[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.25 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk095-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk095-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk095.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.0 = TCAATCTCAGCAGTTT-1

using 1130 reads

====================================================================================

graph has 408 edges initially, 14 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[203, 209^2, 246, 259]
surviving nonsolo ucounts = 5[203, 209^2, 246, 259]
ids = [8, 4, 7, 2, 6]

====================================================================================

UMI info for barcode TCAATCTCAGCAGTTT-1 contig 1 = AGCTTCAGCT...
umi CTAACCCTCC = 250 reads: +388 validated
umi GCCTTATTGG = 259 reads: +388 validated
umi GGAACCTGGG = 203 reads: +388 validated
umi TGGGTTCGGG = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-589 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 170 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2, 6, 7, 8]
of which 4 are surviving nonsolos
reads assigned: 896
start codons at 47, 201, 351, 376, 381
confident = true

REJECT CONTIGS

TIG 1[bases=567]
3-81 ==> 11265-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
35-374 ==> 0-339 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=0)
375-413 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
413-567 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 25, 35, 96, 165, 183, 333
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2 = TCAATCTCAGCGTAAG-1

using 296 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 10, 277]
surviving nonsolo ucounts = 1[277]
ids = [6]

====================================================================================

UMI info for barcode TCAATCTCAGCGTAAG-1 contig 1 = AGTGCTTTCT...
umi TCGGCGTCGA = 250 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=482]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=19)
437-456 ==> 33-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
456-482 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARGAARSPSVFIDSW at 377, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 17, 38, 82, 112, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.5 = TCAATCTCAGCTGTTA-1

using 1845 reads

====================================================================================

graph has 2586 edges initially, 18 edges after simplification

total ucounts = 799
nonsolo ucounts = 338[2^149, 3^79, 4^39, 5^33, 6^11, 7^6, 8^8, 9^4, 10^3, 12^3, 13, 17, 224]
surviving nonsolo ucounts = 1[224]
ids = [470]

====================================================================================

UMI info for barcode TCAATCTCAGCTGTTA-1 contig 1 = GATCAGGACT...
umi GCGCATCCGT = 225 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=484]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=9)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-484 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [470]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.6 = TCAATCTCAGGGTTAG-1

using 294 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 285]
surviving nonsolo ucounts = 1[285]
ids = [2]

====================================================================================

UMI info for barcode TCAATCTCAGGGTTAG-1 contig 1 = AGTCCCAACC...
umi CCCCTTTTCT = 285 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDNLPPLTF at 347, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 20, 26, 82, 95, 234, 357, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.7 = TCAATCTCAGGTGCCT-1

using 1649 reads

====================================================================================

graph has 610 edges initially, 10 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 121, 128, 146, 189, 505, 555]
surviving nonsolo ucounts = 6[121, 128, 146, 189, 505, 555]
ids = [6, 9, 7, 3, 8, 1]

====================================================================================

UMI info for barcode TCAATCTCAGGTGCCT-1 contig 1 = AGCTCTGAGA...
umi ACCTGTGAAT = 546 reads: +424 validated
umi CGTCAGTTTT = 122 reads: +424 validated
umi TCACCTTCTC = 128 reads: +415 -9 non-validated

UMI info for barcode TCAATCTCAGGTGCCT-1 contig 2 = AGCTTCAGCT...
umi CCCCTTGCTT = 185 reads: +388 validated
umi GCCTCTCGCT = 506 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=639]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-639 ==> 0-136 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 70 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1, 6, 9]
of which 3 are surviving nonsolos
reads assigned: 784
start codons at 79, 230, 235, 382, 460
confident = true

TIG 2[bases=579]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-579 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 109 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3, 8]
of which 2 are surviving nonsolos
reads assigned: 679
start codons at 47, 201, 351, 376, 381
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGCGGCGACAGCTCGTCTTGGCGGTATGGACGTCTGGGGCCAAGGGACCGCGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGCTTATTACTGTGCATCATGGGATGACAGCCTGCGTGGTCGGGTGTTTGGCGGTGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.12 = TCAATCTCATCGGAAG-1

using 190 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 182]
surviving nonsolo ucounts = 1[182]
ids = [5]

====================================================================================

UMI info for barcode TCAATCTCATCGGAAG-1 contig 1 = AAGCCCCTGG...
umi TAGTACGTCC = 149 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=464]
0-27 ==> 31-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
27-380 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=2)
386-417 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=5)
417-463 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
junction support: 1 umis using 12 reads
cdr3 = CASNPIDYYDSSGYYRTHDYW at 369, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 27, 178, 225, 324, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.15 = TCAATCTCATGGAATA-1

using 59 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[3^4, 4, 37]
surviving nonsolo ucounts = 1[37]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.19 = TCAATCTCATTGTGCA-1

using 155 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[7, 24, 119]
surviving nonsolo ucounts = 1[119]
ids = [6]

====================================================================================

UMI info for barcode TCAATCTCATTGTGCA-1 contig 1 = AACAACCACA...
umi TATCTAGATT = 2 reads: -381X +1 -6X +1 -2X +1 -1X +3 -2X +14 -1X +20 invalidated
umi TCGGCTTGGG = 115 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=517]
0-51 ==> 7-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
51-404 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=42)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
484-517 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CGREFEGFCTDGSCYGFDYW at 393, score = 10 + 7
umis assigned: [4, 6]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 51, 348, 424, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.20 = TCAATCTCATTTCAGG-1

using 198 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [4]

====================================================================================

UMI info for barcode TCAATCTCATTTCAGG-1 contig 1 = AGTCCCAGTC...
umi TATTCGATAT = 178 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-472 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQLNSYPRTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.29 = TCAATCTGTAGGAGTC-1

using 727 reads

====================================================================================

graph has 320 edges initially, 6 edges after simplification

total ucounts = 19
nonsolo ucounts = 12[2, 4^4, 5, 8, 10^2, 18, 272, 379]
surviving nonsolo ucounts = 2[272, 379]
ids = [10, 0]

====================================================================================

UMI info for barcode TCAATCTGTAGGAGTC-1 contig 1 = GATCAGGACT...
umi CTCGTCCGAA = 275 reads: +397 validated

UMI info for barcode TCAATCTGTAGGAGTC-1 contig 2 = GGGGAGACTC...
umi ACAGATGCAT = 378 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

TIG 2[bases=548]
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYNGQSRAF at 351, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 24, 30, 99, 235, 238, 331, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.30 = TCAATCTGTATAGTAG-1

using 164 reads

====================================================================================

graph has 67 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 157]
surviving nonsolo ucounts = 1[157]
ids = [0]

====================================================================================

UMI info for barcode TCAATCTGTATAGTAG-1 contig 1 = AGGAGTCAGA...
umi ATTAGTTCGT = 155 reads: +388 validated
umi TCGGCTTAAC = 4 reads: -26 +6 -1 +15 -1X +12 -2X +10 -1X +2 -1 +4 -150 +4 -1X +22 -2X +8 -1X +18 -1X +20 -1X +3 -1X +4 -1X +11 -59 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=14)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNSYSGTF at 354, score = 8 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.32 = TCAATCTGTCCATCCT-1

using 38 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.43 = TCAATCTGTGAAGGCT-1

using 249 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 238]
surviving nonsolo ucounts = 2[8, 238]
ids = [4, 2]

====================================================================================

UMI info for barcode TCAATCTGTGAAGGCT-1 contig 1 = GGGATCACAC...
umi GGATCTAAGG = 238 reads: +427 validated
umi TTTAATAGAC = 8 reads: -39 +80 -57 +78 -1X +26 -1 +2 -1 +1 -1 +3 -2 +1 -1 +1 -1 +1 -2 +2 -1 +2 -1 +20 -1 +18 -1 +16 -66 invalidated

GOOD CONTIGS

TIG 1[bases=494]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=0)
446-487 ==> 22-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CATDRPHKNYGDIRADVW at 402, score = 9 + 7
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 236
start codons at 60, 216, 258, 280, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.44 = TCAATCTGTGACGCCT-1

using 190 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 182]
surviving nonsolo ucounts = 1[182]
ids = [2]

====================================================================================

UMI info for barcode TCAATCTGTGACGCCT-1 contig 1 = GGAGGAACTG...
umi CCGACCGTCG = 175 reads: +388 validated
umi CTGACCGTCT = 2 reads: -111 +6 -1 +1 -2 +1 -1 +1 -2 +1 -3 +1 -1 +2 -1 +1 -1 +1 -3X +3 -1 +3 -2 +1 -1 +4 -3 +5 -1 +2 -221 invalidated

GOOD CONTIGS

TIG 1[bases=492]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
422-492 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQHSNWPLMYTF at 355, score = 9 + 8
umis assigned: [2, 4]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 34, 239, 242, 382, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.55 = TCAATCTGTTCGCTAA-1

using 702 reads

====================================================================================

graph has 228 edges initially, 24 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[219, 481]
surviving nonsolo ucounts = 2[219, 481]
ids = [2, 3]

====================================================================================

UMI info for barcode TCAATCTGTTCGCTAA-1 contig 1 = GGGAAGCTCA...
umi TATATATTTG = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=611]
0-56 ==> 58-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
56-409 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=23)
406-444 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
444-611 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAAWDDSLTVVLF at 377, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 56, 270, 360, 390
confident = false

REJECT CONTIGS

TIG 1[bases=598]
1-28 ==> 5785-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
23-89 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
42-228 ==> 0-186 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
229-394 ==> 186-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=2) [SHIFT!]
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-598 ==> 0-167 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTWVF at 367, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 465
start codons at 42, 199, 244, 251, 254
confident = false
not full
frameshifted full length stopped transcript of length 598
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.56 = TCAATCTGTTCTGGTA-1

using 229 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 221]
surviving nonsolo ucounts = 1[221]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.60 = TCAATCTGTTGTGGCC-1

using 245 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode TCAATCTGTTGTGGCC-1 contig 1 = GAGTCAGTCT...
umi CAGTCCAAGC = 231 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=476]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-476 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.62 = TCAATCTTCAAACGGG-1

using 141 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[136]
surviving nonsolo ucounts = 1[136]
ids = [3]

====================================================================================

UMI info for barcode TCAATCTTCAAACGGG-1 contig 1 = TCTCAGGAGG...
umi CCCTGTGGCA = 135 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=529]
0-34 ==> 7-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
34-354 ==> 0-320 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
419-529 ==> 0-110 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSDGGPTRIF at 358, score = 7 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 34, 191, 242, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.68 = TCAATCTTCACAGTAC-1

using 670 reads

====================================================================================

graph has 190 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 190, 475]
surviving nonsolo ucounts = 2[190, 475]
ids = [1, 4]

====================================================================================

UMI info for barcode TCAATCTTCACAGTAC-1 contig 1 = GCTCAGCTTC...
umi CACACCGGCC = 187 reads: +388 validated

UMI info for barcode TCAATCTTCACAGTAC-1 contig 2 = TGAGCGCAGA...
umi TTGGCGGCAC = 465 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=603]
0-51 ==> 63-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
51-404 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
401-439 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
439-603 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASWDDSLRGRVF at 372, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 51, 205, 355, 380, 385
confident = false

TIG 2[bases=588]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-588 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 462
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.78 = TCAATCTTCATAAAGG-1

using 1289 reads

====================================================================================

graph has 1463 edges initially, 20 edges after simplification

total ucounts = 412
nonsolo ucounts = 210[2^73, 3^46, 4^24, 5^28, 6^14, 7^7, 8^5, 9^3, 10^2, 11^3, 12^2, 13^2, 264]
surviving nonsolo ucounts = 1[264]
ids = [27]

====================================================================================

UMI info for barcode TCAATCTTCATAAAGG-1 contig 1 = GCTCTGCCTC...
umi ACTCGACTCA = 260 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=575]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-575 ==> 0-130 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [27]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.99 = TCAATCTTCGGAGGTA-1

using 1540 reads

====================================================================================

graph has 506 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 243, 1291]
surviving nonsolo ucounts = 2[243, 1291]
ids = [0, 1]

====================================================================================

UMI info for barcode TCAATCTTCGGAGGTA-1 contig 1 = AGCTCAGCTT...
umi ATATGCCACC = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=651]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-360 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-651 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CVAWDDSLYAWVF at 373, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 52, 356, 386, 398
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.105 = TCAATCTTCTAACGGT-1

using 908 reads

====================================================================================

graph has 1304 edges initially, 2 edges after simplification

total ucounts = 369
nonsolo ucounts = 169[2^72, 3^40, 4^27, 5^14, 6^6, 7^3, 8^3, 9^2, 13, 154]
surviving nonsolo ucounts = 1[154]
ids = [80]

====================================================================================

UMI info for barcode TCAATCTTCTAACGGT-1 contig 1 = GGGAGGAACT...
umi CAGAGCTGGT = 146 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=448]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-448 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYHNWPPYTF at 356, score = 9 + 7
umis assigned: [80]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 35, 104
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.121 = TCACAAGAGACAAAGG-1

using 1340 reads

====================================================================================

graph has 392 edges initially, 20 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[208, 233, 261, 314, 321]
surviving nonsolo ucounts = 5[208, 233, 261, 314, 321]
ids = [2, 7, 4, 0, 5]

====================================================================================

UMI info for barcode TCACAAGAGACAAAGG-1 contig 1 = AGAGCTGCTC...
umi ATTGCAATTG = 285 reads: +385 validated

UMI info for barcode TCACAAGAGACAAAGG-1 contig 2 = AGCTTCAGCT...
umi TATGGGCCTA = 322 reads: +388 validated
umi TGCATTTCAT = 232 reads: +388 validated

UMI info for barcode TCACAAGAGACAAAGG-1 contig 3 = GGGGTCTCAG...
umi CCCACTAGTG = 212 reads: +111 -1XX +276 invalidated
umi CTGTTAGGTG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-362 ==> 0-331 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-464 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQLFGNLLYTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 31, 239, 458
confident = false

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 548
start codons at 47, 201, 351, 376, 381
confident = false

TIG 3[bases=637]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-389 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 61 reads
cdr3 = CSSYTTSSTVVF at 362, score = 8 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 464
start codons at 38, 174, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.125 = TCACAAGAGACGCTTT-1

using 1831 reads

====================================================================================

graph has 1578 edges initially, 20 edges after simplification

total ucounts = 424
nonsolo ucounts = 179[2^92, 3^32, 4^25, 5^11, 6^5, 7^5, 8, 9, 10, 12, 65, 104, 165, 299, 413]
surviving nonsolo ucounts = 4[104, 165, 299, 413]
ids = [345, 204, 54, 301]

====================================================================================

UMI info for barcode TCACAAGAGACGCTTT-1 contig 1 = GCTCTCTCTC...
umi ACGCCTCTTC = 308 reads: +379 validated
umi ATCACTTCTA = 7 reads: -32X +1 -1X +1 -1XX +1 -6XX +2 -3XX +3 -2XX +4 -3XX +1 -1XX +2 -1XX +20 -1XX +3 -1XX +1 -1XX +1 -1XX +4 -1XX +2 -1XX +4 -2XX +1 -1X +2 -1X +4 -1X +1 -260 invalidated
umi CTGTTATTTT = 165 reads: +322 -6 +51 non-validated
umi TCGAGGCACT = 105 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=768]
178-509 ==> 0-331 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=13)
519-557 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
557-768 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 76 reads
cdr3 = CQAWDTNSAWVF at 493, score = 6 + 8
umis assigned: [54, 101, 204, 345]
of which 3 are surviving nonsolos
reads assigned: 566
start codons at 178, 183, 239, 326, 476
confident = true

REJECT CONTIGS

TIG 1[bases=515]
9-70 ==> 2164-2225 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=2)
69-265 ==> 2240-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=3)
303-355 ==> 11-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
355-515 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
umis assigned: [301]
of which 1 are surviving nonsolos
reads assigned: 408
start codons at 4, 36, 42, 267, 270, 312, 409
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.128 = TCACAAGAGATATGGT-1

using 52 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[52]
surviving nonsolo ucounts = 1[52]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.133 = TCACAAGAGCTTATCG-1

using 62 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 55]
surviving nonsolo ucounts = 1[55]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.134 = TCACAAGAGCTTTGGT-1

using 138 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 132]
surviving nonsolo ucounts = 1[132]
ids = [2]

====================================================================================

UMI info for barcode TCACAAGAGCTTTGGT-1 contig 1 = CTCAGGAGGC...
umi CGCGATTTGC = 127 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=510]
33-384 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-510 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSYTSSSTFVVF at 357, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 33, 190, 234, 241, 244
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.136 = TCACAAGAGGCCCTCA-1

using 223 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 15, 200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================

UMI info for barcode TCACAAGAGGCCCTCA-1 contig 1 = AGTCTGGGCC...
umi ATTCTTTCGA = 195 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=519]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-519 ==> 0-97 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.142 = TCACAAGAGTAGGCCA-1

using 204 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 197]
surviving nonsolo ucounts = 1[197]
ids = [1]

====================================================================================

UMI info for barcode TCACAAGAGTAGGCCA-1 contig 1 = AGGAGTCAGA...
umi CGCTTGACCA = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-475 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.143 = TCACAAGAGTCAATAG-1

using 12 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.149 = TCACAAGCAAGCTGAG-1

using 458 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 167, 283]
surviving nonsolo ucounts = 2[167, 283]
ids = [3, 5]

====================================================================================

UMI info for barcode TCACAAGCAAGCTGAG-1 contig 1 = AGTCCCAACC...
umi TTGTACTGTC = 289 reads: +385 validated

UMI info for barcode TCACAAGCAAGCTGAG-1 contig 2 = TCTCAGGAGG...
umi TCGTCACGCA = 154 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYDNLFTF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false

TIG 2[bases=445]
0-34 ==> 129-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
34-388 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
422-445 ==> 0-23 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYAGSNNLVF at 358, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 34, 191, 235, 242, 341, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.153 = TCACAAGCAATCTACG-1

using 234 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3^2, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

UMI info for barcode TCACAAGCAATCTACG-1 contig 1 = AAAAACCACA...
umi CGTGCGTCGG = 225 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-522 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.159 = TCACAAGCACAGGCCT-1

using 539 reads

====================================================================================

graph has 194 edges initially, 22 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[203, 328]
surviving nonsolo ucounts = 2[203, 328]
ids = [1, 8]

====================================================================================

UMI info for barcode TCACAAGCACAGGCCT-1 contig 1 = AGATTCCTCC...
umi AATCTACGGT = 195 reads: +424 validated

UMI info for barcode TCACAAGCACAGGCCT-1 contig 2 = AGCATCATCC...
umi TAAACTCCAG = 311 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=511]
44-395 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
468-511 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARLQVDAPLAHGGDYW at 386, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 44, 242, 405
confident = false

TIG 2[bases=510]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=11)
420-451 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=7)
443-494 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
junction support: 1 umis using 24 reads
cdr3 = CARAPRYYYDNSGINCFDPW at 403, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 61, 217, 259, 265, 325, 358, 428
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.161 = TCACAAGCACATTCGA-1

using 190 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 177]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.168 = TCACAAGCACGTGAGA-1

using 5665 reads

====================================================================================

graph has 4005 edges initially, 72 edges after simplification

total ucounts = 721
nonsolo ucounts = 536[2^85, 3^56, 4^60, 5^60, 6^48, 7^46, 8^32, 9^31, 10^22, 11^17, 12^25, 13^11, 14^7, 15^12, 16^3, 17^7, 19^2, 21, 23, 24, 42, 104, 150, 188, 234, 244, 246, 340, 508]
surviving nonsolo ucounts = 8[104, 150, 188, 234, 244, 246, 340, 508]
ids = [460, 83, 144, 585, 363, 616, 3, 384]

====================================================================================

UMI info for barcode TCACAAGCACGTGAGA-1 contig 1 = TCTGAGGATA...
umi ATACGACGTT = 148 reads: +391 validated
umi CAGATGAGAA = 194 reads: +391 validated
umi GTCCGGTCAG = 104 reads: +391 validated
umi TGAATTTCAG = 235 reads: +391 validated
umi TGCTTGCTGA = 245 reads: +391 validated

UMI info for barcode TCACAAGCACGTGAGA-1 contig 2 = TGGGGGACTC...
umi AAATGATCTA = 317 reads: +424 validated
umi GAGTAATGGG = 224 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=688]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
86-439 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=8)
439-477 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
477-688 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 136 reads
cdr3 = CQSHDSSTPWVF at 413, score = 6 + 8
umis assigned: [83, 144, 460, 585, 616]
of which 5 are surviving nonsolos
reads assigned: 915
start codons at 86, 149, 240, 291, 423
confident = true

TIG 2[bases=548]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=5)
400-446 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
446-548 ==> 0-102 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 78 reads
cdr3 = CAHRRVSSSWPRIDNW at 367, score = 7 + 7
umis assigned: [3, 363]
of which 2 are surviving nonsolos
reads assigned: 534
start codons at 22, 66, 173, 245, 248, 328, 337, 500
confident = true
now this is a cell
paired!

GTGGACACAGCCACATATTACTGTGCACACAGACGCGTAAGTAGCAGCTGGCCACGAATTGACAACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTGAGGACTGAGGACGAGGCTGATTACTACTGTCAGTCTCATGATAGCAGCACTCCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.182 = TCACAAGCATATACGC-1

using 237 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.190 = TCACAAGCATTACCTT-1

using 50 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[49]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.194 = TCACAAGGTAGAGCTG-1

using 356 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 347]
surviving nonsolo ucounts = 1[347]
ids = [0]

====================================================================================

UMI info for barcode TCACAAGGTAGAGCTG-1 contig 1 = GAGGAACTGC...
umi AGAGTGGCCT = 353 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNNWPSWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.206 = TCACAAGGTGACGGTA-1

using 284 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 1[278]
ids = [1]

====================================================================================

UMI info for barcode TCACAAGGTGACGGTA-1 contig 1 = AGAGCTGCTC...
umi AACCTCAATG = 252 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
416-486 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQHATSPFTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.214 = TCACAAGGTTACCGAT-1

using 436 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[11, 129, 291]
surviving nonsolo ucounts = 2[129, 291]
ids = [6, 3]

====================================================================================

UMI info for barcode TCACAAGGTTACCGAT-1 contig 1 = AAAACCACAC...
umi TCTATTTGTT = 123 reads: +436 validated

UMI info for barcode TCACAAGGTTACCGAT-1 contig 2 = GTCAGTCTCA...
umi GAATAGTCTC = 271 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 49, 247, 252, 269, 313, 346
confident = false

TIG 2[bases=483]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-483 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.221 = TCACAAGTCAACGAAA-1

using 17287 reads

====================================================================================

graph has 7557 edges initially, 94 edges after simplification

total ucounts = 1170
nonsolo ucounts = 577[2^186, 3^118, 4^80, 5^47, 6^35, 7^13, 8^6, 9^11, 10^3, 11^2, 12^4, 13, 14^2, 15^3, 21, 36, 48, 50, 83, 95, 99, 109, 118, 150, 159, 161, 162, 175, 178, 179, 183, 184, 185, 187, 188, 198, 200, 206, 208, 209, 210, 215, 221^2, 225, 227, 230, 232, 233, 235, 237^2, 239, 242^2, 253, 258, 262^2, 265, 266^4, 268^2, 270, 271^2, 272, 274, 279, 280, 281, 294, 313, 315, 340, 405, 796]
surviving nonsolo ucounts = 61[48, 83, 95, 99, 109, 118, 150, 159, 161, 162, 175, 178, 179, 183, 184, 185, 188, 198, 200, 206, 208, 209, 210, 221^2, 225, 227, 230, 232, 233, 235, 237^2, 239, 242^2, 253, 258, 262^2, 265, 266^4, 268^2, 270, 271^2, 272, 274, 279, 280, 281, 294, 313, 315, 340, 405, 796]
ids = [337, 924, 966, 235, 480, 870, 253, 1104, 557, 11, ...]

