, 231, 433
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1094 = TGGGAAGGTGAGTATA-1

using 71 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 12[2^3, 3, 4, 5, 6, 7^2, 8, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1095 = TGGGAAGGTGCCTTGG-1

using 400 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[400]
surviving nonsolo ucounts = 1[400]
ids = [0]

====================================================================================

UMI info for barcode TGGGAAGGTGCCTTGG-1 contig 1 = GAGGAACTGC...
umi ACGGGACACG = 345 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=476]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-476 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 75 reads
cdr3 = CQQRSSWPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1100 = TGGGAAGGTGTGTGCC-1

using 332 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[329]
surviving nonsolo ucounts = 1[329]
ids = [0]

====================================================================================

UMI info for barcode TGGGAAGGTGTGTGCC-1 contig 1 = AGAGCTCTGG...
umi AACCTAGGGC = 331 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNNWPPYTF at 365, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1102 = TGGGAAGGTGTTTGTG-1

using 8760 reads

====================================================================================

graph has 3623 edges initially, 56 edges after simplification

total ucounts = 486
nonsolo ucounts = 206[2^60, 3^38, 4^26, 5^17, 6^16, 7^8, 8^5, 9, 10, 11^3, 14, 20, 29, 42, 58, 70, 112, 115, 133, 147, 191, 240^2, 260, 265, 287, 288, 294, 296, 309, 312, 325, 333, 351, 364, 370, 375, 383, 408, 439, 743]
surviving nonsolo ucounts = 24[42, 70, 112, 191, 240^2, 260, 265, 287, 288, 294, 296, 309, 312, 325, 333, 351, 364, 370, 375, 383, 408, 439, 743]
ids = [269, 434, 397, 355, 262, 384, 31, 230, 197, 370, ...]

====================================================================================

UMI info for barcode TGGGAAGGTGTTTGTG-1 contig 1 = ACTTTCTGAG...
umi CAACCTTTTG = 259 reads: +412 validated
umi CCCCCGCCTT = 332 reads: +412 validated
umi CTCAATCATA = 271 reads: +412 validated
umi GATTAATGCA = 30 reads: -5 +56 -1 +4 -1 +8 -1 +286 -1 +6 -1 +6 -1 +32 -3 non-validated
umi TAAATTCTAT = 193 reads: +412 validated
umi TCATCTGCGG = 374 reads: +412 validated
umi TCCGTATTCC = 379 reads: +412 validated
umi TGGACATCGC = 69 reads: +412 validated

UMI info for barcode TGGGAAGGTGTTTGTG-1 contig 2 = AGAGCTCTGG...
umi ACAAATCGTC = 264 reads: +382 validated
umi CCCACACCGC = 386 reads: +382 validated
umi CCGCATTCTA = 297 reads: +382 validated
umi CCTTTATGTG = 285 reads: +382 validated
umi CTCGTGGCGC = 411 reads: +382 validated
umi CTGTGTGTCC = 416 reads: -342X +1 -1X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi GACTCCTAGA = 242 reads: +382 validated
umi TAAATGTCGT = 362 reads: +299 -1XX +82 invalidated
umi TAGCGCCGTT = 287 reads: +382 validated
umi TCCCTATATT = 114 reads: +382 validated
umi TCTCATCTAA = 363 reads: +382 validated
umi TGTGGCCTCG = 640 reads: -342X +1 -1XX +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi TTGTGTCAGC = 314 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=518]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=1)
387-410 ==> 8-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=3)
399-447 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
447-518 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 190 reads
cdr3 = CARANFWSGYFDYW at 374, score = 9 + 7
umis assigned: [125, 163, 230, 269, 355, 389, 400, 434]
of which 8 are surviving nonsolos
reads assigned: 1874
start codons at 35, 79
confident = true

TIG 2[bases=562]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 452 reads
cdr3 = CQQYGSSYTF at 368, score = 9 + 8
umis assigned: [31, 156, 177, 197, 235, 242, 262, 353, 370, 397] and 3 others
of which 13 are surviving nonsolos
reads assigned: 4299
start codons at 44, 252, 378, 468
confident = true

REJECT CONTIGS

TIG 1[bases=769]
520-558 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
558-769 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [12, 335, 384]
of which 3 are surviving nonsolos
reads assigned: 807
start codons at 20, 56, 122, 190, 233, 329, 339, 356, 522, 690
confident = false
did not find CDR3
note long unannotated region
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGCCAATTTTTGGAGTGGTTATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1107 = TGGGAAGGTTGAGGTG-1

using 333 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [0]

====================================================================================

UMI info for barcode TGGGAAGGTTGAGGTG-1 contig 1 = GGCTGGGGTC...
umi ATCTTACTCT = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-544 ==> 0-114 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1108 = TGGGAAGTCAAACAAG-1

using 258 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 251]
surviving nonsolo ucounts = 1[251]
ids = [2]

====================================================================================

UMI info for barcode TGGGAAGTCAAACAAG-1 contig 1 = CAGGAAGCAG...
umi AGTCCACTAT = 240 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=550]
0-29 ==> 23-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
29-369 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
370-408 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
408-550 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQAWDSSTGVVF at 344, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 29, 34, 90, 177, 323, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1117 = TGGGAAGTCATCGATG-1

using 342 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 332]
surviving nonsolo ucounts = 1[332]
ids = [0]

====================================================================================

UMI info for barcode TGGGAAGTCATCGATG-1 contig 1 = AGTGCTTTCT...
umi AAAGTTGGAG = 312 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-537 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1125 = TGGGAAGTCGAGCCCA-1

using 287 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode TGGGAAGTCGAGCCCA-1 contig 1 = GGGAATCAGT...
umi CTAATCTTGC = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1126 = TGGGAAGTCGCAGGCT-1

using 590 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 585]
surviving nonsolo ucounts = 1[585]
ids = [3]

====================================================================================

UMI info for barcode TGGGAAGTCGCAGGCT-1 contig 1 = GGGGAGGAGT...
umi GCCTCCTACC = 528 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-511 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 103 reads
cdr3 = CQQSYSTPYTF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 522
start codons at 31, 37, 93, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1127 = TGGGAAGTCGGTTAAC-1

using 476 reads

====================================================================================

graph has 200 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 17[2^5, 3, 4^3, 5^3, 6, 8, 9^2, 397]
surviving nonsolo ucounts = 1[397]
ids = [11]

====================================================================================

UMI info for barcode TGGGAAGTCGGTTAAC-1 contig 1 = AGTTAGGACC...
umi CTTAAACCTT = 399 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 76-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
21-366 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
370-409 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CQQYNNWPSMYTF at 342, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 21, 90, 226, 369, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1130 = TGGGAAGTCTAACCGA-1

using 686 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[325, 356]
surviving nonsolo ucounts = 2[325, 356]
ids = [4, 1]

====================================================================================

UMI info for barcode TGGGAAGTCTAACCGA-1 contig 1 = GGGGAGGAAT...
umi CATCTATGCA = 359 reads: +388 validated
umi GCGGCCGCCG = 329 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 672
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1133 = TGGGAAGTCTGTGCAA-1

using 360 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 355]
surviving nonsolo ucounts = 1[355]
ids = [1]

====================================================================================

UMI info for barcode TGGGAAGTCTGTGCAA-1 contig 1 = GGGGATCAGT...
umi CTTTATCGTG = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQHNSYPRTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 27, 33, 102, 184, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1138 = TGGGCGTAGAAACGAG-1

using 457 reads

====================================================================================

graph has 419 edges initially, 6 edges after simplification

total ucounts = 180
nonsolo ucounts = 40[2^20, 3^10, 4^4, 6^4, 7, 200]
surviving nonsolo ucounts = 1[200]
ids = [93]

====================================================================================

UMI info for barcode TGGGCGTAGAAACGAG-1 contig 1 = GAGTCAGTCC...
umi CGTCAACAGA = 201 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYDNLPTF at 352, score = 9 + 8
umis assigned: [93]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 25, 31, 87, 100, 239, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1141 = TGGGCGTAGACACTAA-1

using 1137 reads

====================================================================================

graph has 416 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 3, 4, 319, 805]
surviving nonsolo ucounts = 2[319, 805]
ids = [3, 1]

====================================================================================

UMI info for barcode TGGGCGTAGACACTAA-1 contig 1 = AGGAGTCAGA...
umi CACAGAAGGA = 315 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 27, 33, 89, 102, 238, 457
confident = false

REJECT CONTIGS

TIG 1[bases=391]
3-142 ==> 208-347 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=1)
142-180 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
180-391 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CCSYAGSYYVF at 119, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 789
start codons at 3, 6, 102, 129, 144, 312
confident = false
not full
VJ delta = 24
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1142 = TGGGCGTAGACAGGCT-1

using 447 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 441]
surviving nonsolo ucounts = 1[441]
ids = [5]

====================================================================================

UMI info for barcode TGGGCGTAGACAGGCT-1 contig 1 = GGAAGTCGCC...
umi TTTCTCCCCG = 444 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=528]
0-54 ==> 13-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
54-407 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=20)
421-457 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CGRGAPSDNW at 396, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 438
start codons at 54, 205, 210, 248, 271, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1153 = TGGGCGTAGCCCAACC-1

using 324 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode TGGGCGTAGCCCAACC-1 contig 1 = TGGGGGCTTT...
umi CCAGTATCCT = 318 reads: +466 validated

GOOD CONTIGS

TIG 1[bases=556]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
422-485 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARRRSGIAAAGNQPQYYYYGMDVW at 379, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 19, 40, 84, 170, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1156 = TGGGCGTAGCTGCGAA-1

using 274 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 270]
surviving nonsolo ucounts = 1[270]
ids = [1]

====================================================================================

UMI info for barcode TGGGCGTAGCTGCGAA-1 contig 1 = AGGAGTCAGA...
umi ATTAACTGCC = 240 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=471]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-471 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYSGYTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 27, 33, 89, 102, 238, 241, 334, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1157 = TGGGCGTAGCTTTGGT-1

using 2354 reads

====================================================================================

graph has 2141 edges initially, 34 edges after simplification

total ucounts = 835
nonsolo ucounts = 330[2^152, 3^77, 4^36, 5^29, 6^9, 7^8, 8^5, 9^6, 10^2, 11, 12, 13, 16, 265, 484]
surviving nonsolo ucounts = 2[265, 484]
ids = [487, 322]

====================================================================================

UMI info for barcode TGGGCGTAGCTTTGGT-1 contig 1 = GGAGTCAGAC...
umi CGAACGCAGC = 444 reads: +180 -1XX +201 invalidated
umi GCTTTAGGGT = 230 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=502]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-502 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 136 reads
cdr3 = CQQYNSYGF at 353, score = 8 + 7
umis assigned: [322, 487]
of which 2 are surviving nonsolos
reads assigned: 645
start codons at 26, 32, 88, 101, 333, 372, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1158 = TGGGCGTAGGACAGCT-1

using 306 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3, 5^3, 9, 265]
surviving nonsolo ucounts = 1[265]
ids = [10]

====================================================================================

UMI info for barcode TGGGCGTAGGACAGCT-1 contig 1 = GGGGGCTGGG...
umi TAAAAACGGA = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
45-406 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
433-513 ==> 0-80 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CSSYTSSSTLVF at 369, score = 8 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 45, 202, 246, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1164 = TGGGCGTAGGCCCTCA-1

using 348 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[343]
surviving nonsolo ucounts = 1[343]
ids = [1]

====================================================================================

UMI info for barcode TGGGCGTAGGCCCTCA-1 contig 1 = GGAGAAGAGC...
umi ATCTCTTCTC = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
424-485 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYGSSPLFTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1179 = TGGGCGTAGTCCCACG-1

using 255 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 252]
surviving nonsolo ucounts = 1[252]
ids = [0]

====================================================================================

UMI info for barcode TGGGCGTAGTCCCACG-1 contig 1 = GGAGTGCTTT...
umi CAACTTTCAT = 235 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=555]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
455-555 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARAHGDYYTLLDFW at 379, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 19, 40, 84, 170, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1188 = TGGGCGTCAAATCCGT-1

using 54 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 48]
surviving nonsolo ucounts = 1[48]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=445]
0-335 ==> 21-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
335-373 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
373-445 ==> 0-72 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSALCVF at 303, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 39
start codons at 133, 136, 187, 286, 313
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1199 = TGGGCGTCACCAGGTC-1

using 560 reads

====================================================================================

graph has 813 edges initially, 14 edges after simplification

total ucounts = 293
nonsolo ucounts = 115[2^61, 3^19, 4^11, 5^13, 6^2, 7^2, 8^3, 9, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1211 = TGGGCGTCAGTACACT-1

using 16 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1219 = TGGGCGTCATTCTTAC-1

using 535 reads

====================================================================================

graph has 686 edges initially, 14 edges after simplification

total ucounts = 290
nonsolo ucounts = 106[2^60, 3^17, 4^14, 5^9, 6, 7, 8^2, 9, 41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1225 = TGGGCGTGTACTTAGC-1

using 432 reads

====================================================================================

graph has 554 edges initially, 6 edges after simplification

total ucounts = 234
nonsolo ucounts = 82[2^36, 3^17, 4^12, 5^6, 6^7, 7, 8^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1229 = TGGGCGTGTCTTGCGG-1

using 235 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 229]
surviving nonsolo ucounts = 1[229]
ids = [5]

====================================================================================

UMI info for barcode TGGGCGTGTCTTGCGG-1 contig 1 = GGGAATCAGT...
umi GTTAGGGAGC = 199 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1235 = TGGGCGTGTGGTCCGT-1

using 3043 reads

====================================================================================

graph has 1550 edges initially, 28 edges after simplification

total ucounts = 224
nonsolo ucounts = 92[2^35, 3^18, 4^10, 5^5, 6^6, 9^3, 10, 11, 119, 123, 145, 150, 173, 188, 190, 198, 208, 249, 282, 288, 325]
surviving nonsolo ucounts = 12[119, 145, 150, 173, 188, 190, 198, 208, 249, 282, 288, 325]
ids = [23, 146, 36, 131, 115, 156, 110, 152, 222, 212, ...]

====================================================================================

UMI info for barcode TGGGCGTGTGGTCCGT-1 contig 1 = GAGCTACAAC...
umi ACGTTTGCCG = 116 reads: +374 -1 +22 non-validated
umi AGCTTTCGCT = 155 reads: +397 validated
umi CAGCCGGTTA = 289 reads: +397 validated
umi CTGCTGTGGA = 197 reads: +397 validated
umi CTTGCTCTTC = 191 reads: +397 validated
umi GGTGTCTCAC = 147 reads: +397 validated
umi GTCCGTTCAC = 207 reads: +397 validated
umi GTGGTGTCCC = 191 reads: +397 validated
umi TACAATTGGC = 323 reads: +397 validated
umi TTTGGCCCTC = 243 reads: -362X +3 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated

UMI info for barcode TGGGCGTGTGGTCCGT-1 contig 2 = AGTGATCAGG...
umi GCGTATTGGC = 167 reads: +415 validated
umi TTCTACGCAT = 282 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
395-427 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 244 reads
cdr3 = CQQYYSTQTF at 369, score = 9 + 8
umis assigned: [23, 36, 69, 110, 115, 146, 152, 156, 161, 222]
of which 10 are surviving nonsolos
reads assigned: 2033
start codons at 30, 99, 352, 469
confident = true

TIG 2[bases=548]
0-31 ==> 49-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
31-390 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
407-446 ==> 7-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
446-548 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CTTDVYGVCYYW at 379, score = 8 + 7
umis assigned: [131, 212]
of which 2 are surviving nonsolos
reads assigned: 441
start codons at 31, 187, 254, 311, 340, 389, 464, 525
confident = true
now this is a cell
paired!

AGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGATGTTTACGGTGTTTGCTACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCAGACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1236 = TGGGCGTGTGGTTTCA-1

using 195 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1238 = TGGGCGTGTGTGTGCC-1

using 32 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[32]
surviving nonsolo ucounts = 1[32]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1254 = TGGGCGTTCACCACCT-1

using 236 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^2, 3^2, 5, 210]
surviving nonsolo ucounts = 1[210]
ids = [7]

====================================================================================

UMI info for barcode TGGGCGTTCACCACCT-1 contig 1 = GGGGTCTCAG...
umi ACTGGACAAT = 2 reads: -349 +7 -1 +5 -1 +2 -1 +5 -2X +6 -1 +8 invalidated
umi CCTGGTCAAT = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=566]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=14)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-566 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [4, 7]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1262 = TGGGCGTTCCCTCAGT-1

using 227 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode TGGGCGTTCCCTCAGT-1 contig 1 = ATCAGTCCCA...
umi AAATTTGTTC = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1268 = TGGGCGTTCGAGCCCA-1

using 867 reads

====================================================================================

graph has 320 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[288, 576]
surviving nonsolo ucounts = 2[288, 576]
ids = [3, 1]

====================================================================================

UMI info for barcode TGGGCGTTCGAGCCCA-1 contig 1 = GGGAGGAATC...
umi CAAACAGCCG = 577 reads: +388 validated
umi GGAAACTTAT = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 144 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 851
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1273 = TGGGCGTTCTCGCATC-1

using 179 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[178]
surviving nonsolo ucounts = 1[178]
ids = [1]

====================================================================================

UMI info for barcode TGGGCGTTCTCGCATC-1 contig 1 = GCTCTGCTTC...
umi TTTTGACCTA = 169 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-560 ==> 0-115 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1277 = TGGGCGTTCTTACCGC-1

using 176 reads

====================================================================================

graph has 95 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^2, 3^2, 4, 154]
surviving nonsolo ucounts = 1[154]
ids = [9]

====================================================================================

UMI info for barcode TGGGCGTTCTTACCGC-1 contig 1 = AGACTCAGTC...
umi CTTAAACGGG = 134 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNTYLFTF at 347, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 20, 26, 82, 95, 231, 234, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1284 = TGGTTAGAGACGCAAC-1

using 13470 reads

====================================================================================

graph has 5022 edges initially, 104 edges after simplification

total ucounts = 508
nonsolo ucounts = 225[2^66, 3^35, 4^24, 5^17, 6^15, 7^4, 8^3, 9^3, 10, 11^4, 12^2, 13^2, 14^3, 62, 113, 118, 137, 154, 165, 192^2, 195, 197, 200, 205, 209, 212, 223, 227, 233, 246, 248, 254, 259, 263, 267, 273, 280, 286, 290, 294, 295, 299, 308, 309, 311, 314, 315, 316, 318, 320, 324, 356, 362^2, 363, 365, 368, 855]
surviving nonsolo ucounts = 45[113, 118, 137, 154, 165, 192^2, 195, 197, 200, 205, 209, 212, 223, 227, 233, 246, 248, 254, 259, 263, 267, 273, 280, 286, 290, 294, 295, 299, 308, 309, 311, 314, 315, 316, 318, 320, 324, 356, 362^2, 363, 365, 368, 855]
ids = [495, 263, 404, 371, 433, 131, 292, 266, 329, 135, ...]

====================================================================================

UMI info for barcode TGGTTAGAGACGCAAC-1 contig 1 = AGAAGTCTCT...
umi AAGTAACGCC = 299 reads: +388 validated
umi ACATCATGGT = 214 reads: +388 validated
umi ACCGGTTTAG = 315 reads: +388 validated
umi AGAATAGTGT = 268 reads: +388 validated
umi ATGCGACCCC = 277 reads: +388 validated
umi CATATATGCA = 321 reads: +388 validated
umi CGCTGTATCT = 233 reads: +388 validated
umi CGGCCCTACG = 362 reads: +388 validated
umi CGTGCGCTTT = 317 reads: +388 validated
umi CGTGTCACGC = 364 reads: +388 validated
umi CTCGCAACAC = 202 reads: +388 validated
umi CTGATCATTA = 313 reads: +388 validated
umi GACACCCCGC = 190 reads: +388 validated
umi GGCCAGTCTC = 200 reads: +388 validated
umi TACACTTGTC = 319 reads: +388 validated
umi TGGCCAACCT = 302 reads: +388 validated

UMI info for barcode TGGTTAGAGACGCAAC-1 contig 2 = AGCTCTGGGA...
umi AGGTCGGATC = 216 reads: +427 validated
umi AGTATAACTA = 212 reads: +427 validated
umi ATAACCATTG = 220 reads: +427 validated
umi ATACATAATC = 187 reads: +378 -1XX +38 -10 invalidated
umi CTCCGCACGG = 101 reads: +427 validated
umi GCTCGAAGGA = 191 reads: +427 validated
umi GTTACCACCT = 260 reads: +427 validated
umi TAAACGTCCG = 143 reads: +427 validated
umi TAAGTTTAAG = 211 reads: +427 validated
umi TTGTATGCCA = 93 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 670 reads
cdr3 = CQKYNSAPWTF at 354, score = 9 + 8
umis assigned: [27, 51, 61, 91, 150, 198, 233, 237, 246, 248] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4431
start codons at 27, 33, 89, 102, 238, 337, 457
confident = true

TIG 2[bases=559]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=9)
444-507 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
507-559 ==> 0-52 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 146 reads
cdr3 = CARTPDKGGYYYYGMDVW at 422, score = 9 + 7
umis assigned: [112, 117, 123, 129, 263, 320, 360, 371, 383, 495]
of which 10 are surviving nonsolos
reads assigned: 1802
start codons at 80, 236, 383, 464, 525
confident = true

REJECT CONTIGS

TIG 1[bases=564]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
390-428 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [11, 72, 135, 149, 183, 232, 245, 280, 372, 382] and 4 others
of which 14 are surviving nonsolos
reads assigned: 4163
start codons at 30, 99, 352, 470
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAACCCCCGACAAAGGGGGATACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1289 = TGGTTAGAGATCCTGT-1

using 112 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 108]
surviving nonsolo ucounts = 1[108]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1294 = TGGTTAGAGCCACTAT-1

using 1686 reads

====================================================================================

graph has 2292 edges initially, 28 edges after simplification

total ucounts = 735
nonsolo ucounts = 330[2^133, 3^73, 4^46, 5^17, 6^21, 7^11, 8^6, 9^6, 10^2, 11^3, 12^3, 13^3, 14, 15^2, 16^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1297 = TGGTTAGAGGATATAC-1

using 1948 reads

====================================================================================

graph has 380 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 1944]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1308 = TGGTTAGAGGTTCCTA-1

using 558 reads

====================================================================================

graph has 226 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 9, 269, 271]
surviving nonsolo ucounts = 2[269, 271]
ids = [2, 5]

====================================================================================

UMI info for barcode TGGTTAGAGGTTCCTA-1 contig 1 = GAATCAGTCC...
umi AGCTATCCGT = 268 reads: +388 validated

UMI info for barcode TGGTTAGAGGTTCCTA-1 contig 2 = GGGACAGCTC...
umi CATTACCCCG = 265 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=612]
16-369 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
418-452 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
452-612 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 358, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 16, 214, 219, 236, 280, 313, 506
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1312 = TGGTTAGAGTCTCCTC-1

using 295 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 286]
surviving nonsolo ucounts = 1[286]
ids = [3]

====================================================================================

UMI info for barcode TGGTTAGAGTCTCCTC-1 contig 1 = GAGTGCTTTC...
umi GTCTCAGGTT = 257 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=515]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
469-515 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 378, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 18, 39, 83, 169, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1317 = TGGTTAGAGTGTGAAT-1

using 684 reads

====================================================================================

graph has 262 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3, 4, 193, 211, 266]
surviving nonsolo ucounts = 3[193, 211, 266]
ids = [8, 11, 3]

====================================================================================

UMI info for barcode TGGTTAGAGTGTGAAT-1 contig 1 = ATCACATAAC...
umi ATTTCTTGCT = 260 reads: +421 validated
umi GGAAAATTCC = 190 reads: +421 validated
umi TGGTGACGCT = 203 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=566]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=10)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-566 ==> 0-87 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 77 reads
cdr3 = CARSELVIAIQRFDYW at 400, score = 8 + 6
umis assigned: [3, 8, 11]
of which 3 are surviving nonsolos
reads assigned: 641
start codons at 58, 209, 256, 355
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1324 = TGGTTAGCACATCTTT-1

using 31 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1326 = TGGTTAGCACCACCAG-1

using 288 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode TGGTTAGCACCACCAG-1 contig 1 = TGAGCGCAGA...
umi CTTTCAGTCT = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1334 = TGGTTAGCACGTGAGA-1

using 265 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [0]

====================================================================================

UMI info for barcode TGGTTAGCACGTGAGA-1 contig 1 = GCTCTGCTTC...
umi CCTTATGGGT = 258 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=590]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-590 ==> 0-148 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1335 = TGGTTAGCACTCGACG-1

using 281 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[10, 265]
surviving nonsolo ucounts = 1[265]
ids = [5]

====================================================================================

UMI info for barcode TGGTTAGCACTCGACG-1 contig 1 = GAAGAGCTGC...
umi CTCATGCGCC = 239 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=488]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-488 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGYSPRTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1336 = TGGTTAGCAGAAGCAC-1

using 244 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode TGGTTAGCAGAAGCAC-1 contig 1 = AGCTCTGGGA...
umi ACCTGCCTGA = 196 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=527]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=15)
466-516 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=6)
junction support: 1 umis using 10 reads
cdr3 = CTTGYWSTVTTRLWAFDIW at 428, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 80, 140, 236, 303, 332, 360, 389, 497
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1341 = TGGTTAGCAGGAACGT-1

using 64 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 60]
surviving nonsolo ucounts = 1[60]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1342 = TGGTTAGCAGGCAGTA-1

using 311 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[4, 5^2, 6, 289]
surviving nonsolo ucounts = 1[289]
ids = [5]

====================================================================================

UMI info for barcode TGGTTAGCAGGCAGTA-1 contig 1 = TGGGAGGAAT...
umi TCTTCAGTAC = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1343 = TGGTTAGCAGGGTATG-1

using 113 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 6, 99]
surviving nonsolo ucounts = 1[99]
ids = [1]

====================================================================================

UMI info for barcode TGGTTAGCAGGGTATG-1 contig 1 = AAAAACCACA...
umi CAGTTGGGCA = 96 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=518]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-518 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 95
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1344 = TGGTTAGCAGTAAGAT-1

using 2295 reads

====================================================================================

graph has 2641 edges initially, 28 edges after simplification

total ucounts = 737
nonsolo ucounts = 350[2^145, 3^88, 4^48, 5^24, 6^15, 7^7, 8^6, 9^7, 10^4, 12^2, 13^2, 15, 687]
surviving nonsolo ucounts = 1[687]
ids = [263]

====================================================================================

UMI info for barcode TGGTTAGCAGTAAGAT-1 contig 1 = CGAGCCCAGC...
umi CGCTTGGGTT = 579 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=497]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [263]
of which 1 are surviving nonsolos
reads assigned: 572
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1345 = TGGTTAGCAGTCAGAG-1

using 412 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^4, 3, 15, 96, 285]
surviving nonsolo ucounts = 4[3, 15, 96, 285]
ids = [6, 5, 3, 0]

====================================================================================

UMI info for barcode TGGTTAGCAGTCAGAG-1 contig 1 = GTCAGTCTCA...
umi ATATTCGTTT = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQSYSTPRTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 23, 29, 85, 98, 234, 453
confident = true

