[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.13 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk103-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk103-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk103.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.0 = TGCTACCTCCAAACAC-1

using 2033 reads

====================================================================================

graph has 2752 edges initially, 36 edges after simplification

total ucounts = 997
nonsolo ucounts = 448[2^199, 3^98, 4^77, 5^26, 6^27, 7^9, 8^2, 9^2, 10^2, 11^3, 13^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.7 = TGCTACCTCCCGGATG-1

using 493 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 488]
surviving nonsolo ucounts = 1[488]
ids = [1]

====================================================================================

UMI info for barcode TGCTACCTCCCGGATG-1 contig 1 = AGGAGTCAGT...
umi CACATGCATG = 484 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 483
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.17 = TGCTACCTCGATAGAA-1

using 539 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[538]
surviving nonsolo ucounts = 1[538]
ids = [0]

====================================================================================

UMI info for barcode TGCTACCTCGATAGAA-1 contig 1 = GATCAGGACT...
umi CCCTGTTGCC = 538 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 83 reads
cdr3 = CMQALQTPVTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 533
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.22 = TGCTACCTCGGAAACG-1

using 250 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[2, 239]
surviving nonsolo ucounts = 1[239]
ids = [6]

====================================================================================

UMI info for barcode TGCTACCTCGGAAACG-1 contig 1 = GATCAGGACT...
umi GCATATGCTT = 229 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-513 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.28 = TGCTACCTCTCAACTT-1

using 249 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 239]
surviving nonsolo ucounts = 2[4, 239]
ids = [3, 5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
0-54 ==> 5938-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
27-339 ==> 0-312 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=54)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
418-550 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSVASGVF at 366, score = 3 + 7
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 238
start codons at 27, 166, 306
confident = false
not full
full length stopped transcript of length 550
frameshifted full length stopped transcript of length 550
VJ delta = 5
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.31 = TGCTACCTCTCGTATT-1

using 258 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 249]
surviving nonsolo ucounts = 1[249]
ids = [3]

====================================================================================

UMI info for barcode TGCTACCTCTCGTATT-1 contig 1 = GGGGGCACCA...
umi GTGGGAGGTG = 218 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=432]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=10)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 53 reads
cdr3 = CLLNYSGAWVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.32 = TGCTACCTCTCTAGGA-1

using 530 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 154, 365]
surviving nonsolo ucounts = 2[154, 365]
ids = [2, 3]

====================================================================================

UMI info for barcode TGCTACCTCTCTAGGA-1 contig 1 = GTCAGTCCCA...
umi CCCCACTATA = 156 reads: -1 +387 non-validated
umi CTTCGGCCAG = 370 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 75 reads
cdr3 = CQQYDDLPITF at 350, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 517
start codons at 23, 29, 85, 98, 360, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.33 = TGCTACCTCTCTGTCG-1

using 664 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 197, 458]
surviving nonsolo ucounts = 2[197, 458]
ids = [6, 3]

====================================================================================

UMI info for barcode TGCTACCTCTCTGTCG-1 contig 1 = AGCTTCAGCT...
umi AATGCCCGGG = 453 reads: +388 validated
umi TAAAGGCTAT = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-574 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 85 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 637
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.36 = TGCTACCTCTGCGGCA-1

using 218 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3^2, 4, 200]
surviving nonsolo ucounts = 1[200]
ids = [5]

====================================================================================

UMI info for barcode TGCTACCTCTGCGGCA-1 contig 1 = GAGTCAGACC...
umi CCATACCCTA = 1 reads: -175 +1 -1X +1 -1X +3 -1X +1 -6 +1 -1 +1 -2 +3 -1 +1 -2 +1 -5 +1 -4X +1 -1 +1 -2 +2 -3 +8 -157 invalidated
umi CCATACGGTA = 184 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=461]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-461 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQFNTDSWTF at 352, score = 8 + 8
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.43 = TGCTGCTAGAACAACT-1

using 189 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 5, 172]
surviving nonsolo ucounts = 1[172]
ids = [6]

====================================================================================

UMI info for barcode TGCTGCTAGAACAACT-1 contig 1 = TTTCTGAGAG...
umi CTAGTATCAA = 159 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=478]
0-33 ==> 112-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
33-383 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
398-448 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
448-478 ==> 0-30 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDFPGNYFTFDIW at 372, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 33, 77, 157, 227, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.45 = TGCTGCTAGACAAAGG-1

using 443 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^4, 428]
surviving nonsolo ucounts = 1[428]
ids = [4]

====================================================================================