====================================================================================

UMI info for barcode TCACAAGTCAACGAAA-1 contig 1 = AGCTCTGGGA...
umi CACGGTTTCG = 266 reads: +448 validated
umi CAGCCCCCTT = 45 reads: +372 -3 +1 -1X +1 -2X +1 -4X +1 -1X +2 -1X +10 -1 +1 -1 +18 -1 +9 -17 invalidated
umi CATATATGGG = 265 reads: +448 validated
umi CCCCCTAGCT = 255 reads: +424 -24 non-validated
umi GAACCATGTT = 255 reads: +448 validated
umi TAACGTAACA = 230 reads: +448 validated
umi TACCCACCAT = 278 reads: +448 validated
umi TATGTGATCG = 81 reads: +391 -57 non-validated
umi TCACTGAAGG = 302 reads: +448 validated
umi TCATTTATTT = 96 reads: +145 -1XX +266 -1 +3 -1 +31 invalidated
umi TCTACCCTCG = 169 reads: +391 -1 +41 -15 non-validated
umi TTTAATCTCC = 185 reads: +433 -15 non-validated

UMI info for barcode TCACAAGTCAACGAAA-1 contig 2 = TGGGGGCTGG...
umi AAACAAGTTC = 270 reads: +388 validated
umi AAACGTCGGA = 241 reads: +388 validated
umi AAACTTCCTC = 164 reads: +388 validated
umi ACCTTATCAT = 273 reads: +388 validated
umi ACGTGAACTG = 183 reads: +388 validated
umi AGGTCGCTAA = 199 reads: +388 validated
umi ATATCAGTCC = 233 reads: +388 validated
umi ATCCCACCGC = 100 reads: +361 -1 +26 non-validated
umi ATCTACTCTC = 237 reads: +126 -4XX +1 -7XX +2 -6XX +1 -7XX +234 invalidated
umi ATGCCCTCAG = 148 reads: +388 validated
umi ATTCACCGGC = 251 reads: +388 validated
umi ATTTTATCTA = 221 reads: +388 validated
umi CAAATATGAC = 179 reads: +388 validated
umi CATGGCTCTC = 266 reads: +388 validated
umi CATTATCCTT = 180 reads: +388 validated
umi CCATCACTCA = 235 reads: +388 validated
umi CCGGGTAAGC = 192 reads: +388 validated
umi CCTAATCTGT = 109 reads: +388 validated
umi CGTAACCGCT = 158 reads: +388 validated
umi CTATTATTTA = 230 reads: +388 validated
umi CTCTCCACGT = 266 reads: +388 validated
umi CTTCGATATA = 276 reads: +388 validated
umi CTTTCTGGTC = 237 reads: +388 validated
umi GCACTTCTTA = 271 reads: +388 validated
umi GCAGTTACCA = 213 reads: +388 validated
umi GCGAATGGAG = 197 reads: +388 validated
umi GCTATTACAC = 238 reads: +388 validated
umi GCTTACAGAA = 264 reads: +388 validated
umi GTCCTACGTG = 211 reads: +388 validated
umi TACCTAACAG = 280 reads: +388 validated
umi TACGTCCCGG = 269 reads: +388 validated
umi TATACTCACT = 242 reads: +388 validated
umi TATCTACCAC = 266 reads: +388 validated
umi TTACCATTCC = 259 reads: +388 validated
umi TTATCTCGCT = 318 reads: +388 validated
umi TTCCAACTAT = 104 reads: +35 -1XX +1 -6XX +345 invalidated
umi TTCCTTTTTT = 248 reads: +388 validated
umi TTCGCGAACA = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=2)
439-460 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=0)
465-528 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
528-599 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 129 reads
cdr3 = CTRAGIAAAGTEYYYYYYYMDVW at 428, score = 8 + 7
umis assigned: [329, 337, 352, 438, 700, 855, 877, 924, 951, 966] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2397
start codons at 80, 133, 231, 236, 303, 360, 389, 485
confident = true

TIG 2[bases=645]
46-394 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 38 umis using 1265 reads
cdr3 = CSSYTSSSPWVF at 370, score = 8 + 8
umis assigned: [6, 9, 11, 121, 130, 193, 222, 235, 240, 253] and 28 others
of which 38 are surviving nonsolos
reads assigned: 8304
start codons at 46, 203, 247, 254, 257
confident = true

REJECT CONTIGS

TIG 1[bases=379]
71-228 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=1)
227-277 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
277-379 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [1127]
of which 1 are surviving nonsolos
reads assigned: 789
start codons at 155, 229, 258, 295, 356
confident = false
did not find CDR3

TIG 2[bases=651]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=0)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
440-651 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [35, 398, 411, 783, 870, 971]
of which 6 are surviving nonsolos
reads assigned: 1297
start codons at 30, 45, 54, 57, 82, 349, 352, 381
confident = false
did not find CDR3

TIG 3[bases=440]
5-282 ==> 2159-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
316-369 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
369-440 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [298, 559, 689, 1151]
of which 4 are surviving nonsolos
reads assigned: 1185
start codons at 37, 43, 84
confident = false
did not find CDR3
now this is a cell
paired!

TGTACTAGAGCGGGTATAGCAGCAGCTGGTACTGAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCCCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.234 = TCACAAGTCATGCATG-1

using 462 reads

====================================================================================

graph has 174 edges initially, 6 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^3, 3, 5, 9, 12, 151, 271]
surviving nonsolo ucounts = 2[151, 271]
ids = [4, 10]

====================================================================================

UMI info for barcode TCACAAGTCATGCATG-1 contig 1 = GCTTCAGCTG...
umi GTGGTAGACC = 252 reads: +391 validated

UMI info for barcode TCACAAGTCATGCATG-1 contig 2 = GTCAGACTCA...
umi CCTCTATCCG = 139 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
437-557 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDTSLSGSVF at 370, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 46, 200, 203, 254, 353, 380
confident = false

TIG 2[bases=408]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
junction support: 1 umis using 23 reads
cdr3 = CHQYNSYSTF at 350, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 23, 29, 85, 98, 234, 237, 330
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.242 = TCACAAGTCCTTTCTC-1

using 279 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 268]
surviving nonsolo ucounts = 1[268]
ids = [4]

====================================================================================

UMI info for barcode TCACAAGTCCTTTCTC-1 contig 1 = AGGAGTCAGA...
umi CGGACGCTGT = 256 reads: +388 validated
umi CGGACTATGT = 1 reads: -225 +3 -1 +1 -1 +1 -1 +1 -1X +1 -1X +2 -1X +7 -1X +3 -1 +6 -1 +21 -108X invalidated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYPWTF at 354, score = 8 + 8
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.243 = TCACAAGTCGACAGCC-1

using 232 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 7, 223]
surviving nonsolo ucounts = 1[223]
ids = [0]

====================================================================================

UMI info for barcode TCACAAGTCGACAGCC-1 contig 1 = CTGGGCCTCA...
umi ACCTCGGGCT = 217 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=515]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
413-515 ==> 0-102 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.244 = TCACAAGTCGACCAGC-1

using 30 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.251 = TCACAAGTCGGCTACG-1

using 527 reads

====================================================================================

graph has 818 edges initially, 8 edges after simplification

total ucounts = 246
nonsolo ucounts = 109[2^53, 3^24, 4^11, 5^6, 6^6, 7^3, 8, 10, 12, 13, 18, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.253 = TCACAAGTCTACTATC-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.254 = TCACAAGTCTATCCCG-1

using 14 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.255 = TCACAAGTCTCCAACC-1

using 53 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^3, 3^2, 4, 5, 6^2, 7, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.259 = TCACAAGTCTGTTTGT-1

using 668 reads

====================================================================================

graph has 1121 edges initially, 2 edges after simplification

total ucounts = 278
nonsolo ucounts = 132[2^46, 3^29, 4^17, 5^17, 6^8, 7^2, 8^5, 9^2, 10^2, 11^2, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.268 = TCACGAAAGACACTAA-1

using 245 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 6, 230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode TCACGAAAGACACTAA-1 contig 1 = AGCTTCAGCT...
umi ACGAACTTGC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-574 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.272 = TCACGAAAGAGTCTGG-1

using 713 reads

====================================================================================

graph has 201 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 324, 380]
surviving nonsolo ucounts = 2[324, 380]
ids = [0, 8]

====================================================================================

UMI info for barcode TCACGAAAGAGTCTGG-1 contig 1 = GGAGTCAGTC...
umi AAGATCTTCG = 309 reads: -348 +1 -1XX +1 -1XX +4 -1XX +6 -2XX +6 -5XX +7 -1XX +4 invalidated
umi TTCGCACCGT = 378 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [0, 8]
of which 2 are surviving nonsolos
reads assigned: 681
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.274 = TCACGAAAGAGTTGGC-1

using 505 reads

====================================================================================

graph has 696 edges initially, 4 edges after simplification

total ucounts = 255
nonsolo ucounts = 79[2^31, 3^18, 4^8, 5^5, 6^6, 7^3, 8^3, 9, 13, 17, 18^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.281 = TCACGAAAGCGAGAAA-1

using 223 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 216]
surviving nonsolo ucounts = 1[216]
ids = [6]

====================================================================================

UMI info for barcode TCACGAAAGCGAGAAA-1 contig 1 = AGCTCTCAGA...
umi TCCCCGTCTC = 216 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=528]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-288 ==> 0-209 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=18)
288-426 ==> 215-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
468-515 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CAREGTKVPGSPNRYYYAGMDVW at 415, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 79, 132, 137, 235, 350, 376, 472
confident = false
see deletion of 6 bases at pos 209 on |142|IGHV3-48|L-REGION+V-REGION|
>vscore_95.281_83.0%
ATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAATGTGATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCCGGATTCGTCTTTAGTAGATATTCCATGAACTGGGTCCGCCTGGCTCCAGGTAAGGGACTGGAGTGGATTGCTTACATTAGTTCTAGTACCATAGAATACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTTTCTGCACATGAACAGCCTGAGAGACGAGGACACGGCTCTATATTTCTGTGCGAGGGAA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.282 = TCACGAAAGCGTGAAC-1

using 20854 reads

====================================================================================

graph has 8100 edges initially, 102 edges after simplification

total ucounts = 849
nonsolo ucounts = 408[2^142, 3^78, 4^31, 5^26, 6^19, 7^12, 8^4, 9^7, 11^3, 12^3, 13^4, 14^2, 15, 18^4, 32, 40, 50, 55, 61, 64^2, 82, 98^2, 129, 130, 152, 156, 172, 179, 192, 193, 199, 210, 226, 229^2, 231^2, 232, 235, 236, 258, 264, 265, 268, 270, 274, 275, 277, 283, 287, 290, 291, 299, 300, 302^2, 303, 304, 306, 308, 311, 317, 319, 321^2, 326, 330, 334, 340, 348^2, 354, 358, 359, 360, 372, 376, 382, 409, 413, 430, 445, 650, 658]
surviving nonsolo ucounts = 67[64^2, 82, 98^2, 129, 130, 152, 156, 172, 179, 192, 193, 199, 210, 226, 229^2, 231^2, 232, 235, 236, 258, 264, 265, 268, 270, 274, 275, 277, 283, 287, 290, 291, 299, 300, 302^2, 303, 304, 306, 308, 311, 317, 319, 321^2, 326, 330, 334, 340, 348^2, 354, 358, 359, 360, 372, 376, 382, 409, 413, 430, 445, 650, 658]
ids = [401, 554, 337, 350, 757, 251, 447, 418, 685, 725, ...]

====================================================================================

UMI info for barcode TCACGAAAGCGTGAAC-1 contig 1 = AGTGCTTTCT...
umi AAAACAATCT = 237 reads: +448 validated
umi AACGGGCCGT = 197 reads: +448 validated
umi AACGTGCCAG = 363 reads: +448 validated
umi AATATTACAC = 321 reads: +448 validated
umi AATTAGATCT = 319 reads: +448 validated
umi ACCTCCATAC = 359 reads: +448 validated
umi ACGATACGCA = 176 reads: +448 validated
umi ACTAAGCGCA = 266 reads: +448 validated
umi ATAAATGCCG = 275 reads: +448 validated
umi ATACCGATCA = 260 reads: +448 validated
umi ATGCGAATTC = 315 reads: +448 validated
umi CACAGGTATT = 129 reads: +448 validated
umi CATCAGTGCG = 290 reads: +444 -1 +3 non-validated
umi CCTGAATAAG = 164 reads: +448 validated
umi CGAAGAATGC = 286 reads: +448 validated
umi CGACTTATCT = 72 reads: +11 -1 +436 non-validated
umi CGATCTGGGA = 230 reads: +448 validated
umi CGCTCTTTGC = 195 reads: +448 validated
umi CGTGCAAGCT = 272 reads: +448 validated
umi CTATCAGGTT = 301 reads: +448 validated
umi CTCACTGATG = 68 reads: -35 +413 non-validated
umi CTGATGACTA = 124 reads: +448 validated
umi CTGTTCGATT = 380 reads: +448 validated
umi CTTGTCCAAG = 191 reads: +448 validated
umi GAAAAGTTCA = 113 reads: +448 validated
umi GACTGCCACG = 272 reads: +448 validated
umi GCCAAAACCA = 306 reads: +448 validated
umi GCCATTGGGC = 353 reads: +448 validated
umi GGAAGTGACC = 321 reads: +448 validated
umi GGTCTGCCCT = 242 reads: +448 validated
umi GTACATCGAA = 325 reads: +448 validated
umi GTAGCACCAT = 60 reads: +387 -5 +24 -1 +31 non-validated
umi GTGATGATGT = 351 reads: +448 validated
umi TATACTCGGC = 334 reads: +448 validated
umi TATGGCTTTT = 335 reads: +448 validated
umi TCGCTATAGT = 276 reads: +448 validated
umi TCTCCTAGCA = 174 reads: +448 validated
umi TGAATATCTC = 316 reads: +448 validated
umi TGGCCATGAC = 103 reads: +448 validated
umi TTTGGAATCT = 374 reads: +448 validated

UMI info for barcode TCACGAAAGCGTGAAC-1 contig 2 = AGGAGTCAGA...
umi AATCATGAAA = 290 reads: +391 validated
umi AATTTCGGGG = 286 reads: +391 validated
umi ACGTCAGCGT = 662 reads: -227 +164 non-validated
umi ATGCCGGTGT = 238 reads: +391 validated
umi CATACATCGA = 300 reads: +391 validated
umi CGCCGGCGTC = 299 reads: +391 validated
umi CGCGCGTCGC = 98 reads: +391 validated
umi CTAAGTCTTA = 305 reads: +391 validated
umi CTCCCCGGAA = 254 reads: +391 validated
umi CTCGGGAGGC = 445 reads: -278 +113 non-validated
umi GATCTCTCTC = 300 reads: +391 validated
umi GTATACTTCG = 221 reads: +391 validated
umi GTGACGATTC = 305 reads: +391 validated
umi GTTCTGATGT = 281 reads: +391 validated
umi TCAGACGATC = 231 reads: +391 validated
umi TCATACCTCT = 356 reads: +391 validated
umi TCCAATCCCG = 160 reads: +179 -1XX +211 invalidated
umi TGATACGGTT = 233 reads: +391 validated
umi TTCGGTCCCT = 276 reads: +391 validated
umi TTTCTCGATC = 277 reads: +391 validated
umi TTTTACATCG = 276 reads: +391 validated
umi TTTTTTCCTC = 177 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=536]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
392-422 ==> 7-37 on |19|IGHD3-16|D-REGION| [len=37] (mis=5)
419-465 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
465-536 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 38 umis using 972 reads
cdr3 = CARGGDYIWGSYRWPLDYW at 377, score = 9 + 7
umis assigned: [0, 30, 32, 53, 70, 98, 103, 116, 175, 180] and 30 others
of which 40 are surviving nonsolos
reads assigned: 9858
start codons at 17, 38, 82, 168
confident = true

TIG 2[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 948 reads
cdr3 = CQQYNSYSPRTF at 354, score = 8 + 8
umis assigned: [58, 74, 113, 211, 279, 348, 350, 386, 403, 407] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6171
start codons at 27, 33, 89, 102, 334, 460
confident = true

REJECT CONTIGS

TIG 1[bases=551]
0-83 ==> 8884-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=7)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=5)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [131, 229, 331, 721, 769]
of which 5 are surviving nonsolos
reads assigned: 1862
start codons at 26, 32, 88, 237, 457
confident = false
did not find CDR3
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGGTGGCGATTACATTTGGGGGAGTTATCGTTGGCCACTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCGAGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.286 = TCACGAAAGGAGTCTG-1

using 78 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^2, 4, 6, 9, 11, 13, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.290 = TCACGAAAGGCCGAAT-1

using 651 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 4, 639]
surviving nonsolo ucounts = 1[639]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=450]
10-201 ==> 165-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
201-239 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
239-450 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 169, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 633
start codons at 53, 152, 179, 203, 371
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.317 = TCACGAACAAGGTGTG-1

using 22923 reads

====================================================================================

graph has 9174 edges initially, 54 edges after simplification

total ucounts = 1366
nonsolo ucounts = 711[2^233, 3^145, 4^89, 5^62, 6^30, 7^23, 8^15, 9^6, 10^5, 11^2, 12^7, 14, 15^2, 16^2, 25, 28, 50, 53, 54, 59, 61, 65, 66, 73, 75, 76, 92, 98, 100, 102, 113, 116, 122, 128, 131, 139, 141, 150, 151, 155, 159^2, 162, 165, 170, 176, 180, 181^2, 182, 190, 199, 217, 225, 230, 235, 237, 239, 241^3, 244, 247^2, 250, 253, 254, 257, 258, 263^2, 265, 267, 273, 274, 276, 281, 283, 284, 286, 293, 306, 307, 315, 320^2, 321, 324, 327, 329, 330, 333, 340, 342, 350, 359, 373, 384, 391, 399, 422, 428, 682]
surviving nonsolo ucounts = 77[12, 59, 61, 73, 75, 76, 98, 100, 102, 116, 128, 139, 141, 150, 155, 159, 162, 165, 170, 176, 180, 181^2, 182, 190, 199, 217, 225, 230, 235, 237, 239, 241^3, 244, 247^2, 250, 253, 254, 257, 258, 263^2, 265, 267, 273, 274, 276, 281, 283, 284, 286, 293, 306, 307, 315, 320^2, 321, 324, 327, 329, 330, 333, 340, 342, 350, 359, 373, 384, 391, 399, 422, 428, 682]
ids = [37, 978, 615, 753, 535, 999, 229, 842, 162, 466, ...]

====================================================================================

UMI info for barcode TCACGAACAAGGTGTG-1 contig 1 = TGGGGATGCT...
umi AAAATCACTG = 277 reads: +436 validated
umi AAACCTATCC = 210 reads: +434 -2 non-validated
umi AACGTAGCGC = 160 reads: +436 validated
umi AAGGAAGGGT = 265 reads: +436 validated
umi AAGTGGCTTC = 245 reads: +436 validated
umi ACAACTGTCT = 247 reads: +436 validated
umi ACAATCCGTT = 240 reads: +436 validated
umi ACAGTGTAGG = 118 reads: +436 validated
umi ACCAATAGGG = 181 reads: +436 validated
umi ACTAAGTTCG = 232 reads: +436 validated
umi ACTATGTGCC = 332 reads: +436 validated
umi AGCTCATCGT = 101 reads: +436 validated
umi AGCTGGAGAT = 277 reads: +436 validated
umi AGGCCTTCGT = 150 reads: +419 -5 +12 non-validated
umi AGTATGCAAT = 181 reads: +436 validated
umi ATGCGTTTGG = 237 reads: +436 validated
umi ATTGCGGCGA = 162 reads: +436 validated
umi CAAATCATAG = 266 reads: +436 validated
umi CAAATCTGTT = 318 reads: +436 validated
umi CAATATTGTC = 332 reads: +436 validated
umi CACCGGGGGC = 361 reads: +436 validated
umi CATACAGTGC = 322 reads: +436 validated
umi CATTCTCATT = 183 reads: +436 validated
umi CCAAAAGCAA = 4 reads: -389X +1 -4X +2 -7X +1 -2XX +30 invalidated
umi CCATTTCCTT = 400 reads: +436 validated
umi CCGACGACGG = 343 reads: +436 validated
umi CCTGCTTTTA = 197 reads: +436 validated
umi CCTGTCTAGA = 48 reads: -371X +1 -10XX +1 -4XX +1 -1XX +1 -3XX +2 -1XX +3 -2XX +35 invalidated
umi CGGATAGGTT = 231 reads: +436 validated
umi CGGTCTGTCC = 176 reads: +4 -1 +431 non-validated
umi CGTCTTTGGG = 134 reads: -1X +4 -1X +3 -1XX +10 -1XX +5 -1XX +29 -1XX +24 -1XX +40 -2XX +47 -1XX +2 -1XX +11 -1XX +15 -1X +3 -2 +7 -1XX +15 -3XX +8 -1XX +41 -1XX +8 -1XX +11 -1XX +35 -1XX +5 -1XX +8 -1XX +7 -2X +2 -5X +1 -2X +1 -4XX +1 -1XX +2 -1XX +1 -2XX +1 -2XX +44 invalidated
umi CTAACTCGGT = 325 reads: +436 validated
umi CTCAAAATCA = 127 reads: +436 validated
umi CTGTTATATA = 75 reads: -382 +1 -1X +1 -4X +1 -4XX +2 -7XX +1 -2XX +30 invalidated
umi CTTTCGAGGA = 284 reads: +436 validated
umi GAGCTCCTCA = 374 reads: +436 validated
umi GAGGGACGTA = 72 reads: -10 +426 non-validated
umi GATTCCGGCT = 137 reads: +436 validated
umi GCCACGTTCT = 157 reads: +436 validated
umi GCCATAGCCA = 336 reads: -302 +134 non-validated
umi GCCCACTTTA = 171 reads: +436 validated
umi GGACCTCCGT = 256 reads: +436 validated
umi GGACTGGGGC = 100 reads: +436 validated
umi GGTATCTCCG = 293 reads: +436 validated
umi GGTATTCTTG = 287 reads: +436 validated
umi GTATTCCTCT = 350 reads: +436 validated
umi GTTATCTGCA = 237 reads: +436 validated
umi TAAATGACTG = 77 reads: +436 validated
umi TACAAAAGGA = 237 reads: +436 validated
umi TATCATTGGG = 385 reads: +436 validated
umi TATCTCTACT = 362 reads: +436 validated
umi TATTTATGTC = 306 reads: +436 validated
umi TGAAACTCAG = 164 reads: +436 validated
umi TGATAGCGTG = 187 reads: +436 validated
umi TGGTCGCTAC = 331 reads: +436 validated
umi TTAAGGATGG = 279 reads: +436 validated
umi TTAGACTCGT = 323 reads: -3 +433 non-validated
umi TTCATTTACC = 224 reads: +436 validated
umi TTGATTGCCG = 15 reads: -371X +1 -10XX +1 -4XX +1 -1XX +1 -3XX +2 -1XX +3 -2XX +35 invalidated
umi TTTAAAGTGC = 366 reads: +436 validated
umi TTTAGTGGTC = 239 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=528]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=2)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
457-528 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 54 umis using 1179 reads
cdr3 = CARDGSSTLFDYW at 387, score = 9 + 7
umis assigned: [3, 6, 41, 74, 83, 121, 125, 137, 142, 174] and 51 others
of which 58 are surviving nonsolos
reads assigned: 13804
start codons at 5, 21, 30, 42, 86
confident = true