REJECT CONTIGS

TIG 1[bases=462]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-157 ==> 0-106 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
157-406 ==> 107-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11) [SHIFT!]
406-444 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
cdr3 = CQSYDSSLSGLYVF at 374, score = 7 + 8
umis assigned: [3, 5, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 110
start codons at 51, 204, 207, 258, 357, 384, 408
confident = false
not full
frameshifted full length stopped transcript of length 462
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1350 = TGGTTAGCATACGCTA-1

using 295 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[2^2, 281]
surviving nonsolo ucounts = 1[281]
ids = [9]

====================================================================================

UMI info for barcode TGGTTAGCATACGCTA-1 contig 1 = GGCTGGGGTC...
umi CTCTGCCGCT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=596]
42-394 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
430-596 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CSSYTSSSTRVF at 366, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1354 = TGGTTAGCATGCCCGA-1

using 55 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1381 = TGGTTAGTCCACGAAT-1

using 331 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 326]
surviving nonsolo ucounts = 1[326]
ids = [0]

====================================================================================

UMI info for barcode TGGTTAGTCCACGAAT-1 contig 1 = GAGAAGAGCT...
umi AATTTTTCTG = 281 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=506]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
420-506 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPHTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 35, 104, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1385 = TGGTTAGTCCATTCTA-1

using 180 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [3]

====================================================================================

UMI info for barcode TGGTTAGTCCATTCTA-1 contig 1 = ACTTTCTGAG...
umi CTTATAGGGT = 167 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=476]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-476 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 35, 79, 159, 229, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1391 = TGGTTAGTCCTTTCTC-1

using 270 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [1]

====================================================================================

UMI info for barcode TGGTTAGTCCTTTCTC-1 contig 1 = AGCTCTCAGA...
umi ACATACGTAC = 258 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=556]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=25)
430-447 ==> 0-17 on |7|IGHD1-1|D-REGION| [len=17] (mis=1)
452-503 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
503-556 ==> 0-53 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVRGTAGTTKYNWFESW at 421, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 79, 235, 273, 356, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1394 = TGGTTAGTCGGAGCAA-1

using 41 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 5, 9, 18]
surviving nonsolo ucounts = 1[18]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1396 = TGGTTAGTCGGTTAAC-1

using 197 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 188]
surviving nonsolo ucounts = 1[188]
ids = [0]

====================================================================================

UMI info for barcode TGGTTAGTCGGTTAAC-1 contig 1 = AGTGCTTTCT...
umi AGCCCTGCTT = 180 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=482]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-482 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1406 = TGGTTAGTCTGTCCGT-1

using 91 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^2, 3, 4^2, 5, 6, 8, 11, 18, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1414 = TGGTTCCAGAATTGTG-1

using 638 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 254, 379]
surviving nonsolo ucounts = 2[254, 379]
ids = [2, 1]

====================================================================================

UMI info for barcode TGGTTCCAGAATTGTG-1 contig 1 = AGCTCTGAGA...
umi TATCATGGAG = 249 reads: +424 validated

UMI info for barcode TGGTTCCAGAATTGTG-1 contig 2 = GAGCTGCTCA...
umi AGAAATCCTG = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-593 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=502]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
418-502 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPLITF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 30, 238, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1416 = TGGTTCCAGACCACGA-1

using 171 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[167]
surviving nonsolo ucounts = 1[167]
ids = [3]

====================================================================================

UMI info for barcode TGGTTCCAGACCACGA-1 contig 1 = ATCCAACAAC...
umi GGAGCGGAAG = 170 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=559]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
437-488 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDFGDTMVQGVDNWFDPW at 397, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 55, 211, 253, 319, 352, 421
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1417 = TGGTTCCAGAGACTTA-1

using 5877 reads

====================================================================================

graph has 6301 edges initially, 102 edges after simplification

total ucounts = 1169
nonsolo ucounts = 866[2^151, 3^122, 4^95, 5^82, 6^66, 7^82, 8^52, 9^43, 10^29, 11^25, 12^33, 13^21, 14^12, 15^16, 16^7, 17^5, 18^8, 19^3, 20^5, 21^3, 22^4, 26^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1421 = TGGTTCCAGATCACGG-1

using 86 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 78]
surviving nonsolo ucounts = 1[78]
ids = [2]

====================================================================================

UMI info for barcode TGGTTCCAGATCACGG-1 contig 1 = GTGGGCACAA...
umi ATTACATTGG = 73 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=439]
0-37 ==> 14-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
37-393 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 15 reads
cdr3 = CQSYDSSLSGLYVF at 361, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 37, 191, 194, 245, 344, 371, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1432 = TGGTTCCAGCTAAACA-1

using 257 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 6, 242]
surviving nonsolo ucounts = 1[242]
ids = [7]

====================================================================================

UMI info for barcode TGGTTCCAGCTAAACA-1 contig 1 = GTGGGCTCAG...
umi TGCCACGGTT = 231 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=509]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-509 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1433 = TGGTTCCAGCTAGCCC-1

using 143 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 132]
surviving nonsolo ucounts = 1[132]
ids = [1]

====================================================================================

UMI info for barcode TGGTTCCAGCTAGCCC-1 contig 1 = GCTCTGCTTC...
umi AGTTATAACA = 124 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=543]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
445-543 ==> 0-98 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSYDSSLSGSWVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1434 = TGGTTCCAGCTATGCT-1

using 371 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 7, 353]
surviving nonsolo ucounts = 1[353]
ids = [8]

====================================================================================

UMI info for barcode TGGTTCCAGCTATGCT-1 contig 1 = GAGCTGCTCA...
umi TAGTTAGTTC = 354 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYGSSPVTF at 354, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 30, 238, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1439 = TGGTTCCAGGACGAAA-1

using 220 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^4, 4^2, 197]
surviving nonsolo ucounts = 1[197]
ids = [5]

====================================================================================

UMI info for barcode TGGTTCCAGGACGAAA-1 contig 1 = GAGGAATCAG...
umi CGTCGGTATC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1446 = TGGTTCCAGGCGACAT-1

using 24 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 20]
surviving nonsolo ucounts = 1[20]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1455 = TGGTTCCAGTGACATA-1

using 706 reads

====================================================================================

graph has 264 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 301, 398]
surviving nonsolo ucounts = 2[301, 398]
ids = [3, 2]

====================================================================================

UMI info for barcode TGGTTCCAGTGACATA-1 contig 1 = AAGAGGCAGC...
umi CTGAGTTACC = 277 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-29 ==> 22-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
29-369 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
420-535 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQSYDKSLRGAVF at 353, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 29, 113, 186, 336, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1456 = TGGTTCCAGTGACTCT-1

using 293 reads

====================================================================================

graph has 111 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 7, 18, 262]
surviving nonsolo ucounts = 1[262]
ids = [5]

====================================================================================

UMI info for barcode TGGTTCCAGTGACTCT-1 contig 1 = AGTCTGGGCC...
umi GCTTCCGCTC = 227 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=503]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-503 ==> 0-81 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1460 = TGGTTCCAGTTTGCGT-1

using 374 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[372]
surviving nonsolo ucounts = 1[372]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=547]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
6-58 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 367
start codons at 33, 238, 241, 453
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1471 = TGGTTCCCACACCGCA-1

using 231 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 3, 5, 6, 7, 204]
surviving nonsolo ucounts = 1[204]
ids = [7]

====================================================================================

UMI info for barcode TGGTTCCCACACCGCA-1 contig 1 = CCACATCCCT...
umi GCATGGGCCG = 180 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=526]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=10)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
469-526 ==> 0-57 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARVASRGYYGPFYFDYW at 384, score = 10 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 42, 193, 198, 240, 245, 262, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1484 = TGGTTCCCACTTGGAT-1

using 4090 reads

====================================================================================

graph has 2922 edges initially, 56 edges after simplification

total ucounts = 623
nonsolo ucounts = 265[2^97, 3^60, 4^37, 5^26, 6^13, 7^6, 8^7, 9^2, 11, 12, 13, 31, 48, 74, 85, 130, 135, 139, 200, 278, 284, 310, 360, 374, 401]
surviving nonsolo ucounts = 9[31, 74, 139, 278, 284, 310, 360, 374, 401]
ids = [417, 353, 184, 535, 583, 454, 423, 169, 47]

====================================================================================

UMI info for barcode TGGTTCCCACTTGGAT-1 contig 1 = GAGTCAGTCT...
umi ACGATCTGGT = 399 reads: +376 validated
umi ATCCGTCCGT = 25 reads: -317X +1 -2XX +1 -1XX +1 -7XX +2 -4XX +1 -2XX +1 -1XX +2 -1XX +22 -1 +6 -3 invalidated
umi CAGTATGTCA = 309 reads: -333 +1 -1XX +1 -3XX +1 -1XX +6 -1XX +4 -2XX +8 -2XX +4 -1XX +7 invalidated
umi CCACACCAGT = 142 reads: +376 validated
umi GCCTGTCGTC = 75 reads: +376 validated
umi GTTAAGCCCT = 366 reads: +376 validated
umi TACCATTGAT = 311 reads: +376 validated
umi TTACGGCTAG = 282 reads: +376 validated

UMI info for barcode TGGTTCCCACTTGGAT-1 contig 2 = AGGTGTTTTC...
umi GTGGAACCAA = 28 reads: +283 -9 +71 -1 +3 -2X +1 -1 +1 -2 +6 -1 +1 -1 +1 -1 +4 -1 +2 -1 +2 -1 +9 -2 +2 -2 +1 -1 +3 -5 invalidated
umi TCTCTGCCTT = 270 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=537]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-357 ==> 0-332 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=12)
362-401 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
401-537 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 315 reads
cdr3 = CQQAYTF at 352, score = 8 + 8
umis assigned: [47, 113, 169, 184, 353, 423, 454, 583]
of which 7 are surviving nonsolos
reads assigned: 1883
start codons at 25, 31, 87, 100, 236, 443
confident = true

TIG 2[bases=546]
0-45 ==> 34-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
45-398 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=16)
396-417 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
416-466 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
466-546 ==> 0-80 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAKEYTSGWYDAFDIW at 387, score = 9 + 8
umis assigned: [417, 535]
of which 2 are surviving nonsolos
reads assigned: 289
start codons at 45, 196, 201, 348, 415, 418, 447, 520
confident = true
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAAGAGTATACCAGTGGCTGGTATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCTCCGTCTCTTCAA <==> TTCACTCTCACCATCAGCAGTCTTCACCCTGAAGATTTTGCAACTTACTACTGTCAGCAGGCCTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1494 = TGGTTCCCAGGCTGAA-1

using 728 reads

====================================================================================

graph has 302 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^2, 141, 217, 357]
surviving nonsolo ucounts = 3[141, 217, 357]
ids = [8, 9, 4]

====================================================================================

UMI info for barcode TGGTTCCCAGGCTGAA-1 contig 1 = AGCTCTGAGA...
umi TTCATCGCCT = 206 reads: +424 validated

UMI info for barcode TGGTTCCCAGGCTGAA-1 contig 2 = GGGGAGGAAC...
umi TAAACATCAG = 357 reads: +382 validated
umi TGGCGCTTTT = 141 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=521]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 79, 230, 235, 382, 460
confident = true

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-342 ==> 0-306 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=25)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 86 reads
cdr3 = CQQYNKWPLTF at 357, score = 9 + 8
umis assigned: [4, 8]
of which 2 are surviving nonsolos
reads assigned: 492
start codons at 36, 241, 460
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGCGGCGACAGCTCGTCTTGGCGGTATGGACGTCTGGGGCCAAGGGACCGCGGTCACCGTCTCCTCAG <==> ATCGACAGCCTGCAGTCTGAAGATCTTGGAGTCTATTATTGTCAACAATATAATAAGTGGCCTCTCACTTTCGGCGGGGGGACCAAGGTGGAGCTCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1499 = TGGTTCCCAGTCAGCC-1

using 14170 reads

====================================================================================

graph has 5589 edges initially, 66 edges after simplification

total ucounts = 1090
nonsolo ucounts = 475[2^185, 3^116, 4^52, 5^26, 6^23, 7^8, 8^5, 9^3, 10, 11^2, 12^4, 14, 15^2, 16, 23, 24, 48, 49, 64, 69^2, 81, 93, 97, 148, 156, 181, 199, 205, 220, 225, 227, 228, 230, 232, 242, 254, 260, 262, 264, 271, 278, 282, 285^2, 291, 308, 316^2, 332, 335, 338, 356, 385, 386, 412, 417, 429, 438, 1488]
surviving nonsolo ucounts = 43[23, 64, 69^2, 81, 93, 97, 148, 156, 181, 199, 205, 220, 225, 227, 228, 230, 232, 242, 254, 260, 262, 264, 271, 278, 282, 285^2, 291, 308, 316^2, 332, 335, 338, 356, 385, 386, 412, 417, 429, 438, 1488]
ids = [763, 585, 922, 968, 902, 474, 266, 663, 1057, 203, ...]

====================================================================================

UMI info for barcode TGGTTCCCAGTCAGCC-1 contig 1 = CTGGGCCTCA...
umi AAGTTTTCGA = 231 reads: +379 validated
umi AAGTTTTTTA = 230 reads: +379 validated
umi AGACTTTAAC = 283 reads: +379 validated
umi ATAAAGTCCA = 180 reads: +379 validated
umi ATACTTGGAC = 252 reads: +379 validated
umi ATTCGGGCCT = 228 reads: +379 validated
umi CACGTAATGG = 226 reads: +379 validated
umi CACTTTATTA = 190 reads: -10X +1 -2X +1 -3XX +1 -1XX +1 -3XX +1 -5XX +1 -1XX +2 -3XX +1 -7XX +335 invalidated
umi CATGGCCCGC = 246 reads: +379 validated
umi CTCACTCATT = 191 reads: +379 validated
umi GATAATAGGT = 266 reads: +379 validated
umi GCTCTGGCAG = 326 reads: +356 -1XX +3 -1 +18 invalidated
umi TAGGATGTAT = 268 reads: +379 validated
umi TGGAGATCTA = 333 reads: +379 validated
umi TTGTCATTGC = 1516 reads: -341X +1 -2XX +3 -1XX +28 -1XX +2 invalidated

UMI info for barcode TGGTTCCCAGTCAGCC-1 contig 2 = GGGGGACTCC...
umi AAAGATGTTG = 427 reads: +436 validated
umi AAGACCAGGT = 283 reads: +436 validated
umi AATACGCTCT = 410 reads: +436 validated
umi AATTCGATTT = 272 reads: +436 validated
umi ACAACTCCTA = 287 reads: +436 validated
umi ACAGTACATA = 358 reads: +436 validated
umi ATACCCTTGT = 331 reads: +436 validated
umi ATTCTTGGTG = 99 reads: +402 -1 +16 -17 non-validated
umi CCTCGTCTTG = 315 reads: +436 validated
umi CGTTGCGTTC = 94 reads: -5 +405 -1 +6 -19 non-validated
umi GACATGGATT = 261 reads: +436 validated
umi GACCTGTGCC = 319 reads: +436 validated
umi GATGGCCTGC = 343 reads: +436 validated
umi GGAGGAACCT = 237 reads: +436 validated
umi GGCTCAGTTG = 125 reads: +427 -1 +1 -7 non-validated
umi GTCCTCATAC = 385 reads: +436 validated
umi TACCAACCCT = 413 reads: +436 validated
umi TATTGCACCC = 200 reads: +436 validated
umi TCTCATCTAG = 67 reads: +436 validated
umi TGACGGCCGG = 71 reads: +436 validated
umi TGTATACTAT = 69 reads: +333 -3 +100 non-validated
umi TGTTTGGTAC = 296 reads: +436 validated
umi TTCCTAGACC = 445 reads: +436 validated
umi TTGTCTAATC = 154 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=627]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-376 ==> 0-339 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=3)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 487 reads
cdr3 = CQAWDSSTSVVF at 352, score = 6 + 8
umis assigned: [54, 55, 159, 203, 217, 265, 301, 309, 341, 491] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4858
start codons at 37, 42, 98, 185, 331, 335
confident = true

TIG 2[bases=528]
21-379 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=8)
406-457 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 21 umis using 535 reads
cdr3 = CVRMTWPGSGSWNDCWFDPW at 366, score = 7 + 7
umis assigned: [11, 34, 58, 77, 84, 91, 212, 266, 406, 474] and 14 others
of which 24 are surviving nonsolos
reads assigned: 6176
start codons at 21, 177, 244, 327, 336, 375
confident = true

REJECT CONTIGS

TIG 1[bases=593]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV1OR2-118 exon 1 [len=6000] (mis=2)
10-74 ==> 5672-5736 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=8)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=8)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=8)
27-358 ==> 0-331 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=2)
457-593 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [754, 986]
of which 2 are surviving nonsolos
reads assigned: 581
start codons at 27, 33, 89, 102, 238, 370, 401, 499
confident = false
did not find CDR3
now this is a cell
paired!

ACATATTACTGTGTACGGATGACCTGGCCCGGCAGTGGCAGCTGGAACGACTGCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTTCTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCGAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1503 = TGGTTCCCAGTTTACG-1

using 12014 reads

====================================================================================

graph has 5160 edges initially, 72 edges after simplification

total ucounts = 745
nonsolo ucounts = 348[2^138, 3^59, 4^40, 5^23, 6^14, 7^13, 8^7, 9^4, 10^4, 12, 13, 14^2, 15, 16, 26, 39^2, 42, 53, 83, 86, 116, 172, 211, 217^2, 236, 237, 239^2, 247, 254, 258, 260, 264, 275, 280, 289, 291, 294, 297, 299, 307, 314, 324, 330, 360, 375, 377, 415, 433, 450, 539, 713]
surviving nonsolo ucounts = 39[26, 39^2, 42, 83, 86, 116, 172, 211, 217^2, 236, 237, 239^2, 247, 254, 258, 260, 264, 275, 280, 289, 291, 294, 297, 299, 307, 314, 324, 330, 360, 375, 377, 415, 433, 450, 539, 713]
ids = [225, 147, 628, 441, 435, 166, 105, 525, 304, 91, ...]

====================================================================================

UMI info for barcode TGGTTCCCAGTTTACG-1 contig 1 = AAGAAGGGCT...
umi AGACGTTCTC = 216 reads: +388 validated
umi AGCGTGTACC = 251 reads: +388 validated
umi AGGAATCTTA = 117 reads: +388 validated
umi AGGCGCCAGT = 258 reads: +388 validated
umi CGATGCTCAC = 718 reads: -139X +1 -1X +247 invalidated
umi CGGCATTCGA = 213 reads: +388 validated
umi CTCCCCTGGC = 544 reads: -141X +247 invalidated
umi GAATGAATAG = 313 reads: +388 validated
umi GAGCACACGC = 244 reads: +365 -1XX +22 invalidated
umi GAGGTATGTA = 276 reads: +388 validated
umi GCACTTGTAC = 158 reads: -136 +17 -1 +38 -5 +12 -1 +62 -6XX +1 -2X +1 -106 invalidated
umi GGTAGTTTCG = 299 reads: +388 validated
umi GTAACCACCG = 384 reads: +388 validated
umi GTTCCGATTC = 72 reads: -352X +1 -1X +1 -4XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi GTTCTATAAT = 61 reads: -359X +2 -4X +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi TCATGGTGTC = 241 reads: +388 validated
umi TTAGACGCGC = 278 reads: +388 validated
umi TTTACCTGTT = 199 reads: -10X +4 -18XX +1 -1XX +3 -6XX +345 invalidated
umi TTTATCGCGG = 44 reads: -388 non-validated
umi TTTTTTTCCA = 217 reads: +388 validated

UMI info for barcode TGGTTCCCAGTTTACG-1 contig 2 = AGCTCTGGGA...
umi AGTCACCCGC = 265 reads: +410 -1 +10 -2 +1 non-validated
umi ATCGGATGAG = 38 reads: +286 -1 +137 non-validated
umi ATGTGTTTTA = 299 reads: +424 validated
umi ATTATGTGAC = 89 reads: +424 validated
umi CATTGTTGCC = 24 reads: -16 +289 -1 +12 -3 +103 non-validated
umi GCCAAGCAGT = 42 reads: +424 validated
umi GTCTAATGCC = 162 reads: +424 validated
umi TCACCTGGGT = 288 reads: +424 validated
umi TCTCCGTTGA = 39 reads: +46 -1 +313 -1 +54 -1 +1 -7 non-validated

GOOD CONTIGS

TIG 1[bases=663]
0-64 ==> 22-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
64-417 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
414-452 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
452-663 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 15 umis using 955 reads
cdr3 = CQSYDSSNQVF at 391, score = 6 + 8
umis assigned: [91, 103, 105, 110, 285, 304, 338, 396, 409, 416] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4934
start codons at 64, 127, 218, 269, 401
confident = true

TIG 2[bases=575]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=2)
436-460 ==> 0-24 on |19|IGHD3-16|D-REGION| [len=37] (mis=4)
458-504 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 90 reads
cdr3 = CTRGYDYVWGSPDYW at 428, score = 8 + 7
umis assigned: [124, 147, 157, 166, 225, 441, 525, 590, 628]
of which 9 are surviving nonsolos
reads assigned: 1221
start codons at 80, 133, 231, 236, 303, 360, 389, 441
confident = true

REJECT CONTIGS

TIG 1[bases=550]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [127, 165, 274, 281, 327, 365, 399, 401, 566, 633]
of which 10 are surviving nonsolos
reads assigned: 3454
start codons at 36, 241, 244, 456
confident = false
did not find CDR3
now this is a cell
paired!

ACCGAGGACACAGCCGTGTATTACTGTACTAGAGGGTATGATTACGTTTGGGGGAGCCCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCAGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1507 = TGGTTCCCATCAGTAC-1

using 187 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 183]
surviving nonsolo ucounts = 1[183]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1508 = TGGTTCCCATCATCCC-1

using 343 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCCATCATCCC-1 contig 1 = GGAGTCAGAC...
umi CTTTTACAGA = 336 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=15)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYKGYSPFTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 26, 32, 88, 101, 237, 240, 333, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1523 = TGGTTCCGTACATGTC-1

using 285 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCGTACATGTC-1 contig 1 = TGAGCGCAGA...
umi AACCTGTCCT = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1526 = TGGTTCCGTAGCGTAG-1

using 182 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 5, 168]
surviving nonsolo ucounts = 1[168]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCGTAGCGTAG-1 contig 1 = AGTCAGACTC...
umi ACCCATTTCG = 148 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-463 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNGQSRAF at 351, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 24, 30, 99, 235, 238, 331, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1532 = TGGTTCCGTCAAAGAT-1

using 319 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [1]

====================================================================================

UMI info for barcode TGGTTCCGTCAAAGAT-1 contig 1 = GACTGATCAG...
umi GCTTCAGGGC = 298 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=509]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
400-437 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-509 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQALQSPRGLTF at 370, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 34, 67, 103, 191, 353, 373, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1544 = TGGTTCCGTGCAACTT-1

using 524 reads

====================================================================================

graph has 222 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^3, 3^2, 4, 213, 286]
surviving nonsolo ucounts = 3[3, 213, 286]
ids = [4, 13, 7]

====================================================================================

UMI info for barcode TGGTTCCGTGCAACTT-1 contig 1 = AGTCTGGGCC...
umi ATAACATCTC = 3 reads: -38 +46 -1 +9 -26 +56 -133 +16 -1 +38 -18 non-validated
umi GTCAAGCGAT = 200 reads: +382 validated

UMI info for barcode TGGTTCCGTGCAACTT-1 contig 2 = TGGGGAGAGC...
umi CATGTGTATG = 285 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-372 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=32)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-547 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQVWDRSRDHVVF at 355, score = 7 + 8
umis assigned: [4, 13]
of which 2 are surviving nonsolos
reads assigned: 199
start codons at 40, 101, 188, 239, 383
confident = false

TIG 2[bases=570]
0-49 ==> 0-49 on |289|IGKV3D-15|5'UTR| [len=49] (mis=3)
49-396 ==> 0-347 on |290|IGKV3D-15|L-REGION+V-REGION| [len=347] (mis=3)
396-434 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNNWPPFTF at 370, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 49, 118, 254, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1546 = TGGTTCCGTGCCTGCA-1

using 335 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 6^2, 318]
surviving nonsolo ucounts = 1[318]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=526]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=7)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-526 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 30, 63, 99, 187, 250, 349, 369, 471
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1554 = TGGTTCCGTTCGCGAC-1

using 419 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[417]
surviving nonsolo ucounts = 1[417]
ids = [2]

====================================================================================

UMI info for barcode TGGTTCCGTTCGCGAC-1 contig 1 = GAGGAACTGC...
umi GTAGATCCAC = 417 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=23)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYDNWWTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 33, 102, 238, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1560 = TGGTTCCGTTTGTTGG-1

using 57 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 1[55]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1566 = TGGTTCCTCACCTCGT-1

using 1077 reads

====================================================================================

graph has 1193 edges initially, 10 edges after simplification

total ucounts = 315
nonsolo ucounts = 138[2^56, 3^30, 4^17, 5^22, 6^2, 7^4, 8^3, 13, 14, 15, 414]
surviving nonsolo ucounts = 1[414]
ids = [204]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1572 = TGGTTCCTCAGGCCCA-1

using 19 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1577 = TGGTTCCTCATTATCC-1

using 14 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1587 = TGGTTCCTCCCAAGAT-1

using 258 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 4, 7, 8, 10, 223]
surviving nonsolo ucounts = 1[223]
ids = [2]

====================================================================================

UMI info for barcode TGGTTCCTCCCAAGAT-1 contig 1 = AGCTTCAGCT...
umi AGATATCCCC = 213 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=536]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
438-536 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDSLNGSWVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1590 = TGGTTCCTCCCTGACT-1

using 261 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCTCCCTGACT-1 contig 1 = TGGGAGGAAT...
umi ACTCTATATA = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1595 = TGGTTCCTCCTTGACC-1

using 49 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^4, 3^2, 4, 7, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1601 = TGGTTCCTCGGAAACG-1

using 235 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCTCGGAAACG-1 contig 1 = TGTGGGCACA...
umi CACTCACGGA = 220 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=591]
0-38 ==> 13-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
38-394 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
432-591 ==> 0-159 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSYDSSLSGLYVF at 362, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 38, 192, 195, 246, 345, 372, 396, 564
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1604 = TGGTTCCTCGTACCGG-1

using 76 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 11[2^3, 3, 4^2, 6, 9, 10, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1613 = TGGTTCCTCTCGTATT-1

using 11 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1621 = TGGTTCCTCTGTTGAG-1

using 362 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 353]
surviving nonsolo ucounts = 1[353]
ids = [5]

====================================================================================

UMI info for barcode TGGTTCCTCTGTTGAG-1 contig 1 = GAGCTGCTCA...
umi TACATACGTA = 354 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQHYSNSPNLEYTF at 354, score = 10 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 30, 238, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1624 = TGGTTCCTCTTCGGTC-1

using 281 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [3]

====================================================================================

UMI info for barcode TGGTTCCTCTTCGGTC-1 contig 1 = ATACTTTCTG...
umi GCATTTTAGG = 256 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=13)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
473-522 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARAPSLWFGDFEGEEFDYW at 382, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 37, 81, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1625 = TGGTTCCTCTTGAGAC-1

using 205 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 196]
surviving nonsolo ucounts = 1[196]
ids = [0]

====================================================================================

UMI info for barcode TGGTTCCTCTTGAGAC-1 contig 1 = CTGGGCCTAA...
umi AGACGCTTTA = 198 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=630]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-369 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=32)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQVWDRSRDHVVF at 352, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 37, 98, 185, 236, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1628 = TGTATTCAGAAACCTA-1

using 334 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 328]
surviving nonsolo ucounts = 1[328]
ids = [3]

====================================================================================

UMI info for barcode TGTATTCAGAAACCTA-1 contig 1 = TGGGGAGTGC...
umi GCCACACCCT = 263 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=490]
22-393 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
415-461 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
461-490 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGAARSGTVTLDYW at 382, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 22, 43, 87, 173, 278
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1629 = TGTATTCAGAAACGAG-1

using 190 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 176]
surviving nonsolo ucounts = 1[176]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1640 = TGTATTCAGATGGCGT-1

using 721 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 712]
surviving nonsolo ucounts = 1[712]
ids = [2]

====================================================================================

UMI info for barcode TGTATTCAGATGGCGT-1 contig 1 = ATCACATAAC...
umi GGTGCTCTAG = 716 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=547]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CASRAGGSIIPFDYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 704
start codons at 58, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1648 = TGTATTCAGCGTGAGT-1

using 21396 reads

====================================================================================

graph has 5991 edges initially, 40 edges after simplification

total ucounts = 611
nonsolo ucounts = 280[2^73, 3^50, 4^27, 5^20, 6^12, 7^7, 8^6, 9^5, 10^3, 11^2, 12^2, 16, 18, 25, 30, 59, 78, 149, 150, 157, 158, 167, 174, 175, 176, 182, 201, 202, 208, 220, 228, 230, 234, 241, 247, 257, 261, 262, 263^2, 265, 267, 268, 270, 272, 291, 298, 300, 301, 302, 305, 306, 312, 317^2, 321, 327, 328^2, 330, 331, 335, 337, 340^3, 341, 348, 352^2, 359^2, 360, 368, 370, 375, 379, 380, 403, 422, 423, 457, 470, 674]
surviving nonsolo ucounts = 68[30, 59, 78, 149, 157, 158, 167, 174, 175, 176, 182, 201, 208, 220, 228, 230, 234, 241, 247, 257, 261, 262, 263^2, 265, 267, 268, 270, 272, 291, 298, 300, 301, 302, 305, 306, 312, 317^2, 321, 327, 328^2, 330, 331, 335, 337, 340^3, 341, 348, 352^2, 359^2, 360, 368, 370, 375, 379, 380, 403, 422, 423, 457, 470, 674]
ids = [243, 544, 44, 503, 307, 468, 283, 429, 249, 13, ...]