UMI info for barcode TGCTGCTAGACAAAGG-1 contig 1 = CCACATCCCT...
umi CAGTTACTGT = 431 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=555]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=2)
395-426 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=4)
421-484 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARSYYDFWSGYQYYYYYGMDVW at 384, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 424
start codons at 42, 193, 198, 240, 245, 262, 339, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.68 = TGCTGCTAGCTAGTTC-1

using 92 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^3, 4, 6, 7, 9, 12^2, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.74 = TGCTGCTAGGAGTACC-1

using 317 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode TGCTGCTAGGAGTACC-1 contig 1 = GAATCAGTCC...
umi CGCAGGTCCT = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.79 = TGCTGCTAGGGAACGG-1

using 1598 reads

====================================================================================

graph has 482 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 5, 1579]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=369]
17-170 ==> 0-153 on rc of segment before IGHD3-9 exon 1 [len=153] (mis=1)
204-267 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
267-369 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [12]
of which 0 are surviving nonsolos
reads assigned: 1561
start codons at 46, 78, 178, 224, 285, 346
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.87 = TGCTGCTAGTACGACG-1

using 770 reads

====================================================================================

graph has 276 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 214, 550]
surviving nonsolo ucounts = 2[214, 550]
ids = [5, 6]

====================================================================================

UMI info for barcode TGCTGCTAGTACGACG-1 contig 1 = GCTCTGCTTC...
umi TCCTGATCAG = 203 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-400 ==> 0-349 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-531 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLTYVVF at 375, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 51, 205, 208, 259, 358, 385, 403
confident = false

REJECT CONTIGS

TIG 1[bases=399]
0-226 ==> 134-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=7)
225-263 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
263-399 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTHWPWTF at 202, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 542
start codons at 23, 185, 205, 305
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 103.98 = TGCTGCTAGTTTAGGA-1

using 7144 reads

====================================================================================

graph has 5854 edges initially, 68 edges after simplification

total ucounts = 1747
nonsolo ucounts = 928[2^413, 3^227, 4^119, 5^63, 6^36, 7^24, 8^7, 9^5, 10, 11^3, 12^2, 13^2, 14^2, 16, 17, 21, 32, 44, 58, 72, 78, 89, 90, 93, 108, 128, 150, 178, 203, 213, 228, 232, 234, 259, 280, 289, 309]
surviving nonsolo ucounts = 19[21, 44, 58, 72, 78, 90, 93, 108, 128, 178, 203, 213, 228, 232, 234, 259, 280, 289, 309]
ids = [1158, 1106, 1102, 1606, 1082, 609, 49, 507, 1133, 1287, ...]

====================================================================================

UMI info for barcode TGCTGCTAGTTTAGGA-1 contig 1 = GAGCTACAAC...
umi CATGCCTCCG = 237 reads: +397 validated
umi CGGTAAATTT = 232 reads: +397 validated
umi CTATAACCTA = 208 reads: +397 validated
umi GATGGGAGAG = 308 reads: +397 validated
umi GTAGTGTGCT = 58 reads: +397 validated
umi GTCTATCAGG = 125 reads: +397 validated
umi GTGGATCACA = 304 reads: +310 -1XX +86 invalidated
umi TCCCCAGCCT = 212 reads: +397 validated
umi TGCAGCTAGC = 229 reads: +397 validated

UMI info for barcode TGCTGCTAGTTTAGGA-1 contig 2 = GAGCTCTGGG...
umi ACCCTGGGCT = 87 reads: +206 -4XX +1 -2XX +189 -1 +12 invalidated
umi CCTGCGTGGC = 113 reads: +207 -7XX +1 -4XX +196 invalidated
umi CGTAGTGCAT = 88 reads: +408 -1 +2 -4 non-validated
umi GTAATTCCCA = 77 reads: +352 -45 +2 -1 +15 non-validated
umi GTATCTGGTT = 42 reads: +292 -13 +92 -18 non-validated
umi GTGGGATCAA = 21 reads: +146 -55 +81 -85 +1 -1 +1 -1 +1 -2 +9 -1 +31 non-validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-185 ==> 0-155 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
185-382 ==> 158-355 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 214 reads
cdr3 = CQQYYTHVWTF at 366, score = 9 + 8
umis assigned: [277, 593, 667, 877, 1102, 1133, 1157, 1362, 1482]
of which 9 are surviving nonsolos
reads assigned: 1875
start codons at 30, 99, 246, 292, 349, 385, 469
confident = true
see deletion of 3 bases at pos 155 on |296|IGKV4-1|L-REGION+V-REGION|

TIG 2[bases=566]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=25)
460-495 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
495-566 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 16 reads
cdr3 = CARDAPGETAMVGW at 422, score = 7 + 7
umis assigned: [49, 507, 609, 1082, 1106, 1158]
of which 6 are surviving nonsolos
reads assigned: 417
start codons at 80, 231, 236, 287, 294, 297, 315, 362, 383, 413, 432, 452
confident = true

REJECT CONTIGS

TIG 1[bases=620]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-358 ==> 0-312 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=12)
385-409 ==> 14-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
409-620 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
cdr3 = CAAWDALGP at 367, score = 6 + 4
umis assigned: [254, 1287, 1606, 1746]
of which 4 are surviving nonsolos
reads assigned: 777
start codons at 46, 350, 380, 534, 541
confident = false
not full
frameshifted full length transcript of length 620
VJ delta = 33
not full
now this is a cell
paired!

AGAGCAGACGACACGGCTATGTATTACTGTGCGAGAGATGCCCCGGGGGAGACAGCTATGGTTGGCTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCACTTTATTACTGTCAGCAATATTATACCCATGTGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk103-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk103-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

3.190 seconds used processing barcodes, peak mem = 0.23