REJECT CONTIGS

TIG 1[bases=555]
7-88 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTSRTF at 358, score = 9 + 8
umis assigned: [162, 479, 535, 742, 907, 936, 1038, 1041, 1052, 1180] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2700
start codons at 31, 37, 93, 106, 242, 461
confident = false
not full
full length stopped transcript of length 555
frameshifted full length stopped transcript of length 555
VJ delta = 16
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.323 = TCACGAACACAACGTT-1

using 348 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [4]

====================================================================================

UMI info for barcode TCACGAACACAACGTT-1 contig 1 = GGGAGGAACT...
umi TCAAGAGGCA = 345 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPLTF at 356, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 35, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.329 = TCACGAACACCAGATT-1

using 352 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 4, 339]
surviving nonsolo ucounts = 1[339]
ids = [7]

====================================================================================

UMI info for barcode TCACGAACACCAGATT-1 contig 1 = AGCTCTGAGA...
umi TTTACCTCTC = 342 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=571]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
437-500 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAKDSSGQYYYGMDVW at 421, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 79, 230, 235, 382, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.330 = TCACGAACACCTATCC-1

using 16786 reads

====================================================================================

graph has 6838 edges initially, 58 edges after simplification

total ucounts = 853
nonsolo ucounts = 417[2^149, 3^81, 4^48, 5^31, 6^17, 7^4, 8^3, 9^5, 10^4, 11^2, 12^3, 14^2, 15, 18, 19, 20, 21, 28, 30, 47, 49, 69, 83, 116, 120, 129, 147, 156, 159, 164^2, 168, 170, 185, 191, 193, 195, 208, 211, 218, 222, 224, 227, 228, 229, 235, 237, 240, 244, 248, 251, 252, 253^2, 258, 259, 260, 268, 269, 270, 275, 276, 277, 279^2, 281, 291, 300, 301^2, 305, 313, 316, 335, 338, 343, 344, 465, 507, 791]
surviving nonsolo ucounts = 61[18, 30, 69, 83, 116, 120, 129, 147, 156, 159, 164^2, 168, 170, 185, 191, 193, 195, 208, 211, 218, 222, 224, 227, 228, 229, 235, 237, 240, 244, 248, 251, 252, 253^2, 258, 259, 260, 268, 269, 270, 275, 276, 277, 279^2, 281, 291, 300, 301^2, 305, 313, 316, 335, 338, 343, 344, 465, 507, 791]
ids = [389, 396, 697, 209, 762, 552, 244, 410, 126, 478, ...]

====================================================================================

UMI info for barcode TCACGAACACCTATCC-1 contig 1 = TGGGGCTCCA...
umi AAGGTTCCTG = 274 reads: +388 validated
umi AATAACACCC = 209 reads: +388 validated
umi AATCATGTGC = 205 reads: +388 validated
umi AATCGCCACC = 347 reads: +388 validated
umi AATTTAGTCG = 300 reads: +388 validated
umi AATTTTGCGC = 226 reads: +388 validated
umi ACAATTCCCT = 218 reads: +352 -1X +35 invalidated
umi ATAAGTCGCG = 285 reads: +388 validated
umi ATACCGATCA = 188 reads: +388 validated
umi ATCCTTACCC = 256 reads: +388 validated
umi ATCGCTCCCT = 85 reads: +388 validated
umi ATCTTACCTC = 804 reads: -261 +127 non-validated
umi ATTGATACTA = 131 reads: +388 validated
umi CCGTTCACCC = 303 reads: +388 validated
umi CTCTTTCTCC = 228 reads: +388 validated
umi CTGAGCGCCA = 240 reads: +388 validated
umi CTGGCGTTCA = 293 reads: +388 validated
umi GCCACTATAC = 255 reads: +388 validated
umi GCCCGGCAGG = 138 reads: +37 -1XX +4 -1XX +333 -11 +1 invalidated
umi GGAGGACCGC = 337 reads: +388 validated
umi GTCATTGCAC = 209 reads: +388 validated
umi TAAGCTCGTG = 120 reads: +388 validated
umi TAATTGGGTC = 252 reads: +388 validated
umi TACCATGGGC = 1 reads: -388 non-validated
umi TACTTTCCTT = 264 reads: +388 validated
umi TCACAGCTTC = 281 reads: +388 validated
umi TCACTCGCCG = 250 reads: +388 validated
umi TCGGGAGCAT = 272 reads: +388 validated
umi TCGTCTACAC = 263 reads: +388 validated
umi TCTTAACCAC = 279 reads: +388 validated
umi TGCTTTAAAG = 248 reads: +388 validated
umi TGGGTTCGCG = 268 reads: +388 validated
umi TGTAACCCCG = 230 reads: +388 validated
umi TTACGTACCG = 115 reads: +388 validated
umi TTCATCCCTT = 231 reads: +388 validated

UMI info for barcode TCACGAACACCTATCC-1 contig 2 = CAGCTCTGGG...
umi AAACCTTTAG = 166 reads: +406 validated
umi AACCACCAAT = 191 reads: +406 validated
umi ACCTGTTATC = 270 reads: +406 validated
umi GCAGTAATCC = 13 reads: -377 +1 -1XX +7 -1XX +1 -1XX +12 -1XX +2 -1XX +1 invalidated
umi GCCAGGTCAC = 25 reads: -406 non-validated
umi GGTTTCACTT = 159 reads: +405 -1 non-validated
umi TAGTATCCCT = 184 reads: +406 validated
umi TATGGACACC = 243 reads: +406 validated
umi TGACTCCAGC = 40 reads: -388X +2 -2X +1 -2X +2 -2X +2 -1X +2 -1X +1 invalidated
umi TTATCATTCC = 272 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 33 umis using 1329 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [43, 51, 55, 60, 68, 74, 77, 187, 193, 206] and 25 others
of which 35 are surviving nonsolos
reads assigned: 8471
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=22)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 99 reads
cdr3 = CVKEEDAFDIW at 422, score = 8 + 8
umis assigned: [3, 20, 103, 389, 396, 478, 595, 617, 697, 771]
of which 10 are surviving nonsolos
reads assigned: 1531
start codons at 80, 231, 236, 297, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=571]
1-81 ==> 5528-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 356, score = 4 + 8
umis assigned: [126, 169, 272, 291, 298, 320, 321, 377, 397, 410] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3008
start codons at 36, 69, 105, 156, 193, 355, 375, 477
confident = false
not full
frameshifted full length stopped transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AACAACCTGAGGGCTGAGGACACGGCTATTTACTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCGG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.346 = TCACGAACATCCGTGG-1

using 36 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 8, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.347 = TCACGAACATCTCGCT-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.350 = TCACGAACATTATCTC-1

using 537 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 199, 332]
surviving nonsolo ucounts = 2[199, 332]
ids = [1, 5]

====================================================================================

UMI info for barcode TCACGAACATTATCTC-1 contig 1 = TGAGCGCAGA...
umi ATTCGCGGGC = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=1)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-521 ==> 0-97 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.357 = TCACGAAGTAGTAGTA-1

using 751 reads

====================================================================================

graph has 238 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 66, 273, 406]
surviving nonsolo ucounts = 3[66, 273, 406]
ids = [7, 1, 2]

====================================================================================

UMI info for barcode TCACGAAGTAGTAGTA-1 contig 1 = CATGGCCTGG...
umi TTTAAGCTGA = 61 reads: +382 validated

UMI info for barcode TCACGAAGTAGTAGTA-1 contig 2 = GAGTCAGTCC...
umi ATAAGGGTCC = 269 reads: +388 validated
umi CAGATTGTTT = 388 reads: -342 +1 -1X +1 -4XX +1 -3XX +6 -1XX +3 -3XX +9 -1XX +12 invalidated

GOOD CONTIGS

TIG 1[bases=444]
1-338 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=4)
345-383 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
383-444 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CNSRDSSGNHYVF at 316, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 60
start codons at 1, 120, 149, 200, 299, 347
confident = false

TIG 2[bases=549]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQLNSYSLTF at 352, score = 9 + 9
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 649
start codons at 25, 31, 87, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.361 = TCACGAAGTCAAAGAT-1

using 103 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[102]
surviving nonsolo ucounts = 1[102]
ids = [1]

====================================================================================

UMI info for barcode TCACGAAGTCAAAGAT-1 contig 1 = GGGATCACAC...
umi GAATCCTGCT = 99 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=493]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=3)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
469-493 ==> 0-24 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.362 = TCACGAAGTCAAGCGA-1

using 279 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 3^2, 4, 6, 255]
surviving nonsolo ucounts = 1[255]
ids = [6]

====================================================================================

UMI info for barcode TCACGAAGTCAAGCGA-1 contig 1 = GAGAGCATCA...
umi TGTACCAGGA = 222 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=494]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
junction support: 1 umis using 15 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 64, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.365 = TCACGAAGTCAGAATA-1

using 404 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 5, 23, 366]
surviving nonsolo ucounts = 1[366]
ids = [8]

====================================================================================

UMI info for barcode TCACGAAGTCAGAATA-1 contig 1 = GGGGAGGAAC...
umi TTGAACGCTC = 369 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.368 = TCACGAAGTCGACTAT-1

using 62 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 7, 51]
surviving nonsolo ucounts = 1[51]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.369 = TCACGAAGTCGCATCG-1

using 338 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.370 = TCACGAAGTCGGCATC-1

using 1113 reads

====================================================================================

graph has 1074 edges initially, 4 edges after simplification

total ucounts = 273
nonsolo ucounts = 103[2^42, 3^24, 4^17, 5^5, 6, 7^3, 8, 9^2, 10^3, 11^2, 13, 245, 331]
surviving nonsolo ucounts = 3[7, 245, 331]
ids = [181, 98, 16]

====================================================================================

UMI info for barcode TCACGAAGTCGGCATC-1 contig 1 = AGGAGTCAGA...
umi CCACATCGCA = 226 reads: +388 validated
umi GTCATTAACC = 7 reads: -69 +11 -1 +21 -1 +92 -1 +14 -24X +1 -2 +1 -1 +7 -1 +56 -8 +60 -17 invalidated

UMI info for barcode TCACGAAGTCGGCATC-1 contig 2 = GGATGCTTTC...
umi AATAGATCTG = 272 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=504]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-504 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYWWTF at 354, score = 8 + 8
umis assigned: [98, 181]
of which 2 are surviving nonsolos
reads assigned: 231
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 2[bases=468]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=1)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
junction support: 1 umis using 30 reads
cdr3 = CARDGSSTLFDYW at 384, score = 9 + 7
umis assigned: [16]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 2, 18, 27, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.371 = TCACGAAGTCGTCTTC-1

using 98 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 4^2, 6, 76]
surviving nonsolo ucounts = 1[76]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=412]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
28-52 ==> 204-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=16)
cdr3 = CNSRARTGDHVF at 351, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 36, 118, 155, 184, 231, 235, 334, 379
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.376 = TCACGAAGTGCAACGA-1

using 256 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 6, 242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode TCACGAAGTGCAACGA-1 contig 1 = GGAACCTGCT...
umi AGAGTTGTAT = 233 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=540]
0-51 ==> 200-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
51-391 ==> 0-340 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=10)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
427-540 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQVWDSTSGVF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 51, 112, 250, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.378 = TCACGAAGTGCTAGCC-1

using 272 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [0]

====================================================================================

UMI info for barcode TCACGAAGTGCTAGCC-1 contig 1 = GGGCCTCAGG...
umi TGCCGGCAAT = 255 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=549]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-549 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.379 = TCACGAAGTGCTGTAT-1

using 344 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[6, 10, 327]
surviving nonsolo ucounts = 1[327]
ids = [2]

====================================================================================

UMI info for barcode TCACGAAGTGCTGTAT-1 contig 1 = GGAGTCAGTC...
umi CCTCCGCTCG = 332 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.381 = TCACGAAGTGTGGTTT-1

using 261 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 256]
surviving nonsolo ucounts = 1[256]
ids = [2]

====================================================================================

UMI info for barcode TCACGAAGTGTGGTTT-1 contig 1 = GCTCTGCCTC...
umi TCGTCAACCT = 238 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=572]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-572 ==> 0-127 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.389 = TCACGAAGTTCCCTTG-1

using 469 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[469]
surviving nonsolo ucounts = 1[469]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.390 = TCACGAAGTTCGCTAA-1

using 835 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 11, 816]
surviving nonsolo ucounts = 1[816]
ids = [1]

====================================================================================

UMI info for barcode TCACGAAGTTCGCTAA-1 contig 1 = GTCAGACCCA...
umi CCGCCTTTTG = 819 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 142 reads
cdr3 = CQQANSFPLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 805
start codons at 23, 29, 85, 98, 237, 255, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.391 = TCACGAAGTTTGCATG-1

using 280 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode TCACGAAGTTTGCATG-1 contig 1 = TTTCTGAGAC...
umi CATTGGCAAT = 261 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=546]
0-33 ==> 31-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
33-386 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=19)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-546 ==> 0-92 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARKGGGDYPFAFNIW at 375, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 12, 33, 77, 297, 508
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.392 = TCACGAATCAAACCAC-1

using 184 reads

====================================================================================

graph has 100 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3, 4, 7, 9, 157]
surviving nonsolo ucounts = 2[4, 157]
ids = [2, 3]

====================================================================================

UMI info for barcode TCACGAATCAAACCAC-1 contig 1 = CTCCTCAGTT...
umi CAGATAAAAA = 3 reads: -270 +2 -1X +53 -2XX +10 -1X +3 -1X +1 -53X invalidated
umi CCGGTGCCAT = 157 reads: +294 -1XX +102 invalidated

GOOD CONTIGS

TIG 1[bases=453]
0-22 ==> 8-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
22-348 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=10)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
419-453 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CMNTLPGGFTF at 358, score = 8 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 153
start codons at 22, 55, 91, 179, 341, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.405 = TCACGAATCATGTCTT-1

using 819 reads

====================================================================================

graph has 304 edges initially, 16 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^4, 5, 53, 214, 261, 274]
surviving nonsolo ucounts = 4[53, 214, 261, 274]
ids = [1, 9, 10, 0]

====================================================================================

UMI info for barcode TCACGAATCATGTCTT-1 contig 1 = ACCCAAAAAC...
umi TCTCACATGC = 206 reads: +436 validated

UMI info for barcode TCACGAATCATGTCTT-1 contig 2 = GAGGAATCAG...
umi ACTTGTCTAA = 46 reads: +17 -2 +330 -28 +11 non-validated
umi TCTCTTGTAA = 235 reads: +388 validated

UMI info for barcode TCACGAATCATGTCTT-1 contig 3 = GAGTGCTTTC...
umi AAGCAGTGAC = 276 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=520]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-520 ==> 0-30 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=498]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-498 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 10]
of which 2 are surviving nonsolos
reads assigned: 280
start codons at 28, 34, 103, 239, 458
confident = false

TIG 3[bases=579]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-579 ==> 0-125 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CARAHGDYYTLLDFW at 378, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 18, 39, 83, 169, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.410 = TCACGAATCCAGTAGT-1

using 306 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 94, 203]
surviving nonsolo ucounts = 2[94, 203]
ids = [8, 5]

====================================================================================

UMI info for barcode TCACGAATCCAGTAGT-1 contig 1 = GATCAGGACT...
umi TTTTTGACAG = 91 reads: +397 validated

UMI info for barcode TCACGAATCCAGTAGT-1 contig 2 = GGGCCTCAGG...
umi TATAATAGTT = 197 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=448]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-448 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 30, 63, 99, 187, 349, 369
confident = false

TIG 2[bases=546]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
414-546 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQAWDSSTAVVF at 350, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.413 = TCACGAATCCCTAACC-1

using 34 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 9, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.421 = TCACGAATCGGTTAAC-1

using 165 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 6, 152]
surviving nonsolo ucounts = 1[152]
ids = [5]

====================================================================================

UMI info for barcode TCACGAATCGGTTAAC-1 contig 1 = GGGGAGGAAT...
umi TCCACTGGCT = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=448]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-448 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 31, 37, 106, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.425 = TCACGAATCTCTTGAT-1

using 339 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 330]
surviving nonsolo ucounts = 1[330]
ids = [2]

====================================================================================

UMI info for barcode TCACGAATCTCTTGAT-1 contig 1 = GGGAGTCTCA...
umi CTGCTAGCCG = 304 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQTYSTPLTF at 350, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.426 = TCACGAATCTGGTATG-1

using 316 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 305]
surviving nonsolo ucounts = 1[305]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
389-415 ==> 11-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 44, 252, 378, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.430 = TCACGAATCTTGTCAT-1

using 153 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 141]
surviving nonsolo ucounts = 1[141]
ids = [7]

====================================================================================

UMI info for barcode TCACGAATCTTGTCAT-1 contig 1 = GAGTCAGACT...
umi TATCTATGTT = 130 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.432 = TCAGATGAGACATAAC-1

using 119 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 109]
surviving nonsolo ucounts = 1[109]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.434 = TCAGATGAGACCTAGG-1

using 285 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^3, 3, 275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGAGACCTAGG-1 contig 1 = GGAGTCAGTC...
umi ACCAGACTCT = 277 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSTPLFTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 237, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.436 = TCAGATGAGAGCCCAA-1

using 310 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 306]
surviving nonsolo ucounts = 1[306]
ids = [2]

====================================================================================

UMI info for barcode TCAGATGAGAGCCCAA-1 contig 1 = GGAGGAACTG...
umi CGTCCATAGT = 286 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=452]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
416-452 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNNWPRTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.438 = TCAGATGAGAGGTACC-1

using 237 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=468]
0-342 ==> 9-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
341-379 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
379-468 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 318, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 66, 202, 421
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.439 = TCAGATGAGAGTAATC-1

using 172 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGAGAGTAATC-1 contig 1 = CCAAGGCATT...
umi AAGGGAGGGC = 168 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=500]
0-48 ==> 31-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
48-257 ==> 0-209 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=18)
257-395 ==> 215-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
437-484 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CAREGTKVPGSPNRYYYAGMDVW at 384, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 48, 101, 106, 204, 319, 345, 441
confident = false
see deletion of 6 bases at pos 209 on |142|IGHV3-48|L-REGION+V-REGION|
>vscore_95.439_83.0%
ATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAATGTGATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCCGGATTCGTCTTTAGTAGATATTCCATGAACTGGGTCCGCCTGGCTCCAGGTAAGGGACTGGAGTGGATTGCTTACATTAGTTCTAGTACCATAGAATACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTTTCTGCACATGAACAGCCTGAGAGACGAGGACACGGCTCTATATTTCTGTGCGAGGGAA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.445 = TCAGATGAGCATGGCA-1

using 296 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[296]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.446 = TCAGATGAGCCATCGC-1

using 72 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[71]
surviving nonsolo ucounts = 1[71]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.448 = TCAGATGAGCGTCTAT-1

using 109 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 100]
surviving nonsolo ucounts = 1[100]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=459]
0-355 ==> 5-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
357-395 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
395-459 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPLFTF at 331, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 89
start codons at 28, 64, 152, 314, 334, 437
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.456 = TCAGATGAGGTACTCT-1

using 44 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 5, 35]
surviving nonsolo ucounts = 1[35]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.458 = TCAGATGAGTACGCCC-1

using 265 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [1]

====================================================================================

UMI info for barcode TCAGATGAGTACGCCC-1 contig 1 = GGGCCTCAGG...
umi CAGATGTCCA = 253 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=502]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-502 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.460 = TCAGATGAGTAGTGCG-1

using 212 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 208]
surviving nonsolo ucounts = 1[208]
ids = [2]

====================================================================================

UMI info for barcode TCAGATGAGTAGTGCG-1 contig 1 = ACAGCATGGA...
umi CCCCTTGGTA = 198 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=470]
5-358 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
353-390 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
390-470 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYSTPTF at 332, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 5, 11, 67, 80, 216, 432
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.464 = TCAGATGAGTGTCCAT-1

using 242 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGAGTGTCCAT-1 contig 1 = GATCAGGACT...
umi CCAACTTTCT = 239 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQVLQPPQTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.469 = TCAGATGCAAGAAGAG-1

using 384 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 6, 369]
surviving nonsolo ucounts = 1[369]
ids = [1]

====================================================================================

UMI info for barcode TCAGATGCAAGAAGAG-1 contig 1 = AGCACTGAAC...
umi CGGTCACCGA = 369 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=562]
0-24 ==> 56-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
24-375 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
377-404 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=2)
409-460 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
460-562 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CARGNYDILTGYYARSWFDPW at 366, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 24, 175, 180, 233, 238, 241, 259, 327, 403, 478, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.471 = TCAGATGCAAGCCCAC-1

using 204 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGCAAGCCCAC-1 contig 1 = CTGGGCCTCA...
umi CTCTTCTCCC = 194 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=535]
0-37 ==> 78-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
37-377 ==> 0-340 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-535 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQVWDSSTVVF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 37, 98, 185, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.474 = TCAGATGCAAGTACCT-1

using 595 reads

====================================================================================

graph has 204 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 268, 317]
surviving nonsolo ucounts = 2[268, 317]
ids = [1, 6]

====================================================================================

UMI info for barcode TCAGATGCAAGTACCT-1 contig 1 = AGTCAGTCTC...
umi CGCTTTGGTC = 267 reads: +388 validated

UMI info for barcode TCAGATGCAAGTACCT-1 contig 2 = AGTTAGGACC...
umi GTCGGCTTAA = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-361 ==> 0-337 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=27)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQMFSIPFTF at 351, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 24, 30, 86, 99, 235, 238, 328, 360, 454
confident = false

TIG 2[bases=545]
0-21 ==> 26-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
21-366 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
371-409 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPPEFTF at 342, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 21, 226, 229, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.476 = TCAGATGCAATGAATG-1

using 85 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 76]
surviving nonsolo ucounts = 1[76]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.479 = TCAGATGCACAGACTT-1

using 428 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 420]
surviving nonsolo ucounts = 1[420]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
0-214 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
214-252 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
252-463 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 182, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 12, 15, 66, 165, 192, 216, 384
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.484 = TCAGATGCACCCATGG-1

using 774 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[348, 420]
surviving nonsolo ucounts = 2[348, 420]
ids = [5, 2]

====================================================================================

UMI info for barcode TCAGATGCACCCATGG-1 contig 1 = GAAGAGCTGC...
umi CTCTATCCAG = 322 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=496]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-496 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGSSPWTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 33, 241, 367, 460
confident = false

REJECT CONTIGS

TIG 1[bases=489]
74-422 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=8)
444-489 ==> 0-45 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
cdr3 = CARAGSYHTPFDYW at 419, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 30, 74, 118
confident = false
VJ delta = 0
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.485 = TCAGATGCACCCATTC-1

using 932 reads

====================================================================================

graph has 894 edges initially, 4 edges after simplification

total ucounts = 282
nonsolo ucounts = 94[2^41, 3^20, 4^13, 5^7, 6^4, 7^4, 8^2, 12, 215, 220]
surviving nonsolo ucounts = 2[215, 220]
ids = [13, 87]

====================================================================================

UMI info for barcode TCAGATGCACCCATTC-1 contig 1 = GGGGTCTCAG...
umi AATTTCTTAC = 217 reads: +388 validated
umi CATCATCCGT = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-570 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 58 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [13, 87]
of which 2 are surviving nonsolos
reads assigned: 428
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.487 = TCAGATGCACCGTTGG-1

using 283 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 275]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.491 = TCAGATGCACGTGAGA-1

using 19381 reads

====================================================================================

graph has 6374 edges initially, 30 edges after simplification

total ucounts = 740
nonsolo ucounts = 327[2^101, 3^57, 4^27, 5^21, 6^16, 7^14, 8, 9^3, 10, 11^2, 16, 25, 27, 40^2, 53, 56, 69, 97, 98, 104, 114, 127^2, 139, 140^2, 153, 156, 160, 167, 168, 169, 170, 178, 180, 182, 184^3, 187^2, 191, 192^2, 194, 195, 197, 199, 207, 209, 212, 213, 215^2, 217, 218, 219, 221^2, 222, 225, 226, 236, 237, 238, 239, 240, 242, 243, 244, 245, 247, 253, 257, 258, 261^2, 266^3, 271, 289, 295, 298, 302, 316, 329, 335, 432, 450, 545, 604, 735]
surviving nonsolo ucounts = 76[69, 97, 98, 104, 114, 127^2, 139, 140^2, 153, 156, 160, 167, 168, 169, 170, 178, 182, 184^3, 187^2, 191, 192^2, 194, 195, 197, 199, 207, 209, 212, 213, 215^2, 217, 218, 219, 221^2, 222, 225, 226, 236, 237, 238, 239, 240, 242, 243, 244, 245, 247, 253, 257, 258, 261^2, 266^3, 271, 289, 295, 298, 302, 316, 329, 335, 432, 450, 545, 604, 735]
ids = [216, 459, 235, 23, 66, 26, 700, 48, 166, 509, ...]