====================================================================================

UMI info for barcode TGTATTCAGCGTGAGT-1 contig 1 = ATCACATAAC...
umi AATACTCTTG = 220 reads: +439 validated
umi AATTGACGGG = 78 reads: +427 -1 +11 non-validated
umi CGCGGTTGTG = 31 reads: +377 -1 +3 -1 +6 -1 +3 -1 +4 -1 +7 -34 non-validated
umi CGCGTTTGTG = 175 reads: +426 -1X +12 invalidated
umi CTCAGGATCT = 162 reads: +150 -1XX +288 invalidated
umi CTTAATGTAC = 267 reads: +438 -1 non-validated
umi GTCGATCTCC = 328 reads: +439 validated
umi TACAGAAGGC = 226 reads: +439 validated
umi TAGAATTGCT = 231 reads: +439 validated
umi TCACATGGCA = 325 reads: +439 validated
umi TCGCACGGCC = 200 reads: +414 -1 +14 -1X +9 invalidated
umi TCTATCCATA = 134 reads: +439 validated
umi TCTGTTGTGT = 266 reads: +439 validated
umi TGTCGGGCAC = 60 reads: -40X +1 -1XX +299 -1 +10 -1X +5 -1 +13 -7 +60 invalidated
umi TTACAGTGGG = 232 reads: +439 validated
umi TTATCGGGTA = 223 reads: +439 validated

UMI info for barcode TGTATTCAGCGTGAGT-1 contig 2 = GGGAGAGCCC...
umi AAAGTAGGCA = 176 reads: +382 validated
umi AAATCAGTAG = 329 reads: +382 validated
umi ACCTATTAGT = 359 reads: +382 validated
umi ACGAGTCCTC = 211 reads: +382 validated
umi ACGTCGTAGG = 381 reads: +382 validated
umi AGACGTCCGG = 341 reads: +382 validated
umi AGCCCATGTT = 262 reads: +382 validated
umi AGTCATCGGC = 360 reads: +382 validated
umi AGTGGTTCGG = 346 reads: +382 validated
umi ATAACAGCCA = 297 reads: +382 validated
umi ATGAAGTCGT = 329 reads: +382 validated
umi ATTAACGGAT = 271 reads: +382 validated
umi CAACTGTCCA = 381 reads: +382 validated
umi CAGAATCAAT = 271 reads: +382 validated
umi CAGAATCCTA = 299 reads: +382 validated
umi CAGTCATGGT = 348 reads: +382 validated
umi CATACGTCGG = 430 reads: +382 validated
umi CCACAAGGCT = 271 reads: +382 validated
umi CCACCCTGTC = 460 reads: -77 +1 -2XX +1 -4XX +297 invalidated
umi CCATAATAGA = 346 reads: +382 validated
umi CCGTGCAGAA = 182 reads: +382 validated
umi CGAATTCATA = 266 reads: +382 validated
umi CGATTCGCTC = 674 reads: +382 validated
umi CGATTTCATC = 368 reads: +382 validated
umi CGCTCGCAAT = 325 reads: +382 validated
umi CGTTACGGTT = 373 reads: +382 validated
umi CTACAATTGC = 238 reads: +382 validated
umi CTCCGGCGTT = 319 reads: +382 validated
umi CTTAGCCAAG = 257 reads: +382 validated
umi CTTCTCAAAA = 159 reads: +382 validated
umi CTTTCCCCCC = 311 reads: +382 validated
umi GAACAGACAC = 255 reads: +382 validated
umi GAATAGCTAT = 300 reads: +382 validated
umi GGCGAAACTC = 334 reads: +382 validated
umi GTAAGTCCAA = 350 reads: +382 validated
umi GTACTTTGGT = 470 reads: +382 validated
umi GTGTACGGAA = 361 reads: +382 validated
umi TAATTTTGGC = 272 reads: +382 validated
umi TACCACCTAC = 173 reads: +382 validated
umi TAGTAGAGCG = 263 reads: +382 validated
umi TATAACGATT = 376 reads: +382 validated
umi TCAGAGGTAA = 158 reads: +382 validated
umi TCATTCTGGG = 417 reads: +382 validated
umi TCCATTTCAT = 315 reads: +382 validated
umi TCGGTCTGCA = 342 reads: +382 validated
umi TCTTATCAAG = 327 reads: +382 validated
umi TGAATCCCCC = 404 reads: +382 validated
umi TGTAGCCTGG = 315 reads: +382 validated
umi TTCGTATCGT = 290 reads: +382 validated
umi TTCTCTATGG = 335 reads: +382 validated
umi TTGGTTGGCT = 302 reads: +382 validated
umi TTGTTATCTT = 322 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=568]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
411-442 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=4)
434-497 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 208 reads
cdr3 = CARDRYCSSTSCYTYYYGMDVW at 400, score = 9 + 7
umis assigned: [38, 44, 243, 249, 283, 303, 395, 426, 436, 464] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3110
start codons at 58, 209, 256, 355, 454
confident = true

TIG 2[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 52 umis using 2693 reads
cdr3 = CQQRSNWPLTF at 368, score = 9 + 9
umis assigned: [13, 14, 55, 58, 65, 83, 91, 97, 99, 105] and 42 others
of which 52 are surviving nonsolos
reads assigned: 16380
start codons at 47, 252, 255, 471
confident = true
now this is a cell
paired!

TACTGTGCGAGAGATCGTTATTGTAGTAGTACCAGCTGCTATACCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1650 = TGTATTCAGCTTTGGT-1

using 16 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1651 = TGTATTCAGGAATTAC-1

using 430 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 425]
surviving nonsolo ucounts = 1[425]
ids = [1]

====================================================================================

UMI info for barcode TGTATTCAGGAATTAC-1 contig 1 = GGAACTGCTC...
umi AGCAACTTTT = 431 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-337 ==> 0-306 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=25)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNKWPLTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 31, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1653 = TGTATTCAGGACTGGT-1

using 302 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi TATTAAAGAT = 295 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=528]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-528 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 31 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1656 = TGTATTCAGGCAGTCA-1

using 224 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================

UMI info for barcode TGTATTCAGGCAGTCA-1 contig 1 = GGGGGCTGGG...
umi GCTCGGCCTT = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=526]
45-397 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=14)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
433-526 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSYTSSSTRVF at 369, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 45, 202, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1658 = TGTATTCAGGGAAACA-1

using 228 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3^2, 6^2, 206]
surviving nonsolo ucounts = 1[206]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCAGGGAAACA-1 contig 1 = GCTCTGCTTC...
umi AACTATGCAA = 197 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=518]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-518 ==> 0-73 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1659 = TGTATTCAGGGCATGT-1

using 400 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[400]
surviving nonsolo ucounts = 1[400]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCAGGGCATGT-1 contig 1 = CCACATCCCT...
umi CTATGTTCGT = 402 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=540]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=0)
398-419 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=1)
418-469 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKGIAVAGTHWFDPW at 384, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 395
start codons at 42, 193, 198, 240, 245, 262, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1662 = TGTATTCAGTACATGA-1

using 234 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 224]
surviving nonsolo ucounts = 1[224]
ids = [8]

====================================================================================

UMI info for barcode TGTATTCAGTACATGA-1 contig 1 = GAGCATCACC...
umi TTGGGCTGGC = 207 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=497]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
429-492 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
junction support: 1 umis using 13 reads
cdr3 = CARATGTTVEYYYYGMDVW at 404, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 62, 218, 260, 265, 297, 326, 359, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1671 = TGTATTCAGTGTCTCA-1

using 255 reads

====================================================================================

graph has 172 edges initially, 6 edges after simplification

total ucounts = 135
nonsolo ucounts = 56[2^25, 3^15, 4^7, 5^3, 6^4, 7^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1672 = TGTATTCAGTTAACGA-1

using 252 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 247]
surviving nonsolo ucounts = 1[247]
ids = [2]

====================================================================================

UMI info for barcode TGTATTCAGTTAACGA-1 contig 1 = GGAGTCAGTC...
umi GCGAACCATT = 247 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSNPSF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 26, 32, 88, 101, 237, 240, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1673 = TGTATTCAGTTGAGAT-1

using 62 reads

====================================================================================

graph has 56 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2, 3, 4, 6, 7^2, 11, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1677 = TGTATTCCAAATTGCC-1

using 223 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 6, 7, 204]
surviving nonsolo ucounts = 1[204]
ids = [7]

====================================================================================

UMI info for barcode TGTATTCCAAATTGCC-1 contig 1 = ACCCAAAAAC...
umi TTGAGCCGGA = 201 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=525]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-525 ==> 0-35 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1682 = TGTATTCCAAGAGTCG-1

using 155 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 147]
surviving nonsolo ucounts = 1[147]
ids = [2]

====================================================================================

UMI info for barcode TGTATTCCAAGAGTCG-1 contig 1 = GAGGAATCAG...
umi GATGAGGGAC = 139 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-488 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1689 = TGTATTCCACATAACC-1

using 210 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 203]
surviving nonsolo ucounts = 1[203]
ids = [4]

====================================================================================

UMI info for barcode TGTATTCCACATAACC-1 contig 1 = GTCTCCCTCA...
umi GCTGGAAGCC = 198 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=526]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=14)
424-474 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
474-526 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARRYGDYVYAFDFW at 398, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 56, 230, 254, 411, 426
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1708 = TGTATTCCAGTCGATT-1

using 275 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 114, 154]
surviving nonsolo ucounts = 2[114, 154]
ids = [4, 5]

====================================================================================

UMI info for barcode TGTATTCCAGTCGATT-1 contig 1 = GAGCATCACC...
umi GTCTATGCCA = 158 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=598]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-598 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARSLVSYSSSWIFDYW at 404, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 62, 260, 265, 297, 326, 359
confident = false

REJECT CONTIGS

TIG 1[bases=464]
0-347 ==> 4-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=18)
346-384 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
384-464 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQTNSSPRTF at 323, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 2, 58, 71, 207, 426
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1710 = TGTATTCCAGTTAACC-1

using 345 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 340]
surviving nonsolo ucounts = 1[340]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCCAGTTAACC-1 contig 1 = GAGGAATCAG...
umi AACTCGCTTT = 341 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1714 = TGTATTCCATCGGGTC-1

using 137 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1721 = TGTATTCGTACCGTAT-1

using 259 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [1]

====================================================================================

UMI info for barcode TGTATTCGTACCGTAT-1 contig 1 = AGGAGTCAGA...
umi ATGCTTTCTC = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYALSF at 354, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 27, 33, 89, 102, 238, 241, 334, 373, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1723 = TGTATTCGTATAATGG-1

using 7404 reads

====================================================================================

graph has 4061 edges initially, 96 edges after simplification

total ucounts = 852
nonsolo ucounts = 416[2^149, 3^97, 4^57, 5^38, 6^20, 7^6, 8^8, 9^4, 10^2, 11^4, 12^2, 13^3, 14, 15^2, 16, 18, 20, 44, 66, 109, 128, 137, 215, 219, 226, 228, 235, 243, 246, 247, 271, 287, 297, 300, 398, 443, 1135]
surviving nonsolo ucounts = 20[20, 66, 109, 128, 137, 215, 219, 226, 228, 235, 243, 246, 247, 271, 287, 297, 300, 398, 443, 1135]
ids = [170, 618, 172, 154, 74, 664, 761, 371, 180, 736, ...]

====================================================================================

UMI info for barcode TGTATTCGTATAATGG-1 contig 1 = AGAGCTCTGG...
umi AGTCTTAACT = 138 reads: +394 validated
umi CATAGTGGAT = 128 reads: +394 validated
umi CGTAATTCTT = 404 reads: +27 -2XX +1 -9XX +1 -3XX +2 -349X invalidated
umi CTTATATGCC = 226 reads: +394 validated
umi CTTCTATGTA = 244 reads: +394 validated
umi GCACAGTTCG = 309 reads: +95 -2 +297 non-validated
umi GCCCCTGAAT = 271 reads: +394 validated
umi TATTAACCCG = 246 reads: +394 validated
umi TCATGCGGTC = 64 reads: +382 -12 non-validated
umi TTAACAGGCT = 245 reads: +394 validated

UMI info for barcode TGTATTCGTATAATGG-1 contig 2 = TGGGGCTCCC...
umi CATGAACATA = 108 reads: +396 -25 non-validated
umi CCAAGTACCA = 228 reads: +421 validated
umi CCCGAACATT = 299 reads: +421 validated
umi TGGTTTCGTA = 235 reads: +421 validated
umi TTACATCTTC = 217 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=627]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
22-381 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=0)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
416-627 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 332 reads
cdr3 = CQTWGTGIHVF at 355, score = 8 + 8
umis assigned: [74, 154, 288, 371, 378, 411, 424, 597, 618, 755]
of which 10 are surviving nonsolos
reads assigned: 2229
start codons at 22, 183, 223, 239, 338, 380, 548
confident = true

TIG 2[bases=617]
125-480 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=28)
498-546 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
546-617 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 49 reads
cdr3 = CAKAMAYDSSGYFDYW at 467, score = 9 + 7
umis assigned: [172, 180, 214, 736, 761]
of which 5 are surviving nonsolos
reads assigned: 1074
start codons at 17, 125, 270, 276, 281, 360, 428, 479, 486
confident = true

REJECT CONTIGS

TIG 1[bases=359]
0-64 ==> 3086-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=7)
110-148 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
148-359 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [306, 317, 664]
of which 3 are surviving nonsolos
reads assigned: 1770
start codons at 6, 91
confident = false
did not find CDR3

TIG 2[bases=481]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
6-58 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-333 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
418-481 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 354, score = 6 + 8
umis assigned: [636]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 33, 238, 460
confident = false
not full
full length stopped transcript of length 481
frameshifted full length stopped transcript of length 481
VJ delta = 13
not full

TIG 3[bases=318]
0-215 ==> 145-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=2)
218-255 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
255-318 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPPVTF at 191, score = 9 + 8
umis assigned: [170]
of which 1 are surviving nonsolos
reads assigned: 16
start codons at 12, 174, 194, 297
confident = false
not full
VJ delta = 13
not full
now this is a cell
paired!

GAGGACACGGCCTTGTATTACTGTGCAAAAGCCATGGCGTATGATAGTAGTGGTTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTCATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1725 = TGTATTCGTATTAGCC-1

using 303 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3^3, 288]
surviving nonsolo ucounts = 1[288]
ids = [7]

====================================================================================

UMI info for barcode TGTATTCGTATTAGCC-1 contig 1 = GAGCTACCAC...
umi TTGGTCCCTC = 291 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=10)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CHQYFGTPFTF at 369, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1728 = TGTATTCGTCCGTGAC-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1729 = TGTATTCGTCGAACAG-1

using 171 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[170]
surviving nonsolo ucounts = 1[170]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCGTCGAACAG-1 contig 1 = CAGCTTCAGC...
umi ATCGATTTTT = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
436-564 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASWDDSLRGRVF at 369, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 48, 202, 352, 377, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1738 = TGTATTCGTGTTGGGA-1

using 237 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[5, 225]
surviving nonsolo ucounts = 1[225]
ids = [2]

====================================================================================

UMI info for barcode TGTATTCGTGTTGGGA-1 contig 1 = AGGAATCAGA...
umi CGCTGGCCTC = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1739 = TGTATTCGTTAAGACA-1

using 3229 reads

====================================================================================

graph has 1600 edges initially, 32 edges after simplification

total ucounts = 275
nonsolo ucounts = 116[2^45, 3^24, 4^13, 5^10, 6^4, 7^3, 8^3, 9^2, 10, 109, 126, 169, 203, 219^2, 244, 325, 351, 354, 390]
surviving nonsolo ucounts = 11[109, 126, 169, 203, 219^2, 244, 325, 351, 354, 390]
ids = [273, 12, 175, 184, 57, 191, 158, 22, 15, 183, ...]

====================================================================================

UMI info for barcode TGTATTCGTTAAGACA-1 contig 1 = GGAGTCTCCC...
umi AATCAGGTAC = 119 reads: +430 validated
umi ATTTAGTTCG = 204 reads: +430 validated
umi CCATGTTTAT = 360 reads: +430 validated
umi GCCGCCTACC = 228 reads: +430 validated
umi GTACCACCAC = 160 reads: +430 validated
umi GTTCGAACAC = 200 reads: +428 -2 non-validated
umi TAAGCGACAC = 205 reads: +430 validated

UMI info for barcode TGTATTCGTTAAGACA-1 contig 2 = AAAAGAGGTT...
umi AATGGCCTGT = 348 reads: +379 validated
umi ACCTTCCTGT = 324 reads: +379 validated
umi GTTAGATGGT = 359 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=528]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
489-528 ==> 0-39 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 87 reads
cdr3 = CARGLDGQGEQWLGAFDIW at 401, score = 8 + 8
umis assigned: [12, 57, 88, 158, 175, 184, 191]
of which 7 are surviving nonsolos
reads assigned: 1450
start codons at 59, 233, 257, 392, 470, 507
confident = true

TIG 2[bases=574]
0-59 ==> 5-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
59-401 ==> 0-342 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=1)
400-438 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
438-574 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 148 reads
cdr3 = CHQSSSLPGTF at 377, score = 10 + 8
umis assigned: [15, 22, 183]
of which 3 are surviving nonsolos
reads assigned: 1017
start codons at 21, 28, 59, 264, 360, 480
confident = true
now this is a cell
paired!

GCCATGTATTACTGTGCGAGAGGTTTAGACGGCCAAGGGGAGCAGTGGCTTGGCGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCGGGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1742 = TGTATTCGTTATCCGA-1

using 271 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 6, 8, 246]
surviving nonsolo ucounts = 1[246]
ids = [1]

====================================================================================

UMI info for barcode TGTATTCGTTATCCGA-1 contig 1 = GAGGAACTGC...
umi ATAGTTAAGG = 249 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNNWPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1751 = TGTATTCTCAAACAAG-1

using 327 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3, 4^2, 313]
surviving nonsolo ucounts = 1[313]
ids = [0]

====================================================================================

UMI info for barcode TGTATTCTCAAACAAG-1 contig 1 = GAGTCAGACC...
umi ACGCACTCTC = 316 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=540]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
372-404 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
404-540 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQHYNSYF at 352, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 25, 31, 87, 100, 332, 395, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1758 = TGTATTCTCAGTGCAT-1

using 220 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 3, 9, 196]
surviving nonsolo ucounts = 1[196]
ids = [10]

====================================================================================

UMI info for barcode TGTATTCTCAGTGCAT-1 contig 1 = GGAGTCAGTC...
umi TATCCGGCTA = 175 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=4)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-504 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1761 = TGTATTCTCCAGAGGA-1

using 21 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1784 = TGTATTCTCTTACCTA-1

using 9453 reads

====================================================================================

graph has 5647 edges initially, 82 edges after simplification

total ucounts = 685
nonsolo ucounts = 340[2^110, 3^76, 4^46, 5^22, 6^22, 7^15, 8^3, 9^4, 10^2, 11^2, 12, 17, 18, 43, 62, 74, 79, 82, 86, 103, 104, 111, 113, 120, 133, 143, 159^2, 169, 192, 197, 203, 204, 209, 213, 222, 236, 284, 285, 312, 331, 356, 369, 399, 407, 420, 666, 735]
surviving nonsolo ucounts = 31[43, 62, 74, 86, 104, 111, 113, 120, 133, 143, 159, 169, 192, 197, 203, 204, 209, 213, 222, 236, 284, 285, 312, 331, 356, 369, 399, 407, 420, 666, 735]
ids = [56, 584, 345, 270, 380, 418, 356, 202, 564, 625, ...]

====================================================================================

UMI info for barcode TGTATTCTCTTACCTA-1 contig 1 = GGGGAGGAGT...
umi ACATCTTGCT = 43 reads: -20 +355 -1XX +9 invalidated
umi ACCACCCGGG = 239 reads: +385 validated
umi CCTCCCAGCC = 401 reads: +385 validated
umi CGATACATAT = 418 reads: +385 validated
umi CTGTGGTCCG = 105 reads: +385 validated
umi CTTCATCCTC = 312 reads: +385 validated
umi GATTTCCTTA = 333 reads: +385 validated
umi GCCAGTTCGC = 281 reads: +385 validated
umi TCTACAACTC = 60 reads: -1 +4 -2 +6 -4 +368 non-validated
umi TCTTAAGTGG = 356 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=9)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 423 reads
cdr3 = CQQYDNLSLF at 358, score = 9 + 6
umis assigned: [56, 61, 281, 295, 380, 385, 429, 441, 584, 596]
of which 10 are surviving nonsolos
reads assigned: 2517
start codons at 31, 37, 93, 106, 245, 368, 458
confident = true

REJECT CONTIGS

TIG 1[bases=406]
2-279 ==> 76-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=16)
289-335 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
335-406 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARARSGTLDYW at 268, score = 9 + 7
umis assigned: [130, 202, 204, 270, 279, 343, 345, 356, 396, 418] and 5 others
of which 15 are surviving nonsolos
reads assigned: 1600
start codons at 82, 137, 143, 229
confident = false
VJ delta = 6
not full
not full

TIG 2[bases=539]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
0-58 ==> 7988-8046 on rc of segment before IGHV2-70 exon 2 [len=8046] (mis=0)
7-76 ==> 10071-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=6)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=16)
438-468 ==> 16-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [77, 133, 564, 606]
of which 4 are surviving nonsolos
reads assigned: 1096
start codons at 58, 209, 219, 256, 355, 395, 432
confident = false
frameshifted full length stopped transcript of length 539
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1788 = TGTCCCAAGAACTCGG-1

using 286 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 4, 6^2, 7, 10, 248]
surviving nonsolo ucounts = 1[248]
ids = [1]

====================================================================================

UMI info for barcode TGTCCCAAGAACTCGG-1 contig 1 = GGGGTCACAA...
umi CGCGACACGG = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-548 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CCSYAGSSTFVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1790 = TGTCCCAAGAAGGGTA-1

using 7983 reads

====================================================================================

graph has 3560 edges initially, 28 edges after simplification

total ucounts = 517
nonsolo ucounts = 228[2^82, 3^42, 4^24, 5^27, 6^7, 7^4, 8^5, 9^3, 10, 11^2, 12, 13, 14, 15, 17^2, 79, 115, 133, 157, 161, 224, 227, 233, 251, 263, 271, 279, 280, 285, 316, 331, 332, 334, 344, 348, 360, 361, 376, 410, 446]
surviving nonsolo ucounts = 23[79, 115, 157, 224, 227, 233, 251, 263, 271, 279, 280, 285, 316, 331, 332, 334, 344, 348, 360, 361, 376, 410, 446]
ids = [300, 357, 334, 34, 143, 437, 372, 315, 43, 514, ...]

====================================================================================

UMI info for barcode TGTCCCAAGAAGGGTA-1 contig 1 = GGGGGCTGGT...
umi AATCCTGTCT = 231 reads: +388 validated
umi AATTGCGGGT = 352 reads: +388 validated
umi ACACTGGATC = 275 reads: +388 validated
umi ACCAAAAGAG = 347 reads: +388 validated
umi CACAGGCTTC = 416 reads: +388 validated
umi CATATAGGCG = 226 reads: +388 validated
umi CCCCCAACCA = 319 reads: +388 validated
umi CCTCGCGATT = 366 reads: +388 validated
umi GACCCCGTGA = 376 reads: +388 validated
umi GGACCACCGG = 332 reads: +388 validated
umi GGATGGTTCA = 82 reads: -1 +1 -1 +3 -1 +20 -8X +1 -7X +1 -5XX +2 -2XX +335 invalidated
umi GTATAAACAT = 261 reads: +388 validated
umi GTGTACGCTG = 158 reads: +388 validated
umi TAATACTTTT = 360 reads: +388 validated
umi TACCCATCCA = 116 reads: +388 validated
umi TAGTTTGGTC = 251 reads: +388 validated
umi TATCATCACA = 284 reads: +388 validated
umi TCCAGCTCGG = 336 reads: +388 validated
umi TGGACAACGG = 336 reads: +388 validated
umi TTAACACCTA = 449 reads: +388 validated
umi TTTTGTGCGT = 285 reads: +388 validated

UMI info for barcode TGTCCCAAGAAGGGTA-1 contig 2 = ACTTTCTGAG...
umi AAATCGGCCT = 269 reads: +451 validated
umi TGCATCTCAC = 222 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=573]
49-402 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
399-437 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 1041 reads
cdr3 = CQQSYNTPWTF at 376, score = 8 + 8
umis assigned: [34, 38, 43, 45, 129, 143, 174, 193, 261, 298] and 11 others
of which 21 are surviving nonsolos
reads assigned: 6035
start codons at 49, 55, 124, 260, 479
confident = true

TIG 2[bases=556]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=29)
433-486 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=1)
486-556 ==> 0-70 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 58 reads
cdr3 = CARLGANYYDRFHYHNPYGYWFFDLW at 377, score = 9 + 7
umis assigned: [14, 437]
of which 2 are surviving nonsolos
reads assigned: 487
start codons at 14, 35, 79, 193, 249, 402, 429, 540
confident = true
now this is a cell
paired!