====================================================================================

UMI info for barcode TCAGATGCACGTGAGA-1 contig 1 = TGAGCGCAGA...
umi AAATCACGCA = 182 reads: +385 validated
umi AACGCTTTAC = 263 reads: +385 validated
umi ACCCATGCCT = 135 reads: +12 -4XX +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +342 invalidated
umi ACGCGTCGGT = 198 reads: +385 validated
umi ACGTAGACAT = 104 reads: +385 validated
umi ACGTATGCGG = 164 reads: +385 validated
umi ACGTCTTCGA = 127 reads: +385 validated
umi ACTGGATCTC = 165 reads: +23 -2X +1 -2XX +1 -5XX +1 -1XX +1 -6XX +312 -9 +21 invalidated
umi AGAATGCCTT = 153 reads: +385 validated
umi AGCCTAGCTC = 100 reads: +31 -3X +1 -1X +1 -6XX +276 -66 invalidated
umi AGGCTTTTTC = 178 reads: +385 validated
umi AGTAGAAGGT = 315 reads: +385 validated
umi AGTATTGCGC = 211 reads: +385 validated
umi ATAAAGTCCG = 732 reads: -332 +53 non-validated
umi ATACGCTGGT = 113 reads: +385 validated
umi ATACTTATCA = 207 reads: +385 validated
umi ATAGGGGTAT = 194 reads: +385 validated
umi ATCACTATAC = 313 reads: -348X +2 -1XX +1 -4XX +1 -4XX +1 -3XX +1 -10XX +1 -1XX +1 -4XX +2 invalidated
umi ATGTAGACCT = 219 reads: +385 validated
umi ATTAATTTAC = 269 reads: +385 validated
umi ATTGCCCCCA = 191 reads: +385 validated
umi CAATTCGGTC = 216 reads: +385 validated
umi CAATTTGCTT = 27 reads: -160 +10 -1XX +2 -1XX +11 -1XX +21 -1XX +1 -1XX +3 -1XX +2 -1XX +4 -1XX +9 -1XX +1 -1XX +8 -91X +2 -1XX +3 -3XX +1 -3XX +2 -3XX +2 -1XX +2 -1XX +5 -1XX +22 invalidated
umi CACGGGCTGT = 246 reads: +385 validated
umi CACGTCGGAA = 237 reads: +385 validated
umi CAGACTTCTT = 192 reads: +385 validated
umi CAGTGCGTGC = 225 reads: +385 validated
umi CAGTGTTACC = 257 reads: +385 validated
umi CATACTCCTA = 244 reads: +385 validated
umi CATGCGATCA = 296 reads: +385 validated
umi CCAACAGCCC = 92 reads: +29 -5X +1 -1XX +1 -6XX +342 invalidated
umi CCTGCTTTAA = 241 reads: +385 validated
umi CGATAGCCGT = 69 reads: +385 validated
umi CGCATGTCAG = 325 reads: -43X +342 invalidated
umi CGGATGGGTT = 225 reads: +385 validated
umi CGGCATTCAG = 70 reads: +11 -1 +1 -3X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +342 invalidated
umi CGTTTTGCCG = 159 reads: +385 validated
umi CTTATGCATA = 146 reads: +23 -2X +1 -2XX +1 -5XX +1 -1XX +1 -6XX +342 invalidated
umi CTTGCTTTCC = 190 reads: +385 validated
umi CTTTCATCTC = 187 reads: +385 validated
umi GAGTGTGTCG = 137 reads: +37 -6XX +280 -1X +49 -12 invalidated
umi GATAGTCCCA = 266 reads: +385 validated
umi GCAGCTAAAG = 237 reads: +385 validated
umi GCCAGTTCGA = 157 reads: +385 validated
umi GCTAAACGCT = 188 reads: +385 validated
umi GCTATCTTGG = 177 reads: +385 validated
umi GGCAATGGAT = 434 reads: +385 validated
umi GGTCCGGACA = 203 reads: +385 validated
umi GGTGTCACTA = 295 reads: +385 validated
umi GGTTAATGAG = 292 reads: +385 validated
umi GGTTGTTTCC = 173 reads: +385 validated
umi GTCGTATAGG = 98 reads: +385 validated
umi GTGGAATAAC = 259 reads: +385 validated
umi GTTATATCTC = 220 reads: +385 validated
umi GTTTGTAATC = 238 reads: +385 validated
umi TAACCATATG = 171 reads: +385 validated
umi TAATTTACCG = 242 reads: +385 validated
umi TACACACATT = 102 reads: +39 -1 +1 -2X +324 -1 +6 -2 +8 -1 invalidated
umi TACAGGCCCT = 184 reads: +385 validated
umi TAGGTATTGC = 247 reads: +385 validated
umi TAGGTTGCCA = 540 reads: +385 validated
umi TCAATATTAC = 265 reads: +385 validated
umi TCACATAGGG = 242 reads: +385 validated
umi TCCAAAATCG = 231 reads: +385 validated
umi TCCGATCTTG = 222 reads: +385 validated
umi TCCGGTAATC = 607 reads: -337X +1 -4XX +1 -1XX +1 -1XX +2 -3XX +2 -1XX +31 invalidated
umi TCGCGCTGTT = 208 reads: +385 validated
umi TGCTCGATGC = 259 reads: +385 validated
umi TGTCACCTGT = 129 reads: +37 -6XX +342 invalidated
umi TTATACTGTG = 217 reads: +385 validated
umi TTATTGTTAT = 261 reads: +385 validated
umi TTCGTAGTGA = 103 reads: +21 -1 +1 -1X +2 -2X +1 -5X +1 -1XX +1 -6XX +284 -1 +2 -18 +37 invalidated
umi TTGGAGATTC = 255 reads: +385 validated
umi TTTAAGGAGT = 214 reads: +385 validated
umi TTTCCATGCA = 301 reads: +385 validated
umi TTTGTCTTTA = 160 reads: +385 validated

UMI info for barcode TCAGATGCACGTGAGA-1 contig 2 = CATTTGGTGA...
umi GTTTGTTACG = 293 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=632]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=4)
383-421 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
421-632 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 67 umis using 2128 reads
cdr3 = CGTWDSSLSAVF at 357, score = 7 + 8
umis assigned: [0, 2, 15, 21, 23, 24, 26, 31, 43, 48] and 66 others
of which 75 are surviving nonsolos
reads assigned: 16393
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=482]
0-36 ==> 43-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
36-389 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=2)
390-417 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
463-482 ==> 0-19 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAKGVLLWFGELCYFDYW at 378, score = 9 + 7
umis assigned: [492]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 36, 187, 192, 339, 398
confident = true
now this is a cell
paired!

ACGGCCGTATATTACTGTGCGAAAGGAGTATTACTATGGTTCGGGGAGTTGTGCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCAGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.493 = TCAGATGCAGATGAGC-1

using 148 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 140]
surviving nonsolo ucounts = 1[140]
ids = [3]

====================================================================================

UMI info for barcode TCAGATGCAGATGAGC-1 contig 1 = AGGAGTCAGA...
umi CAGCCATGCA = 129 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-465 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYNSYSWTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.494 = TCAGATGCAGCTCCGA-1

using 668 reads

====================================================================================

graph has 994 edges initially, 6 edges after simplification

total ucounts = 316
nonsolo ucounts = 148[2^69, 3^36, 4^17, 5^9, 6^5, 7^4, 8^2, 9, 10^3, 11, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.501 = TCAGATGCATCACGAT-1

using 277 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [2]

====================================================================================

UMI info for barcode TCAGATGCATCACGAT-1 contig 1 = GATCAGGACT...
umi TCTTACGGGT = 259 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=467]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
427-467 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CMQALQTPCSF at 366, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.513 = TCAGATGGTAGATTAG-1

using 520 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 510]
surviving nonsolo ucounts = 1[510]
ids = [4]

====================================================================================

UMI info for barcode TCAGATGGTAGATTAG-1 contig 1 = GAGTCAGACT...
umi CTCTTGTATA = 481 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-487 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 85 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 474
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.520 = TCAGATGGTCAAAGAT-1

using 301 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGGTCAAAGAT-1 contig 1 = ACCATCACAC...
umi ACCACTTCCT = 298 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=536]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
469-536 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.526 = TCAGATGGTGAGGGAG-1

using 56 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 1[54]
ids = [1]

====================================================================================

UMI info for barcode TCAGATGGTGAGGGAG-1 contig 1 = TTCACCTTCT...
umi GACATTATCT = 54 reads: +213 -1X +183 invalidated

GOOD CONTIGS

TIG 1[bases=547]
14-374 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CMQALQTPLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 14, 47, 83, 171, 333, 353, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.527 = TCAGATGGTGAGTATA-1

using 501 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 495]
surviving nonsolo ucounts = 1[495]
ids = [2]

====================================================================================

UMI info for barcode TCAGATGGTGAGTATA-1 contig 1 = GCTCTGCTTC...
umi CGTTAAGAAG = 472 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-584 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 465
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.532 = TCAGATGGTTCCCTTG-1

using 173 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGGTTCCCTTG-1 contig 1 = ACAACAGGCA...
umi GGGTAGTGGC = 158 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
425-520 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYYGSPRTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 22, 25, 80, 94, 347, 377, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.533 = TCAGATGGTTCCTCCA-1

using 590 reads

====================================================================================

graph has 301 edges initially, 20 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 239, 347]
surviving nonsolo ucounts = 2[239, 347]
ids = [2, 4]

====================================================================================

UMI info for barcode TCAGATGGTTCCTCCA-1 contig 1 = GAGTCAGTCT...
umi GTTTGGAAAG = 245 reads: -217X +1 -1X +4 -1X +4 -1X +159 invalidated

UMI info for barcode TCAGATGGTTCCTCCA-1 contig 2 = GAGTCAGTCT...
umi TGCAACCTTA = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-361 ==> 0-336 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 25, 31, 87, 100, 236, 332, 455
confident = false

TIG 2[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.541 = TCAGATGTCAAGGCTT-1

using 209 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 201]
surviving nonsolo ucounts = 1[201]
ids = [5]

====================================================================================

UMI info for barcode TCAGATGTCAAGGCTT-1 contig 1 = ATCAGTCCCA...
umi TGGGTTTGGT = 183 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.542 = TCAGATGTCAAGGTAA-1

using 343 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2^4, 3^2, 13, 304]
surviving nonsolo ucounts = 1[304]
ids = [4]

====================================================================================

UMI info for barcode TCAGATGTCAAGGTAA-1 contig 1 = GGGGAGGAAC...
umi CCTGGTATCT = 304 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.543 = TCAGATGTCAATAAGG-1

using 1020 reads

====================================================================================

graph has 320 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 80, 224, 708]
surviving nonsolo ucounts = 3[80, 224, 708]
ids = [5, 4, 1]

====================================================================================

UMI info for barcode TCAGATGTCAATAAGG-1 contig 1 = GGGAGCATCA...
umi CTTATGTGTA = 212 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=526]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-526 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 64, 262, 267, 299, 328, 361
confident = false

REJECT CONTIGS

TIG 1[bases=385]
0-139 ==> 214-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=6)
136-174 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
174-385 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 107, score = 8 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 781
start codons at 90, 115, 120
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.547 = TCAGATGTCAGTCAGT-1

using 233 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 220]
surviving nonsolo ucounts = 1[220]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.558 = TCAGATGTCCGTACAA-1

using 462 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^3, 5, 6, 166, 278]
surviving nonsolo ucounts = 2[166, 278]
ids = [4, 1]

====================================================================================

UMI info for barcode TCAGATGTCCGTACAA-1 contig 1 = AGGCTGGTCA...
umi CGTGTGCCCT = 269 reads: +388 validated

UMI info for barcode TCAGATGTCCGTACAA-1 contig 2 = GGCTCTGGGA...
umi TCCGTCAATA = 165 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=488]
0-47 ==> 134-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
47-398 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-488 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYPLTF at 374, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 47, 53, 109, 122, 258, 261, 354, 477
confident = false

TIG 2[bases=575]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=4)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=41)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
507-575 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAKDMFGSGSYTYYFDYW at 422, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 80, 225, 231, 236, 315, 383, 434, 561
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.560 = TCAGATGTCCTAGAAC-1

using 267 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 16, 243]
surviving nonsolo ucounts = 1[243]
ids = [5]

====================================================================================

UMI info for barcode TCAGATGTCCTAGAAC-1 contig 1 = TGGGAGGAAT...
umi TGGTTATGTA = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-503 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.562 = TCAGATGTCCTTTCTC-1

using 269 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGTCCTTTCTC-1 contig 1 = GGAGTCAGTC...
umi ACAATAATCC = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-501 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYSTLRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.576 = TCAGATGTCTGAAAGA-1

using 2221 reads

====================================================================================

graph has 2812 edges initially, 10 edges after simplification

total ucounts = 770
nonsolo ucounts = 385[2^149, 3^81, 4^62, 5^36, 6^23, 7^5, 8^5, 9^8, 11^6, 12^3, 14^2, 15, 17^2, 18, 385]
surviving nonsolo ucounts = 1[385]
ids = [75]

====================================================================================

UMI info for barcode TCAGATGTCTGAAAGA-1 contig 1 = AGTCCCAACC...
umi AGGTATATGA = 385 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
368-405 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDNLPLF at 347, score = 9 + 7
umis assigned: [75]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.577 = TCAGATGTCTGAGTGT-1

using 481 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[213, 264]
surviving nonsolo ucounts = 2[213, 264]
ids = [4, 0]

====================================================================================

UMI info for barcode TCAGATGTCTGAGTGT-1 contig 1 = CAGCTCTGGG...
umi CCGTCGGTTC = 268 reads: +406 validated

UMI info for barcode TCAGATGTCTGAGTGT-1 contig 2 = GGTGCTTTCT...
umi TTCTAAAGCC = 212 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=588]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=5)
437-486 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
486-588 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQNPQYGMDVW at 422, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 80, 231, 236, 294, 297, 315, 383, 443, 504, 565
confident = false

TIG 2[bases=513]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-513 ==> 0-60 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.578 = TCAGATGTCTGCCCTA-1

using 340 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [0]

====================================================================================

UMI info for barcode TCAGATGTCTGCCCTA-1 contig 1 = GTCAGACTCA...
umi AAATAGCCTG = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.585 = TCAGCAAAGAAGGACA-1

using 626 reads

====================================================================================

graph has 246 edges initially, 42 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[303, 319]
surviving nonsolo ucounts = 2[303, 319]
ids = [5, 2]

====================================================================================

UMI info for barcode TCAGCAAAGAAGGACA-1 contig 1 = AGGAGTCAGT...
umi TCTAGTACCC = 300 reads: +385 validated

UMI info for barcode TCAGCAAAGAAGGACA-1 contig 2 = AGGAGTCAGA...
umi CGTTCCCCTT = 324 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYSTPSF at 354, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 27, 33, 89, 102, 238, 454
confident = false

TIG 2[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSNSYWTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 27, 33, 87, 102, 238, 241, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.587 = TCAGCAAAGACAAAGG-1

using 318 reads

====================================================================================

graph has 529 edges initially, 4 edges after simplification

total ucounts = 153
nonsolo ucounts = 65[2^26, 3^12, 4^12, 5^7, 6^6, 9, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.598 = TCAGCAAAGCGCCTTG-1

using 382 reads

====================================================================================

graph has 146 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 7, 170, 198]
surviving nonsolo ucounts = 2[170, 198]
ids = [4, 2]

====================================================================================

UMI info for barcode TCAGCAAAGCGCCTTG-1 contig 1 = AGAGCTCTGG...
umi CATCCGGCTA = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYGSSPGLTF at 368, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 44, 252, 378, 474
confident = false

REJECT CONTIGS

TIG 1[bases=540]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-79 ==> 0-43 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-51 exon 2 [len=109] (mis=0)
188-498 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2) [SHIFT!]
495-533 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
cdr3 = CGTWDSSLSAWVF at 466, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 36, 122, 299, 350, 474
confident = false
not full
frameshifted full length stopped transcript of length 540
VJ delta = -87
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.605 = TCAGCAAAGGATTCGG-1

using 220 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAAAGGATTCGG-1 contig 1 = AGAGCTCTGG...
umi GTGTCCTCTG = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=470]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
432-470 ==> 0-38 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSPPWTF at 368, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.606 = TCAGCAAAGGCCCTTG-1

using 514 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^3, 504]
surviving nonsolo ucounts = 1[504]
ids = [7]

====================================================================================

UMI info for barcode TCAGCAAAGGCCCTTG-1 contig 1 = TTTATGGGAA...
umi TCTGACACGC = 506 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=644]
45-397 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CSAWDSSLNVWVF at 366, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 499
start codons at 3, 45, 184, 374, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.610 = TCAGCAAAGTACCGGA-1

using 305 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 300]
surviving nonsolo ucounts = 1[300]
ids = [4]

====================================================================================

UMI info for barcode TCAGCAAAGTACCGGA-1 contig 1 = GCTGGGGTCT...
umi TGCATCTGTC = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-554 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.615 = TCAGCAAAGTGGTCCC-1

using 188 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 182]
surviving nonsolo ucounts = 1[182]
ids = [5]

====================================================================================

UMI info for barcode TCAGCAAAGTGGTCCC-1 contig 1 = GATCAGGACT...
umi TTCCTCGTCC = 172 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-513 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQALQTPPYTF at 366, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.617 = TCAGCAAAGTTAGGTA-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.622 = TCAGCAACAATTCCTT-1

using 150 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^4, 3^2, 130]
surviving nonsolo ucounts = 1[130]
ids = [0]

====================================================================================

UMI info for barcode TCAGCAACAATTCCTT-1 contig 1 = GAGTCAGTCT...
umi AACTCACACT = 121 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-460 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.623 = TCAGCAACACACATGT-1

using 440 reads

====================================================================================

graph has 232 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 43, 175, 214]
surviving nonsolo ucounts = 1[214]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAACACACATGT-1 contig 1 = AGCTCTGAGA...
umi ACTTTACGGT = 186 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=499]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=9)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 17 reads
cdr3 = CAKDRLPTRTAFDYW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 79, 230, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.630 = TCAGCAACACCGCTAG-1

using 59 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 4, 8, 10^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.640 = TCAGCAACAGGCGATA-1

using 163 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAACAGGCGATA-1 contig 1 = GGGCCTCAGG...
umi TAACTAACAG = 153 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=528]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-528 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.645 = TCAGCAACATACGCCG-1

using 195 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAACATACGCCG-1 contig 1 = AGCTCTGAGA...
umi TTCATTTCCT = 190 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=538]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-538 ==> 0-35 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.649 = TCAGCAACATCCGGGT-1

using 208 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [2]

====================================================================================

UMI info for barcode TCAGCAACATCCGGGT-1 contig 1 = GGCTGGGGTC...
umi TGGTAGGGGC = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
42-380 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
430-519 ==> 0-89 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSYTTIHTFVF at 366, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 42, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.650 = TCAGCAACATCCGTGG-1

using 281 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode TCAGCAACATCCGTGG-1 contig 1 = GGAGAAGAGC...
umi ACACTCGGCA = 281 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-368 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDVSPCSF at 360, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 36, 132, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.651 = TCAGCAACATCGGAAG-1

using 309 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[309]
surviving nonsolo ucounts = 1[309]
ids = [0]

====================================================================================

UMI info for barcode TCAGCAACATCGGAAG-1 contig 1 = GAGAGCATCA...
umi AAGGATCGAG = 284 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=509]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
432-482 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
482-509 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CASGIAVDTDAFDIW at 406, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 64, 262, 267, 299, 328, 361, 434, 463, 500
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.652 = TCAGCAACATGACATC-1

using 293 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=499]
0-46 ==> 6497-6543 on rc of segment before IGHVII-53-1 exon 1 [len=6543] (mis=1)
16-54 ==> 6508-6546 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=0)
46-401 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=31)
412-475 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
475-499 ==> 0-24 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CKDMRLKYPHYYYGMDVW at 390, score = 3 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 46, 191, 197, 202, 281, 349, 399, 432
confident = false
frameshifted full length stopped transcript of length 499
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.653 = TCAGCAACATGATCCA-1

using 490 reads

====================================================================================

graph has 180 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 192, 289]
surviving nonsolo ucounts = 2[192, 289]
ids = [3, 2]

====================================================================================

UMI info for barcode TCAGCAACATGATCCA-1 contig 1 = AGCTTCAGCT...
umi ATAATTTTAG = 41 reads: -332X +1 -3XX +2 -1XX +2 -6XX +2 -2XX +3 -2XX +3 -1XX +30 -1XX invalidated
umi CAAGTTCGCG = 191 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=561]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
438-561 ==> 0-123 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CAAWDDSLNGHWVF at 368, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 221
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.657 = TCAGCAACATTGGCGC-1

using 230 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAACATTGGCGC-1 contig 1 = GGGGTCACAA...
umi TCGGCAACCT = 221 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=531]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-531 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.661 = TCAGCAAGTACCATCA-1

using 302 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 297]
surviving nonsolo ucounts = 1[297]
ids = [3]

====================================================================================

UMI info for barcode TCAGCAAGTACCATCA-1 contig 1 = GTCAGTCTCA...
umi TCTGACTCCT = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-486 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYRRPITF at 350, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 23, 29, 85, 98, 234, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.672 = TCAGCAAGTCCCGACA-1

using 9977 reads

====================================================================================

graph has 4181 edges initially, 36 edges after simplification

total ucounts = 649
nonsolo ucounts = 260[2^101, 3^51, 4^31, 5^16, 6^7, 7^5, 8^3, 9, 10^2, 11, 12^2, 14, 17, 42, 43, 46, 49, 50, 134, 141, 142, 144, 156, 158, 178, 192, 199, 224, 225, 227^2, 232, 246, 251, 254, 272, 282, 286, 292, 294, 298, 299, 306, 310, 313, 327^2, 328, 351, 355, 633]
surviving nonsolo ucounts = 35[43, 49, 50, 134, 141, 142, 156, 158, 178, 192, 199, 224, 225, 227^2, 232, 246, 251, 254, 272, 282, 286, 292, 294, 298, 299, 306, 310, 313, 327^2, 328, 351, 355, 633]
ids = [494, 183, 327, 238, 92, 131, 468, 589, 587, 314, ...]