CTGGGCGCAAATTACTATGATCGTTTTCATTATCACAACCCTTATGGCTACTGGTTCTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCACCAATCTGCAACCTGAAGATTTTACAACTTACTACTGTCAACAGAGTTACAATACCCCTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1794 = TGTCCCAAGACACTAA-1

using 12 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1798 = TGTCCCAAGATATGGT-1

using 100 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 5, 84]
surviving nonsolo ucounts = 1[84]
ids = [2]

====================================================================================

UMI info for barcode TGTCCCAAGATATGGT-1 contig 1 = GGCTTTCTGA...
umi CCAGTGCGGA = 79 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=477]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
451-477 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARYFAFVNYYFDKW at 375, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 15, 36, 80
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1801 = TGTCCCAAGATCCTGT-1

using 129 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[7, 12, 103]
surviving nonsolo ucounts = 1[103]
ids = [9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1803 = TGTCCCAAGCAGCGTA-1

using 258 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 247]
surviving nonsolo ucounts = 1[247]
ids = [3]

====================================================================================

UMI info for barcode TGTCCCAAGCAGCGTA-1 contig 1 = GGGGTCACAA...
umi CACTTGTAAG = 253 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1810 = TGTCCCAAGGAATGGA-1

using 786 reads

====================================================================================

graph has 404 edges initially, 14 edges after simplification

total ucounts = 51
nonsolo ucounts = 36[2^6, 3^6, 4^4, 5^3, 6^3, 7^3, 8, 9^2, 10^2, 12, 13^2, 19, 245, 323]
surviving nonsolo ucounts = 2[245, 323]
ids = [3, 31]

====================================================================================

UMI info for barcode TGTCCCAAGGAATGGA-1 contig 1 = GGGAGGAACT...
umi GCCGATTAGC = 321 reads: +382 validated

UMI info for barcode TGTCCCAAGGAATGGA-1 contig 2 = TGATCAGGAC...
umi ACTTCAAATG = 244 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=12)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQGSNWLLTF at 356, score = 9 + 9
umis assigned: [31]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 35, 240, 243, 459
confident = false

TIG 2[bases=567]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQALQTPPCTF at 367, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 31, 64, 100, 188, 350, 370, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1812 = TGTCCCAAGGAGCGTT-1

using 107 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 97]
surviving nonsolo ucounts = 1[97]
ids = [5]

====================================================================================

UMI info for barcode TGTCCCAAGGAGCGTT-1 contig 1 = AGGAGTCAGT...
umi CGGGCTCGTT = 86 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-446 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYDNVPFTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 27, 33, 89, 102, 241, 364, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1815 = TGTCCCAAGGCCCTCA-1

using 364 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 108
nonsolo ucounts = 72[2^16, 3^15, 4^12, 5^9, 6^8, 7^3, 8^2, 9^3, 10^3, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1816 = TGTCCCAAGGCGATAC-1

using 214 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^2, 6, 195]
surviving nonsolo ucounts = 1[195]
ids = [10]

====================================================================================

UMI info for barcode TGTCCCAAGGCGATAC-1 contig 1 = GAGGAATCAG...
umi GCTCTTGTCG = 160 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-469 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1817 = TGTCCCAAGGCTACGA-1

using 728 reads

====================================================================================

graph has 274 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 716]
surviving nonsolo ucounts = 1[716]
ids = [2]

====================================================================================

UMI info for barcode TGTCCCAAGGCTACGA-1 contig 1 = AGGAGTCAGA...
umi ATCATGGACA = 720 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=18)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 111 reads
cdr3 = CQQYNSYALSF at 354, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 704
start codons at 27, 33, 89, 102, 238, 241, 334, 373, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1829 = TGTCCCAAGTGACATA-1

using 235 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 10, 215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCAAGTGACATA-1 contig 1 = GGAGTCAGTC...
umi AAATTGGTGG = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=443]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-443 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYDNSPITF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 26, 32, 88, 101, 240, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1845 = TGTCCCACAATAGCGG-1

using 204 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCACAATAGCGG-1 contig 1 = GCTCAGTTAG...
umi CACAAAGGCC = 203 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=543]
0-25 ==> 72-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
25-370 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
369-407 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSDWPRTF at 346, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 25, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1849 = TGTCCCACACAAGCCC-1

using 281 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCACACAAGCCC-1 contig 1 = GATCAGGACT...
umi ACCACACCAC = 260 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=494]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-494 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1855 = TGTCCCACACCATGTA-1

using 239 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 4, 5, 7, 215]
surviving nonsolo ucounts = 1[215]
ids = [7]

====================================================================================

UMI info for barcode TGTCCCACACCATGTA-1 contig 1 = GAGAGAGGAG...
umi GGGACATCAG = 202 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=597]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-597 ==> 0-100 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1862 = TGTCCCACAGATGGCA-1

using 21 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1870 = TGTCCCACAGGCGATA-1

using 286 reads

====================================================================================

graph has 73 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCACAGGCGATA-1 contig 1 = AGCCTGGGCC...
umi CATTCGATCA = 259 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=569]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-374 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
416-569 ==> 0-153 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQAWDSTEVVF at 355, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 40, 45, 334, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1871 = TGTCCCACAGGGAGAG-1

using 362 reads

====================================================================================

graph has 207 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 4, 347]
surviving nonsolo ucounts = 1[347]
ids = [5]

====================================================================================

UMI info for barcode TGTCCCACAGGGAGAG-1 contig 1 = AGTCCCAGTC...
umi GTCCACCGAC = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQLNSYPLTF at 347, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1873 = TGTCCCACAGGTTTCA-1

using 112 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 14[2^2, 3, 4, 6, 7^2, 8, 10^2, 11, 13^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1874 = TGTCCCACAGTATAAG-1

using 272 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 264]
surviving nonsolo ucounts = 1[264]
ids = [5]

====================================================================================

UMI info for barcode TGTCCCACAGTATAAG-1 contig 1 = ATCATCCAAC...
umi TTGATATCCC = 236 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=569]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
469-509 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
509-569 ==> 0-60 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDSGGYTAMVLERQYSSGWLGDYW at 400, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 58, 214, 256, 322, 355, 430, 527
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1881 = TGTCCCACATATACGC-1

using 72 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2, 3, 6^2, 7^2, 9, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1884 = TGTCCCACATCCCACT-1

using 75 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[75]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1904 = TGTCCCAGTAGTAGTA-1

using 105 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 11, 84]
surviving nonsolo ucounts = 1[84]
ids = [3]

====================================================================================

UMI info for barcode TGTCCCAGTAGTAGTA-1 contig 1 = GGGGATCTCA...
umi CGACCTGGCA = 83 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
39-393 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-530 ==> 0-103 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CSSYTTSTTWVF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 39, 240, 247
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1906 = TGTCCCAGTCAAACTC-1

using 237 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 230]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1908 = TGTCCCAGTCACTGGC-1

using 236 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [1]

====================================================================================

UMI info for barcode TGTCCCAGTCACTGGC-1 contig 1 = AGTCAGTCCC...
umi AGCTCAGTCC = 204 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=512]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
409-512 ==> 0-103 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLPTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 24, 30, 86, 99, 238, 361, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1909 = TGTCCCAGTCAGGACA-1

using 47 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 11[2^2, 3^5, 4, 5^2, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1910 = TGTCCCAGTCATCGGC-1

using 254 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [3]

====================================================================================

UMI info for barcode TGTCCCAGTCATCGGC-1 contig 1 = GACTGATCAG...
umi ATTGCTTCCA = 233 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=524]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
396-434 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
434-524 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTPLFTF at 370, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 34, 67, 103, 191, 353, 373, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1916 = TGTCCCAGTCGGATCC-1

using 250 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 8, 233]
surviving nonsolo ucounts = 1[233]
ids = [6]

====================================================================================

UMI info for barcode TGTCCCAGTCGGATCC-1 contig 1 = CAAAAACCAC...
umi TAAGAGTCGT = 222 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=576]
0-51 ==> 8-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
51-404 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
453-487 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
487-576 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 393, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 51, 249, 254, 271, 315, 348, 541
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1923 = TGTCCCAGTGACTCAT-1

using 244 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 26
nonsolo ucounts = 8[2^4, 3, 4^2, 207]
surviving nonsolo ucounts = 1[207]
ids = [10]

====================================================================================

UMI info for barcode TGTCCCAGTGACTCAT-1 contig 1 = ATCACATAAC...
umi CCCGCACCTT = 207 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=561]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=7)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-561 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARVGYSSSASYYYYYAMDVW at 400, score = 9 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1927 = TGTCCCAGTGCAACGA-1

using 99 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 86]
surviving nonsolo ucounts = 1[86]
ids = [7]

====================================================================================

UMI info for barcode TGTCCCAGTGCAACGA-1 contig 1 = CCAGCATGGC...
umi GTGCCCTGCA = 74 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
5-356 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=10)
355-393 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
393-472 ==> 0-79 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CATWDDSLSGWVF at 326, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 5, 159, 309, 334, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1931 = TGTCCCAGTGCGATAG-1

using 1044 reads

====================================================================================

graph has 256 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 1032]
surviving nonsolo ucounts = 1[1032]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=353]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-32 ==> 5705-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
31-353 ==> 0-322 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 829
start codons at 31, 239
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1937 = TGTCCCAGTGTCCTCT-1

using 2437 reads

====================================================================================

graph has 2594 edges initially, 12 edges after simplification

total ucounts = 569
nonsolo ucounts = 313[2^110, 3^71, 4^36, 5^37, 6^23, 7^9, 8^8, 9^8, 10^2, 11^3, 13^3, 302, 304, 384]
surviving nonsolo ucounts = 5[6, 13, 302, 304, 384]
ids = [355, 485, 250, 162, 34]

====================================================================================

UMI info for barcode TGTCCCAGTGTCCTCT-1 contig 1 = AGCTCTCAGA...
umi AATAAATCCA = 382 reads: +436 validated
umi CATGGTCTAA = 302 reads: +436 validated
umi CTGTCGAGGT = 305 reads: +436 validated
umi GGGAGTCGTT = 5 reads: -59 +2 -1 +1 -2 +2 -1 +2 -1 +1 -2 +1 -1 +1 -1 +4 -2 +1 -2 +1 -1 +108 -1 +5 -233 non-validated
umi TCGGCGGTCA = 13 reads: -17 +60 -8 +6 -1 +6 -1 +80 -4 +3 -1X +3 -1 +68 -177 invalidated

GOOD CONTIGS

TIG 1[bases=586]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=14)
444-471 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
515-586 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 38 reads
cdr3 = CARGGGRTYYYGSGSHSFDYW at 421, score = 9 + 7
umis assigned: [34, 162, 250, 355, 485]
of which 5 are surviving nonsolos
reads assigned: 991
start codons at 79, 235, 356, 452
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1941 = TGTCCCAGTTACGACT-1

using 13461 reads

====================================================================================

graph has 5248 edges initially, 64 edges after simplification

total ucounts = 977
nonsolo ucounts = 405[2^153, 3^87, 4^51, 5^35, 6^20, 7^8, 8^9, 9^4, 10^3, 11^3, 13^3, 18, 35, 39, 86, 101, 113, 115, 140, 186, 196, 226, 233, 245, 256, 262, 289, 374, 469, 517, 537, 575, 596, 612, 722, 809, 821, 904, 982, 1099]
surviving nonsolo ucounts = 25[35, 39, 86, 113, 140, 186, 196, 226, 233, 245, 262, 289, 374, 469, 517, 537, 575, 596, 612, 722, 809, 821, 904, 982, 1099]
ids = [642, 418, 344, 868, 720, 774, 493, 700, 212, 510, ...]

====================================================================================

UMI info for barcode TGTCCCAGTTACGACT-1 contig 1 = ACACATTTCC...
umi CCCCTTGTGC = 86 reads: +412 -18 non-validated
umi CGGGTAGTGC = 39 reads: -8 +366 -1 +26 -1 +12 -16 non-validated
umi GAACAGTGTG = 247 reads: +430 validated
umi GGTCTACGGA = 32 reads: +203 -1 +1 -21 +59 -15 +2 -1 +8 -1 +98 -20 non-validated
umi TGCCTGGGGA = 112 reads: +430 validated

UMI info for barcode TGTCCCAGTTACGACT-1 contig 2 = AGCTTCAGCT...
umi AAGGGGTGTT = 367 reads: +391 validated
umi ACTGTATAAC = 292 reads: +391 validated
umi ATCCTAACCG = 232 reads: +391 validated
umi CTTCAGGCCC = 197 reads: +391 validated
umi TAAACGGTCT = 228 reads: +391 validated
umi TACATTTTCT = 137 reads: +391 validated
umi TCACACCCTG = 184 reads: +391 validated
umi TCTGTCAGAT = 260 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=688]
0-76 ==> 69-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
76-426 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=28)
464-506 ==> 7-49 on |56|IGHJ5|J-REGION| [len=49] (mis=3)
506-688 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 2 umis using 42 reads
cdr3 = CASLKVVPAFRSDWLTVDLW at 415, score = 9 + 7
umis assigned: [344, 418, 510, 642, 868]
of which 5 are surviving nonsolos
reads assigned: 511
start codons at 32, 76, 120
confident = true

TIG 2[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=13)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 313 reads
cdr3 = CAVWDDSLSGRVVF at 367, score = 6 + 8
umis assigned: [39, 133, 212, 493, 700, 720, 774, 839]
of which 8 are surviving nonsolos
reads assigned: 1866
start codons at 46, 200, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=472]
0-134 ==> 117-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
54-181 ==> 5570-5697 on segment before IGLV3-29 exon 1 [len=6000] (mis=11)
134-235 ==> 0-101 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=5)
261-472 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [104, 168, 195, 202, 440, 446, 775, 809, 815, 913] and 2 others
of which 12 are surviving nonsolos
reads assigned: 8507
start codons at 41, 134, 218
confident = false
did not find CDR3
now this is a cell
paired!

GTCTATTACTGTGCGAGTCTCAAAGTAGTTCCAGCTTTTAGGTCGGACTGGCTCACTGTCGACCTCTGGGGCCAGGGAAGTCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATCATTGTGCAGTATGGGATGACAGCCTGAGTGGTCGGGTTGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1960 = TGTCCCATCACTATTC-1

using 151 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 4^2, 6, 11, 115]
surviving nonsolo ucounts = 1[115]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCATCACTATTC-1 contig 1 = TGAGCTACAA...
umi AAGTTGCACT = 108 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=478]
0-31 ==> 144-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
31-394 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
431-478 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQHYYSSPFSF at 370, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 31, 100, 353, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1964 = TGTCCCATCATGCATG-1

using 268 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 4, 258]
surviving nonsolo ucounts = 1[258]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
1-82 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 25, 31, 87, 100, 236, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1980 = TGTCCCATCGCGTTTC-1

using 150 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 10, 132]
surviving nonsolo ucounts = 1[132]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCATCGCGTTTC-1 contig 1 = AGCTTCAGCT...
umi AAAAGTTTGC = 127 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-497 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1986 = TGTCCCATCTACTCAT-1

using 26 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1988 = TGTCCCATCTCCGGTT-1

using 78 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 71]
surviving nonsolo ucounts = 1[71]
ids = [3]

====================================================================================

UMI info for barcode TGTCCCATCTCCGGTT-1 contig 1 = CCTATCCACT...
umi GTAAGGTTTG = 68 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=489]
0-42 ==> 37-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
42-395 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
419-466 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
466-489 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARDRAATARLGGMDVW at 384, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 42, 193, 198, 345, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1991 = TGTCCCATCTGCTGCT-1

using 200 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [0]

====================================================================================

UMI info for barcode TGTCCCATCTGCTGCT-1 contig 1 = GGTAGAGAAG...
umi ATACGATATT = 187 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=500]
0-34 ==> 22-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
34-358 ==> 0-324 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=9)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
416-500 ==> 0-84 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CTAWDGSQRVF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 34, 245, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.1993 = TGTCCCATCTGGCGAC-1

using 21 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2002 = TGTGGTAAGAAGAAGC-1

using 225 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 212]
surviving nonsolo ucounts = 1[212]
ids = [5]

====================================================================================

UMI info for barcode TGTGGTAAGAAGAAGC-1 contig 1 = GAGAGGAGCC...
umi TATGGTTGGT = 194 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=539]
71-424 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=4)
439-492 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
492-539 ==> 0-47 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAREGEVSLPGYFDLW at 413, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 71, 222, 227, 285, 288, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2004 = TGTGGTAAGAATTGTG-1

using 327 reads

====================================================================================

graph has 184 edges initially, 6 edges after simplification

total ucounts = 73
nonsolo ucounts = 52[2^15, 3^7, 4^4, 5^2, 6^4, 7^2, 8^3, 9^3, 10^4, 11^3, 12, 13^2, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2016 = TGTGGTAAGCGATATA-1

using 559 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3^3, 266, 274]
surviving nonsolo ucounts = 2[266, 274]
ids = [10, 13]

====================================================================================

UMI info for barcode TGTGGTAAGCGATATA-1 contig 1 = GCTCTGCTTC...
umi TTTGCATGCA = 257 reads: +391 validated

UMI info for barcode TGTGGTAAGCGATATA-1 contig 2 = GGGGAGGAAC...
umi TAACGTTAAC = 232 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=568]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-568 ==> 0-126 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 51, 135, 208, 358, 385
confident = false

TIG 2[bases=493]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2020 = TGTGGTAAGCTAGTCT-1

using 199 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 189]
surviving nonsolo ucounts = 1[189]
ids = [5]

====================================================================================

UMI info for barcode TGTGGTAAGCTAGTCT-1 contig 1 = AGCCCTGGGG...
umi GTCCAATTCA = 164 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=467]
0-42 ==> 5-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
42-387 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-467 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQRSNWPPASGFTF at 363, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 42, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2032 = TGTGGTAAGTAAGTAC-1

using 317 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3^2, 300]
surviving nonsolo ucounts = 2[2, 300]
ids = [2, 6]

====================================================================================

UMI info for barcode TGTGGTAAGTAAGTAC-1 contig 1 = ATCAGTCCCA...
umi ACTAACATAT = 2 reads: -82 +56 -206 +1 -3 +2 -1 +3 -2X +1 -2 +1 -1 +1 -3 +2 -1 +5 -2 +2 -1 +2 -1X +2 -1X +1 -3X invalidated
umi CGCTAATTCC = 304 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 299
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2035 = TGTGGTAAGTACGACG-1

using 2341 reads

====================================================================================

graph has 2544 edges initially, 101 edges after simplification

total ucounts = 1037
nonsolo ucounts = 559[2^234, 3^148, 4^82, 5^42, 6^22, 7^12, 8^8, 9^2, 10, 11, 12^3, 13, 14, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2040 = TGTGGTAAGTCCGTAT-1

using 624 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[5, 6, 136, 471]
surviving nonsolo ucounts = 2[136, 471]
ids = [3, 4]

====================================================================================

UMI info for barcode TGTGGTAAGTCCGTAT-1 contig 1 = GGGGTCACAA...
umi CGCACATGTA = 126 reads: +391 validated
umi GTGGGTTTCT = 461 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=1)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
429-588 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CCSYAGSSTFWVF at 362, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 567
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2054 = TGTGGTACAACTGGCC-1

using 3864 reads

====================================================================================

graph has 3420 edges initially, 138 edges after simplification

total ucounts = 1324
nonsolo ucounts = 759[2^257, 3^153, 4^102, 5^79, 6^44, 7^34, 8^26, 9^13, 10^9, 11^8, 12^13, 13^8, 14^3, 15^3, 16, 17^2, 22^2, 29, 48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2074 = TGTGGTACAGCGTTCG-1

using 331 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 6[2^2, 6^2, 10, 296]
surviving nonsolo ucounts = 1[296]
ids = [1]

====================================================================================

UMI info for barcode TGTGGTACAGCGTTCG-1 contig 1 = GGGAGGAACT...
umi ACCGTTCGGT = 266 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=485]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-485 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQRSNWPLTF at 356, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 35, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2081 = TGTGGTACAGGACGTA-1

using 302 reads

====================================================================================

graph has 137 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 4^2, 284]
surviving nonsolo ucounts = 1[284]
ids = [9]

====================================================================================

UMI info for barcode TGTGGTACAGGACGTA-1 contig 1 = TGGGGAGGAA...
umi TTCACATTAA = 283 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=21)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSSWPLTF at 358, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 37, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2085 = TGTGGTACATAACCTG-1

using 73 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[2^3, 3, 4, 6, 10, 11, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2087 = TGTGGTACATATACCG-1

using 54 reads

====================================================================================

graph has 60 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2, 3^2, 4^2, 5, 6, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2091 = TGTGGTACATGCATGT-1

using 609 reads

====================================================================================

graph has 242 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 4, 5, 220, 372]
surviving nonsolo ucounts = 2[220, 372]
ids = [7, 5]

====================================================================================

UMI info for barcode TGTGGTACATGCATGT-1 contig 1 = AGTGACTCCT...
umi TATGACTGGT = 201 reads: +415 validated

UMI info for barcode TGTGGTACATGCATGT-1 contig 2 = GGGAGTCTCA...
umi CCTGGGCATT = 377 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=502]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=7)
387-435 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
435-502 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAHCTSIDYLVYW at 365, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 20, 64, 243, 246, 326, 335
confident = false

TIG 2[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQTYSTPPDTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2102 = TGTGGTAGTACAGTGG-1

using 27 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^3, 3^3, 4, 5]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2107 = TGTGGTAGTATAATGG-1

using 246 reads

====================================================================================

graph has 153 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^4, 3, 4, 38, 186]
surviving nonsolo ucounts = 1[186]
ids = [9]

====================================================================================

UMI info for barcode TGTGGTAGTATAATGG-1 contig 1 = AAAAACCACA...
umi CTGTGGGTAA = 167 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=516]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-516 ==> 0-30 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2116 = TGTGGTAGTCCTAGCG-1

using 702 reads

====================================================================================

graph has 356 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 149, 549]
surviving nonsolo ucounts = 2[149, 549]
ids = [1, 0]

====================================================================================

UMI info for barcode TGTGGTAGTCCTAGCG-1 contig 1 = GAAGAGCTGC...
umi CACTTACCAC = 550 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CQQYGSSPWTF at 357, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 540
start codons at 33, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2120 = TGTGGTAGTCTCGTTC-1

using 419 reads

====================================================================================

graph has 190 edges initially, 34 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 188, 221]
surviving nonsolo ucounts = 2[188, 221]
ids = [0, 3]

====================================================================================

UMI info for barcode TGTGGTAGTCTCGTTC-1 contig 1 = AGCTTCAGCT...
umi ACTTTGGAGC = 180 reads: +391 validated

UMI info for barcode TGTGGTAGTCTCGTTC-1 contig 2 = GGGGTCTCAG...
umi GATTTTGGTC = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
438-560 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDSLNGSYVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 47, 351, 376, 381, 393, 402
confident = false

TIG 2[bases=551]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-551 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2122 = TGTGGTAGTGAGGCTA-1

using 131 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4^3, 115]
surviving nonsolo ucounts = 1[115]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2123 = TGTGGTAGTGATGCCC-1

using 287 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 4[3, 4, 6, 262]
surviving nonsolo ucounts = 1[262]
ids = [11]

====================================================================================

UMI info for barcode TGTGGTAGTGATGCCC-1 contig 1 = GAGGAATCAG...
umi TCGGTCTGGA = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=485]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-485 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2135 = TGTGGTAGTTTAGGAA-1

using 113 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2139 = TGTGGTATCAAAGACA-1

using 414 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 9[2^2, 3^3, 6, 7, 10, 365]
surviving nonsolo ucounts = 1[365]
ids = [1]

====================================================================================

UMI info for barcode TGTGGTATCAAAGACA-1 contig 1 = GGGGAGGAAC...
umi AGCATACCGT = 307 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-502 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNNWPLLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2142 = TGTGGTATCACATACG-1

using 85 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 11[2, 3, 4^2, 5, 6, 7^3, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2143 = TGTGGTATCACCAGGC-1

using 22 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2147 = TGTGGTATCAGATAAG-1

using 134 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 123]
surviving nonsolo ucounts = 1[123]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2162 = TGTGGTATCCTCCTAG-1

using 370 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 9[2^4, 3, 4, 5, 7, 332]
surviving nonsolo ucounts = 1[332]
ids = [1]

====================================================================================

UMI info for barcode TGTGGTATCCTCCTAG-1 contig 1 = GGGGAGGAAC...
umi ACATTGTGTG = 336 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNPITF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 36, 105, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2169 = TGTGGTATCGCATGGC-1

using 193 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^4, 3, 6, 175]
surviving nonsolo ucounts = 1[175]
ids = [3]

====================================================================================

UMI info for barcode TGTGGTATCGCATGGC-1 contig 1 = GACCCAGAGG...
umi AGCGGGATGA = 160 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=490]
15-360 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
359-397 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
397-490 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQRRTWPPAF at 336, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 15, 64, 220, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2170 = TGTGGTATCGCTTGTC-1

using 331 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 35
nonsolo ucounts = 12[2^4, 3^2, 4^3, 6, 7, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode TGTGGTATCGCTTGTC-1 contig 1 = GGGAGGAATC...
umi AGACCGTGAC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQHNSYPPTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 30, 36, 105, 187, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2172 = TGTGGTATCGTTGACA-1

using 26 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2173 = TGTGGTATCTAACGGT-1

using 282 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 273]
surviving nonsolo ucounts = 1[273]
ids = [2]

====================================================================================

UMI info for barcode TGTGGTATCTAACGGT-1 contig 1 = GTGGGCTCAG...
umi ACGGGTCCAG = 260 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=578]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
417-578 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CYSTDSSGNHRVF at 350, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2179 = TGTGGTATCTCATTCA-1

using 271 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 6, 8, 247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode TGTGGTATCTCATTCA-1 contig 1 = TGGGGGTCAG...
umi ACTACTACGG = 220 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=511]
34-282 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=35)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-511 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLHYDNRRRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 34, 90, 103, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2196 = TGTGTTTAGATGCCTT-1

using 1207 reads

====================================================================================

graph has 1821 edges initially, 8 edges after simplification

total ucounts = 569
nonsolo ucounts = 244[2^96, 3^56, 4^34, 5^25, 6^11, 7^8, 8^6, 9^2, 10^2, 11, 12^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2197 = TGTGTTTAGCAAATCA-1

using 134 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^4, 3, 120]
surviving nonsolo ucounts = 1[120]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2203 = TGTGTTTAGCGGATCA-1

using 2141 reads

====================================================================================

graph has 2680 edges initially, 24 edges after simplification

total ucounts = 789
nonsolo ucounts = 365[2^145, 3^76, 4^62, 5^27, 6^22, 7^10, 8^9, 9^3, 10, 11^2, 12^2, 13, 14, 16, 17, 156, 243]
surviving nonsolo ucounts = 2[156, 243]
ids = [341, 626]

====================================================================================

UMI info for barcode TGTGTTTAGCGGATCA-1 contig 1 = GAGGAACTGC...
umi TCATCCTTTG = 229 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-508 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPPLTF at 354, score = 9 + 9
umis assigned: [626]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 33, 238, 241, 460
confident = false

REJECT CONTIGS

TIG 1[bases=548]
10-303 ==> 44-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=2)
299-337 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
337-548 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [341]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 85, 114, 165, 264
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2207 = TGTGTTTAGCTGCGAA-1

using 8759 reads

====================================================================================

graph has 3640 edges initially, 32 edges after simplification

total ucounts = 557
nonsolo ucounts = 240[2^80, 3^46, 4^25, 5^22, 6^7, 7^10, 8^3, 9, 10, 11, 12^5, 14, 16, 29, 45, 71, 101, 146, 158, 173, 174, 188, 189, 191, 197, 200, 201, 204, 213, 214, 217^2, 219, 220, 222, 225, 230, 233^2, 234, 242, 243, 248, 250, 269, 279, 283, 294, 300, 326]
surviving nonsolo ucounts = 36[45, 71, 101, 146, 158, 173, 174, 188, 189, 191, 197, 200, 201, 204, 213, 214, 217^2, 219, 220, 222, 225, 230, 233^2, 234, 242, 243, 248, 250, 269, 279, 283, 294, 300, 326]
ids = [297, 263, 128, 293, 214, 372, 380, 314, 312, 13, ...]