====================================================================================

UMI info for barcode TCAGCAAGTCCCGACA-1 contig 1 = AGGAATCAGA...
umi AAAGTATCAC = 330 reads: +388 validated
umi ACCGTACTAA = 324 reads: +388 validated
umi ACTACTATGC = 228 reads: +388 validated
umi ACTGCCTAAA = 299 reads: -98X +290 invalidated
umi AGTTGGCCCT = 305 reads: +388 validated
umi ATCAAGTCAC = 272 reads: +388 validated
umi ATGAGTCCAT = 142 reads: +388 validated
umi CACTCGCTCG = 48 reads: -7 +381 non-validated
umi CACTTGGGTG = 282 reads: +388 validated
umi CCTAAGGCAG = 137 reads: +388 validated
umi CTAATACGAG = 291 reads: +388 validated
umi CTATTGGATC = 220 reads: +388 validated
umi CTTCCTCTGT = 50 reads: +10 -1 +4 -1 +347 -14 +11 non-validated
umi CTTCGAGGCA = 300 reads: +388 validated
umi GCACTGCCTA = 246 reads: +388 validated
umi GGGGGGTGCT = 313 reads: +388 validated
umi TCACCTAGCC = 328 reads: +388 validated
umi TCCACGTAGT = 231 reads: +388 validated
umi TTAACGTCCT = 222 reads: +388 validated
umi TTGAGTGGGG = 294 reads: +388 validated
umi TTTTACAGCC = 255 reads: +388 validated

UMI info for barcode TCAGCAAGTCCCGACA-1 contig 2 = GAGCTCTGGG...
umi ACTCTCTGGC = 352 reads: +421 validated
umi AGTTCTAGCT = 295 reads: +410 -1 +2 -1 +7 non-validated
umi ATATTTTATA = 310 reads: +421 validated
umi CAAGTGTACC = 202 reads: -387X +1 -1X +1 -20X +2 -1XX +1 -6XX +1 invalidated
umi CCCAAACGCT = 252 reads: +421 validated
umi CTGCGCCACC = 1 reads: -421 non-validated
umi CTTGGTATTC = 183 reads: -410X +2 -1X +1 -6X +1 invalidated
umi TAACCGCATT = 633 reads: -147X +274 invalidated
umi TACACCGGCC = 157 reads: +417 -4 non-validated
umi TATCCTCTCT = 44 reads: +357 -17 +47 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 837 reads
cdr3 = CQQYNSYPLTF at 354, score = 9 + 9
umis assigned: [5, 60, 77, 82, 112, 121, 131, 183, 186, 238] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5045
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=3)
432-455 ==> 0-23 on |28|IGHD5-12|D-REGION| [len=23] (mis=3)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 160 reads
cdr3 = CANSGYSGYDPPFDYW at 422, score = 9 + 7
umis assigned: [81, 111, 120, 167, 218, 314, 333, 454, 468, 494]
of which 10 are surviving nonsolos
reads assigned: 2393
start codons at 80, 231, 236, 289, 294, 297, 315, 383
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCAAATAGTGGCTATAGTGGCTACGATCCCCCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.676 = TCAGCAAGTGACCAAG-1

using 171 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[9, 37, 124]
surviving nonsolo ucounts = 1[124]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAAGTGACCAAG-1 contig 1 = GAATCAGTCC...
umi CAACTGACAG = 106 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.680 = TCAGCAAGTGCTTCTC-1

using 634 reads

====================================================================================

graph has 232 edges initially, 54 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 273, 359]
surviving nonsolo ucounts = 2[273, 359]
ids = [2, 0]

====================================================================================

UMI info for barcode TCAGCAAGTGCTTCTC-1 contig 1 = AGAGCTGCTC...
umi GTCCCTTTTT = 269 reads: +388 validated

UMI info for barcode TCAGCAAGTGCTTCTC-1 contig 2 = GGAGGAACTG...
umi AATACTTTAG = 363 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYGSSPRVTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 31, 239, 365, 461
confident = false

TIG 2[bases=549]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 34, 239, 242, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.683 = TCAGCAAGTGTTTGTG-1

using 235 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 231]
surviving nonsolo ucounts = 1[231]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=512]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-377 ==> 0-347 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=2)
376-512 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQGTVAAPSVFIFPPSDEQLKS at 366, score = 9 + 4
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 30, 63, 91, 99, 187, 349, 369, 418
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.687 = TCAGCAAGTTCGGCAC-1

using 218 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[9, 205]
surviving nonsolo ucounts = 1[205]
ids = [3]

====================================================================================

UMI info for barcode TCAGCAAGTTCGGCAC-1 contig 1 = ATCCAACAAC...
umi GCTTCCAGGC = 196 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=548]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-548 ==> 0-63 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 55, 211, 253, 319, 352, 442, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.688 = TCAGCAAGTTGATTCG-1

using 295 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 291]
surviving nonsolo ucounts = 1[291]
ids = [0]

====================================================================================

UMI info for barcode TCAGCAAGTTGATTCG-1 contig 1 = ATCAGTCCCA...
umi GAAATCAGCG = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.692 = TCAGCAATCACATAGC-1

using 261 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[9, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode TCAGCAATCACATAGC-1 contig 1 = ACTTTCTGAG...
umi TCCGGATCAT = 247 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=530]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=13)
440-486 ==> 6-52 on |50|IGHJ2|J-REGION| [len=52] (mis=0)
486-530 ==> 0-44 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDSPENRFVFTRREETTSVNYFDLW at 374, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.699 = TCAGCAATCAGGCGAA-1

using 17926 reads

====================================================================================

graph has 7131 edges initially, 98 edges after simplification

total ucounts = 839
nonsolo ucounts = 401[2^150, 3^69, 4^41, 5^22, 6^12, 7^15, 8^8, 9^7, 10^6, 11^2, 18, 22, 28, 35, 46, 50, 59, 64, 101, 103, 104, 105, 116, 127, 145, 154, 173, 181, 193, 200, 203, 205, 208, 212, 213, 219, 220, 222, 224, 226, 227, 233, 237, 238^2, 239, 240, 249, 253, 254, 256, 257, 260, 261, 263, 265, 268, 280, 284, 290, 302, 311, 313, 321, 323, 329, 331^3, 336, 341, 343, 345, 357, 362, 388, 403, 560, 726]
surviving nonsolo ucounts = 61[50, 64, 101, 103, 104, 105, 116, 127, 145, 154, 173, 181, 193, 200, 205, 208, 212, 213, 219, 220, 222, 224, 226, 227, 233, 237, 238^2, 239, 240, 249, 254, 256, 257, 260, 261, 263, 265, 268, 280, 284, 290, 302, 311, 313, 321, 323, 329, 331^3, 336, 341, 343, 345, 357, 362, 388, 403, 560, 726]
ids = [810, 282, 134, 748, 102, 569, 361, 664, 642, 652, ...]

====================================================================================

UMI info for barcode TCAGCAATCAGGCGAA-1 contig 1 = ATACTTTCTG...
umi AATACGTTGT = 256 reads: +412 validated
umi ACTTGTGCTA = 316 reads: +412 validated
umi ATATGTTGTC = 360 reads: +412 validated
umi CAAGATAGGT = 259 reads: +412 validated
umi CCCCTCTGCG = 286 reads: +412 validated
umi CCTACATGGC = 311 reads: +412 validated
umi CCTGAATCGG = 189 reads: -363X +6 -1XX +1 -1XX +3 -2XX +7 -1XX +1 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CTAGATGTCG = 116 reads: +412 validated
umi CTGTTCTCTT = 318 reads: +412 validated
umi TATCGTGTTC = 259 reads: +412 validated
umi TATTTTCCAG = 110 reads: +412 validated
umi TTAATATCAT = 387 reads: +412 validated

UMI info for barcode TCAGCAATCAGGCGAA-1 contig 2 = GGGGAGGAGT...
umi AAAAATGGCG = 330 reads: +388 validated
umi ACCAGCGGAT = 302 reads: +388 validated
umi ACTAGACTCG = 211 reads: +388 validated
umi ATCGGGTTAA = 263 reads: +388 validated
umi CAATGTCTTC = 182 reads: +388 validated
umi CAGGTAGAAA = 254 reads: +388 validated
umi CATTCATACT = 226 reads: +388 validated
umi CCTACCACCC = 337 reads: +388 validated
umi CCTCACGCAC = 217 reads: +388 validated
umi CCTCTAGGGT = 278 reads: +388 validated
umi CTCGACCGTA = 324 reads: +388 validated
umi CTCTAAGCGT = 260 reads: +388 validated
umi CTGCATCGGA = 325 reads: +388 validated
umi CTGGCACGAT = 320 reads: +388 validated
umi GATCCGTACG = 328 reads: +388 validated
umi GGTGCCCTCC = 337 reads: +388 validated
umi GTATGACATC = 106 reads: +388 validated
umi GTTTCGCTTT = 349 reads: +388 validated
umi TAACTGTTAT = 369 reads: +388 validated
umi TAGTTCACTG = 144 reads: +388 validated
umi TATGCTCGTT = 150 reads: +388 validated
umi TCGGGTAATC = 240 reads: +388 validated
umi TTCGTGCTAT = 339 reads: +388 validated
umi TTGCTAGCCA = 53 reads: +368 -1 +19 non-validated
umi TTGTAGCCCA = 577 reads: +388 validated
umi TTTCCTATCT = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=2)
401-449 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 291 reads
cdr3 = CASAAAGPYYFDYW at 376, score = 9 + 7
umis assigned: [36, 93, 139, 188, 266, 290, 301, 361, 415, 649] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3093
start codons at 37, 81
confident = true

TIG 2[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 1088 reads
cdr3 = CQQYDNLPPTF at 358, score = 9 + 8
umis assigned: [2, 64, 79, 148, 192, 218, 237, 291, 295, 299] and 16 others
of which 26 are surviving nonsolos
reads assigned: 6955
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

REJECT CONTIGS

TIG 1[bases=630]
0-38 ==> 0-38 on |354|IGLV3-16|5'UTR| [len=38] (mis=3)
38-72 ==> 0-34 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=0)
72-383 ==> 36-347 on |355|IGLV3-16|L-REGION+V-REGION| [len=347] (mis=3) [SHIFT!]
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [10, 12, 86, 102, 125, 134, 194, 198, 207, 233] and 13 others
of which 21 are surviving nonsolos
reads assigned: 4497
start codons at 38, 97, 141, 184
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGCGCAGCAGCTGGTCCTTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.702 = TCAGCAATCATCGATG-1

using 435 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[7, 422]
surviving nonsolo ucounts = 1[422]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=362]
25-91 ==> 287-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=4)
130-180 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
180-362 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARQMSRQILLITAAVRGAFDMW at 80, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 418
start codons at 71, 92, 143, 161
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.705 = TCAGCAATCCACGTTC-1

using 249 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [1]

====================================================================================

UMI info for barcode TCAGCAATCCACGTTC-1 contig 1 = GGTAGCTCAG...
umi CAAACTCGCT = 248 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=594]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=26)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
427-594 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDTSNPVVF at 363, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 36, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.711 = TCAGCAATCCCTCAGT-1

using 651 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^4, 295, 343]
surviving nonsolo ucounts = 2[295, 343]
ids = [10, 6]

====================================================================================

UMI info for barcode TCAGCAATCCCTCAGT-1 contig 1 = ACATGGGAAG...
umi GCCGTTTTAA = 342 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=563]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
427-461 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
461-563 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARGHGIAAAGYAGW at 385, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 2, 25, 46, 90, 176, 479, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.718 = TCAGCAATCGAGAACG-1

using 206 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode TCAGCAATCGAGAACG-1 contig 1 = AAAAACCACA...
umi CACTTCCACC = 195 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=534]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-534 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.736 = TCAGCTCAGAAACCGC-1

using 240 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCAGAAACCGC-1 contig 1 = AGGAGTCAGA...
umi GAAGGCTCCA = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-507 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.745 = TCAGCTCAGATAGGAG-1

using 103 reads

====================================================================================

graph has 108 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2^2, 3^3, 4^2, 5^3, 8, 15^2, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.752 = TCAGCTCAGCCCAGCT-1

using 263 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[258]
surviving nonsolo ucounts = 1[258]
ids = [5]

====================================================================================

UMI info for barcode TCAGCTCAGCCCAGCT-1 contig 1 = CAGAGCTCTG...
umi TTAATGTCGT = 258 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=566]
0-45 ==> 7-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
45-393 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYGTSPPTF at 369, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 45, 379, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.757 = TCAGCTCAGCGCTCCA-1

using 199 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 190]
surviving nonsolo ucounts = 1[190]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=399]
0-161 ==> 200-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
150-188 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
188-399 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLVF at 124, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 1, 8, 11, 320
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.761 = TCAGCTCAGGACATTA-1

using 272 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 4, 258]
surviving nonsolo ucounts = 1[258]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=540]
0-24 ==> 5788-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=1)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=2)
38-114 ==> 0-76 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=1)
114-339 ==> 116-341 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=14) [SHIFT!]
345-383 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
383-540 ==> 0-157 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSSYAGASWVF at 322, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 38, 149, 155, 206, 209, 305, 332
confident = false
not full
frameshifted full length stopped transcript of length 540
VJ delta = 64
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.762 = TCAGCTCAGGACGAAA-1

using 156 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 8, 138]
surviving nonsolo ucounts = 1[138]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCAGGACGAAA-1 contig 1 = GGGGGGGGTC...
umi CCTCTATCAT = 137 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-391 ==> 0-349 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=22)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
430-520 ==> 0-90 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CSSYADSYRLLF at 366, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.763 = TCAGCTCAGGACTGGT-1

using 290 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode TCAGCTCAGGACTGGT-1 contig 1 = GAGTGCTTTC...
umi TTCGAGCTTC = 284 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=586]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-586 ==> 0-117 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_95.763_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.764 = TCAGCTCAGGATATAC-1

using 1208 reads

====================================================================================

graph has 1604 edges initially, 24 edges after simplification

total ucounts = 640
nonsolo ucounts = 253[2^122, 3^65, 4^22, 5^21, 6^9, 7^3, 8^2, 9^4, 11^2, 12, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.775 = TCAGCTCAGTATCGAA-1

using 662 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 312, 344]
surviving nonsolo ucounts = 2[312, 344]
ids = [2, 3]

====================================================================================

UMI info for barcode TCAGCTCAGTATCGAA-1 contig 1 = GTCAGTCTCA...
umi GGAACTATGC = 309 reads: +388 validated
umi TCTCTTAGAT = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 108 reads
cdr3 = CQQSYTTPWTF at 350, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 649
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.787 = TCAGCTCCAACGATGG-1

using 552 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 543]
surviving nonsolo ucounts = 1[543]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCCAACGATGG-1 contig 1 = GTCAGACTCA...
umi ATACCCCGGA = 545 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 91 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 537
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.793 = TCAGCTCCAAGTAGTA-1

using 412 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^3, 397]
surviving nonsolo ucounts = 1[397]
ids = [1]

====================================================================================

UMI info for barcode TCAGCTCCAAGTAGTA-1 contig 1 = GTGGGTCCAG...
umi ACCTATAGGG = 378 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=14)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQSADIDTTHRVF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 35, 96, 165, 183, 224
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.797 = TCAGCTCCAATGAATG-1

using 250 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode TCAGCTCCAATGAATG-1 contig 1 = TGAGCGCAGA...
umi ACTATACAGA = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-537 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CGAWDTSLSAWVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.799 = TCAGCTCCACATCCGG-1

using 223 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 29
nonsolo ucounts = 14[2^4, 3^5, 4^2, 5, 7, 165]
surviving nonsolo ucounts = 1[165]
ids = [26]

====================================================================================

UMI info for barcode TCAGCTCCACATCCGG-1 contig 1 = GGGGATCAGT...
umi TGCGCGAGAT = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=444]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-444 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [26]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 27, 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.800 = TCAGCTCCACATCTTT-1

using 189 reads

====================================================================================

graph has 60 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 32, 148]
surviving nonsolo ucounts = 2[32, 148]
ids = [2, 1]

====================================================================================

UMI info for barcode TCAGCTCCACATCTTT-1 contig 1 = CCCAGAGGGA...
umi CCCATAAGGA = 144 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
13-361 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
401-464 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYGSSSGWTF at 337, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 13, 221, 347, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.803 = TCAGCTCCACCAGTTA-1

using 402 reads

====================================================================================

graph has 108 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 76, 318]
surviving nonsolo ucounts = 2[76, 318]
ids = [4, 2]

====================================================================================

UMI info for barcode TCAGCTCCACCAGTTA-1 contig 1 = GAGAGCTCTG...
umi CATAGTGGTC = 315 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=566]
45-395 ==> 0-350 on |286|IGKV3/OR2-268|L-REGION+V-REGION| [len=350] (mis=33)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CHQDGSSPRTF at 369, score = 10 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 45, 253, 379, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.808 = TCAGCTCCAGAAGCAC-1

using 301 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 12, 280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

UMI info for barcode TCAGCTCCAGAAGCAC-1 contig 1 = ACCCAAAAAC...
umi CGCTACAGCG = 262 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=567]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-567 ==> 0-77 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.809 = TCAGCTCCAGACAGGT-1

using 808 reads

====================================================================================

graph has 402 edges initially, 26 edges after simplification

total ucounts = 17
nonsolo ucounts = 5[7, 72, 218, 242, 257]
surviving nonsolo ucounts = 4[72, 218, 242, 257]
ids = [4, 3, 8, 1]

====================================================================================

UMI info for barcode TCAGCTCCAGACAGGT-1 contig 1 = GAGGAGTCAG...
umi ATGAATACGT = 248 reads: +41 -1XX +10 -1XX +3 -2XX +1 -6XX +2 -291X +1 -13X +1 -1XX +3 -3XX +1 -1XX +1 -3XX +1 -1XX invalidated
umi CGGGACTCGT = 227 reads: +308 -1XX +79 invalidated
umi CTAGCATGGT = 31 reads: +61 -1XX +1 -1XX +11 -1XX +13 -1XX +1 -4XX +2 -117 +1 -1XX +2 -1XX +2 -1XX +1 -1XX +3 -6XX +3 -1XX +9 -1XX +40 -1XX +41 -1XX +2 -1XX +2 -3XX +1 -2XX +2 -1X +1 -1X +1 -2X +6 -1X +6 -14 +12 invalidated

UMI info for barcode TCAGCTCCAGACAGGT-1 contig 2 = GGTGATCAGC...
umi GTTGAGCAGG = 239 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=552]
28-360 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CQHLVTHPISF at 355, score = 8 + 7
umis assigned: [1, 3, 4]
of which 3 are surviving nonsolos
reads assigned: 491
start codons at 28, 34, 239, 242, 335, 458
confident = true

TIG 2[bases=531]
0-31 ==> 48-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
31-384 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
408-455 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
455-531 ==> 0-76 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDRAATARLGGMDVW at 373, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 31, 182, 187, 334, 412
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGCGGCGACAGCTCGTCTTGGCGGTATGGACGTCTGGGGCCAAGGGACCGCGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGTCAGCACCTTGTTACTCACCCGATCAGCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.810 = TCAGCTCCAGATCTGT-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.817 = TCAGCTCCAGGGTACA-1

using 50 reads

====================================================================================

graph has 53 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 6, 10^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.824 = TCAGCTCCATATGAGA-1

using 257 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 4, 242]
surviving nonsolo ucounts = 1[242]
ids = [3]

====================================================================================

UMI info for barcode TCAGCTCCATATGAGA-1 contig 1 = AGCTCAGCTT...
umi CGTCATGAAT = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
0-51 ==> 5-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
51-402 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
401-439 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
439-525 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CAAWDDSLSGWVF at 372, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 51, 205, 355, 380, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.827 = TCAGCTCCATCCGTGG-1

using 138 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[138]
surviving nonsolo ucounts = 1[138]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=370]
22-222 ==> 99-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=12)
299-347 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
347-370 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CVRGGRSLWFGDLLDYW at 265, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 79, 137, 140, 288
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.835 = TCAGCTCCATTGGCGC-1

using 23 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.838 = TCAGCTCGTACTTAGC-1

using 326 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 319]
surviving nonsolo ucounts = 1[319]
ids = [4]

====================================================================================

UMI info for barcode TCAGCTCGTACTTAGC-1 contig 1 = GAGAAGAGCT...
umi TGTGTGTCTC = 295 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=515]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-515 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQHATSPFTF at 359, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.839 = TCAGCTCGTAGAAGGA-1

using 306 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [0]

====================================================================================