====================================================================================

UMI info for barcode TGTGTTTAGCTGCGAA-1 contig 1 = ATCACATAAC...
umi AACTTTCCTT = 241 reads: +430 validated
umi AGTGGGAGCA = 290 reads: +430 validated
umi CCTGAGGGGA = 152 reads: +430 validated
umi CTTGGTGTTT = 40 reads: +344 -41 +45 non-validated

UMI info for barcode TGTGTTTAGCTGCGAA-1 contig 2 = GGGGGGCTGG...
umi AAACGACAGT = 236 reads: +388 validated
umi AAAGATACGA = 218 reads: +388 validated
umi AACCAGGTCA = 189 reads: +388 validated
umi AAGCGCTTAG = 207 reads: +388 validated
umi ACATTTCTCC = 202 reads: +388 validated
umi ACCAGCTTTT = 247 reads: +388 validated
umi ACGAGTCTCT = 193 reads: +388 validated
umi ACTGGATCTT = 224 reads: +388 validated
umi ATATACTGCT = 242 reads: +388 validated
umi ATTTCTCGGA = 104 reads: +388 validated
umi CACATGAGGA = 222 reads: +189 -2XX +197 invalidated
umi CCAGATCCGC = 251 reads: +388 validated
umi CCGCCGGCTA = 201 reads: +388 validated
umi CGCTTAACCG = 294 reads: +388 validated
umi CTCACTTACA = 71 reads: +388 validated
umi CTTAATGGCT = 145 reads: +388 validated
umi GACGACCCTC = 190 reads: +388 validated
umi GACTATTCGA = 189 reads: +388 validated
umi GATTGGGCAC = 229 reads: +388 validated
umi GGGGGTTAGA = 238 reads: +388 validated
umi GGTCCTTGCT = 222 reads: +388 validated
umi GTGAATCTAC = 176 reads: +388 validated
umi TAACTCGGCG = 216 reads: +388 validated
umi TGAATCACCT = 212 reads: +388 validated
umi TGCGTTCAGG = 241 reads: +388 validated
umi TTTGCCGTCG = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=2)
439-488 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
488-509 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 67 reads
cdr3 = CARGALGGRGSSWYGMDVW at 400, score = 9 + 7
umis assigned: [16, 93, 214, 297]
of which 4 are surviving nonsolos
reads assigned: 712
start codons at 58, 209, 256, 355, 445
confident = true

TIG 2[bases=645]
46-394 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 26 umis using 875 reads
cdr3 = CSSYTSSSSYVF at 370, score = 8 + 8
umis assigned: [3, 5, 13, 21, 47, 50, 60, 69, 103, 128] and 16 others
of which 26 are surviving nonsolos
reads assigned: 5300
start codons at 46, 203, 247, 254, 257, 398, 566
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-79 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-394 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [35, 86, 102, 164, 380, 439]
of which 6 are surviving nonsolos
reads assigned: 1461
start codons at 34, 67, 103, 191, 353, 373, 471
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGGGGAGCTTTAGGGGGACGTGGCAGCAGCTGGTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCTCTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2210 = TGTGTTTAGGACGAAA-1

using 17 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2222 = TGTGTTTAGTGTCCCG-1

using 114 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[113]
surviving nonsolo ucounts = 1[113]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=346]
4-173 ==> 176-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
173-210 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
210-346 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWPPTF at 149, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 33, 36, 252
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2231 = TGTGTTTCAAAGTCAA-1

using 472 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 217, 243]
surviving nonsolo ucounts = 2[217, 243]
ids = [1, 0]

====================================================================================

UMI info for barcode TGTGTTTCAAAGTCAA-1 contig 1 = GGGGGCTGGG...
umi ATCCCTTTGA = 237 reads: +388 validated
umi CATCATATCT = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=587]
45-397 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=14)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
433-587 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 73 reads
cdr3 = CSSYTSSSTRVF at 369, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 438
start codons at 45, 202, 253, 256, 565
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2234 = TGTGTTTCAAGACGTG-1

using 939 reads

====================================================================================

graph has 1152 edges initially, 32 edges after simplification

total ucounts = 460
nonsolo ucounts = 191[2^84, 3^33, 4^28, 5^18, 6^13, 7^7, 8^5, 9, 10, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2240 = TGTGTTTCACAAGCCC-1

using 275 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[5, 263]
surviving nonsolo ucounts = 1[263]
ids = [8]

====================================================================================

UMI info for barcode TGTGTTTCACAAGCCC-1 contig 1 = GCTCTGCCTC...
umi TTGTCATCCA = 260 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2248 = TGTGTTTCACGTGAGA-1

using 101 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 92]
surviving nonsolo ucounts = 1[92]
ids = [0]

====================================================================================

UMI info for barcode TGTGTTTCACGTGAGA-1 contig 1 = GAGGAGCCCC...
umi CTTTGTAGCC = 87 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=498]
0-70 ==> 10-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
70-425 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
479-498 ==> 0-19 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CAKDNEGAFDIW at 412, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 70, 215, 221, 226, 305, 373, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2265 = TGTGTTTCATCTCGCT-1

using 499 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 8, 127, 361]
surviving nonsolo ucounts = 2[127, 361]
ids = [2, 0]

====================================================================================

UMI info for barcode TGTGTTTCATCTCGCT-1 contig 1 = AGGAGTCAGT...
umi AAGAACTCGT = 354 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2276 = TGTGTTTGTCAAAGAT-1

using 278 reads

====================================================================================

graph has 106 edges initially, 16 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 24, 246]
surviving nonsolo ucounts = 2[24, 246]
ids = [3, 4]

====================================================================================

UMI info for barcode TGTGTTTGTCAAAGAT-1 contig 1 = AGTCTCAGTC...
umi TAAAAATACG = 13 reads: +37 -7 +8 -1X +14 -1X +4 -2X +20 -2X +2 -1X +1 -3 +5 -2X +20 -1X +3 -1X +3 -3X +6 -1X +10 -22X +18 -1X +24 -1X +69 -2XX +1 -1XX +5 -2XX +19 -1X +3 -61 invalidated
umi TAGCTTGACC = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-482 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYSTPLTF at 347, score = 9 + 9
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 237
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2282 = TGTGTTTGTCATCCCT-1

using 132 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 5, 6, 115]
surviving nonsolo ucounts = 1[115]
ids = [0]

====================================================================================

UMI info for barcode TGTGTTTGTCATCCCT-1 contig 1 = GAGTCAGTCC...
umi ATTCATTCAT = 105 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-490 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYDDLPITF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2287 = TGTGTTTGTCCGTGAC-1

using 97 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[96]
surviving nonsolo ucounts = 1[96]
ids = [1]

====================================================================================

UMI info for barcode TGTGTTTGTCCGTGAC-1 contig 1 = CTCCTTGGGA...
umi CTGCCGCCTC = 94 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=501]
0-37 ==> 22-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
37-390 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
439-473 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
473-501 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 379, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 37, 235, 240, 257, 301, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2293 = TGTGTTTGTGAACCTT-1

using 446 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 435]
surviving nonsolo ucounts = 1[435]
ids = [3]

====================================================================================

UMI info for barcode TGTGTTTGTGAACCTT-1 contig 1 = GCTCTGCTTC...
umi AGTGCGGGGT = 418 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=567]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-567 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2297 = TGTGTTTGTGGTACAG-1

using 211 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode TGTGTTTGTGGTACAG-1 contig 1 = AGGAGTCAGT...
umi CAGGCACTCT = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2303 = TGTGTTTGTTGCCTCT-1

using 307 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode TGTGTTTGTTGCCTCT-1 contig 1 = AGGAGTCAGT...
umi AAACGGCTCT = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-497 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYERPPCSF at 354, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2315 = TGTGTTTTCAGGCGAA-1

using 13 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2318 = TGTGTTTTCAGTTGAC-1

using 1663 reads

====================================================================================

graph has 368 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2, 3, 4, 5, 6, 7^2, 10^2, 15, 1591]
surviving nonsolo ucounts = 1[1591]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2324 = TGTGTTTTCCGATATG-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2329 = TGTGTTTTCGCGGATC-1

using 282 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 279]
surviving nonsolo ucounts = 1[279]
ids = [1]

====================================================================================

UMI info for barcode TGTGTTTTCGCGGATC-1 contig 1 = GAAGAGCTGC...
umi CCCGCCCTTC = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-495 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2330 = TGTGTTTTCGCTTGTC-1

using 259 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 35, 214]
surviving nonsolo ucounts = 1[214]
ids = [2]

====================================================================================

UMI info for barcode TGTGTTTTCGCTTGTC-1 contig 1 = GGAACTGCTC...
umi ACTCGTGCTT = 208 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-507 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPLTF at 352, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 31, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2345 = TGTGTTTTCTTTCCTC-1

using 425 reads

====================================================================================

graph has 172 edges initially, 30 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 149, 271]
surviving nonsolo ucounts = 2[149, 271]
ids = [0, 4]

====================================================================================

UMI info for barcode TGTGTTTTCTTTCCTC-1 contig 1 = ATCACCCAAA...
umi CAAGCCCCTA = 142 reads: +436 validated

UMI info for barcode TGTGTTTTCTTTCCTC-1 contig 2 = ATCACCCAGC...
umi TGTTGCGCTT = 249 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=536]
0-57 ==> 2-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
57-410 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
459-493 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
493-536 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 399, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 57, 255, 260, 277, 321, 354
confident = false

TIG 2[bases=525]
0-58 ==> 6-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
58-411 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
482-525 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARSLVSYSSSWIFDYW at 400, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 58, 256, 261, 293, 322, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2347 = TGTTCCGAGAATGTGT-1

using 327 reads

====================================================================================

graph has 177 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^2, 3, 4, 5, 7, 302]
surviving nonsolo ucounts = 1[302]
ids = [3]

====================================================================================

UMI info for barcode TGTTCCGAGAATGTGT-1 contig 1 = CTGGGCCTCA...
umi CGCCCCTATT = 282 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=563]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-92 ==> 0-55 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
92-380 ==> 58-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-563 ==> 0-150 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQAWDSSTAVVF at 349, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 37, 42, 95, 182, 328, 332
confident = false
see deletion of 3 bases at pos 55 on |349|IGLV3-1|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2348 = TGTTCCGAGACAAGCC-1

using 611 reads

====================================================================================

graph has 208 edges initially, 36 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 10, 294, 301]
surviving nonsolo ucounts = 2[294, 301]
ids = [1, 2]

====================================================================================

UMI info for barcode TGTTCCGAGACAAGCC-1 contig 1 = GAGGAATCAG...
umi CGAAGAGCCT = 301 reads: +388 validated

UMI info for barcode TGTTCCGAGACAAGCC-1 contig 2 = TGGGGGAGTC...
umi CCGTGAGGCA = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2349 = TGTTCCGAGAGACTAT-1

using 29 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2356 = TGTTCCGAGCCGATTT-1

using 261 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGAGCCGATTT-1 contig 1 = GCTCTGCTTC...
umi ACGCCTACCT = 235 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-579 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2364 = TGTTCCGAGCTAGCCC-1

using 236 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGAGCTAGCCC-1 contig 1 = GGAGTCAGAC...
umi AACGAGCCTT = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=470]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-470 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2368 = TGTTCCGAGCTGTCTA-1

using 548 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 538]
surviving nonsolo ucounts = 1[538]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=376]
0-79 ==> 0-79 on |156|IGHV3-7|5'UTR| [len=79] (mis=1)
47-118 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=4)
79-238 ==> 0-159 on |157|IGHV3-7|L-REGION+V-REGION| [len=351] (mis=1)
257-305 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
305-376 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 533
start codons at 79, 235
confident = false
full length transcript of length 376
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2370 = TGTTCCGAGGACTGGT-1

using 229 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi GTATTTCGTC = 227 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-547 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 32 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2375 = TGTTCCGAGTACGTAA-1

using 1136 reads

====================================================================================

graph has 290 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 96, 313, 725]
surviving nonsolo ucounts = 3[96, 313, 725]
ids = [0, 3, 2]

====================================================================================

UMI info for barcode TGTTCCGAGTACGTAA-1 contig 1 = GGAGAAGAGC...
umi GGGCCATCCA = 726 reads: +385 validated

UMI info for barcode TGTTCCGAGTACGTAA-1 contig 2 = TATATGTGGA...
umi AGAGCTGCCT = 94 reads: +3 -1 +2 -1 +381 non-validated
umi TTGGTCGCTA = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 120 reads
cdr3 = CQQYGSSPVTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 720
start codons at 36, 244, 247, 370, 463
confident = true

TIG 2[bases=560]
36-387 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
386-424 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CLQYSSSPWTF at 363, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 404
start codons at 3, 36, 42, 111, 247, 466
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2376 = TGTTCCGAGTACTTGC-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2383 = TGTTCCGCAAACGCGA-1

using 265 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 6, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode TGTTCCGCAAACGCGA-1 contig 1 = CTTTCTGAGA...
umi CAGCCTGGGC = 246 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=569]
13-384 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
393-424 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=7)
417-467 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=5)
467-569 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARVARIPDCSGGSCYPIDIW at 373, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 13, 34, 78, 164, 448, 485, 546
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2395 = TGTTCCGCACGGCGTT-1

using 342 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 333]
surviving nonsolo ucounts = 1[333]
ids = [2]

====================================================================================

UMI info for barcode TGTTCCGCACGGCGTT-1 contig 1 = GGTAAGAAAT...
umi CAGTTACACT = 330 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=662]
0-54 ==> 6-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
54-413 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=20)
413-451 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
451-662 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQTWGAGIEVVF at 387, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 54, 255, 268, 271, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2398 = TGTTCCGCACGTCTCT-1

using 617 reads

====================================================================================

graph has 788 edges initially, 14 edges after simplification

total ucounts = 343
nonsolo ucounts = 122[2^60, 3^23, 4^19, 5^11, 6^2, 7, 8, 9^3, 10, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2402 = TGTTCCGCAGACGCTC-1

using 104 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[98]
surviving nonsolo ucounts = 1[98]
ids = [4]

====================================================================================

UMI info for barcode TGTTCCGCAGACGCTC-1 contig 1 = AGTCTGGGCC...
umi GAATTCGACT = 86 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=519]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-519 ==> 0-97 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2405 = TGTTCCGCAGCGTCCA-1

using 316 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[314]
surviving nonsolo ucounts = 1[314]
ids = [1]

====================================================================================

UMI info for barcode TGTTCCGCAGCGTCCA-1 contig 1 = GATCAGGACT...
umi CAGATTCGGT = 301 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=517]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
424-517 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQGTHSVTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 30, 63, 91, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2419 = TGTTCCGGTAAGGATT-1

using 1313 reads

====================================================================================

graph has 1216 edges initially, 10 edges after simplification

total ucounts = 446
nonsolo ucounts = 201[2^80, 3^54, 4^22, 5^21, 6^11, 7^4, 8^3, 9^3, 10, 17, 381]
surviving nonsolo ucounts = 1[381]
ids = [300]

====================================================================================

UMI info for barcode TGTTCCGGTAAGGATT-1 contig 1 = GTCAGTCTCA...
umi GTATAAGCTG = 384 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [300]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2420 = TGTTCCGGTAAGTTCC-1

using 1093 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[1092]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2421 = TGTTCCGGTAATCGTC-1

using 635 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[634]
surviving nonsolo ucounts = 1[634]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2445 = TGTTCCGGTGGGTCAA-1

using 48 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[48]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2447 = TGTTCCGGTTCCCTTG-1

using 255 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGGTTCCCTTG-1 contig 1 = ACCCAAAAAC...
umi TTAACATTCC = 251 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=568]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-568 ==> 0-105 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2448 = TGTTCCGGTTCCGGCA-1

using 341 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 329]
surviving nonsolo ucounts = 1[329]
ids = [4]

====================================================================================

UMI info for barcode TGTTCCGGTTCCGGCA-1 contig 1 = GGAATCAGTC...
umi GCGTTCATTC = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2452 = TGTTCCGTCAACTCTT-1

using 703 reads

====================================================================================

graph has 244 edges initially, 50 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 156, 232, 308]
surviving nonsolo ucounts = 3[156, 232, 308]
ids = [4, 2, 1]

====================================================================================

UMI info for barcode TGTTCCGTCAACTCTT-1 contig 1 = AGTGACTCCT...
umi CAACTTCGTC = 153 reads: +433 validated

UMI info for barcode TGTTCCGTCAACTCTT-1 contig 2 = GCTCTGCTTC...
umi ATGGTATCCG = 227 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=563]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-370 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
401-453 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
453-563 ==> 0-110 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 365, score = 8 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 20, 64, 243, 326
confident = false

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
407-445 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
445-656 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CQSYDSSLSGSGVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 51, 205, 208, 259, 358, 385
confident = false

REJECT CONTIGS

TIG 1[bases=648]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
437-648 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=1)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 47, 351, 376, 381, 393
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2456 = TGTTCCGTCACGACTA-1

using 38 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 4, 5, 18]
surviving nonsolo ucounts = 1[18]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2458 = TGTTCCGTCAGAGCTT-1

using 274 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 4, 6, 7, 251]
surviving nonsolo ucounts = 1[251]
ids = [6]

====================================================================================

UMI info for barcode TGTTCCGTCAGAGCTT-1 contig 1 = GAGAGAGGAG...
umi TTACAAACAG = 248 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=567]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-567 ==> 0-70 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2471 = TGTTCCGTCCGTAGTA-1

using 39 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 1[31]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=351]
0-305 ==> 29-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
309-347 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
cdr3 = CQAWDSTEVVF at 286, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 27
start codons at 265, 269
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2475 = TGTTCCGTCGAATCCA-1

using 265 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 255]
surviving nonsolo ucounts = 1[255]
ids = [1]

====================================================================================

UMI info for barcode TGTTCCGTCGAATCCA-1 contig 1 = AGGAGTCAGA...
umi ATCTTATGCG = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=448]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
418-448 ==> 0-30 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYLLYTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 89, 102, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2476 = TGTTCCGTCGAGCCCA-1

using 227 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGTCGAGCCCA-1 contig 1 = GGAGTCAGAC...
umi ATTATCCTAA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
414-499 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYNTYLFTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2481 = TGTTCCGTCGTTACGA-1

using 602 reads

====================================================================================

graph has 172 edges initially, 12 edges after simplification

total ucounts = 6
nonsolo ucounts = 6[2^2, 3, 14, 278, 303]
surviving nonsolo ucounts = 2[278, 303]
ids = [1, 0]

====================================================================================

UMI info for barcode TGTTCCGTCGTTACGA-1 contig 1 = GGAGAAGAGC...
umi ACAGTATCAT = 242 reads: +385 validated

UMI info for barcode TGTTCCGTCGTTACGA-1 contig 2 = GGGGAGTCTC...
umi AATACACACG = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-488 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPRTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 36, 240, 244, 370, 463
confident = false

TIG 2[bases=479]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-479 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2482 = TGTTCCGTCGTTGACA-1

using 219 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode TGTTCCGTCGTTGACA-1 contig 1 = AAAAACCACA...
umi AACCGCGGTG = 202 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=528]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-528 ==> 0-42 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2486 = TGTTCCGTCTCTTGAT-1

using 258 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 245]
surviving nonsolo ucounts = 1[245]
ids = [5]

====================================================================================

UMI info for barcode TGTTCCGTCTCTTGAT-1 contig 1 = GGAAATCAGT...
umi CTTATATTCT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-472 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2489 = TGTTCCGTCTTAGCCC-1

using 225 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 214]
surviving nonsolo ucounts = 1[214]
ids = [6]

====================================================================================

UMI info for barcode TGTTCCGTCTTAGCCC-1 contig 1 = ATCACATAAC...
umi GGTTGTGGTA = 215 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=556]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
443-506 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
506-556 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGGWATGTTGLEKGYYYYAMDVW at 400, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 58, 118, 209, 256, 293, 355, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2495 = TTAACTCAGACTGGGT-1

using 395 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 17, 371]
surviving nonsolo ucounts = 1[371]
ids = [4]

====================================================================================

UMI info for barcode TTAACTCAGACTGGGT-1 contig 1 = GGGAGTCTCA...
umi CCAACACTCT = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2502 = TTAACTCAGATGTCGG-1

using 275 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 271]
surviving nonsolo ucounts = 1[271]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2513 = TTAACTCAGGAATCGC-1

using 69 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 58]
surviving nonsolo ucounts = 1[58]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=426]
0-24 ==> 5788-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-366 ==> 0-328 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
cdr3 = CNSCRGSSTL at 362, score = 8 + 4
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 49
start codons at 38, 195, 239, 246, 249, 370
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2514 = TTAACTCAGGAATTAC-1

using 155 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

UMI info for barcode TTAACTCAGGAATTAC-1 contig 1 = ACCCAAAAAC...
umi TTCAAATCGT = 150 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=492]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2517 = TTAACTCAGGATCGCA-1

using 552 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[52, 495]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=335]
0-161 ==> 5839-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
161-199 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
199-335 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 486
start codons at 24, 29, 142, 241
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2521 = TTAACTCAGGCTAGAC-1

using 256 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 251]
surviving nonsolo ucounts = 1[251]
ids = [4]

====================================================================================

UMI info for barcode TTAACTCAGGCTAGAC-1 contig 1 = GGCACAAGAG...
umi TTTATCCATT = 253 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=545]
0-34 ==> 17-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
34-390 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
428-545 ==> 0-117 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 358, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 34, 188, 191, 242, 341, 368, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2524 = TTAACTCAGGGCTTGA-1

using 180 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[172]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TTAACTCAGGGCTTGA-1 contig 1 = GACTCAACAA...
umi CTTCCACACG = 154 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=463]
56-409 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=22)
416-462 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
junction support: 1 umis using 14 reads
cdr3 = CVRNSGLGDYW at 398, score = 8 + 7
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 154
start codons at 56, 207, 254, 259, 263, 291, 320, 353
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2545 = TTAACTCCAAGCGCTC-1

using 1008 reads

====================================================================================

graph has 1374 edges initially, 14 edges after simplification

total ucounts = 474
nonsolo ucounts = 192[2^74, 3^41, 4^26, 5^14, 6^18, 7^7, 8^5, 9, 10, 11, 12, 13^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2556 = TTAACTCCACCAGCAC-1

using 338 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 330]
surviving nonsolo ucounts = 1[330]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=436]
7-27 ==> 5792-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=1)
33-88 ==> 5820-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=1)
41-379 ==> 0-338 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=16)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 41, 177, 249
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2558 = TTAACTCCACGGTAGA-1

using 20037 reads

====================================================================================

graph has 5856 edges initially, 30 edges after simplification

total ucounts = 501
nonsolo ucounts = 244[2^78, 3^34, 4^21, 5^11, 6^10, 7^8, 8^3, 9^2, 10, 11^2, 14^2, 16, 30, 37, 43, 67, 77, 94, 112, 123, 124, 125, 128, 139, 150, 151, 159, 160, 168, 179, 200, 203^2, 209, 210^2, 221, 224, 225, 235, 243, 245, 246, 254, 258, 259, 262, 274, 276, 288, 291, 293, 295, 297, 298, 301, 307, 309, 310, 312, 314, 316^2, 325^2, 330, 335, 339, 342, 350, 353, 360, 361, 372, 373, 379^2, 386, 431, 449, 554, 676, 960]
surviving nonsolo ucounts = 68[30, 37, 67, 94, 123, 124, 125, 128, 139, 150, 151, 159, 160, 168, 179, 200, 203^2, 209, 210^2, 221, 224, 225, 235, 243, 245, 246, 254, 258, 259, 262, 274, 276, 288, 291, 293, 295, 297, 298, 301, 307, 309, 310, 312, 314, 316^2, 325^2, 330, 335, 339, 342, 350, 353, 360, 361, 372, 373, 379^2, 386, 431, 449, 554, 676, 960]
ids = [366, 283, 119, 491, 188, 103, 204, 100, 117, 172, ...]

====================================================================================

UMI info for barcode TTAACTCCACGGTAGA-1 contig 1 = GGGAGAGCCC...
umi AACCGATGTT = 377 reads: +382 validated
umi AACGCATATG = 340 reads: +382 validated
umi AACTGGATAT = 318 reads: +382 validated
umi ACATTACCAT = 219 reads: +382 validated
umi ACGTTAATCG = 316 reads: +382 validated
umi AGTGATGATC = 256 reads: +382 validated
umi ATCGTAACAC = 309 reads: +382 validated
umi ATCTATAGTC = 272 reads: +382 validated
umi CAAGATTAAG = 274 reads: +382 validated
umi CAAGTCACAG = 231 reads: +382 validated
umi CAATAAGGTT = 308 reads: +382 validated
umi CACATGCAGC = 216 reads: +382 validated
umi CAGGTGAAGC = 167 reads: +382 validated
umi CAGTTGTAGG = 375 reads: +382 validated
umi CATAGCCTCT = 127 reads: -334 +29 -7 +1 -1 +10 non-validated
umi CATTATATTT = 377 reads: +382 validated
umi CCACCCTCCG = 323 reads: +382 validated
umi CCACTGGGCT = 136 reads: +382 validated
umi CCGGAAATCC = 161 reads: +13 -5 +364 non-validated
umi CCGGAACTTC = 294 reads: +382 validated
umi CCTGCCTTCT = 210 reads: +382 validated
umi CGGTTGATCG = 146 reads: +382 validated
umi CTCCTTAACC = 421 reads: +382 validated
umi CTCTAAGGGC = 357 reads: +382 validated
umi CTGATACCCT = 327 reads: +382 validated
umi CTGGTACGTA = 353 reads: +382 validated
umi CTTAACCCGT = 251 reads: +382 validated
umi CTTAGCGGGG = 123 reads: +382 validated
umi CTTCATCGGA = 452 reads: +382 validated
umi GATAGAACCT = 378 reads: +382 validated
umi GCTGAGCCTG = 290 reads: +382 validated
umi GCTTATCTGC = 348 reads: +382 validated
umi GGATGCGATC = 311 reads: +382 validated
umi GGCGTTCTCT = 253 reads: +382 validated
umi GGGGCTACTG = 676 reads: +382 validated
umi GTTATATGTG = 334 reads: +382 validated
umi TATACAATTC = 380 reads: +382 validated
umi TCAAACCTGT = 299 reads: +382 validated
umi TCTCGTCTGT = 330 reads: +382 validated
umi TCTTTACTAA = 297 reads: +382 validated
umi TCTTTGCGCA = 325 reads: +382 validated
umi TGACCGATCG = 291 reads: +382 validated
umi TGCGGGTAGT = 350 reads: +382 validated
umi TGCTAATTCT = 209 reads: +382 validated
umi TGTTCCAGCG = 320 reads: +382 validated
umi TTAAATAGTA = 367 reads: +382 validated
umi TTCCCGTGGC = 259 reads: +382 validated
umi TTCGCTCTAC = 298 reads: +382 validated
umi TTCGTCATCC = 245 reads: +382 validated
umi TTGAAAGGGC = 200 reads: +382 validated
umi TTTTCAGCGG = 200 reads: +382 validated

UMI info for barcode TTAACTCCACGGTAGA-1 contig 2 = GAGCTCTGGG...
umi AGCGCTCCCG = 226 reads: +433 validated
umi AGTTCGCTAC = 150 reads: +334 -4 +95 non-validated
umi ATCCCACCGA = 228 reads: +431 -1X +1 invalidated
umi CATAGGTTAT = 125 reads: +433 validated
umi CATGGAATAG = 161 reads: +433 validated
umi CCAGCATGGT = 68 reads: +422 -11 non-validated
umi CGTACGAGCG = 558 reads: +267 -1XX +3 -7XX +1 -1XX +2 -7XX +1 -131XX +1 -4X +1 -5XX +1 invalidated
umi CGTATGCAGC = 307 reads: +34 -2X +1 -7X +1 -1XX +379 -8 invalidated
umi CGTTGTAGGC = 262 reads: +417 -16 non-validated
umi CTATTTATGC = 123 reads: +297 -1 +135 non-validated
umi GCATGATTCA = 205 reads: +433 validated
umi GGAGTTCGGT = 246 reads: +433 validated
umi GGGAGCGTCA = 37 reads: +397 -36 non-validated
umi TATAACCGAT = 183 reads: +433 validated
umi TCAGATATTG = 30 reads: +269 -2 +1 -1 +2 -1 +66 -91 non-validated
umi TTTGTTTCAC = 96 reads: +357 -48 +4 -1 +23 non-validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=6)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 50 umis using 2418 reads
cdr3 = CQHRRNWPITF at 368, score = 9 + 8
umis assigned: [2, 3, 4, 9, 13, 35, 51, 52, 76, 77] and 41 others
of which 51 are surviving nonsolos
reads assigned: 14785
start codons at 47, 255, 471
confident = true

TIG 2[bases=584]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=10)
462-513 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 76 reads
cdr3 = CARDKDGVQYSSSWRWFDPW at 422, score = 8 + 7
umis assigned: [27, 36, 47, 103, 108, 119, 173, 174, 177, 188] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2941
start codons at 80, 231, 236, 289, 297, 315, 368, 383
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGAGATAAGGACGGGGTTCAATATAGCAGCAGCTGGAGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCACCGTAGGAACTGGCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2568 = TTAACTCCAGCTTCGG-1

using 205 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 196]
surviving nonsolo ucounts = 1[196]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=435]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
0-20 ==> 1300-1320 on rc of segment before IGHVIII-5-1 exon 1 [len=1320] (mis=0)
0-20 ==> 7558-7578 on rc of segment before IGHVIII-26-1 exon 1 [len=7578] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-434 ==> 0-31 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2581 = TTAACTCCATGATCCA-1

using 299 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 290]
surviving nonsolo ucounts = 1[290]
ids = [4]

====================================================================================

UMI info for barcode TTAACTCCATGATCCA-1 contig 1 = AGTCAGTCTC...
umi GTAGGTCCGG = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-504 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQGYSIPLTF at 351, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 24, 30, 86, 235, 289, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2586 = TTAACTCCATTCTTAC-1

using 236 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode TTAACTCCATTCTTAC-1 contig 1 = GGAGTCAGAC...
umi GAGGTGTTCA = 227 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2600 = TTAACTCGTCTCGTTC-1

using 562 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 5, 229, 325]
surviving nonsolo ucounts = 2[229, 325]
ids = [4, 3]

====================================================================================

UMI info for barcode TTAACTCGTCTCGTTC-1 contig 1 = ATCACCCAGC...
umi TATCACCCTC = 332 reads: +433 validated

UMI info for barcode TTAACTCGTCTCGTTC-1 contig 2 = AGTCCCACTC...
umi TTTACCATTG = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-58 ==> 6-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
58-411 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
413-444 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=6)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARAPDIVVVPAAWGEFDYW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 58, 214, 256, 261, 293, 322, 355
confident = false

TIG 2[bases=422]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 20, 26, 95, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2605 = TTAACTCGTGGTAACG-1

using 1196 reads

====================================================================================

graph has 578 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^2, 6, 218, 242, 248, 471]
surviving nonsolo ucounts = 4[218, 242, 248, 471]
ids = [2, 10, 4, 1]

====================================================================================

UMI info for barcode TTAACTCGTGGTAACG-1 contig 1 = ATGGGGGAGA...
umi AGCCGGGCTT = 473 reads: -223 +201 non-validated
umi AGCTACTTAT = 213 reads: +424 validated
umi ATAGGGCTTC = 252 reads: +424 validated
umi TAACACGTGA = 247 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=685]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=5)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-685 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 4 umis using 203 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 2, 4, 10]
of which 4 are surviving nonsolos
reads assigned: 1156
start codons at 0, 79, 230, 235, 382, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2608 = TTAACTCGTGTTCTTT-1

using 4684 reads

====================================================================================

graph has 6732 edges initially, 82 edges after simplification

total ucounts = 2421
nonsolo ucounts = 934[2^430, 3^190, 4^123, 5^74, 6^50, 7^21, 8^19, 9^9, 10^4, 11^4, 12^2, 13^3, 14^2, 15, 17^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2610 = TTAACTCGTTCAACCA-1

using 267 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode TTAACTCGTTCAACCA-1 contig 1 = AAAAACCACA...
umi CCGCGACTCT = 261 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=581]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-581 ==> 0-95 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2611 = TTAACTCGTTCACCTC-1

using 227 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 5, 216]
surviving nonsolo ucounts = 1[216]
ids = [3]

====================================================================================

UMI info for barcode TTAACTCGTTCACCTC-1 contig 1 = GGGGGTCTCA...
umi GTTCGTAACC = 204 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=576]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-576 ==> 0-146 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYTSSSTNWVF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 39, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2620 = TTAACTCGTTGTCGCG-1

using 840 reads

====================================================================================

graph has 254 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 91, 262, 480]
surviving nonsolo ucounts = 2[262, 480]
ids = [4, 2]

====================================================================================

UMI info for barcode TTAACTCGTTGTCGCG-1 contig 1 = GGGAATCAGT...
umi CCACCTAGGG = 479 reads: +388 validated
umi CGGATTATGG = 50 reads: +22 -1XX +25 -1XX +12 -2XX +26 -1XX +3 -1XX +16 -1XX +10 -25 +1 -3X +4 -2XX +1 -5XX +2 -1XX +1 -1XX +5 -1XX +8 -1XX +20 -1XX +3 -1XX +3 -1XX +3 -1XX +2 -2XX +39 -2XX +27 -1XX +20 -1XX +8 -1XX +11 -1XX +1 -1X +7 -2X +1 -19 +2 -2X +15 -1X +4 -1X +2 invalidated
umi TATCTTCGCT = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 122 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2, 3, 4]
of which 2 are surviving nonsolos
reads assigned: 779
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2626 = TTAACTCTCACCGTAA-1

using 1340 reads

====================================================================================

graph has 1996 edges initially, 22 edges after simplification

total ucounts = 575
nonsolo ucounts = 268[2^105, 3^62, 4^35, 5^20, 6^15, 7^11, 8^7, 9^6, 10, 12^3, 14, 27, 33]
surviving nonsolo ucounts = 1[33]
ids = [21]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2632 = TTAACTCTCCAAAGTC-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2637 = TTAACTCTCCCTTGCA-1

using 540 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[538]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2658 = TTAACTCTCTGTCCGT-1

using 29 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 18]
surviving nonsolo ucounts = 1[18]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2659 = TTAACTCTCTTAGCCC-1

using 644 reads

====================================================================================

graph has 264 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 5, 6, 270, 353]
surviving nonsolo ucounts = 2[270, 353]
ids = [0, 2]

====================================================================================

UMI info for barcode TTAACTCTCTTAGCCC-1 contig 1 = GAGGAACTGC...
umi AAAGCACCGT = 253 reads: +388 validated

UMI info for barcode TTAACTCTCTTAGCCC-1 contig 2 = AGCTCTGAGA...
umi ACGTATCCTA = 336 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=471]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-471 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNNWPWGYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 33, 102, 238, 463
confident = false

TIG 2[bases=566]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
458-506 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
506-566 ==> 0-60 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARAPQPRIVGATHFDYW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 79, 235, 382, 524
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2660 = TTAACTCTCTTATCTG-1

using 325 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 8, 310]
surviving nonsolo ucounts = 1[310]
ids = [6]

====================================================================================

UMI info for barcode TTAACTCTCTTATCTG-1 contig 1 = GGAATCAGTC...
umi TTATTAGAGC = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 66 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2665 = TTAGGACAGACTAAGT-1

using 280 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 3^2, 4, 5^2, 252]
surviving nonsolo ucounts = 1[252]
ids = [9]

====================================================================================

UMI info for barcode TTAGGACAGACTAAGT-1 contig 1 = GAGAGAGGAG...
umi GGACGACCCT = 249 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=595]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-595 ==> 0-98 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2666 = TTAGGACAGAGCTTCT-1

using 271 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 7, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode TTAGGACAGAGCTTCT-1 contig 1 = CAGCTTCAGC...
umi GGCTGTGTTA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=647]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
436-647 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CASWDDSLRGRVF at 369, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 48, 202, 352, 377, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2668 = TTAGGACAGAGTGACC-1

using 306 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 7, 287]
surviving nonsolo ucounts = 1[287]
ids = [3]

====================================================================================

UMI info for barcode TTAGGACAGAGTGACC-1 contig 1 = AGTCTCAGTC...
umi GAATGGTTCG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYTTLLTF at 347, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2675 = TTAGGACAGCCAACAG-1

using 309 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 1[309]
ids = [0]

====================================================================================

UMI info for barcode TTAGGACAGCCAACAG-1 contig 1 = AGCTTCAGCT...
umi GTTGAACGTA = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=8)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
434-556 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CAARDDSLSGSVF at 367, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 46, 200, 350, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2676 = TTAGGACAGCCCAACC-1

using 1022 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 7, 9, 998]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2678 = TTAGGACAGCGATAGC-1

using 267 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3^2, 258]
surviving nonsolo ucounts = 1[258]
ids = [5]

====================================================================================

UMI info for barcode TTAGGACAGCGATAGC-1 contig 1 = GCTCTGCTTC...
umi GTAAGCGCAG = 256 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2682 = TTAGGACAGCTAGTGG-1

using 39 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3, 5, 6, 7, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2685 = TTAGGACAGGAATTAC-1

using 220 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3^2, 5, 6, 7, 190]
surviving nonsolo ucounts = 1[190]
ids = [4]

====================================================================================

UMI info for barcode TTAGGACAGGAATTAC-1 contig 1 = GAGATCACAG...
umi CAATTAGCTA = 170 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=569]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-569 ==> 0-114 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2694 = TTAGGACAGTAGCCGA-1

using 411 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 4, 5, 8, 10, 12, 367]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2708 = TTAGGACCACAGCCCA-1

using 211 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [2]

====================================================================================

UMI info for barcode TTAGGACCACAGCCCA-1 contig 1 = ATCAGTCCCA...
umi GTGCAGGGGG = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2712 = TTAGGACCACCATCCT-1

using 428 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[425]
surviving nonsolo ucounts = 1[425]
ids = [0]

====================================================================================

UMI info for barcode TTAGGACCACCATCCT-1 contig 1 = GAGCTCTGGG...
umi AAGTTCGCTA = 370 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=525]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=5)
455-504 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
504-525 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAKDSLGWFGEYGMDVW at 422, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 80, 231, 236, 294, 297, 315, 383, 442, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2715 = TTAGGACCACGGTGTC-1

using 271 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 260]
surviving nonsolo ucounts = 1[260]
ids = [6]

====================================================================================

UMI info for barcode TTAGGACCACGGTGTC-1 contig 1 = GGGCCTAAGG...
umi TCTTTCGGCA = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-35 ==> 216-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
35-386 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
423-562 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQVWDSSSDHPNYVF at 350, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 35, 96, 234, 237, 333, 387, 555
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2724 = TTAGGACCAGGCGATA-1

using 206 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [0]

====================================================================================

UMI info for barcode TTAGGACCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi ACAAGTGTCT = 191 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=498]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-498 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2731 = TTAGGACCATGCCCGA-1

using 353 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 346]
surviving nonsolo ucounts = 1[346]
ids = [2]

====================================================================================

UMI info for barcode TTAGGACCATGCCCGA-1 contig 1 = TGGGGGAGTC...
umi CTACCGCCAC = 298 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=501]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPSF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 30, 36, 92, 105, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2735 = TTAGGACGTAAGAGAG-1

using 653 reads

====================================================================================

graph has 286 edges initially, 34 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 265, 375]
surviving nonsolo ucounts = 2[265, 375]
ids = [0, 2]

====================================================================================

UMI info for barcode TTAGGACGTAAGAGAG-1 contig 1 = GGGCACTCAA...
umi CATCCGTCTA = 376 reads: +442 validated

UMI info for barcode TTAGGACGTAAGAGAG-1 contig 2 = TACAGAAGCC...
umi AACAATCTCC = 254 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=603]
59-412 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
438-501 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
501-603 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGFTQWLGIKLPYYYYGMDVW at 401, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 59, 210, 257, 262, 266, 294, 323, 356, 458, 519, 580
confident = false

TIG 2[bases=534]
0-32 ==> 272-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
32-385 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
414-462 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
462-534 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 374, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 32, 188, 230, 296, 329, 419, 516
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2740 = TTAGGACGTATATGGA-1

using 500 reads

====================================================================================

graph has 268 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 233, 261]
surviving nonsolo ucounts = 2[233, 261]
ids = [6, 3]

====================================================================================

UMI info for barcode TTAGGACGTATATGGA-1 contig 1 = AGCTCTGAGA...
umi CGGTTAGAAG = 264 reads: +424 validated

UMI info for barcode TTAGGACGTATATGGA-1 contig 2 = GATGCTTTCT...
umi TTCTTTCCTT = 213 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=615]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-615 ==> 0-112 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=578]
17-392 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=30)
412-465 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=4)
465-578 ==> 0-113 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CACLKKGNWGDWYFDLW at 383, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 1, 17, 26, 38, 82, 171, 519, 538
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2747 = TTAGGACGTCTGCGGT-1

using 79 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 77]
surviving nonsolo ucounts = 1[77]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=315]
0-278 ==> 73-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
277-315 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
cdr3 = CLQYSSSPWTF at 254, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 2, 138
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2750 = TTAGGACGTGCTAGCC-1

using 21 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2751 = TTAGGACGTGCTTCTC-1

using 224 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-32 ==> 5968-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
5-57 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
32-332 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 353, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 32, 237, 459
confident = false
not full
full length stopped transcript of length 553
frameshifted full length stopped transcript of length 553
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2752 = TTAGGACGTGGACGAT-1

using 399 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 391]
surviving nonsolo ucounts = 1[391]
ids = [0]

====================================================================================

UMI info for barcode TTAGGACGTGGACGAT-1 contig 1 = GGAGTCAGAC...
umi AGAAAACGAC = 390 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQYNSYPFTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2754 = TTAGGACGTGGGTCAA-1

using 73 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 4^2, 56]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2755 = TTAGGACGTGGTAACG-1

using 242 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode TTAGGACGTGGTAACG-1 contig 1 = GAGGAATCAG...
umi GCATGAGTGG = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-489 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2760 = TTAGGACGTTAGTGGG-1

using 1293 reads

====================================================================================

graph has 354 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[1293]
surviving nonsolo ucounts = 1[1293]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=362]
3-116 ==> 240-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
113-151 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
151-362 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CGAWDTSLSAWVF at 84, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 1278
start codons at 92
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2769 = TTAGGACTCACCGTAA-1

using 306 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3, 4, 8, 9, 273]
surviving nonsolo ucounts = 1[273]
ids = [4]

====================================================================================

UMI info for barcode TTAGGACTCACCGTAA-1 contig 1 = GTGGGCTCAG...
umi CGTCCTTACG = 244 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=513]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-513 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2773 = TTAGGACTCAGGCAAG-1

using 607 reads

====================================================================================

graph has 260 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 202, 393]
surviving nonsolo ucounts = 2[202, 393]
ids = [1, 0]

====================================================================================

UMI info for barcode TTAGGACTCAGGCAAG-1 contig 1 = GGGGTCACAA...
umi CGGCTCCTGC = 202 reads: +385 validated

UMI info for barcode TTAGGACTCAGGCAAG-1 contig 2 = GTCAGACTCA...
umi AGTCCATAGG = 395 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
393-423 ==> 8-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
423-555 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CCSYAGSSTLL at 362, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 38, 177, 239, 246, 372
confident = false

TIG 2[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 386
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2780 = TTAGGACTCCTCATTA-1

using 285 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [1]

====================================================================================

UMI info for barcode TTAGGACTCCTCATTA-1 contig 1 = GGGGAGGAAC...
umi TGCTGAGCTA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=21)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-516 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRYNWPREYTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 36, 241, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2796 = TTAGGACTCTTCAACT-1

using 9682 reads

====================================================================================

graph has 5788 edges initially, 90 edges after simplification

total ucounts = 1081
nonsolo ucounts = 548[2^230, 3^116, 4^65, 5^53, 6^21, 7^13, 8^8, 9^6, 10^4, 11^2, 13, 15^2, 23, 112, 114, 150, 167, 191, 196, 208, 249, 252, 254, 259, 264, 301, 303, 308, 310, 323, 347, 349, 357, 359, 365, 367, 410, 418, 420]
surviving nonsolo ucounts = 26[112, 114, 150, 167, 191, 196, 208, 249, 252, 254, 259, 264, 301, 303, 308, 310, 323, 347, 349, 357, 359, 365, 367, 410, 418, 420]
ids = [373, 110, 317, 277, 312, 417, 585, 1046, 789, 287, ...]

====================================================================================

UMI info for barcode TTAGGACTCTTCAACT-1 contig 1 = TGGGGAGGAG...
umi ATACGCTCTA = 311 reads: +388 validated
umi ATCGCTCTAC = 421 reads: +388 validated
umi CACCTCCGCA = 252 reads: +388 validated
umi CATCTGCCGT = 189 reads: +388 validated
umi CATTTACTCG = 149 reads: +388 validated
umi CCCCTTCTTG = 422 reads: +388 validated
umi CGTGCCCGCT = 307 reads: +388 validated
umi CTCGTCATTG = 370 reads: +388 validated
umi CTGTCCTCTA = 299 reads: +388 validated
umi GATGTCGTCT = 207 reads: +388 validated
umi GCTCCAATGC = 372 reads: +388 validated
umi GGGTTCTAGC = 347 reads: +388 validated
umi TAGAGGAATG = 251 reads: +388 validated
umi TCGAAGGCCG = 358 reads: +388 validated
umi TTAATGGCTG = 263 reads: +388 validated
umi TTTCATATGG = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 786 reads
cdr3 = CQQSYSTPCSF at 359, score = 9 + 7
umis assigned: [187, 215, 287, 312, 317, 352, 441, 481, 504, 585] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4704
start codons at 32, 38, 94, 107, 243, 462
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=1)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7, 169, 277, 373, 417]
of which 5 are surviving nonsolos
reads assigned: 1178
start codons at 30, 63, 99, 187, 250, 349, 369, 471
confident = false
did not find CDR3

TIG 2[bases=518]
4-180 ==> 5256-5432 on segment before IGLJ1 exon 1 [len=5432] (mis=0)
269-307 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
307-518 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [110, 703, 835, 862, 1046]
of which 5 are surviving nonsolos
reads assigned: 562
start codons at 134, 177, 271, 439
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2800 = TTAGGCAAGAGGTTAT-1

using 171 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 4[3, 4, 5, 144]
surviving nonsolo ucounts = 1[144]
ids = [18]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2806 = TTAGGCAAGCGTGAAC-1

using 1006 reads

====================================================================================

graph has 394 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[362, 641]
surviving nonsolo ucounts = 2[362, 641]
ids = [1, 3]

====================================================================================

UMI info for barcode TTAGGCAAGCGTGAAC-1 contig 1 = GAGGAATCAG...
umi ACATATTCCT = 362 reads: +388 validated
umi CGGCTACGGC = 643 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 147 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 985
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2811 = TTAGGCAAGTACACCT-1

using 486 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 229, 249]
surviving nonsolo ucounts = 2[229, 249]
ids = [2, 0]

====================================================================================

UMI info for barcode TTAGGCAAGTACACCT-1 contig 1 = GGGTAGAGAA...
umi AAAGTCATCG = 254 reads: +388 validated
umi ACAATGCCGC = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=634]
0-35 ==> 79-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
35-388 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 102 reads
cdr3 = CASWDDSLRGRVF at 356, score = 8 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 473
start codons at 35, 189, 339, 364, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2822 = TTAGGCACAAGCGCTC-1

using 320 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[319]
surviving nonsolo ucounts = 1[319]
ids = [1]

====================================================================================

UMI info for barcode TTAGGCACAAGCGCTC-1 contig 1 = GGAGGAGTCA...
umi TCAGACTTTG = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-476 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSPPYTF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2831 = TTAGGCACACCCATGG-1

using 766 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[764]
surviving nonsolo ucounts = 1[764]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=353]
4-176 ==> 176-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=5)
180-217 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
217-353 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 750
start codons at 36, 39, 162, 259
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2842 = TTAGGCACAGACACTT-1

using 242 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [1]

====================================================================================

UMI info for barcode TTAGGCACAGACACTT-1 contig 1 = AGTGCTGGGG...
umi CAAATCGCAA = 227 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=570]
0-44 ==> 118-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
44-384 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
401-429 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-570 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CFSYGTSGRTF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2861 = TTAGGCAGTACTCAAC-1

using 176 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 165]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2862 = TTAGGCAGTAGCGCTC-1

using 656 reads

====================================================================================

graph has 350 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[294, 356]
surviving nonsolo ucounts = 2[294, 356]
ids = [4, 7]

====================================================================================

UMI info for barcode TTAGGCAGTAGCGCTC-1 contig 1 = AGCTTCAGCT...
umi TGCTAGAGGC = 276 reads: +388 validated

UMI info for barcode TTAGGCAGTAGCGCTC-1 contig 2 = ATCATCCAAC...
umi TTATTTTACA = 361 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=594]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-594 ==> 0-159 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 47, 351, 381, 393
confident = false

TIG 2[bases=639]
58-411 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=59)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
479-639 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=2)
junction support: 1 umis using 46 reads
cdr3 = CARPARGHSYGYFDYW at 400, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 58, 256, 322, 428, 533, 578
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2866 = TTAGGCAGTCAAAGAT-1

using 332 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [0]

====================================================================================

UMI info for barcode TTAGGCAGTCAAAGAT-1 contig 1 = ATCAGTCCCA...
umi TAAACATTCC = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQHKSYPFTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2867 = TTAGGCAGTCACTTCC-1

using 25 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2870 = TTAGGCAGTCCGTTAA-1

using 280 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode TTAGGCAGTCCGTTAA-1 contig 1 = CTGGGCCTCA...
umi CAATTCCTTG = 285 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2871 = TTAGGCAGTCGCGGTT-1

using 620 reads

====================================================================================

graph has 268 edges initially, 20 edges after simplification

total ucounts = 20
nonsolo ucounts = 9[2^3, 3, 4, 10, 27, 278, 281]
surviving nonsolo ucounts = 6[2, 3, 4, 27, 278, 281]
ids = [14, 17, 15, 18, 3, 6]

====================================================================================

UMI info for barcode TTAGGCAGTCGCGGTT-1 contig 1 = GAATCAGTCC...
umi ACACTTCATA = 292 reads: +22 -1XX +87 -1XX +13 -1XX +133 -2XX +128 invalidated
umi GAAAGGCGAA = 223 reads: +148 -1XX +5 -1XX +3 -1XX +13 -1XX +8 -1XX +2 -9 +6 -1XX +10 -2XX +6 -1XX +3 -2XX +4 -1XX +62 -1XX +25 -1XX +2 -1XX +18 -3XX +1 -1XX +2 -4X +9 -1XX +13 -1XX +7 -1XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=14)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 490
start codons at 25, 31, 100, 236, 455
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2872 = TTAGGCAGTCTAACGT-1

using 38 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 34]
surviving nonsolo ucounts = 1[34]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=441]
0-347 ==> 4-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=7)
352-384 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
384-441 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQANSFPQTF at 323, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 30
start codons at 2, 58, 71, 207, 426
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2875 = TTAGGCAGTCTGCCAG-1

using 141 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [1]

====================================================================================

UMI info for barcode TTAGGCAGTCTGCCAG-1 contig 1 = GAGCTGCTCA...
umi ACTTACGATG = 136 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYGSSLTTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2882 = TTAGGCAGTTACGCGC-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2898 = TTAGGCATCATGTAGC-1

using 101 reads

====================================================================================

graph has 36 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[35, 64]
surviving nonsolo ucounts = 2[35, 64]
ids = [1, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=357]
0-312 ==> 39-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
311-349 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
cdr3 = CLQYSSSPWTF at 288, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 30
start codons at 36, 172
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2905 = TTAGGCATCCTAGAAC-1

using 432 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 425]
surviving nonsolo ucounts = 1[425]
ids = [3]

====================================================================================

UMI info for barcode TTAGGCATCCTAGAAC-1 contig 1 = AGAGCTCTGG...
umi TGAATTGCCA = 430 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNNWPPETF at 365, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 420
start codons at 44, 113, 249, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2914 = TTAGGCATCGGTTAAC-1

using 2643 reads

====================================================================================

graph has 2178 edges initially, 14 edges after simplification

total ucounts = 499
nonsolo ucounts = 218[2^75, 3^54, 4^26, 5^15, 6^14, 7^9, 8^7, 9, 10^5, 11^3, 14, 34, 37, 113, 127, 174, 201, 234, 642]
surviving nonsolo ucounts = 6[37, 127, 174, 201, 234, 642]
ids = [49, 140, 105, 369, 426, 294]

====================================================================================

UMI info for barcode TTAGGCATCGGTTAAC-1 contig 1 = TGTGAGGAGT...
umi ACCTAGTTAC = 36 reads: -19 +372 non-validated
umi GTACTAAGGT = 643 reads: +391 validated
umi TCACATCGGC = 205 reads: +391 validated
umi TGGTCCGCGG = 238 reads: +391 validated