UMI info for barcode TCAGCTCGTAGAAGGA-1 contig 1 = GGAACTGCTC...
umi CACTCACCCG = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=491]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-491 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSDWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.842 = TCAGCTCGTAGGACAC-1

using 325 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [3]

====================================================================================

UMI info for barcode TCAGCTCGTAGGACAC-1 contig 1 = GACTCAGGAC...
umi TTGTCTATCT = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
15-366 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
364-403 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQDYTYPFSF at 342, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 15, 21, 77, 90, 172, 175, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.844 = TCAGCTCGTCAAAGAT-1

using 328 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 325]
surviving nonsolo ucounts = 1[325]
ids = [1]

====================================================================================

UMI info for barcode TCAGCTCGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi CCGCTTATAC = 309 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=535]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-535 ==> 0-102 on |212|IGKC|C-REGION| [len=320] (mis=2)
junction support: 1 umis using 52 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 30, 63, 99, 187, 349, 369, 475, 516
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.846 = TCAGCTCGTCCTCCAT-1

using 85 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 79]
surviving nonsolo ucounts = 1[79]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCGTCCTCCAT-1 contig 1 = CCTCCTTGGG...
umi TAGCTTCCTT = 77 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=485]
0-38 ==> 21-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
38-391 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
396-447 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
447-485 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARGSTSWYDYW at 380, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 38, 189, 236, 241, 273, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.847 = TCAGCTCGTCGGCTCA-1

using 79 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 76]
surviving nonsolo ucounts = 1[76]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.873 = TCAGCTCTCAGTTGAC-1

using 66 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^2, 3^3, 4, 5, 6, 9, 11, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.874 = TCAGCTCTCATCTGCC-1

using 254 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 242]
surviving nonsolo ucounts = 1[242]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCTCATCTGCC-1 contig 1 = TGGGAGAGTC...
umi CCCAGCTGGG = 230 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=552]
0-32 ==> 27-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
32-385 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
434-468 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
468-552 ==> 0-84 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 374, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 32, 230, 235, 252, 296, 329, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.875 = TCAGCTCTCATGTCTT-1

using 3615 reads

====================================================================================

graph has 4540 edges initially, 36 edges after simplification

total ucounts = 1401
nonsolo ucounts = 716[2^318, 3^179, 4^105, 5^48, 6^21, 7^12, 8^11, 9^3, 10^6, 11^3, 12^5, 13, 17, 113, 138, 338]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=375]
67-224 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=0)
223-273 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
273-375 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [344, 718]
of which 0 are surviving nonsolos
reads assigned: 463
start codons at 151, 189, 225, 254, 291, 352
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.877 = TCAGCTCTCCACGAAT-1

using 255 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 6, 240]
surviving nonsolo ucounts = 1[240]
ids = [6]

====================================================================================

UMI info for barcode TCAGCTCTCCACGAAT-1 contig 1 = GTCAGTCCCA...
umi TAACAAACGC = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-459 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.880 = TCAGCTCTCCAGTAGT-1

using 1979 reads

====================================================================================

graph has 2780 edges initially, 16 edges after simplification

total ucounts = 862
nonsolo ucounts = 379[2^181, 3^76, 4^48, 5^29, 6^22, 7^8, 8^6, 9, 10^2, 11, 13, 17, 18, 21, 224]
surviving nonsolo ucounts = 1[224]
ids = [499]

====================================================================================

UMI info for barcode TCAGCTCTCCAGTAGT-1 contig 1 = GAGATCACAG...
umi GCCACGGCGC = 205 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=539]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-539 ==> 0-84 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [499]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.881 = TCAGCTCTCCATGAAC-1

using 27 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 5, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.884 = TCAGCTCTCCGTCATC-1

using 11334 reads

====================================================================================

graph has 4907 edges initially, 72 edges after simplification

total ucounts = 745
nonsolo ucounts = 366[2^141, 3^78, 4^52, 5^20, 6^13, 7^6, 8^4, 9^3, 10^4, 11^4, 12, 14, 15, 16, 18, 75, 93, 105, 115, 142, 166, 171, 189, 190, 197, 207, 209, 230, 231^2, 232, 234, 240, 249, 252, 273, 274^2, 278, 292, 301, 302, 305, 314, 319, 364, 366, 418, 522, 716, 717]
surviving nonsolo ucounts = 35[14, 75, 93, 105, 142, 166, 189, 190, 197, 207, 209, 230, 231^2, 232, 234, 240, 249, 252, 273, 274^2, 278, 292, 301, 302, 305, 314, 319, 364, 366, 418, 522, 716, 717]
ids = [418, 238, 208, 287, 346, 451, 312, 739, 227, 531, ...]

====================================================================================

UMI info for barcode TCAGCTCTCCGTCATC-1 contig 1 = ACTTTCTGAG...
umi AAGCACGCAC = 229 reads: +436 validated
umi CTGCGTGTGG = 126 reads: +436 validated
umi CTGGAATCCA = 248 reads: +436 validated
umi GTATTTGTAT = 258 reads: +436 validated
umi TGTCTATCCT = 199 reads: +436 validated

UMI info for barcode TCAGCTCTCCGTCATC-1 contig 2 = AGCTTCAGCT...
umi ACTCAGCACT = 255 reads: +388 validated
umi AGCCTATCCA = 231 reads: +388 validated
umi CAAGTTATAA = 93 reads: +388 validated
umi CAGATGTTGG = 197 reads: +388 validated
umi CATAGACCTT = 75 reads: +388 validated
umi CTAAAGCCAG = 190 reads: +388 validated
umi GCCGCCCACC = 276 reads: +388 validated
umi GCTCCTCCTT = 232 reads: +388 validated
umi GGAGACGCTT = 318 reads: +388 validated
umi GGGCTCACCC = 165 reads: +388 validated
umi GGTAACTGCG = 299 reads: -17X +1 -2XX +2 -3XX +2 -3XX +1 -1XX +1 -3XX +2 -3XX +1 -2XX +344 invalidated
umi TAGGTAGTTT = 210 reads: +269 -1XX +118 invalidated
umi TCCTATCATC = 233 reads: +388 validated
umi TCCTGTTGAA = 211 reads: +388 validated
umi TGACACATTG = 234 reads: +388 validated
umi TGGCGCGCGG = 228 reads: +388 validated
umi TTCGATCGAT = 248 reads: +388 validated
umi TTTTCTCCGT = 190 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=17)
393-420 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=7)
420-471 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
471-491 ==> 0-20 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 101 reads
cdr3 = CARGSLSMVRGVREVWFDPW at 380, score = 9 + 7
umis assigned: [31, 346, 347, 468, 651]
of which 5 are surviving nonsolos
reads assigned: 1044
start codons at 35, 79, 401
confident = true

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=6)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 18 umis using 592 reads
cdr3 = CATWDASLNGPVF at 368, score = 8 + 8
umis assigned: [94, 111, 208, 227, 238, 312, 407, 423, 436, 451] and 8 others
of which 18 are surviving nonsolos
reads assigned: 3825
start codons at 47, 351, 376, 381, 393
confident = true

REJECT CONTIGS

TIG 1[bases=392]
1-125 ==> 2526-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
157-210 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
210-392 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [58, 418, 514]
of which 3 are surviving nonsolos
reads assigned: 971
start codons at 26, 167
confident = false
did not find CDR3

TIG 2[bases=564]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-44 ==> 5956-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
17-58 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [16, 141, 225, 266, 282, 283, 287, 320, 338, 415]
of which 9 are surviving nonsolos
reads assigned: 3317
start codons at 44, 113, 249, 470
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGAGGGTCCCTTTCTATGGTTCGGGGAGTTAGAGAGGTTTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGGTGATTATTACTGTGCAACATGGGATGCCAGCCTGAATGGTCCGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.886 = TCAGCTCTCCTAAGTG-1

using 16439 reads

====================================================================================

graph has 7570 edges initially, 88 edges after simplification

total ucounts = 1324
nonsolo ucounts = 607[2^238, 3^123, 4^86, 5^37, 6^31, 7^11, 8^11, 9^4, 10, 11^2, 12, 13, 18, 19, 21, 33, 36, 38, 81, 108, 139, 140, 146^3, 149, 160, 167, 174, 180, 181^2, 184, 188^2, 189^2, 190, 193, 202, 207, 219, 221, 225, 227, 229^3, 230^2, 231, 235, 243^2, 244, 245, 246, 247, 254, 262, 272, 276, 284, 306, 310, 316, 317, 319, 334, 407, 550, 794, 937]
surviving nonsolo ucounts = 54[33, 38, 108, 139, 146^3, 149, 167, 174, 180, 181^2, 184, 188^2, 189^2, 190, 193, 202, 207, 219, 221, 225, 227, 229^3, 230^2, 231, 235, 243^2, 244, 245, 246, 247, 254, 262, 272, 276, 284, 306, 310, 316, 317, 319, 334, 407, 550, 794, 937]
ids = [158, 65, 862, 232, 173, 323, 358, 386, 838, 1181, ...]

====================================================================================

UMI info for barcode TCAGCTCTCCTAAGTG-1 contig 1 = ATACTTTCTG...
umi ACAGGCGTCT = 37 reads: +308 -1 +1 -78 +24 non-validated
umi ACCAGAGCTG = 275 reads: +412 validated
umi ACGCCCAGTA = 219 reads: -196X +216 invalidated
umi AGCTCCTCTA = 13 reads: +70 -1 +5 -1 +5 -1 +1 -1 +2 -1 +3 -1 +2 -1X +3 -1 +8 -1X +107 -125X +1 -3X +1 -4X +1 -3X +1 -1X +2 -2X +1 -3X +49 invalidated
umi AGGTTCTCTA = 129 reads: +412 validated
umi CATCTAAGTT = 146 reads: +412 validated
umi CCAACATGTC = 148 reads: +412 validated
umi CGTTGTCCCT = 274 reads: +412 validated
umi CTCTGTGCTT = 249 reads: +412 validated
umi CTGGAGACGC = 326 reads: +207 -1XX +204 invalidated
umi GTAGCACATG = 317 reads: +412 validated
umi GTAGTACGTA = 108 reads: +367 -1X +5 -1 +1 -37 invalidated

UMI info for barcode TCAGCTCTCCTAAGTG-1 contig 2 = AGCTTCAGCT...
umi AATCGTCCGA = 225 reads: +391 validated
umi ACATGGACTC = 323 reads: +391 validated
umi ACCACTTAAT = 188 reads: +391 validated
umi AGTGAATGAT = 314 reads: -349 +1 -1XX +1 -2XX +37 invalidated
umi AGTTGATATG = 234 reads: +391 validated
umi ATCATTCTCT = 180 reads: +391 validated
umi CAATAGTATG = 235 reads: +391 validated
umi CACATACAGT = 231 reads: +391 validated
umi CAGATTGGTT = 231 reads: +391 validated
umi CAGCTTGATC = 98 reads: +27 -1X +1 -12X +1 -1XX +348 invalidated
umi CCAATAGTGG = 221 reads: +391 validated
umi CCCTACGTGG = 227 reads: +391 validated
umi CCGTTAGGAC = 268 reads: +391 validated
umi CTATTATTGC = 231 reads: +391 validated
umi CTCACTAAGG = 202 reads: +391 validated
umi CTGATGATCC = 205 reads: +391 validated
umi GCAGTTAGGT = 272 reads: +151 -1XX +3 -1XX +235 invalidated
umi GCCATGGTAG = 307 reads: -355X +2 -1XX +1 -5XX +1 -6XX +2 -2XX +1 -2XX +1 -1XX +2 -3XX +1 -3XX +2 invalidated
umi GCGTATATTC = 187 reads: +391 validated
umi GCTCAAGACT = 405 reads: +391 validated
umi GGAATCGCCG = 796 reads: -340 +1 -3XX +1 -6XX +1 -2XX +37 invalidated
umi GGAGTATGTC = 184 reads: +391 validated
umi TACATCATTA = 245 reads: +391 validated
umi TACTCGTACT = 287 reads: +391 validated
umi TCATTGTCCC = 305 reads: +391 validated
umi TCCCGGGATT = 221 reads: +391 validated
umi TCTAATTTTG = 257 reads: +391 validated
umi TCTATACTTC = 187 reads: +391 validated
umi TGATTTAGTA = 187 reads: +384 -4 +3 non-validated
umi TGCTCGGGCT = 177 reads: +391 validated
umi TGGATATCAT = 242 reads: +391 validated
umi TGTATCGGGT = 249 reads: +391 validated
umi TGTATTGTCT = 230 reads: +391 validated
umi TGTGTATAGC = 243 reads: +391 validated
umi TTCGGGCCTT = 188 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=520]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=20)
398-449 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 320 reads
cdr3 = CARGQVGGHWFDPW at 376, score = 8 + 7
umis assigned: [65, 93, 111, 158, 173, 358, 386, 555, 610, 621] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2192
start codons at 37, 81, 182, 231, 310
confident = true

TIG 2[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=4)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
437-648 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 31 umis using 1045 reads
cdr3 = CAAWDDSLSGYWVF at 367, score = 7 + 8
umis assigned: [38, 76, 92, 185, 193, 220, 285, 293, 319, 323] and 25 others
of which 35 are surviving nonsolos
reads assigned: 8619
start codons at 46, 350, 375, 380
confident = true

REJECT CONTIGS

TIG 1[bases=812]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
0-86 ==> 5914-6000 on segment before IGLV6-57 exon 1 [len=6000] (mis=0)
86-129 ==> 0-43 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=0)
89-257 ==> 0-168 on segment before IGLV6-57 exon 2 [len=168] (mis=2)
254-564 ==> 43-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=9) [SHIFT!]
563-601 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
601-812 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [100, 232, 731, 838, 1181, 1252]
of which 6 are surviving nonsolos
reads assigned: 1066
start codons at 86, 168, 183, 274, 422, 548
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCTGCGGACACGGCCGTGTATTCCTGTGCGAGGGGACAAGTTGGAGGCCACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTTACTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.887 = TCAGCTCTCCTAGGGC-1

using 108 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 103]
surviving nonsolo ucounts = 1[103]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.893 = TCAGCTCTCGAGAGCA-1

using 649 reads

====================================================================================

graph has 298 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 291, 351]
surviving nonsolo ucounts = 2[291, 351]
ids = [5, 4]

====================================================================================

UMI info for barcode TCAGCTCTCGAGAGCA-1 contig 1 = ATCAGTCCCA...
umi GAGTTCATGG = 355 reads: +388 validated

UMI info for barcode TCAGCTCTCGAGAGCA-1 contig 2 = GAGCTGCTCA...
umi GGTGATGCGC = 290 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 344
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=557]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGSSPPMYTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 30, 238, 364, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.897 = TCAGCTCTCGGCTTGG-1

using 346 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 336]
surviving nonsolo ucounts = 1[336]
ids = [2]

====================================================================================

UMI info for barcode TCAGCTCTCGGCTTGG-1 contig 1 = GAGTCAGTCT...
umi TCCCCTCCGT = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYSTPLTF at 352, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.909 = TCAGCTCTCTGTCTCG-1

using 229 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TCAGCTCTCTGTCTCG-1 contig 1 = GCTGGGGTCA...
umi ACACGCTCAG = 226 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=597]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-597 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 31 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.922 = TCAGGATAGAATAGGG-1

using 611 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[610]
surviving nonsolo ucounts = 1[610]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=350]
1-35 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
14-168 ==> 0-154 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=1)
168-350 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 599
start codons at 14, 35, 79, 165
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.923 = TCAGGATAGACCCACC-1

using 206 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 196]
surviving nonsolo ucounts = 1[196]
ids = [3]

====================================================================================

UMI info for barcode TCAGGATAGACCCACC-1 contig 1 = GCTCTGCTTC...
umi CTTGAGACCA = 186 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=562]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-562 ==> 0-117 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.935 = TCAGGATAGCGATCCC-1

using 338 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode TCAGGATAGCGATCCC-1 contig 1 = GGCGCCAGGG...
umi CAAGCAATCT = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=630]
0-31 ==> 3-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CLLYYGGAQLVF at 355, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 31, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.939 = TCAGGATAGGACCACA-1

using 337 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [3]

====================================================================================

UMI info for barcode TCAGGATAGGACCACA-1 contig 1 = AGGAATCAGT...
umi GCCAGCTTAG = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.944 = TCAGGATAGGCTCAGA-1

using 218 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 211]
surviving nonsolo ucounts = 1[211]
ids = [5]

====================================================================================

UMI info for barcode TCAGGATAGGCTCAGA-1 contig 1 = GAGTCAGACT...
umi TCTATTCCTC = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-502 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.948 = TCAGGATAGTACGACG-1

using 5590 reads

====================================================================================

graph has 3376 edges initially, 56 edges after simplification

total ucounts = 1013
nonsolo ucounts = 797[2^140, 3^100, 4^100, 5^96, 6^81, 7^68, 8^39, 9^44, 10^29, 11^20, 12^22, 13^14, 14^16, 15^6, 16^10, 17^6, 18^3, 19, 25, 614]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.950 = TCAGGATAGTGGAGTC-1

using 476 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3^2, 462]
surviving nonsolo ucounts = 1[462]
ids = [3]

====================================================================================

UMI info for barcode TCAGGATAGTGGAGTC-1 contig 1 = ACAACAGGCA...
umi ATCAAGCTGG = 435 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=17)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
425-509 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CQQYYTTPFTF at 364, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 429
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.954 = TCAGGATCAAGCGAGT-1

using 56 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.960 = TCAGGATCAATGTTGC-1

using 48 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.968 = TCAGGATCAGACGCAA-1

using 303 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[12, 288]
surviving nonsolo ucounts = 1[288]
ids = [2]

====================================================================================

UMI info for barcode TCAGGATCAGACGCAA-1 contig 1 = GGCGCCAGGG...
umi TGTTAGTAGA = 264 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
0-31 ==> 3-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=3)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
416-508 ==> 0-92 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLLYYGGALVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 31, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.970 = TCAGGATCAGAGCCAA-1

using 120 reads

====================================================================================

graph has 134 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[3, 5^2, 13, 16, 77]
surviving nonsolo ucounts = 1[77]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.971 = TCAGGATCAGCCAGAA-1

using 301 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 8, 288]
surviving nonsolo ucounts = 1[288]
ids = [3]

====================================================================================

UMI info for barcode TCAGGATCAGCCAGAA-1 contig 1 = GGGACTGATC...
umi CTAGTTACAG = 286 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTRETF at 372, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.979 = TCAGGATCATGTCCTC-1

using 291 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 15, 266]
surviving nonsolo ucounts = 1[266]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.980 = TCAGGATCATGTCTCC-1

using 349 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 344]
surviving nonsolo ucounts = 1[344]
ids = [1]

====================================================================================

UMI info for barcode TCAGGATCATGTCTCC-1 contig 1 = GTCAGACTCA...
umi GCTTTAAGGC = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-502 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.982 = TCAGGATCATTTCACT-1

using 283 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode TCAGGATCATTTCACT-1 contig 1 = GTCAGACTCA...
umi AAGTTGCGGG = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNTYLFTF at 350, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.985 = TCAGGATGTAATTGGA-1

using 454 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[137, 309]
surviving nonsolo ucounts = 2[137, 309]
ids = [6, 8]

====================================================================================

UMI info for barcode TCAGGATGTAATTGGA-1 contig 1 = AGTCTCAGTC...
umi GTAAATGCTC = 124 reads: +388 validated

UMI info for barcode TCAGGATGTAATTGGA-1 contig 2 = AGCTCTGGGA...
umi TAAACTCCCA = 312 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=474]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-474 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQSYSTPYTF at 347, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 20, 26, 82, 95, 231, 450
confident = false

TIG 2[bases=578]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=10)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
507-578 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARSVGGRWWDLYYFDYW at 422, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 80, 236, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.989 = TCAGGATGTATGAAAC-1

using 343 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[341]
surviving nonsolo ucounts = 1[341]
ids = [2]

====================================================================================

UMI info for barcode TCAGGATGTATGAAAC-1 contig 1 = AGAAGTCTCT...
umi TTTCCTGTTC = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-27 ==> 4-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
27-343 ==> 0-316 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=17)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQKHDTAPWTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 27, 33, 89, 102, 292, 337, 364, 377, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.991 = TCAGGATGTCACCTAA-1

using 783 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 350, 427]
surviving nonsolo ucounts = 2[350, 427]
ids = [3, 2]

====================================================================================

UMI info for barcode TCAGGATGTCACCTAA-1 contig 1 = TGGGGAGGAA...
umi GTCAAGCTTC = 432 reads: +382 validated
umi TATAATGCGG = 350 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 102 reads
cdr3 = CQQRRTWPPAF at 358, score = 9 + 6
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 768
start codons at 37, 86, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.996 = TCAGGATGTCGAGATG-1

using 806 reads

====================================================================================

graph has 356 edges initially, 44 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[188, 232, 386]
surviving nonsolo ucounts = 3[188, 232, 386]
ids = [1, 2, 0]

====================================================================================

UMI info for barcode TCAGGATGTCGAGATG-1 contig 1 = GGGGAGGAGT...
umi AGATGTCGAA = 393 reads: +385 validated

UMI info for barcode TCAGGATGTCGAGATG-1 contig 2 = GGGCCTCAGG...
umi TTTAACTTTA = 219 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=552]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYSTPSF at 358, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 31, 37, 93, 106, 242, 458
confident = false

TIG 2[bases=538]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-375 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
411-538 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQAWDSSTVVF at 350, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 35, 40, 96, 183, 329, 333
confident = false

REJECT CONTIGS

TIG 1[bases=549]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-27 ==> 6795-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
16-79 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 27, 33, 89, 102, 455
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1005 = TCAGGATGTTAAGACA-1

using 361 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^3, 10, 335]
surviving nonsolo ucounts = 1[335]
ids = [5]

====================================================================================

UMI info for barcode TCAGGATGTTAAGACA-1 contig 1 = AGTCCCACTC...
umi CATGTACATT = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1008 = TCAGGATGTTATGCGT-1

using 586 reads

====================================================================================

graph has 232 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[38, 196, 349]
surviving nonsolo ucounts = 3[38, 196, 349]
ids = [2, 0, 4]

====================================================================================

UMI info for barcode TCAGGATGTTATGCGT-1 contig 1 = TGAGCGCAGA...
umi ACCGGGCCTC = 184 reads: +388 validated

UMI info for barcode TCAGGATGTTATGCGT-1 contig 2 = AGTCCCACTC...
umi TATTTTCCTG = 352 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-376 ==> 0-340 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
424-536 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CGAWDSNLSVLLF at 357, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 36, 190, 241, 247, 365
confident = false

TIG 2[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1010 = TCAGGATTCAAACCGT-1

using 63 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^3, 54]
surviving nonsolo ucounts = 1[54]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1029 = TCAGGATTCGGTGTTA-1

using 285 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 277]
surviving nonsolo ucounts = 1[277]
ids = [1]

====================================================================================

UMI info for barcode TCAGGATTCGGTGTTA-1 contig 1 = AGAGAGGTGC...
umi ATAATATAAC = 275 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=589]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
449-487 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
487-589 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDLGSYGPRSYW at 414, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 72, 223, 228, 375, 436, 505, 566
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1037 = TCAGGATTCTATGTGG-1

using 183 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 177]
surviving nonsolo ucounts = 1[177]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1048 = TCAGGTAAGATAGTCA-1

using 197 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 185]
surviving nonsolo ucounts = 1[185]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1052 = TCAGGTAAGCAGATCG-1

using 13824 reads

====================================================================================

graph has 4742 edges initially, 22 edges after simplification

total ucounts = 670
nonsolo ucounts = 333[2^119, 3^70, 4^39, 5^18, 6^14, 7^13, 8^3, 9^4, 10, 11, 12^2, 13, 17, 65, 68, 70, 94, 98, 120, 126, 162^2, 186, 187, 236, 240, 263, 266, 268, 269, 271, 274^2, 277, 283, 288, 290, 294, 297^2, 298, 300, 301, 302, 307, 310^2, 313, 316, 318, 319, 320, 322^2, 323, 349, 354, 362, 399, 613]
surviving nonsolo ucounts = 42[98, 126, 162^2, 186, 187, 236, 240, 263, 266, 268, 269, 271, 274^2, 277, 283, 288, 290, 294, 297^2, 298, 300, 301, 302, 307, 310^2, 313, 316, 318, 319, 320, 322^2, 323, 349, 354, 362, 399, 613]
ids = [559, 481, 141, 325, 293, 131, 37, 258, 454, 220, ...]

====================================================================================

UMI info for barcode TCAGGTAAGCAGATCG-1 contig 1 = GGGAGAGCCC...
umi AATAGTGTTT = 237 reads: +385 validated
umi ACACCAGCTG = 299 reads: +385 validated
umi ACACGTATCT = 289 reads: +385 validated
umi ACCCGTTCAT = 271 reads: +385 validated
umi ACCGCACTTC = 310 reads: +385 validated
umi AGCTCATTCT = 270 reads: +385 validated
umi AGTCTTTTGC = 396 reads: +385 validated
umi ATATCACCCT = 189 reads: +385 validated
umi ATGTTGGGGA = 301 reads: +385 validated
umi ATGTTGTGAC = 165 reads: +385 validated
umi ATTCTTTGGG = 275 reads: +385 validated
umi ATTGCTAGGG = 276 reads: +385 validated
umi CACCATTTCT = 323 reads: +385 validated
umi CATTTGACAA = 301 reads: +385 validated
umi CCAATCACCG = 273 reads: +385 validated
umi CCACCAGTCG = 274 reads: +385 validated
umi CCAGTTGTTG = 326 reads: +385 validated
umi CCTTCGTCCG = 240 reads: +385 validated
umi CGCACACAGC = 316 reads: +385 validated
umi CGCTTGATCA = 307 reads: +385 validated
umi CGTAGTTAGG = 299 reads: +385 validated
umi CGTTGTTCAA = 186 reads: +385 validated
umi CTTATCAAAT = 161 reads: +385 validated
umi CTTGTATCCC = 366 reads: +385 validated
umi CTTTGCAGTC = 603 reads: +385 validated
umi GATAGCCTTC = 318 reads: +385 validated
umi GATGTAATAT = 299 reads: +385 validated
umi GCACGAGGCT = 349 reads: +385 validated
umi GCTACAGTCG = 273 reads: +385 validated
umi GGCAGTTTCT = 298 reads: +385 validated
umi GGCCAATGCG = 320 reads: +385 validated
umi GTGGAGGTCA = 261 reads: +385 validated
umi GTTAATTGGT = 312 reads: +385 validated
umi GTTCATTCAT = 356 reads: +385 validated
umi TAATTCTTGT = 126 reads: +385 validated
umi TGCCCGCTAG = 287 reads: +385 validated
umi TTATTAACAC = 291 reads: +385 validated
umi TTCGCCCCTT = 323 reads: +385 validated
umi TTGCAATAGC = 317 reads: +385 validated
umi TTGCCTTTCA = 302 reads: +385 validated
umi TTTTCCTGTT = 326 reads: +385 validated

UMI info for barcode TCAGGTAAGCAGATCG-1 contig 2 = ATCATCCAAC...
umi TCGTCATAGT = 96 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 41 umis using 1842 reads
cdr3 = CQQRSNWPPITF at 368, score = 10 + 8
umis assigned: [37, 50, 54, 64, 72, 109, 123, 131, 140, 141] and 31 others
of which 41 are surviving nonsolos
reads assigned: 11807
start codons at 47, 252, 255, 474
confident = true

TIG 2[bases=498]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
476-498 ==> 0-22 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CALVSTLSALPFDFW at 400, score = 9 + 7
umis assigned: [559]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 58, 256, 262, 355
confident = true
now this is a cell
paired!

TCTGAAGACACGGCCGTCTATTACTGTGCCCTAGTGTCTACACTCAGCGCCCTCCCATTTGACTTTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTAGAGCCTGAAGATTCTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCTATCACCTTCGGCCAAGGGACACGATTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1055 = TCAGGTAAGCGAAGGG-1

using 25 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 19]
surviving nonsolo ucounts = 1[19]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1056 = TCAGGTAAGCGATAGC-1

using 372 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[16, 354]
surviving nonsolo ucounts = 1[354]
ids = [3]

====================================================================================

UMI info for barcode TCAGGTAAGCGATAGC-1 contig 1 = AGGAGTCAGA...
umi TCTAGCGGTG = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-464 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYPRTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1061 = TCAGGTAAGCGTGAGT-1

using 972 reads

====================================================================================

graph has 340 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 267, 339, 362]
surviving nonsolo ucounts = 3[267, 339, 362]
ids = [1, 4, 0]

====================================================================================

UMI info for barcode TCAGGTAAGCGTGAGT-1 contig 1 = AGGCTGGTCA...
umi ACTGCTTGCT = 367 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=568]
0-47 ==> 134-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
47-398 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=26)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNAFATF at 374, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 47, 53, 122, 236, 387, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1070 = TCAGGTAAGGCTCATT-1

using 235 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [1]

====================================================================================

UMI info for barcode TCAGGTAAGGCTCATT-1 contig 1 = ATCAGTCCCA...
umi GCGTAGACAC = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=457]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-457 ==> 0-46 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1080 = TCAGGTACAACAACCT-1

using 697 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 5, 323, 358]
surviving nonsolo ucounts = 2[323, 358]
ids = [6, 3]

====================================================================================

UMI info for barcode TCAGGTACAACAACCT-1 contig 1 = CTGGGCCTCA...
umi GCCAAAATGA = 309 reads: +376 validated

UMI info for barcode TCAGGTACAACAACCT-1 contig 2 = GTCAGTCTCA...
umi CCCCATCGCG = 356 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=574]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-373 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-574 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQAWDSSLVVF at 352, score = 6 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 37, 42, 98, 185, 331, 335
confident = false

TIG 2[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1097 = TCAGGTACAGATAATG-1

using 143 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================

UMI info for barcode TCAGGTACAGATAATG-1 contig 1 = GGAGGAACTG...
umi TCCTACCTAC = 122 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=512]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-512 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1100 = TCAGGTACAGCCAGAA-1

using 8386 reads

====================================================================================

graph has 4509 edges initially, 42 edges after simplification

total ucounts = 859
nonsolo ucounts = 382[2^165, 3^76, 4^49, 5^23, 6^14, 7^14, 8^9, 9^4, 10, 11^2, 17, 83, 98, 100, 106, 109, 147, 161, 187, 196, 218, 260, 262, 281, 291, 301, 303, 307, 309, 312, 318, 535, 561, 570, 686]
surviving nonsolo ucounts = 23[9, 83, 98, 100, 106, 109, 187, 196, 218, 260, 262, 281, 291, 301, 303, 307, 309, 312, 318, 535, 561, 570, 686]
ids = [343, 250, 122, 273, 121, 416, 762, 832, 204, 768, ...]

====================================================================================

UMI info for barcode TCAGGTACAGCCAGAA-1 contig 1 = TGGGGAGAGC...
umi ATTGGCTCAC = 106 reads: +394 validated
umi CACATCGATA = 303 reads: +394 validated
umi CAGCGACAAT = 261 reads: +394 validated
umi CCCGCAGTAT = 314 reads: +394 validated
umi CCTCTACCCC = 84 reads: +394 validated
umi CCTTAGTCAT = 279 reads: +394 validated
umi CCTTTTCTAT = 306 reads: +394 validated
umi CGATTCGGGT = 101 reads: +394 validated
umi GGATTTTCTT = 290 reads: -360X +2 -1XX +14 -5XX +4 -2XX +1 -1XX +1 -1XX +2 invalidated
umi GGCCCCATAA = 371 reads: -360X +2 -1XX +14 -5XX +4 -2XX +1 -1XX +1 -1XX +2 invalidated
umi GTATTCAGTA = 309 reads: +394 validated
umi GTTCCTGCGC = 317 reads: +394 validated
umi TGTTGCCTGC = 120 reads: +27 -2 +2 -1 +1 -1XX +1 -5X +1 -2XX +2 -1XX +1 -1XX +1 -1XX +1 -1XX +2 -1XX +327 -12 invalidated
umi TTAACGTTGA = 257 reads: +394 validated
umi TTGATCACCC = 288 reads: +394 validated
umi TTGCAATCGC = 307 reads: +394 validated
umi TTTAGAACTC = 196 reads: +394 validated

UMI info for barcode TCAGGTACAGCCAGAA-1 contig 2 = TGAGTCTCCC...
umi ATTGTATGCG = 97 reads: +331 -1X +24 -1 +3 -1 +54 invalidated
umi CCACTCGCCA = 213 reads: -409 +2 -1X +3 invalidated
umi CTCCTCTGGT = 9 reads: -17 +145 -20 +8 -1 +4 -1 +37 -1 +4 -19 +56 -54 +48 non-validated
umi GAGTAGTCCT = 109 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=571]
41-400 ==> 0-359 on |294|IGKV3D-7|L-REGION+V-REGION| [len=359] (mis=14)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 490 reads
cdr3 = CQQGYDLPGTF at 374, score = 9 + 7
umis assigned: [121, 147, 165, 222, 250, 257, 265, 273, 497, 501] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4150
start codons at 41, 49, 258, 387, 477
confident = true

TIG 2[bases=656]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=16)
430-474 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
474-656 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 20 reads
cdr3 = CARLCPKFHAMDVW at 401, score = 8 + 7
umis assigned: [122, 204, 343, 416]
of which 4 are surviving nonsolos
reads assigned: 423
start codons at 59, 257, 392, 431
confident = true
now this is a cell
paired!

AAGGCCTCGGACAGCGCCATGTATTACTGTGCGAGACTTTGTCCCAAGTTCCACGCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTTCTGTCAGCAGGGTTATGACTTACCGGGGACGTTCGGCCAAGGGACCAAGGTGGAACTCAGAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1103 = TCAGGTACAGCTGCTG-1

using 272 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 267]
surviving nonsolo ucounts = 1[267]
ids = [1]

====================================================================================

UMI info for barcode TCAGGTACAGCTGCTG-1 contig 1 = CTGGGCCTAA...
umi GAAATTCCAA = 267 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=633]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-388 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQVWDSSSDHPWVF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 37, 98, 236, 239, 335, 384, 554
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1104 = TCAGGTACAGCTTCGG-1

using 20800 reads

====================================================================================

graph has 6334 edges initially, 44 edges after simplification

total ucounts = 792
nonsolo ucounts = 398[2^118, 3^75, 4^47, 5^26, 6^11, 7^14, 8^7, 9, 10^8, 12^3, 13, 14, 17, 19, 24, 27, 40, 42, 43, 70, 91, 98, 108, 111, 118, 126, 131, 132, 145, 149, 152, 153, 161^2, 162, 166, 180, 184, 186, 193^2, 196, 198^2, 203, 205, 207, 208, 212, 222, 223^2, 228, 231, 233, 235, 236, 241^3, 242, 244, 249, 256, 257, 260, 266^2, 271^2, 273, 274^2, 275, 276, 277, 280^2, 283, 285, 287^2, 288, 289, 291, 292, 303^2, 304, 306, 316, 320, 328, 423, 427, 488, 527, 554]
surviving nonsolo ucounts = 73[118, 126, 131, 132, 145, 149, 152, 153, 161^2, 162, 166, 180, 184, 186, 193^2, 196, 198^2, 203, 205, 207, 208, 212, 222, 223^2, 228, 231, 233, 235, 236, 241^3, 242, 244, 249, 256, 257, 260, 266^2, 271^2, 273, 274^2, 275, 276, 277, 280^2, 283, 285, 287^2, 288, 289, 291, 292, 303^2, 304, 306, 316, 320, 328, 423, 488, 527, 554]
ids = [790, 595, 415, 736, 186, 629, 373, 342, 177, 329, ...]

====================================================================================

UMI info for barcode TCAGGTACAGCTTCGG-1 contig 1 = AGGAGTCAGA...
umi AATTAACATC = 290 reads: +391 validated
umi AGATTGACAG = 276 reads: +391 validated
umi AGCTGTTCGG = 230 reads: +391 validated
umi ATAATGGGGC = 207 reads: +391 validated
umi ATATGCATGG = 193 reads: +391 validated
umi ATGTACGGGT = 264 reads: +391 validated
umi CAAATATTGG = 303 reads: +391 validated
umi CAAATGTGTT = 162 reads: +391 validated
umi CAAGTTCGGG = 222 reads: +391 validated
umi CAATGTGGTG = 141 reads: +391 validated
umi CACCTGCGCT = 324 reads: +391 validated
umi CACTAGACCA = 271 reads: +391 validated
umi CATACTTACC = 161 reads: +391 validated
umi CCAATTCGTA = 212 reads: +391 validated
umi CCAGTGCCTT = 226 reads: +391 validated
umi CCCCTCACCA = 159 reads: -353X +1 -2X +6 -1XX +3 -3XX +9 -1XX +12 invalidated
umi CCCGAATTCA = 206 reads: +391 validated
umi CCCTTATTGG = 269 reads: +391 validated
umi CCGCCTGGCC = 206 reads: +56 -2XX +1 -6XX +2 -9XX +1 -3XX +1 -287XX +1 -8X +3 -3X +1 -1XX +2 -2XX +1 -1XX invalidated
umi CCGGATAGTG = 238 reads: +391 validated
umi CCTTTGTCGC = 240 reads: +391 validated
umi CGCTACCTTT = 160 reads: +391 validated
umi CGTATTCGAC = 155 reads: +391 validated
umi CGTGCATGCA = 219 reads: +391 validated
umi CTCGATTATA = 154 reads: +391 validated
umi CTTCGGGCAC = 222 reads: +391 validated
umi CTTGCCCATC = 196 reads: +391 validated
umi GACACGGGAT = 258 reads: +391 validated
umi GACATCCTAA = 277 reads: +391 validated
umi GACCTGTTTG = 130 reads: +391 validated
umi GACGTTAGGG = 240 reads: +391 validated
umi GCAAAGTAGG = 279 reads: +391 validated
umi GCATATATTC = 245 reads: +391 validated
umi GCATTAATTC = 273 reads: +391 validated
umi GCATTCATAC = 205 reads: -356X +1 -2XX +2 -1XX +1 -3XX +1 -6XX +1 -3XX +1 -7XX +1 -2XX +2 -1XX invalidated
umi GCGTCTGTTT = 186 reads: +391 validated
umi GGCCCCTCTA = 184 reads: +391 validated
umi GGGAATCGTT = 297 reads: +391 validated
umi GTCGCTGGCT = 526 reads: +391 validated
umi GTGTCAGACA = 303 reads: +391 validated
umi TAAACCGCGG = 288 reads: +391 validated
umi TAAATGTTCA = 259 reads: +391 validated
umi TAACGGGTCC = 271 reads: +391 validated
umi TACACCTTTT = 314 reads: +391 validated
umi TACATTTGCG = 241 reads: +391 validated
umi TACGGAATAA = 127 reads: +391 validated
umi TAGACACCGT = 277 reads: +391 validated
umi TAGTTAGTGT = 188 reads: +391 validated
umi TATATCTCCG = 325 reads: +391 validated
umi TATTGGGGCC = 141 reads: +46 -3X +2 -1XX +339 invalidated
umi TATTTTCTCT = 283 reads: +391 validated
umi TCAACCACTA = 307 reads: +391 validated
umi TCATAAGGGT = 198 reads: +391 validated
umi TCATGACGTA = 280 reads: +391 validated
umi TCTATGCCAA = 286 reads: +391 validated
umi TCTGTTATGG = 199 reads: +391 validated
umi TCTTAGTACG = 245 reads: +391 validated
umi TGCCCTAAAG = 556 reads: +391 validated
umi TGCCTTCGAA = 489 reads: +391 validated
umi TGGTAGTCCT = 287 reads: +391 validated
umi TGTCGAGTAA = 233 reads: -330 +4 -1 +6 -1 +49 non-validated
umi TTATGTGGCT = 131 reads: +56 -2XX +1 -6XX +2 -9XX +1 -291X +1 -8XX +3 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi TTCAATCCCA = 211 reads: +391 validated
umi TTCATAGGCC = 291 reads: +391 validated
umi TTCGCCTTCC = 239 reads: +391 validated
umi TTCGGACCAA = 302 reads: +56 -2XX +1 -6XX +2 -9XX +1 -3X +1 -287X +1 -8X +3 -3XX +1 -1XX +2 -2XX +1 -1XX invalidated
umi TTCTGGCGAT = 292 reads: +391 validated
umi TTGGTCGTCG = 186 reads: +391 validated
umi TTGGTGCTAC = 287 reads: +391 validated
umi TTGTTTGGTT = 234 reads: +391 validated
umi TTTCCCGCAG = 274 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 65 umis using 2499 reads
cdr3 = CQQYNSYSAYTF at 354, score = 8 + 8
umis assigned: [39, 92, 101, 123, 138, 153, 176, 177, 184, 186] and 61 others
of which 70 are surviving nonsolos
reads assigned: 17271
start codons at 27, 33, 89, 102, 334, 460
confident = true

REJECT CONTIGS

TIG 1[bases=379]
0-174 ==> 5235-5409 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
172-332 ==> 5840-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
332-370 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
umis assigned: [700]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 45, 56, 67, 85, 100, 105, 195, 200, 313
confident = false
did not find CDR3

TIG 2[bases=576]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-90 ==> 0-39 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
106-327 ==> 135-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8) [SHIFT!]
327-365 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
365-576 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 295, score = 7 + 8
umis assigned: [641]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 51, 125, 128, 179, 278, 305, 329, 497
confident = false
not full
frameshifted full length stopped transcript of length 576
VJ delta = 102
delta too large
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1105 = TCAGGTACAGTAACGG-1

using 682 reads

====================================================================================

graph has 930 edges initially, 4 edges after simplification

total ucounts = 339
nonsolo ucounts = 133[2^57, 3^32, 4^18, 5^5, 6^6, 7, 8^4, 9^7, 10^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1113 = TCAGGTACATCGATGT-1

using 200 reads

====================================================================================

graph has 175 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 15[2^3, 3^5, 5^3, 8, 9, 11, 136]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1125 = TCAGGTAGTACGCTGC-1

using 548 reads

====================================================================================

graph has 914 edges initially, 2 edges after simplification

total ucounts = 337
nonsolo ucounts = 101[2^50, 3^26, 4^8, 5^11, 6^4, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1140 = TCAGGTAGTCATATGC-1

using 143 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 132]
surviving nonsolo ucounts = 1[132]
ids = [2]

====================================================================================

UMI info for barcode TCAGGTAGTCATATGC-1 contig 1 = GCTCTGCTTC...
umi ATTAACGGGA = 130 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=544]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-544 ==> 0-99 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1144 = TCAGGTAGTCGAAAGC-1

using 136 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[134]
surviving nonsolo ucounts = 1[134]
ids = [0]

====================================================================================

UMI info for barcode TCAGGTAGTCGAAAGC-1 contig 1 = ACCCAAAAAC...
umi AGGCTATTTG = 130 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=583]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-583 ==> 0-93 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1149 = TCAGGTAGTGAGGCTA-1

using 299 reads

====================================================================================

graph has 168 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 127, 166]
surviving nonsolo ucounts = 2[127, 166]
ids = [2, 0]

====================================================================================

UMI info for barcode TCAGGTAGTGAGGCTA-1 contig 1 = GCTCTGCTTC...
umi CCTATAGATG = 117 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=610]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-610 ==> 0-165 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1152 = TCAGGTAGTGCTCTTC-1

using 478 reads

====================================================================================

graph has 536 edges initially, 2 edges after simplification

total ucounts = 152
nonsolo ucounts = 54[2^30, 3^6, 4^12, 5^2, 9, 11, 14, 210]
surviving nonsolo ucounts = 1[210]
ids = [60]

====================================================================================

UMI info for barcode TCAGGTAGTGCTCTTC-1 contig 1 = GAGCTACAAC...
umi CGGTGTTGCC = 211 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=4)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYYSTPVTF at 369, score = 9 + 8
umis assigned: [60]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1156 = TCAGGTAGTTAAGAAC-1

using 8037 reads

====================================================================================

graph has 3766 edges initially, 44 edges after simplification

total ucounts = 584
nonsolo ucounts = 257[2^88, 3^58, 4^28, 5^15, 6^7, 7^7, 8^2, 9, 10^3, 12, 13, 20, 27, 38, 70, 72^2, 75, 85, 93, 96, 97, 99, 101, 107, 110, 124^2, 127, 129, 139, 141, 146, 149, 153^2, 163, 165, 170, 173, 176^2, 177, 181, 183, 184, 187^2, 188, 195, 199, 270, 279, 280, 285, 307, 330]
surviving nonsolo ucounts = 44[27, 38, 70, 72^2, 75, 85, 93, 96, 97, 99, 101, 110, 124^2, 127, 129, 139, 141, 146, 149, 153^2, 163, 165, 170, 173, 176^2, 177, 181, 183, 184, 187^2, 188, 195, 199, 270, 279, 280, 285, 307, 330]
ids = [33, 234, 232, 264, 378, 330, 241, 424, 538, 36, ...]