UMI info for barcode TTAGGCATCGGTTAAC-1 contig 2 = TGGGGATGGG...
umi ATCTATTCGG = 139 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=558]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=4)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 191 reads
cdr3 = CQQYDNLPPLTF at 358, score = 9 + 9
umis assigned: [49, 294, 369, 426]
of which 4 are surviving nonsolos
reads assigned: 1104
start codons at 31, 37, 93, 106, 245, 368, 464
confident = true

TIG 2[bases=501]
49-397 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
405-442 ==> 0-37 on |19|IGHD3-16|D-REGION| [len=37] (mis=7)
437-488 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 14 reads
cdr3 = CARGLYDYIWGSYRFLWFDPW at 394, score = 9 + 7
umis assigned: [105]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 5, 49, 93, 410
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGGTCTTTATGATTACATTTGGGGGAGTTATCGTTTTCTCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2916 = TTAGGCATCGTCACGG-1

using 165 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[164]
surviving nonsolo ucounts = 1[164]
ids = [1]

====================================================================================

UMI info for barcode TTAGGCATCGTCACGG-1 contig 1 = GAGCTACAGC...
umi TCGTAAGAGG = 146 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=457]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=22)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
430-457 ==> 0-27 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYYSAPLTF at 369, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 30, 99, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2923 = TTAGGCATCTGTTTGT-1

using 204 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [0]

====================================================================================

UMI info for barcode TTAGGCATCTGTTTGT-1 contig 1 = GCTGGGGTCT...
umi CAGGTGCATC = 189 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=583]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-583 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2926 = TTAGTTCAGAAAGTGG-1

using 523 reads

====================================================================================

graph has 200 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 3, 200, 310]
surviving nonsolo ucounts = 2[200, 310]
ids = [3, 0]

====================================================================================

UMI info for barcode TTAGTTCAGAAAGTGG-1 contig 1 = ATCACCCAAA...
umi CACCACCGGG = 191 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=543]
0-57 ==> 2-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
57-410 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
459-493 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
493-543 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 399, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 57, 255, 260, 277, 321, 354
confident = false

REJECT CONTIGS

TIG 1[bases=553]
6-76 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
389-417 ==> 10-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 28, 34, 103, 239, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2927 = TTAGTTCAGAACTGTA-1

using 289 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 6, 11, 263]
surviving nonsolo ucounts = 1[263]
ids = [7]

====================================================================================

UMI info for barcode TTAGTTCAGAACTGTA-1 contig 1 = GCTTTCTGAG...
umi TCTCTATGTC = 239 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=515]
35-339 ==> 0-304 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=30)
412-462 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
462-515 ==> 0-53 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARQDGITIFSDACDLW at 380, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 23, 35, 79, 95, 414
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2932 = TTAGTTCAGACTAGAT-1

using 3060 reads

====================================================================================

graph has 4082 edges initially, 34 edges after simplification

total ucounts = 1149
nonsolo ucounts = 573[2^216, 3^132, 4^77, 5^55, 6^31, 7^27, 8^10, 9^9, 10^2, 11^4, 12, 13^3, 16, 19, 23, 25, 84, 255]
surviving nonsolo ucounts = 1[255]
ids = [126]

====================================================================================

UMI info for barcode TTAGTTCAGACTAGAT-1 contig 1 = CTCTGCTTCA...
umi ACGGAACCCC = 249 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=22)
403-441 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
441-577 ==> 0-136 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CQSYDSILTGWAF at 374, score = 7 + 8
umis assigned: [126]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 50, 204, 357, 384, 520
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2934 = TTAGTTCAGAGGACGG-1

using 289 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 5, 6, 271]
surviving nonsolo ucounts = 1[271]
ids = [3]

====================================================================================

UMI info for barcode TTAGTTCAGAGGACGG-1 contig 1 = GCTTGCCTTG...
umi CCGACGCTGA = 264 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=484]
43-403 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=15)
403-440 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
440-484 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQGSHWPPAF at 379, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 43, 76, 104, 112, 200, 263, 362, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2941 = TTAGTTCAGCGATATA-1

using 98 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3^2, 4, 38, 40]
surviving nonsolo ucounts = 2[38, 40]
ids = [4, 9]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2953 = TTAGTTCAGTACATGA-1

using 137 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 81
nonsolo ucounts = 26[2^17, 3^3, 4^3, 7, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2957 = TTAGTTCAGTTACGGG-1

using 270 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 261]
surviving nonsolo ucounts = 1[261]
ids = [1]

====================================================================================

UMI info for barcode TTAGTTCAGTTACGGG-1 contig 1 = GGAGCCCCAG...
umi AGTTGTGCGC = 254 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=518]
0-68 ==> 168-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
68-399 ==> 0-331 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=17)
440-477 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
477-518 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CTNLYHFGSEVW at 410, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 68, 224, 285
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2959 = TTAGTTCAGTTGCAGG-1

using 328 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 57, 264]
surviving nonsolo ucounts = 2[57, 264]
ids = [4, 5]

====================================================================================

UMI info for barcode TTAGTTCAGTTGCAGG-1 contig 1 = GCCTATCCAC...
umi TTATAGAAAG = 58 reads: +424 validated

UMI info for barcode TTAGTTCAGTTGCAGG-1 contig 2 = GGGGAGGAAC...
umi TTGGGTCGCG = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=500]
0-43 ==> 36-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
43-396 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
420-467 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
467-500 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARDRAATARLGGMDVW at 385, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 56
start codons at 43, 194, 199, 346, 424
confident = false

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWGLTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2963 = TTAGTTCCACCATCCT-1

using 62 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 10[2^3, 3^2, 4^2, 5, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2967 = TTAGTTCCACTGTGTA-1

using 934 reads

====================================================================================

graph has 1466 edges initially, 6 edges after simplification

total ucounts = 439
nonsolo ucounts = 192[2^86, 3^36, 4^27, 5^13, 6^11, 7^6, 8^5, 9^2, 10, 11^2, 12^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2972 = TTAGTTCCAGCCTTGG-1

using 271 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 262]
surviving nonsolo ucounts = 1[262]
ids = [1]

====================================================================================

UMI info for barcode TTAGTTCCAGCCTTGG-1 contig 1 = TGGGGGATCA...
umi ACTGGGCTCG = 263 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CMQALQTPGVTF at 371, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2976 = TTAGTTCCAGGTCGTC-1

using 400 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 14[2^6, 3^2, 5^2, 6, 7^2, 343]
surviving nonsolo ucounts = 1[343]
ids = [0]

====================================================================================

UMI info for barcode TTAGTTCCAGGTCGTC-1 contig 1 = GTCAGACTCA...
umi AACCGGATTG = 343 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2987 = TTAGTTCCATGCAATC-1

using 589 reads

====================================================================================

graph has 204 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[283, 300]
surviving nonsolo ucounts = 2[283, 300]
ids = [0, 7]

====================================================================================

UMI info for barcode TTAGTTCCATGCAATC-1 contig 1 = AGGAGTCAGT...
umi AGGGCTTCTA = 262 reads: +388 validated
umi TATTCTGAGC = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 87 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [0, 7]
of which 2 are surviving nonsolos
reads assigned: 532
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2994 = TTAGTTCGTACGCTGC-1

using 435 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 433]
surviving nonsolo ucounts = 1[433]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-32 ==> 5705-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 428
start codons at 31, 239, 365, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.2996 = TTAGTTCGTAGCACGA-1

using 263 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode TTAGTTCGTAGCACGA-1 contig 1 = GGCTGGGGTC...
umi GTGATGGCAT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-541 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSHAGSYIWVF at 366, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 42, 178, 181, 199, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3001 = TTAGTTCGTCACCCAG-1

using 245 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [2]

====================================================================================

UMI info for barcode TTAGTTCGTCACCCAG-1 contig 1 = ACTGCGGGGG...
umi AGCACCTGGC = 231 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=570]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=0)
28-397 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=2)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
431-570 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMIWHSSAYVF at 370, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 28, 170, 302, 314, 353, 373, 395, 563
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3002 = TTAGTTCGTCACCTAA-1

using 418 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 3^2, 402]
surviving nonsolo ucounts = 1[402]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3005 = TTAGTTCGTCCAGTAT-1

using 637 reads

====================================================================================

graph has 274 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 265, 360]
surviving nonsolo ucounts = 2[265, 360]
ids = [9, 1]

====================================================================================

UMI info for barcode TTAGTTCGTCCAGTAT-1 contig 1 = GAAGAGCTGC...
umi ACACACGATT = 364 reads: +388 validated

UMI info for barcode TTAGTTCGTCCAGTAT-1 contig 2 = TCAGGACAAT...
umi TCCAATTGCA = 261 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYGGSPMYTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 33, 97, 241, 367, 381, 463
confident = false

TIG 2[bases=499]
17-350 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
370-408 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
408-499 ==> 0-91 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSNANNLDGFVF at 341, score = 8 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 17, 141, 171, 174, 324, 351, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3008 = TTAGTTCGTCGCGTGT-1

using 216 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [6]

====================================================================================

UMI info for barcode TTAGTTCGTCGCGTGT-1 contig 1 = GTCAGACCCA...
umi TATGACGATC = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-23 ==> 6-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
23-374 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=3)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQDYNYPYTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 23, 29, 85, 98, 180, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3011 = TTAGTTCGTCTGATTG-1

using 585 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 10, 563]
surviving nonsolo ucounts = 2[10, 563]
ids = [6, 7]

====================================================================================

UMI info for barcode TTAGTTCGTCTGATTG-1 contig 1 = AGGAGTCAGT...
umi TACCTTTCGT = 8 reads: -85 +129 -55 +72 -47 non-validated
umi TACCTTTTCG = 530 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
415-498 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 93 reads
cdr3 = CQQYDDLPITF at 354, score = 9 + 8
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 529
start codons at 27, 33, 89, 102, 364, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3012 = TTAGTTCGTGAACCTT-1

using 253 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 6, 235]
surviving nonsolo ucounts = 1[235]
ids = [3]

====================================================================================

UMI info for barcode TTAGTTCGTGAACCTT-1 contig 1 = GGAGGAGTCA...
umi CCCCTCGGCG = 226 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=470]
35-283 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-470 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLHYDNRRRTF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 35, 91, 104, 243, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3032 = TTAGTTCTCCACTGGG-1

using 282 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 271]
surviving nonsolo ucounts = 1[271]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=493]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-26 ==> 5974-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-26 ==> 5270-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-26 ==> 783-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-26 ==> 9984-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-26 ==> 787-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
11-82 ==> 8895-8966 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
11-82 ==> 8904-8975 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
11-82 ==> 8903-8974 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
26-79 ==> 0-53 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
79-320 ==> 110-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
319-357 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
357-493 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYKSYPFTF at 296, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 26, 32, 176, 180, 183, 276, 399
confident = false
not full
full length transcript of length 493
VJ delta = 71
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3045 = TTAGTTCTCGCAAGCC-1

using 276 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 42, 227]
surviving nonsolo ucounts = 2[42, 227]
ids = [3, 6]

====================================================================================

UMI info for barcode TTAGTTCTCGCAAGCC-1 contig 1 = GGGTCTCAGG...
umi GTTAGAACTG = 209 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
37-387 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-577 ==> 0-149 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYTSSSTLVVF at 361, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 37, 194, 238, 245, 248
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3048 = TTAGTTCTCGCTAGCG-1

using 284 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^3, 3^2, 4, 5, 6, 252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=491]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
429-491 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNSSITF at 350, score = 3 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 30, 63, 99, 187, 349, 369, 471
confident = false
not full
frameshifted full length transcript of length 491
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3055 = TTAGTTCTCTCCCTGA-1

using 698 reads

====================================================================================

graph has 268 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3^2, 310, 372]
surviving nonsolo ucounts = 2[310, 372]
ids = [13, 2]

====================================================================================

UMI info for barcode TTAGTTCTCTCCCTGA-1 contig 1 = GGGGAGGAAT...
umi CACACTGTAA = 382 reads: +388 validated
umi TTCACCTCTT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 115 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2, 13]
of which 2 are surviving nonsolos
reads assigned: 677
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3057 = TTAGTTCTCTCGCTTG-1

using 350 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 340]
surviving nonsolo ucounts = 1[340]
ids = [0]

====================================================================================

UMI info for barcode TTAGTTCTCTCGCTTG-1 contig 1 = GGAGAAGAGC...
umi AACGACGGCT = 341 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-373 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYDRSWTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 36, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3063 = TTAGTTCTCTTTAGTC-1

using 891 reads

====================================================================================

graph has 302 edges initially, 18 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 5, 7, 250, 625]
surviving nonsolo ucounts = 2[250, 625]
ids = [5, 4]

====================================================================================

UMI info for barcode TTAGTTCTCTTTAGTC-1 contig 1 = GAATCAGTCC...
umi TAGTAGTGCT = 251 reads: +22 -1XX +365 invalidated

UMI info for barcode TTAGTTCTCTTTAGTC-1 contig 2 = GGGTCAGACC...
umi GCCGGTTTGG = 628 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=550]
25-376 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-550 ==> 16-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 114 reads
cdr3 = CLQDYTYPFSF at 352, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 616
start codons at 25, 31, 87, 100, 182, 185, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3068 = TTATGCTAGAGGTTAT-1

using 37 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3082 = TTATGCTAGGACATTA-1

using 124 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 3^2, 107]
surviving nonsolo ucounts = 1[107]
ids = [11]

====================================================================================

REJECT CONTIGS

TIG 1[bases=380]
0-344 ==> 1-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
343-380 ==> 0-37 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
cdr3 = CQVWYSNSDHVVF at 314, score = 7 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 194, 201, 297, 342
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3087 = TTATGCTAGGGATACC-1

using 5466 reads

====================================================================================

graph has 5316 edges initially, 110 edges after simplification

total ucounts = 991
nonsolo ucounts = 777[2^125, 3^89, 4^89, 5^78, 6^56, 7^60, 8^52, 9^53, 10^35, 11^37, 12^27, 13^13, 14^12, 15^21, 16^10, 17^4, 18^5, 19^3, 20^2, 21, 24, 25, 27, 44, 51]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3092 = TTATGCTAGGTTACCT-1

using 264 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 258]
surviving nonsolo ucounts = 1[258]
ids = [3]

====================================================================================

UMI info for barcode TTATGCTAGGTTACCT-1 contig 1 = TGGGGGAGGA...
umi CTATTCCTCT = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-505 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 33, 39, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3104 = TTATGCTAGTTCCACA-1

using 40 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[40]
surviving nonsolo ucounts = 1[40]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3106 = TTATGCTAGTTGAGAT-1

using 437 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[168, 262]
surviving nonsolo ucounts = 2[168, 262]
ids = [5, 7]

====================================================================================

UMI info for barcode TTATGCTAGTTGAGAT-1 contig 1 = ATCAGTCCCA...
umi GCCTATTTCT = 143 reads: +388 validated

UMI info for barcode TTATGCTAGTTGAGAT-1 contig 2 = GGTAGCTCAG...
umi TGGCCTAATA = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-482 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=545]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-373 ==> 0-337 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=6)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-545 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSFGSNTRVF at 363, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 36, 99, 190, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3112 = TTATGCTCAAGCTGAG-1

using 13401 reads

====================================================================================

graph has 7494 edges initially, 92 edges after simplification

total ucounts = 1302
nonsolo ucounts = 588[2^213, 3^109, 4^90, 5^58, 6^25, 7^13, 8^10, 9^8, 10^12, 11^7, 12^5, 13, 14^3, 15, 24, 43, 78, 81, 145, 169, 210, 231, 237, 239, 244, 252, 275, 294, 302, 306, 309, 310, 312, 320, 328, 343, 358, 361, 364, 382, 418, 425, 438, 611, 618, 753, 784]
surviving nonsolo ucounts = 31[78, 81, 145, 169, 210, 231, 237, 239, 244, 252, 275, 294, 302, 306, 309, 310, 312, 320, 328, 343, 358, 361, 364, 382, 418, 425, 438, 611, 618, 753, 784]
ids = [1200, 1198, 1000, 1207, 1071, 735, 594, 649, 831, 30, ...]

====================================================================================

UMI info for barcode TTATGCTCAAGCTGAG-1 contig 1 = GGGGAGGAGT...
umi AACAGCCGGA = 361 reads: +388 validated
umi AACTCTCACC = 311 reads: +388 validated
umi AAGATCTGGA = 255 reads: +388 validated
umi AGCGCGGCAC = 443 reads: +138 -4XX +1 -5XX +1 -4XX +2 -3XX +2 -1XX +1 -41XX +1 -9XX +1 -3XX +1 -3XX +2 -1XX +2 -2XX +1 -1XX +158 invalidated
umi AGTTCTCACC = 369 reads: +388 validated
umi ATAGAGACCC = 436 reads: +138 -4XX +1 -5XX +1 -4XX +2 -3XX +2 -1XX +1 -40XX +2 -9XX +1 -3XX +1 -3XX +2 -1XX +2 -2XX +1 -1XX +158 invalidated
umi CAACAACCTC = 278 reads: +388 validated
umi CAGTGTCCAA = 303 reads: +388 validated
umi CATCCATCTT = 313 reads: +388 validated
umi CTATAGGGAG = 239 reads: +388 validated
umi CTCCGTCGGG = 319 reads: +361 -1XX +26 invalidated
umi CTCGACCGGT = 393 reads: +388 validated
umi CTGTACGGAT = 251 reads: +219 -2X +1 -2XX +164 invalidated
umi GAATAGCATT = 342 reads: +388 validated
umi GATACATCAC = 333 reads: +388 validated
umi GCATATTTTC = 231 reads: +388 validated
umi GGTTTGTCAA = 243 reads: +388 validated
umi GTACGTACCG = 361 reads: +388 validated
umi TAGCACTGGG = 319 reads: +388 validated
umi TCCCAGTCTT = 213 reads: +388 validated
umi TGCGGTTATG = 292 reads: +388 validated
umi TGGACAATTG = 303 reads: +388 validated
umi TTAACGGCCC = 81 reads: +388 validated
umi TTTAGGCTAT = 440 reads: +388 validated

UMI info for barcode TTATGCTCAAGCTGAG-1 contig 2 = AGCTCTGGGA...
umi TTAACCTCAC = 71 reads: +417 -1 +10 -1 +10 -15 non-validated
umi TTACCACTCC = 145 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=25)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 1264 reads
cdr3 = CQQSYSVPLTF at 358, score = 9 + 8
umis assigned: [8, 25, 30, 180, 211, 228, 316, 381, 403, 594] and 14 others
of which 24 are surviving nonsolos
reads assigned: 7229
start codons at 31, 37, 93, 106, 242, 461
confident = true

TIG 2[bases=548]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=52)
492-534 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CAKAQIYRLRGFRGYDSPYYFYSVDLW at 422, score = 9 + 7
umis assigned: [1198, 1207]
of which 2 are surviving nonsolos
reads assigned: 213
start codons at 80, 133, 182, 231, 236, 297, 303, 315, 383
confident = true

REJECT CONTIGS

TIG 1[bases=395]
4-146 ==> 214-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
146-184 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
184-395 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 114, score = 7 + 8
umis assigned: [250, 409]
of which 2 are surviving nonsolos
reads assigned: 1494
start codons at 97, 124, 148, 316
confident = false
not full
VJ delta = 22
not full
now this is a cell
paired!

CAAATCTATCGACTACGTGGATTTCGTGGTTACGATTCCCCTTATTATTTCTACAGTGTGGACCTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CTCAGCAGTCTACAACCTGAGGATTGTGCAACTTATTACTGTCAACAGAGTTACAGTGTCCCTCTCACTTTCGGCGGAGGGACCGAAGTTGACATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3120 = TTATGCTCACCGAATT-1

using 262 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 253]
surviving nonsolo ucounts = 1[253]
ids = [5]

====================================================================================

UMI info for barcode TTATGCTCACCGAATT-1 contig 1 = GAGTCAGTCT...
umi TTATACTTCA = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQSYDTPRTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 25, 31, 87, 100, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3125 = TTATGCTCACTGTGTA-1

using 197 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[12, 181]
surviving nonsolo ucounts = 1[181]
ids = [4]

====================================================================================

UMI info for barcode TTATGCTCACTGTGTA-1 contig 1 = TCTCCACCAT...
umi GTGAACACGT = 181 reads: +85 -1 +1 -1 +1 -2X +2 -3XX +295 invalidated

GOOD CONTIGS

TIG 1[bases=549]
8-330 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
361-399 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
399-549 ==> 0-150 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CCSFTVNTRSYVF at 332, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 8, 165, 209, 219, 363, 531
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3126 = TTATGCTCAGCATACT-1

using 327 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode TTATGCTCAGCATACT-1 contig 1 = GGAGTCAGTC...
umi AGAACTAAGC = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-495 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPYTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3128 = TTATGCTCAGCCAGAA-1

using 191 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 185]
surviving nonsolo ucounts = 1[185]
ids = [1]

====================================================================================

UMI info for barcode TTATGCTCAGCCAGAA-1 contig 1 = GCTTCAGCTG...
umi GAAGTCAGGG = 171 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=538]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-538 ==> 0-101 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CQCYDNSLTGWGF at 370, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 46, 200, 353, 380, 516
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3131 = TTATGCTCAGGAATGC-1

using 874 reads

====================================================================================

graph has 1231 edges initially, 8 edges after simplification

total ucounts = 346
nonsolo ucounts = 166[2^57, 3^33, 4^29, 5^11, 6^10, 7^6, 8^4, 9^5, 10^2, 11^5, 13^2, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3136 = TTATGCTCATCACGTA-1

using 496 reads

====================================================================================

graph has 278 edges initially, 42 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 5, 234, 253]
surviving nonsolo ucounts = 2[234, 253]
ids = [2, 0]

====================================================================================

UMI info for barcode TTATGCTCATCACGTA-1 contig 1 = GAGCTCTGGG...
umi CCCGATTCTC = 176 reads: -24 +5 -1XX +6 -1XX +5 -2XX +13 -1XX +29 -1XX +5 -1XX +7 -2XX +25 -1XX +25 -1XX +4 -1XX +22 -1XX +4 -1XX +12 -2XX +2 -3XX +2 -2XX +1 -6X +1 -1XX +1 -1XX +3 -1XX +1 -1XX +1 -1XX +3 -1XX +2 -1XX +6 -1XX +1 -1XX +32 -2XX +2 -1XX +1 -1XX +3 -1XX +4 -1XX +29 -1XX +17 -1XX +8 -4X +1 -2XX +2 -4XX +1 -1XX +2 -1XX +5 -1XX +7 -1XX +31 -1 +1 -1 +8 invalidated
umi CGCCTTTCAC = 236 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=575]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=10)
441-504 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDEENSFYFYGLDVW at 422, score = 9 + 7
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 396
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 432
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3139 = TTATGCTCATCGGACC-1

using 1974 reads

====================================================================================

graph has 1780 edges initially, 36 edges after simplification

total ucounts = 402
nonsolo ucounts = 289[2^56, 3^34, 4^30, 5^24, 6^19, 7^31, 8^17, 9^18, 10^9, 11^13, 12^11, 13^7, 14^8, 15^6, 16^2, 18, 19, 24, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3144 = TTATGCTCATGCCTTC-1

using 21 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3149 = TTATGCTGTAAGGGAA-1

using 111 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 99]
surviving nonsolo ucounts = 1[99]
ids = [7]

====================================================================================

UMI info for barcode TTATGCTGTAAGGGAA-1 contig 1 = AAAAACCACA...
umi TATACCCCGC = 78 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=512]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=20)
406-437 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=5)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-512 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDPYYYDSSGFYPDAFDIW at 392, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 74
start codons at 50, 201, 248, 253, 270, 285, 314, 347, 414, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3163 = TTATGCTGTCATCCCT-1

using 22 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3171 = TTATGCTGTCGCGGTT-1

using 272 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[5, 17, 244]
surviving nonsolo ucounts = 1[244]
ids = [2]

====================================================================================

UMI info for barcode TTATGCTGTCGCGGTT-1 contig 1 = AGTGCTTTCT...
umi CAGTCGGCAC = 191 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=451]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
393-447 ==> 7-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGSHYYYMDVW at 377, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 17, 38, 82, 168, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3186 = TTATGCTGTGTAACGG-1

using 520 reads

====================================================================================

graph has 412 edges initially, 8 edges after simplification

total ucounts = 270
nonsolo ucounts = 109[2^54, 3^26, 4^14, 5^5, 6^4, 8^2, 9, 10, 13, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3189 = TTATGCTGTGTGGCTC-1

using 25 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[9, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3192 = TTATGCTGTTAAAGAC-1

using 44344 reads

====================================================================================

graph has 25385 edges initially, 174 edges after simplification

total ucounts = 3740
nonsolo ucounts = 2024[2^691, 3^415, 4^277, 5^175, 6^108, 7^78, 8^60, 9^25, 10^27, 11^12, 12^6, 13^3, 14^2, 15, 16^2, 17, 19^2, 20, 23, 30, 31, 38, 44, 52, 60, 66, 68, 69, 79^2, 94, 95, 99, 101, 114, 126, 127, 136, 149, 152, 155, 158, 161, 164, 165, 168^2, 172, 181, 182, 183, 184, 185, 186, 187, 191, 193^2, 195, 196, 199, 207, 208, 211, 212, 214^2, 215, 217, 219, 220^2, 223, 226, 227, 230, 234, 235^2, 236^2, 237, 239, 245, 255, 257, 259, 262^2, 268, 269, 270^4, 273^2, 275, 276, 277, 285, 287, 289^2, 290, 293, 294, 297, 298, 301, 308, 309, 312^2, 313, 314^2, 315^2, 318, 321^2, 322, 325^2, 326, 327, 329, 331, 332, 333, 334^2, 338, 345^3, 347, 358, 360, 363, 371, 373, 375, 376^3, 403, 420, 425, 510, 537, 611, 628, 722, 794]
surviving nonsolo ucounts = 131[15, 19, 23, 30, 38, 52, 60, 69, 79, 95, 99, 101, 126, 127, 136, 149, 152, 155, 158, 161, 164, 165, 168^2, 172, 181, 182, 183, 184, 185, 186, 187, 191, 193^2, 195, 196, 199, 207, 208, 211, 212, 214^2, 215, 217, 219, 220^2, 223, 226, 227, 230, 234, 235^2, 236^2, 237, 239, 245, 255, 257, 259, 262^2, 268, 269, 270^4, 273^2, 275, 276, 277, 285, 287, 289^2, 290, 293, 294, 297, 298, 301, 308, 309, 312, 313, 314^2, 315^2, 318, 321^2, 322, 325^2, 326, 327, 329, 331, 332, 333, 334^2, 338, 345^3, 347, 358, 360, 363, 371, 375, 376^3, 403, 420, 425, 510, 537, 611, 628, 722, 794]
ids = [884, 182, 1998, 3030, 1488, 3447, 2102, 1586, 2465, 1086, ...]

====================================================================================

UMI info for barcode TTATGCTGTTAAAGAC-1 contig 1 = AGCCCTCAGA...
umi AAGCTACCCC = 212 reads: +430 validated
umi AATTGGCCCG = 192 reads: +430 validated
umi ACCACCAACC = 218 reads: +430 validated
umi ACTTCGAGCC = 123 reads: +430 validated
umi AGCGAGAAGA = 300 reads: +430 validated
umi AGCTATGCTT = 243 reads: +430 validated
umi AGGGATCCGG = 605 reads: +1 -1XX +3 -1XX +2 -1XX +6 -1XX +2 -385XX +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi ATTCGACTTA = 15 reads: -3 +12 -1X +67 -1 +1 -1 +1 -1 +1 -2X +1 -1 +2 -1X +8 -2 +214 -1 +1 -1 +14 -1 +6 -1 +4 -81 invalidated
umi CAACTTATAG = 190 reads: +430 validated
umi CAACTTTGCA = 103 reads: +430 validated
umi CAGATCTGCA = 92 reads: +430 validated
umi CCTATGTCGA = 271 reads: +198 -1XX +231 invalidated
umi CCTCATAGGT = 186 reads: +430 validated
umi CGAAGAATAA = 520 reads: +1 -1XX +3 -1XX +2 -1XX +6 -1XX +2 -8XX +1 -376X +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi CGCTATCGCT = 38 reads: +91 -1 +3 -1X +194 -1 +1 -78 +56 -4 invalidated
umi CGTGCACTTC = 168 reads: +430 validated
umi CTAACTCTTC = 67 reads: +430 validated
umi CTAAGTCCAG = 193 reads: +430 validated
umi CTCACCTCCT = 160 reads: +430 validated
umi CTCTTTCATC = 150 reads: +430 validated
umi CTGACTTCTT = 710 reads: +1 -1XX +3 -1XX +2 -1XX +6 -1XX +2 -385XX +1 -1XX +1 -3XX +1 -7XX +1 -3XX +1 -3XX +2 -1XX +2 invalidated
umi CTGCAACTTC = 265 reads: +430 validated
umi GACTACACTT = 23 reads: +238 -11 +83 -1 +39 -58 non-validated
umi GACTCGATGT = 162 reads: +105 -1XX +324 invalidated
umi GACTTGGTTT = 105 reads: +421 -9 non-validated
umi GCACTAATTA = 56 reads: +430 validated
umi GGAGCCGAAT = 162 reads: +2 -2X +426 invalidated
umi GGCACGTAGC = 214 reads: +198 -1XX +231 invalidated
umi GGCTAATATG = 222 reads: +430 validated
umi GTCAGCCTGA = 275 reads: +430 validated
umi GTCGCCCGCT = 210 reads: +430 validated
umi GTTATGATCG = 187 reads: +430 validated
umi TAGGCAGGGT = 222 reads: +430 validated
umi TAGGTCCTCT = 124 reads: +430 validated
umi TAGTTCCTTA = 217 reads: +430 validated
umi TAGTTTCCTC = 222 reads: +430 validated
umi TCATCCTTAC = 228 reads: +430 validated
umi TCATGGCTTC = 178 reads: +425 -5 non-validated
umi TCCTATTCTT = 154 reads: +430 validated
umi TCGTGTGACC = 31 reads: +350 -1 +1 -2 +72 -4 non-validated
umi TCTGCCTCTG = 153 reads: +430 validated
umi TCTGTCTACC = 212 reads: +430 validated
umi TGCGTATCAC = 149 reads: +430 validated
umi TTAGTTCTCC = 198 reads: +430 validated
umi TTCAGTTCCC = 51 reads: +105 -1 +211 -1 +105 -7 non-validated
umi TTCATAGCGC = 187 reads: +430 validated
umi TTCCACCCTT = 206 reads: +430 validated
umi TTGTACACTG = 199 reads: +430 validated

UMI info for barcode TTATGCTGTTAAAGAC-1 contig 2 = TGGGGAGGAG...
umi AACGAACATT = 361 reads: +382 validated
umi ACATATAGGG = 258 reads: +382 validated
umi ACATTAGCCT = 375 reads: +382 validated
umi ACCTCTTTTA = 310 reads: +382 validated
umi ACTGGGCTTC = 286 reads: +382 validated
umi ACTTTCGTCC = 270 reads: +382 validated
umi AGATCGCGTC = 324 reads: +382 validated
umi AGATCTGTAG = 237 reads: +382 validated
umi AGCAGCCATA = 372 reads: +382 validated
umi AGCCGGGTGA = 235 reads: +382 validated
umi AGGCAATGCT = 279 reads: +382 validated
umi AGTCTCCATA = 323 reads: -2XX +1 -1XX +378 invalidated
umi AGTGGTTCTC = 339 reads: +382 validated
umi AGTTACTCTT = 293 reads: +382 validated
umi ATACCTTTTA = 252 reads: +382 validated
umi ATCCTTCGAG = 170 reads: +11 -1XX +4 -1XX +25 -1XX +2 -1XX +10 -1XX +50 -1XX +6 -1XX +3 -1XX +1 -1XX +9 -1XX +3 -1XX +7 -51XX +3 -1XX +3 -1XX +3 -1XX +1 -1XX +1 -1XX +5 -1XX +2 -1XX +8 -2XX +20 -1XX +2 -3XX +4 -2XX +5 -1XX +1 -1XX +1 -1XX +2 -1XX +3 -1XX +4 -2XX +1 -72 +9 -5XX +4 -1XX +2 -1XX +4 invalidated
umi ATCGACACCC = 336 reads: +382 validated
umi ATCTGCTTAC = 271 reads: +382 validated
umi ATGCTTATCT = 313 reads: +382 validated
umi ATTATATTGC = 315 reads: +382 validated
umi ATTGCTAGGG = 624 reads: +382 validated
umi CAACACTCGG = 276 reads: +382 validated
umi CAATTACTCT = 279 reads: +382 validated
umi CAATTTCTGT = 356 reads: +382 validated
umi CACAATACGC = 335 reads: +382 validated
umi CACTTATGCA = 220 reads: +382 validated
umi CAGAATCGAA = 262 reads: +382 validated
umi CAGAGCACCG = 134 reads: +382 validated
umi CCAGTCTACC = 415 reads: +382 validated
umi CCCCTATCAC = 331 reads: +382 validated
umi CCGATTCATT = 334 reads: +382 validated
umi CCGGGCTCTG = 355 reads: +382 validated
umi CCGTCCTGCA = 179 reads: +382 validated
umi CCTGGCTACT = 186 reads: +382 validated
umi CCTGGTTAGC = 295 reads: +382 validated
umi CGAATATGTT = 378 reads: +382 validated
umi CGATTCGTCG = 796 reads: -207X +175 invalidated
umi CGCACGCCTT = 354 reads: +382 validated
umi CGCATCTACC = 234 reads: +382 validated
umi CGCGATCCGA = 332 reads: +382 validated
umi CGGTAAAGCA = 407 reads: +382 validated
umi CGTAAGCCCT = 295 reads: +382 validated
umi CGTATCTTTT = 293 reads: +382 validated
umi CGTTCTTCGC = 317 reads: +382 validated
umi CGTTGAATCA = 187 reads: -22X +20 -1XX +2 -1XX +5 -1XX +7 -1XX +26 -1XX +3 -1XX +13 -1XX +2 -1XX +6 -1XX +5 -28X +1 -1X +1 -1XX +1 -3XX +3 -3XX +11 -1XX +8 -2XX +22 -1XX +1 -1XX +5 -1XX +2 -1XX +4 -1XX +3 -2XX +20 -1XX +2 -1XX +6 -2XX +5 -1XX +1 -1XX +4 -1XX +3 -1XX +5 -60 +1 -1XX +1 -1XX +1 -1XX +2 -1XX +14 -5XX +4 -1XX +2 -1XX +4 invalidated
umi CGTTTCAGCG = 236 reads: +382 validated
umi CGTTTTTATA = 330 reads: +382 validated
umi CTATGCTTTT = 173 reads: +382 validated
umi CTCCCCAGCT = 325 reads: +382 validated
umi CTCCTTTGTA = 376 reads: +382 validated
umi CTTATTTCGG = 311 reads: +382 validated
umi CTTCAGTATA = 270 reads: +382 validated
umi CTTCTATACC = 165 reads: +382 validated
umi CTTGTTAGTA = 185 reads: +382 validated
umi CTTTTACATA = 328 reads: +382 validated
umi GACGATTGCA = 339 reads: +382 validated
umi GATATGGGAA = 266 reads: +382 validated
umi GATCGAATAG = 267 reads: +277 -3XX +1 -5XX +1 -2XX +93 invalidated
umi GCTATCTGCT = 301 reads: +382 validated
umi GGATTGCAGC = 234 reads: -311 +71 non-validated
umi GGCCATCTAT = 292 reads: +382 validated
umi GGGCTGACCA = 320 reads: +382 validated
umi GGTTCTATAA = 273 reads: +382 validated
umi GTGCCTGCAC = 184 reads: +382 validated
umi GTGTCTCGTG = 272 reads: +382 validated
umi TAATTCCATG = 321 reads: +382 validated
umi TAGGCGGTTG = 265 reads: +382 validated
umi TATCTTTCAG = 337 reads: +382 validated
umi TCATTTCCTA = 359 reads: +382 validated
umi TCCATTTCTG = 310 reads: +382 validated
umi TCCGATTGTT = 240 reads: +382 validated
umi TCCGGTTCAT = 211 reads: +382 validated
umi TGCATCCCTT = 377 reads: +382 validated
umi TGCTCACCTC = 236 reads: +382 validated
umi TGCTTACCTC = 315 reads: +382 validated
umi TTATCGGGAC = 219 reads: +382 validated
umi TTCCTCTGCT = 330 reads: +382 validated
umi TTCTAACGAC = 299 reads: +382 validated
umi TTCTTCGACA = 535 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi TTGCCAAACT = 231 reads: +382 validated
umi TTGCGTCCTC = 322 reads: +382 validated
umi TTGGTCCCGT = 334 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=39)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 36 umis using 570 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [132, 214, 322, 474, 560, 571, 594, 884, 993, 995] and 38 others
of which 48 are surviving nonsolos
reads assigned: 9169
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

TIG 2[bases=556]
38-286 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 79 umis using 3972 reads
cdr3 = CLHYDNRRRTF at 359, score = 9 + 8
umis assigned: [89, 284, 305, 378, 464, 486, 511, 515, 532, 548] and 72 others
of which 80 are surviving nonsolos
reads assigned: 24256
start codons at 38, 94, 107, 246, 369, 462
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGCGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3205 = TTATGCTGTTTACTCT-1

using 268 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[261]
surviving nonsolo ucounts = 1[261]
ids = [2]

====================================================================================

UMI info for barcode TTATGCTGTTTACTCT-1 contig 1 = AGCTTCAGCT...
umi GAATGCTTCA = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=530]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-530 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3206 = TTATGCTTCAACGGCC-1

using 401 reads

====================================================================================

graph has 370 edges initially, 6 edges after simplification

total ucounts = 182
nonsolo ucounts = 45[2^25, 3^9, 4^2, 5^2, 6, 7^2, 9, 11, 14, 114]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3208 = TTATGCTTCACAACGT-1

using 79 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[2^2, 3^2, 4, 5, 6, 7, 9, 10^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3225 = TTATGCTTCATGTCTT-1

using 596 reads

====================================================================================

graph has 230 edges initially, 36 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[244, 349]
surviving nonsolo ucounts = 2[244, 349]
ids = [3, 4]

====================================================================================

UMI info for barcode TTATGCTTCATGTCTT-1 contig 1 = AGGAGTCAGA...
umi CCTTGGTAAT = 245 reads: +388 validated
umi CTGCTTGGCG = 224 reads: +41 -1XX +10 -1XX +36 -1XX +3 -1XX +16 -1XX +2 -1XX +26 -2XX +6 -3XX +2 -1XX +1 -1XX +1 -5XX +2 -4XX +7 -45 +1 -1XX +1 -1XX +3 -2XX +2 -2XX +3 -1XX +8 -1XX +2 -1XX +3 -1XX +1 -1XX +20 -1XX +20 -1XX +5 -2XX +3 -2XX +2 -1XX +11 -1 +1 -5X +2 -5XX +1 -1XX +4 -4XX +1 -2XX +30 -2XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYWWTF at 354, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 451
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3233 = TTATGCTTCCGAACGC-1

using 310 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 9, 289]
surviving nonsolo ucounts = 1[289]
ids = [7]

====================================================================================

UMI info for barcode TTATGCTTCCGAACGC-1 contig 1 = AGGAGTCAGA...
umi TAACACTCCA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-484 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3236 = TTATGCTTCCTATGTT-1

using 258 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TTATGCTTCCTATGTT-1 contig 1 = GAGGGTCCTG...
umi TTCTTCGATT = 255 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=579]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
429-477 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
477-579 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARSTGDPPYFDYW at 404, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 252
start codons at 15, 59, 103, 495, 556
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3248 = TTATGCTTCTAACCGA-1

using 40 reads

====================================================================================

graph has 48 edges initially, 6 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2^5, 3^3, 6, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3253 = TTATGCTTCTCTAGGA-1

using 623 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 614]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3256 = TTATGCTTCTGGGCCA-1

using 393 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[389]
surviving nonsolo ucounts = 1[389]
ids = [3]

====================================================================================

UMI info for barcode TTATGCTTCTGGGCCA-1 contig 1 = AGAGCTCTGG...
umi TACAATGCGG = 385 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-376 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 63 reads
cdr3 = CQQYDVSPCSF at 368, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 44, 140, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3257 = TTATGCTTCTGTCAAG-1

using 271 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 4, 253]
surviving nonsolo ucounts = 1[253]
ids = [5]

====================================================================================

UMI info for barcode TTATGCTTCTGTCAAG-1 contig 1 = GAAGAGCTGC...
umi CAATAGTTCG = 231 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3269 = TTCCCAGAGAAGATTC-1

using 201 reads

====================================================================================

graph has 91 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 187]
surviving nonsolo ucounts = 1[187]
ids = [6]

====================================================================================

UMI info for barcode TTCCCAGAGAAGATTC-1 contig 1 = AGGAGTCAGT...
umi GGGCAGCTCC = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=15)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-471 ==> 0-56 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSHRIPITF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3280 = TTCCCAGAGAGAACAG-1

using 100 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 89]
surviving nonsolo ucounts = 1[89]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=384]
49-277 ==> 125-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=35)
291-327 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
327-384 ==> 0-57 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CAKNSGIYDW at 266, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 75, 80, 159, 188, 227, 288, 364
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3288 = TTCCCAGAGATCCCAT-1

using 10557 reads

====================================================================================

graph has 4619 edges initially, 60 edges after simplification

total ucounts = 877
nonsolo ucounts = 433[2^176, 3^92, 4^61, 5^32, 6^16, 7^16, 8^7, 9^3, 10, 12, 14, 80, 133, 140, 222, 232, 244, 252, 254, 256, 265, 273, 300, 301, 305^2, 317, 322, 327, 337, 338, 372, 387, 397, 415, 468, 726, 786]
surviving nonsolo ucounts = 27[80, 133, 140, 222, 232, 244, 252, 254, 256, 265, 273, 300, 301, 305^2, 317, 322, 327, 337, 338, 372, 387, 397, 415, 468, 726, 786]
ids = [375, 87, 30, 429, 95, 449, 870, 567, 135, 152, ...]

====================================================================================

UMI info for barcode TTCCCAGAGATCCCAT-1 contig 1 = TGGGGGATCA...
umi AACATATCTC = 294 reads: +397 validated
umi AACTGCTCAC = 303 reads: +397 validated
umi AAGCCTAGAC = 138 reads: +397 validated
umi ACCAATCTGT = 320 reads: +397 validated
umi ACCTCGCTGC = 475 reads: +397 validated
umi ACGTTTGGAC = 135 reads: +397 validated
umi ACTCTAATCT = 190 reads: -15 +3 -1XX +1 -1XX +2 -2XX +1 -2XX +1 -3XX +1 -15XX +349 invalidated
umi ACTTGTTTCT = 372 reads: -243X +2 -3 +2 -1 +2 -1 +143 invalidated
umi AGTTGGGTGC = 260 reads: +397 validated
umi CAATTCTGCA = 266 reads: +397 validated
umi CACGATCTCG = 341 reads: +397 validated
umi CATCTCGCCC = 323 reads: +397 validated
umi CATTCTAATA = 310 reads: +397 validated
umi CCCAAAGCAT = 310 reads: +397 validated
umi CCGAACCAGT = 387 reads: +397 validated
umi CGGCGCCTCC = 740 reads: +397 validated
umi CGTGGTCTGA = 81 reads: +397 validated
umi CTCTTTTGCA = 228 reads: +397 validated
umi CTGGAAGTGC = 337 reads: +397 validated
umi CTGTCACGCT = 244 reads: +397 validated
umi GACTTTAGAC = 392 reads: +397 validated
umi GCCATTTGCC = 268 reads: +397 validated
umi GCGTTGCAAA = 161 reads: -14X +4 -1XX +1 -1XX +2 -2XX +1 -2XX +1 -3XX +1 -15XX +349 invalidated
umi GGGCTACCTT = 336 reads: +397 validated
umi TCCCTTTCCT = 413 reads: +397 validated
umi TTTTCCCTCG = 252 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=28)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 1101 reads
cdr3 = CMQALQGPLTF at 371, score = 8 + 8
umis assigned: [15, 24, 30, 61, 73, 87, 95, 104, 135, 152] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7725
start codons at 35, 68, 104, 192, 216, 255, 354, 374, 474
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3294 = TTCCCAGAGATGCGAC-1

using 248 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode TTCCCAGAGATGCGAC-1 contig 1 = GGTGATCAGC...
umi CTTGCATGAG = 251 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=526]
0-31 ==> 49-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=1)
31-390 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=16)
407-455 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CTICGGRCPPRFDYW at 379, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 31, 84, 182, 187, 254, 311, 340
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3307 = TTCCCAGAGCTCCCAG-1

using 845 reads

====================================================================================

graph has 350 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 410, 424]
surviving nonsolo ucounts = 2[410, 424]
ids = [8, 1]

====================================================================================

UMI info for barcode TTCCCAGAGCTCCCAG-1 contig 1 = ATGAGCAAAA...
umi ACGTATCGCT = 425 reads: +379 validated

UMI info for barcode TTCCCAGAGCTCCCAG-1 contig 2 = GGGACTGATC...
umi TTACCCTCGG = 416 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=546]
0-31 ==> 33-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
31-373 ==> 0-342 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=13)
372-410 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CHQSSSLPQTF at 349, score = 10 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 415
start codons at 0, 31, 236, 332, 452
confident = false

TIG 2[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CMQALQTPLFTF at 372, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 405
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3311 = TTCCCAGAGGACTGGT-1

using 184 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [0]

====================================================================================

UMI info for barcode TTCCCAGAGGACTGGT-1 contig 1 = GCTTTCTGAG...
umi CAAACCATGA = 169 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=565]
35-172 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
172-298 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
419-465 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
465-565 ==> 0-100 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 374, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 35, 79, 344
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_104.3311_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3341 = TTCCCAGAGTTTCCTT-1

using 379 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 368]
surviving nonsolo ucounts = 1[368]
ids = [1]

====================================================================================

UMI info for barcode TTCCCAGAGTTTCCTT-1 contig 1 = GAGTCAGACT...
umi ATTACACATG = 374 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3347 = TTCCCAGCAACGATCT-1

using 309 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 9[2^4, 3, 5, 7, 9, 266]
surviving nonsolo ucounts = 1[266]
ids = [14]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3386 = TTCCCAGCAGGCGATA-1

using 98 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 85]
surviving nonsolo ucounts = 4[2, 3^2, 85]
ids = [4, 0, 2, 1]

====================================================================================

UMI info for barcode TTCCCAGCAGGCGATA-1 contig 1 = AGCCTGGGCC...
umi AAGTGACCAG = 3 reads: -79 +80 -44 +56 -117 non-validated
umi ACCAGTCGGG = 79 reads: +376 validated
umi AGGTCTACTT = 3 reads: -227 +55 -39X +55 invalidated
umi CGACTACCAG = 1 reads: -160 +47 -1 +8 -160 non-validated
umi CGGTTGGCCA = 2 reads: -100 +56 -217 +3 non-validated
umi GGCGAACCTC = 1 reads: -136 +4 -1 +18 -1 +1 -1 +30 -184 non-validated
umi TCCCGCTTCC = 1 reads: -117 +2 -1 +16 -1 +16 -1 +4 -2 +7 -1 +5 -203 non-validated
umi TCGATATCTA = 1 reads: -57 +56 -263 non-validated

GOOD CONTIGS

TIG 1[bases=498]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-374 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
416-498 ==> 0-82 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQAWDSTEVVF at 355, score = 6 + 8
umis assigned: [0, 1, 2, 3, 4, 5, 7, 8]
of which 4 are surviving nonsolos
reads assigned: 90
start codons at 40, 45, 334, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3388 = TTCCCAGCAGGTTTCA-1

using 38 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[2, 4, 6^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3390 = TTCCCAGCAGTCACTA-1

using 192 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[191]
surviving nonsolo ucounts = 1[191]
ids = [0]

====================================================================================

UMI info for barcode TTCCCAGCAGTCACTA-1 contig 1 = TGAGCGCAGA...
umi GGGTACGATA = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-502 ==> 0-78 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3394 = TTCCCAGCATAACCTG-1

using 100 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 13[2^2, 3^3, 4^2, 5, 7, 15, 16^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3400 = TTCCCAGCATCAGTCA-1

using 72 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[3^2, 4, 5, 6, 9, 11, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3404 = TTCCCAGCATCTCGCT-1

using 21 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 3^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3406 = TTCCCAGCATGTAAGA-1

using 7 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3421 = TTCCCAGGTACAGTGG-1

using 352 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2, 4^2, 5, 327]
surviving nonsolo ucounts = 1[327]
ids = [12]

====================================================================================

UMI info for barcode TTCCCAGGTACAGTGG-1 contig 1 = GGGGTCTGGG...
umi TAGGTCACTC = 325 reads: +392 -1 +13 non-validated

GOOD CONTIGS

TIG 1[bases=557]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=29)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARENDAFDIW at 422, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 80, 140, 231, 236, 294, 297, 383, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3442 = TTCCCAGGTCCAGTGC-1

using 355 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 340]
surviving nonsolo ucounts = 1[340]
ids = [5]

====================================================================================

UMI info for barcode TTCCCAGGTCCAGTGC-1 contig 1 = GGAATCAGTC...
umi GAAGGCGGCA = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3450 = TTCCCAGGTCTAAACC-1

using 4261 reads

====================================================================================

graph has 5372 edges initially, 118 edges after simplification

total ucounts = 1756
nonsolo ucounts = 969[2^390, 3^225, 4^133, 5^94, 6^42, 7^29, 8^21, 9^14, 10^9, 11^4, 12^3, 13, 15, 16, 21, 33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3460 = TTCCCAGGTCTCTTTA-1

using 26 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 104.3491 = TTCCCAGGTTCTGTTT-1

using 10249 reads

====================================================================================

graph has 5406 edges initially, 52 edges after simplification

total ucounts = 963
nonsolo ucounts = 468[2^206, 3^87, 4^50, 5^44, 6^19, 7^14, 8^5, 9^3, 10^2, 11^2, 14, 15^3, 20, 67, 86, 134, 161, 207, 212, 214, 220, 237, 246, 258^2, 268, 274, 277, 281, 291, 293, 296, 297, 300, 311, 318^3, 323, 331, 336, 355, 386, 388]
surviving nonsolo ucounts = 31[67, 86, 134, 161, 207, 212, 214, 220, 237, 246, 258^2, 268, 274, 277, 281, 291, 293, 296, 297, 300, 311, 318^3, 323, 331, 336, 355, 386, 388]
ids = [220, 836, 337, 72, 413, 710, 328, 897, 509, 339, ...]

====================================================================================

UMI info for barcode TTCCCAGGTTCTGTTT-1 contig 1 = GGGGAGGAGT...
umi ACGGCCCCAT = 316 reads: +388 validated
umi ATCAAGTGGA = 295 reads: +388 validated
umi ATCTTTCGGA = 284 reads: +388 validated
umi ATTCGTACCG = 328 reads: +388 validated
umi CATTCGTCCC = 357 reads: +388 validated
umi CCCCCATCGG = 242 reads: +388 validated
umi CCCGGGCCCT = 321 reads: +388 validated
umi CGGTGTCGTC = 320 reads: +388 validated
umi CTTATGGGGT = 273 reads: +388 validated
umi GAAATTTGCG = 270 reads: +388 validated
umi GAGTCGGCCA = 298 reads: +388 validated
umi GATATCTGGA = 301 reads: +388 validated
umi GCAGTGTCTA = 297 reads: +388 validated
umi GCGTCTCTCC = 337 reads: +388 validated
umi GTACCCTCCT = 289 reads: +388 validated
umi GTATACGCTG = 313 reads: +388 validated

UMI info for barcode TTCCCAGGTTCTGTTT-1 contig 2 = ACCTCTGGGA...
umi ACATATGAAT = 143 reads: +433 validated
umi ATTCCCCTGA = 65 reads: +433 validated
umi CAGGTACGGG = 280 reads: +433 validated
umi CCATCGTCGT = 212 reads: +433 validated
umi CCCATACCTG = 133 reads: +378 -1 +54 non-validated
umi CGGACGTGCT = 208 reads: +433 validated
umi GAATCTTGCA = 235 reads: +433 validated
umi GCCAGTCCAC = 260 reads: +433 validated
umi TACTATGGAG = 215 reads: +433 validated
umi TATTTACCTT = 254 reads: +433 validated
umi TGCCGTATTG = 87 reads: +409 -24 non-validated
umi TTCCTTGCTA = 225 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=555]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=10)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 773 reads
cdr3 = CQQSHITPRTF at 358, score = 9 + 8
umis assigned: [93, 173, 192, 222, 306, 339, 343, 422, 474, 504] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4772
start codons at 31, 37, 93, 106, 461
confident = true

TIG 2[bases=584]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=1)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=10)
464-513 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 123 reads
cdr3 = CTTDKGTRLQLQDGYDPW at 428, score = 9 + 7
umis assigned: [72, 220, 278, 328, 337, 413, 509, 562, 710, 741] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2256
start codons at 80, 236, 303, 360, 389, 471
confident = true

REJECT CONTIGS

TIG 1[bases=453]
0-73 ==> 7-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
0-73 ==> 7073-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=1)
0-73 ==> 7067-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=1)
42-109 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
73-164 ==> 0-91 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=2)
164-212 ==> 132-180 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=1) [SHIFT!]
210-301 ==> 260-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=5)
307-330 ==> 0-23 on |28|IGHD5-12|D-REGION| [len=23] (mis=4)
336-382 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
382-453 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CAKDLPDIVATIDSPEVTTGAREPWSPSPQGVHPPQPF at 292, score = 8 + 4
umis assigned: [124, 352, 578]
of which 3 are surviving nonsolos
reads assigned: 1098
start codons at 73, 183, 188, 253
confident = false
frameshifted full length stopped transcript of length 453
VJ delta = 182
delta too large
not full
not full
now this is a cell
paired!

ACAGCCGTGTATTATTGTACCACAGATAAGGGAACCCGACTGCAGTTACAGGACGGTTATGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTCACATTACCCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
sorting bam, mem = 0.12
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk104-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk104-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

129.210 seconds used processing barcodes, peak mem = 0.29