====================================================================================

UMI info for barcode TCAGGTAGTTAAGAAC-1 contig 1 = GGGGTCACAA...
umi AATACGCCAA = 177 reads: +391 validated
umi ACCACCCCCG = 178 reads: +391 validated
umi ATCCCCTCAG = 190 reads: +342 -6XX +1 -10XX +2 -2X +1 -2X +1 -7XX +1 -7XX +1 -6XX +2 invalidated
umi CACTTACGGA = 171 reads: +391 validated
umi CAGGGCCCTA = 165 reads: +391 validated
umi CATAGTCTTC = 181 reads: +391 validated
umi CATCTCTTAA = 182 reads: +391 validated
umi CATTATACTT = 122 reads: +391 validated
umi CCGAAGATGG = 137 reads: +391 validated
umi CCGTTCTTAC = 308 reads: +391 validated
umi CGTGTCCATT = 37 reads: +16 -4 +371 non-validated
umi CTGAAGCACA = 204 reads: +391 validated
umi CTGGTGGCTG = 183 reads: +391 validated
umi CTTGACGTCG = 149 reads: +391 validated
umi GAATGCTACT = 142 reads: +391 validated
umi GTATTAGCCA = 55 reads: -15X +2 -6XX +2 -6XX +1 -2XX +1 -1XX +1 -6XX +286 -12 +22 -1 +1 -1 +1 -1 +5 -1 +17 invalidated
umi GTGATATATT = 190 reads: +391 validated
umi TAATTACTGT = 166 reads: +391 validated
umi TACACGTTTG = 183 reads: +189 -2XX +200 invalidated
umi TAGTCCTAAA = 187 reads: +342 -6XX +1 -10XX +2 -5X +1 -7X +1 -7XX +1 -6XX +2 invalidated
umi TCGTCGTGGT = 129 reads: +391 validated
umi TGATCCCCTC = 159 reads: +391 validated
umi TGCACCTTCA = 148 reads: +391 validated
umi TTCCGCTCTC = 98 reads: +391 validated
umi TTTCTTCTCA = 190 reads: +391 validated

UMI info for barcode TCAGGTAGTTAAGAAC-1 contig 2 = TGGGGGCTTT...
umi ACCAAAGGGC = 26 reads: +229 -2 +99 -23 +56 -1 +22 -1 +6 non-validated
umi ACCCCATAGA = 100 reads: +439 validated
umi AGAAATTGGA = 113 reads: +439 validated
umi CCCAAGCAGG = 101 reads: +439 validated
umi CCTCGCTCAT = 161 reads: +172 -1XX +266 invalidated
umi CGTGCACGTT = 69 reads: -8 +431 non-validated
umi GCCAATTGCA = 121 reads: +439 validated
umi GCGGCATTAC = 13 reads: -409 +4 -1X +2 -1X +2 -2XX +13 -1XX +4 invalidated
umi GTAAGCATTG = 99 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=640]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 22 umis using 518 reads
cdr3 = CCSYAGTSIFKVF at 362, score = 8 + 8
umis assigned: [23, 34, 86, 127, 133, 139, 147, 154, 194, 200] and 15 others
of which 24 are surviving nonsolos
reads assigned: 3937
start codons at 38, 177, 246, 372
confident = true

TIG 2[bases=640]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=26)
408-458 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
458-640 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 106 reads
cdr3 = CATWRTVTNAYEIW at 385, score = 9 + 8
umis assigned: [33, 36, 57, 170, 206, 232, 321, 330, 366]
of which 9 are surviving nonsolos
reads assigned: 783
start codons at 19, 28, 40, 84, 410, 416, 439
confident = true

REJECT CONTIGS

TIG 1[bases=703]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=21)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
425-689 ==> 0-264 on rc of segment before IGKJ4 exon 1 [len=280] (mis=18)
umis assigned: [241, 378, 424]
of which 3 are surviving nonsolos
reads assigned: 244
start codons at 30, 63, 159, 187, 250, 349, 352, 369, 454, 541
confident = false
did not find CDR3

TIG 2[bases=556]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-36 ==> 5964-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=23)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6, 55, 212, 315, 368, 432, 494]
of which 7 are surviving nonsolos
reads assigned: 1735
start codons at 36, 105, 462
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCCGCAGACACGGCGGTGTATTATTGTGCGACTTGGAGGACGGTGACCAATGCTTATGAAATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTACTAGTATTTTCAAAGTCTTCGGCGCAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1163 = TCAGGTAGTTTAGGAA-1

using 60 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[60]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1174 = TCAGGTATCACTCTTA-1

using 218 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 12, 201]
surviving nonsolo ucounts = 1[201]
ids = [4]

====================================================================================

UMI info for barcode TCAGGTATCACTCTTA-1 contig 1 = GATCAGGACT...
umi TAACTTTCAC = 188 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=505]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-505 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1175 = TCAGGTATCACTGGGC-1

using 25 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1190 = TCAGGTATCCGAGCCA-1

using 26 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 5, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1191 = TCAGGTATCCGCAGTG-1

using 20562 reads

====================================================================================

graph has 7853 edges initially, 124 edges after simplification

total ucounts = 1043
nonsolo ucounts = 510[2^203, 3^105, 4^55, 5^26, 6^11, 7^16, 8^6, 9^5, 10^6, 11^4, 12, 13^3, 16, 18, 31, 38, 56, 61, 62, 66, 67, 74, 87, 88, 99, 100, 136^2, 144, 147, 184, 188, 189^2, 190^2, 193, 195, 196^2, 197, 198, 199, 204, 206, 207, 209^2, 214, 217, 220, 224, 229, 237, 244, 245^2, 247, 252^3, 260, 263, 265^2, 287, 291, 293, 303, 304, 314, 356, 534, 610, 615, 628, 651, 753, 801, 934, 1762]
surviving nonsolo ucounts = 60[56, 61, 62, 67, 74, 87, 136^2, 144, 147, 188, 189^2, 190^2, 193, 195, 196^2, 197, 198, 199, 204, 206, 207, 209^2, 214, 217, 220, 224, 229, 237, 244, 245^2, 247, 252^3, 260, 263, 265^2, 287, 291, 293, 303, 304, 314, 356, 534, 610, 615, 628, 651, 753, 801, 934, 1762]
ids = [137, 135, 671, 856, 552, 213, 377, 1020, 721, 303, ...]

====================================================================================

UMI info for barcode TCAGGTATCCGCAGTG-1 contig 1 = GAGCTCTGGG...
umi ACTAGGTTAA = 61 reads: +396 -13 non-validated
umi ACTCATCCTC = 56 reads: +326 -1 +24 -1 +3 -1 +7 -46 non-validated
umi AGGATGTCAC = 185 reads: +409 validated
umi ATACCAACAC = 88 reads: +359 -1 +49 non-validated
umi ATCTTAATGT = 295 reads: +409 validated
umi ATTGAAGCCA = 208 reads: +409 validated
umi CAATGTTTAG = 151 reads: +315 -1X +93 invalidated
umi CACTCATCCG = 360 reads: +409 validated
umi CCAATTCGGG = 257 reads: -264 +145 non-validated
umi CCCATATACT = 285 reads: +409 validated
umi CTCAATCTAA = 651 reads: -123 +286 non-validated
umi CTCCTACACT = 194 reads: +409 validated
umi GACATGTCGT = 74 reads: +325 -4 +1 -1 +2 -1 +1 -1 +64 -1 +2 -1 +5 non-validated
umi GGCGATACAA = 53 reads: +329 -11 +69 non-validated
umi GTACACCGCA = 317 reads: +409 validated
umi GTCATGCTGC = 253 reads: +409 validated
umi TAGTTATGGG = 199 reads: +409 validated
umi TCCGGGACTG = 59 reads: +382 -27 non-validated
umi TTGACCATTA = 254 reads: +409 validated
umi TTTCTTGGGG = 138 reads: +409 validated

UMI info for barcode TCAGGTATCCGCAGTG-1 contig 2 = TGGGGGCTGG...
umi AATCGTCCTA = 244 reads: +388 validated
umi ACCGGCATGT = 226 reads: +388 validated
umi ACTGTGTTGC = 218 reads: +388 validated
umi ATCCCATTGC = 243 reads: +388 validated
umi ATCCCCGAGG = 315 reads: +113 -3XX +1 -1XX +2 -9XX +1 -8XX +1 -1X +1 -14X +1 -3X +2 -1XX +3 -1XX +3 -2XX +1 -5XX +1 -3XX +3 -1XX +203 invalidated
umi ATCGAACCAT = 237 reads: +388 validated
umi ATCTGTTTTG = 186 reads: +388 validated
umi ATTCGCAGGA = 196 reads: +330 -1XX +57 invalidated
umi ATTGGATCTC = 198 reads: +388 validated
umi CATAAACGAT = 233 reads: +388 validated
umi CCCCCCTGGC = 140 reads: +388 validated
umi CGATCGCTTT = 258 reads: +388 validated
umi CGGACATGCG = 267 reads: +388 validated
umi CGTATACACC = 301 reads: +388 validated
umi CGTCATGGAA = 194 reads: +388 validated
umi GAACGCTACG = 204 reads: +388 validated
umi GAAGTACCAG = 220 reads: +388 validated
umi GAGTATCCGT = 269 reads: +388 validated
umi GATTTCTCGG = 212 reads: +388 validated
umi GCACTTGATC = 17 reads: -265X +1 -1XX +1 -11XX +1 -2XX +1 -4XX +1 -5XX +49 -46 invalidated
umi GCTTAAGTCG = 207 reads: +388 validated
umi GGTACTGGCA = 201 reads: +388 validated
umi GTATTTCCAT = 193 reads: +388 validated
umi GTCAGTACGC = 147 reads: +388 validated
umi GTTGTTCCTG = 246 reads: +388 validated
umi TATCCTTCGC = 200 reads: +388 validated
umi TTACGTGGGT = 207 reads: +388 validated
umi TTATGGCTCT = 251 reads: +388 validated
umi TTCAAAAACC = 263 reads: +71 -2X +315 invalidated
umi TTTTATCCAG = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=7)
436-489 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 297 reads
cdr3 = CARDKYWYLDLW at 422, score = 9 + 7
umis assigned: [135, 137, 185, 213, 247, 272, 303, 313, 351, 373] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4057
start codons at 80, 231, 236, 294, 297, 383
confident = true

TIG 2[bases=645]
46-400 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=6)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 28 umis using 982 reads
cdr3 = CISYTSSNTYVF at 370, score = 8 + 8
umis assigned: [67, 119, 144, 235, 236, 239, 246, 268, 273, 332] and 20 others
of which 29 are surviving nonsolos
reads assigned: 6356
start codons at 46, 247, 254, 398, 566
confident = true

REJECT CONTIGS

TIG 1[bases=378]
8-93 ==> 3076-3161 on segment before IGLJ5 exon 1 [len=3161] (mis=11)
94-166 ==> 0-72 on |315|IGLJ5|J-REGION| [len=72] (mis=9)
167-378 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [143, 220, 320, 326, 520, 704, 785, 993]
of which 8 are surviving nonsolos
reads assigned: 6543
start codons at 2, 16, 24, 110
confident = false
did not find CDR3
now this is a cell
paired!

AGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGATAAATACTGGTACTTAGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCATCTCATATACAAGCAGCAACACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1199 = TCAGGTATCGCTGATA-1

using 8435 reads

====================================================================================

graph has 6313 edges initially, 124 edges after simplification

total ucounts = 1393
nonsolo ucounts = 999[2^179, 3^137, 4^135, 5^101, 6^82, 7^81, 8^59, 9^47, 10^39, 11^33, 12^28, 13^14, 14^12, 15^11, 16^12, 17^4, 18^5, 19^5, 20, 21^2, 22^2, 25, 26, 100, 115, 124, 157, 198, 246, 280, 847]
surviving nonsolo ucounts = 4[115, 198, 246, 280]
ids = [434, 346, 1084, 948]

====================================================================================

UMI info for barcode TCAGGTATCGCTGATA-1 contig 1 = GTCTCCCTCA...
umi CATGTTTCGA = 111 reads: +430 validated

UMI info for barcode TCAGGTATCGCTGATA-1 contig 2 = AGTCTGGGCC...
umi CAACTTTTGC = 197 reads: +389 -1X +1 invalidated
umi GTACACTACT = 281 reads: +391 validated
umi TACACGTGAT = 870 reads: -348 +2 -3XX +1 -3XX +2 -1XX +5 -4XX +7 -1XX +1 -1XX +1 -1XX +10 invalidated
umi TAGTCCGGCT = 249 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=504]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=19)
435-486 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
junction support: 1 umis using 13 reads
cdr3 = CARKGLIGETGYLNWFDPW at 398, score = 8 + 7
umis assigned: [434]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 56, 230, 254
confident = true

TIG 2[bases=642]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-369 ==> 0-329 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=9)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
431-642 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 122 reads
cdr3 = CQVWESGSDHPDIYVF at 355, score = 7 + 7
umis assigned: [346, 948, 1045, 1084]
of which 3 are surviving nonsolos
reads assigned: 1534
start codons at 40, 239, 338, 395, 563
confident = true
now this is a cell
paired!

GCCATTTACTTCTGTGCGAGAAAGGGCCTCATCGGGGAGACTGGTTACTTAAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGAGAGTGGTAGTGATCATCCGGACATTTATGTCTTCGGATCTGGGACCACGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1200 = TCAGGTATCGGAATCT-1

using 122 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 116]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1201 = TCAGGTATCGGCCGAT-1

using 270 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 264]
surviving nonsolo ucounts = 1[264]
ids = [4]

====================================================================================

UMI info for barcode TCAGGTATCGGCCGAT-1 contig 1 = GAGGAATCAG...
umi GGGCAATTAT = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1202 = TCAGGTATCGTACCGG-1

using 224 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [0]

====================================================================================

UMI info for barcode TCAGGTATCGTACCGG-1 contig 1 = TGGGGTCACA...
umi ACAGGTTTTC = 218 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=541]
0-39 ==> 123-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
39-379 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
433-541 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 30 reads
cdr3 = CCSEAGGGVPGLLF at 363, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 39, 193
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1205 = TCAGGTATCTACTCAT-1

using 760 reads

====================================================================================

graph has 276 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 78, 80, 593]
surviving nonsolo ucounts = 3[78, 80, 593]
ids = [6, 1, 4]

====================================================================================

UMI info for barcode TCAGGTATCTACTCAT-1 contig 1 = GTAGGCTCAG...
umi GCCAGGATAG = 72 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=449]
0-35 ==> 3-38 on |364|IGLV3-27|5'UTR| [len=38] (mis=0)
35-374 ==> 0-339 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=1)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-449 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CYSAADNKPQGVF at 350, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 71
start codons at 25, 35, 96, 165, 183, 333
confident = false

REJECT CONTIGS

TIG 1[bases=379]
5-203 ==> 5531-5729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=2)
204-243 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
243-379 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 588
start codons at 185, 285
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1218 = TCAGGTATCTTGCAAG-1

using 245 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [1]

====================================================================================

UMI info for barcode TCAGGTATCTTGCAAG-1 contig 1 = CTGACTACCA...
umi TGAGTGCAGT = 233 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=496]
0-32 ==> 31-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=0)
32-377 ==> 0-345 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=5)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-496 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHDNFPWTF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 32, 122, 180, 183, 188, 291, 336, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1219 = TCAGGTATCTTGTTTG-1

using 207 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 198]
surviving nonsolo ucounts = 1[198]
ids = [4]

====================================================================================

UMI info for barcode TCAGGTATCTTGTTTG-1 contig 1 = GAGGAACTGC...
umi TCGTTTGACT = 200 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
33-325 ==> 0-292 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQHSAWPLTF at 357, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 33, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1221 = TCATTACAGAAGAAGC-1

using 529 reads

====================================================================================

graph has 244 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3^2, 8, 240, 272]
surviving nonsolo ucounts = 2[240, 272]
ids = [0, 4]

====================================================================================

UMI info for barcode TCATTACAGAAGAAGC-1 contig 1 = GGATGGAGTT...
umi CAACTTCCTC = 254 reads: +421 validated

UMI info for barcode TCATTACAGAAGAAGC-1 contig 2 = ACTTTCTGAG...
umi AACCATTCTT = 232 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=533]
2-353 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=40)
387-423 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
423-533 ==> 0-110 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CATAPPSLIWFGLQSW at 344, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 2, 104, 158, 211, 219, 237, 305
confident = false

TIG 2[bases=569]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-569 ==> 0-110 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1225 = TCATTACAGAGTGAGA-1

using 93 reads

====================================================================================

graph has 168 edges initially, 6 edges after simplification

total ucounts = 29
nonsolo ucounts = 17[2^6, 3^2, 5^2, 6^2, 7^2, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1226 = TCATTACAGATATGCA-1

using 157 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 149]
surviving nonsolo ucounts = 1[149]
ids = [1]

====================================================================================

UMI info for barcode TCATTACAGATATGCA-1 contig 1 = GGGGAGTGAC...
umi CAAAGCTACC = 144 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=519]
24-382 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
407-457 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=5)
457-519 ==> 0-62 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 369, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 24, 68, 247, 250, 253, 339, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1233 = TCATTACAGCCACTAT-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1244 = TCATTACAGGTAGCTG-1

using 215 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode TCATTACAGGTAGCTG-1 contig 1 = ATCAGTCCCA...
umi TTCTCACCAA = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1250 = TCATTACAGTCGTACT-1

using 14 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1255 = TCATTACAGTGTTAGA-1

using 33 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 9, 14]
surviving nonsolo ucounts = 1[14]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1260 = TCATTACCAAATTGCC-1

using 18 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1273 = TCATTACCACCACGTG-1

using 598 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^3, 586]
surviving nonsolo ucounts = 1[586]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=329]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-76 ==> 0-59 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=3)
84-146 ==> 0-62 on rc of segment before IGHV4-34 exon 1 [len=83] (mis=3)
147-329 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 575
start codons at 17, 38, 82, 99, 107, 115, 120
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1276 = TCATTACCACGCGAAA-1

using 345 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 5, 335]
surviving nonsolo ucounts = 1[335]
ids = [4]

====================================================================================

UMI info for barcode TCATTACCACGCGAAA-1 contig 1 = AGGAATCAGT...
umi GTATCATCCT = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1277 = TCATTACCACGCTTTC-1

using 219 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 212]
surviving nonsolo ucounts = 1[212]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1282 = TCATTACCACTGCCAG-1

using 169 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 6, 160]
surviving nonsolo ucounts = 1[160]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1285 = TCATTACCAGCGTCCA-1

using 132 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 124]
surviving nonsolo ucounts = 1[124]
ids = [5]

====================================================================================

UMI info for barcode TCATTACCAGCGTCCA-1 contig 1 = GTCAGACTCA...
umi TTTCGGTAGG = 116 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-459 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNSYPLTF at 350, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 23, 29, 85, 98, 234, 237, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1293 = TCATTACCAGTTAACC-1

using 353 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^2, 3, 4, 5, 329]
surviving nonsolo ucounts = 1[329]
ids = [13]

====================================================================================

UMI info for barcode TCATTACCAGTTAACC-1 contig 1 = AGGAACTGCT...
umi TGATGACTAG = 299 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=472]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
414-472 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRRTWPPAF at 353, score = 9 + 6
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 32, 81, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1294 = TCATTACCAGTTTACG-1

using 1124 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 230, 886]
surviving nonsolo ucounts = 2[230, 886]
ids = [5, 8]

====================================================================================

UMI info for barcode TCATTACCAGTTTACG-1 contig 1 = TGAGCGCAGA...
umi GAATGCAAGC = 225 reads: +388 validated
umi TGAGGAACGA = 883 reads: -296 +92 non-validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [5, 8]
of which 2 are surviving nonsolos
reads assigned: 1097
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1296 = TCATTACCATATACGC-1

using 361 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 15, 340]
surviving nonsolo ucounts = 1[340]
ids = [5]

====================================================================================

UMI info for barcode TCATTACCATATACGC-1 contig 1 = GAGTCAGTCC...
umi TCGGATTCCC = 343 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYDDLPITF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1298 = TCATTACCATCACGTA-1

using 330 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [0]

====================================================================================

UMI info for barcode TCATTACCATCACGTA-1 contig 1 = GGGAGGAACT...
umi AAGGTGTCAC = 331 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSDWPRTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1309 = TCATTACCATTTGCTT-1

using 303 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 293]
surviving nonsolo ucounts = 1[293]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
6-76 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
28-339 ==> 0-311 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=13)
340-380 ==> 311-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6) [SHIFT!]
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 356, score = 4 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 28, 34, 103, 239, 459
confident = false
not full
frameshifted full length stopped transcript of length 553
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1310 = TCATTACGTAAACCTC-1

using 270 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^4, 3, 4, 7, 239]
surviving nonsolo ucounts = 1[239]
ids = [14]

====================================================================================

UMI info for barcode TCATTACGTAAACCTC-1 contig 1 = GGAATCAGTC...
umi TGCGTGTCGA = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=461]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-461 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1317 = TCATTACGTACTCAAC-1

using 192 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[190]
surviving nonsolo ucounts = 1[190]
ids = [2]

====================================================================================

UMI info for barcode TCATTACGTACTCAAC-1 contig 1 = GATCAGGACT...
umi CATAGTACTG = 182 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=460]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-460 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1322 = TCATTACGTCAAACTC-1

using 45 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 9, 28]
surviving nonsolo ucounts = 1[28]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=303]
0-303 ==> 10-313 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 23
start codons at 284, 288
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1329 = TCATTACGTCTAAACC-1

using 225 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 209]
surviving nonsolo ucounts = 1[209]
ids = [1]

====================================================================================

UMI info for barcode TCATTACGTCTAAACC-1 contig 1 = AGCTTCAGCT...
umi AGGCTTTTTT = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=528]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-528 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1330 = TCATTACGTCTAGCCG-1

using 37 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 1[35]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1359 = TCATTACTCAGAGCTT-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1362 = TCATTACTCAGGTTCA-1

using 311 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [0]

====================================================================================

UMI info for barcode TCATTACTCAGGTTCA-1 contig 1 = GAATCAGTCC...
umi CATATTGCCA = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-490 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1368 = TCATTACTCATTATCC-1

using 33 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[33]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1372 = TCATTACTCCCTGACT-1

using 2818 reads

====================================================================================

graph has 4161 edges initially, 12 edges after simplification

total ucounts = 1171
nonsolo ucounts = 560[2^231, 3^129, 4^78, 5^44, 6^30, 7^22, 8^10, 9^3, 10^4, 11^3, 13^2, 14^2, 26, 232]
surviving nonsolo ucounts = 1[232]
ids = [1062]

====================================================================================

UMI info for barcode TCATTACTCCCTGACT-1 contig 1 = GGGGTCTCAG...
umi TTAAAAATCG = 224 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=596]
38-385 ==> 0-347 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
429-596 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CSSYTGSSSLEVF at 362, score = 8 + 8
umis assigned: [1062]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 38, 157, 174, 195, 239, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1381 = TCATTACTCGACGGAA-1

using 225 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1388 = TCATTACTCGGCATCG-1

using 1754 reads

====================================================================================

graph has 2450 edges initially, 14 edges after simplification

total ucounts = 748
nonsolo ucounts = 310[2^114, 3^79, 4^51, 5^28, 6^9, 7^10, 8^5, 9^5, 10, 12, 13, 16, 18, 19, 24, 29, 157]
surviving nonsolo ucounts = 1[157]
ids = [471]

====================================================================================

UMI info for barcode TCATTACTCGGCATCG-1 contig 1 = GGCTGGGGTC...
umi GGAGTAGCTT = 149 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=524]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-400 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=3)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
436-524 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CCSYAGSYTSHVVF at 366, score = 8 + 8
umis assigned: [471]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 42, 181, 199, 243, 250, 253, 349, 376, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1391 = TCATTACTCTACGAGT-1

using 19012 reads

====================================================================================

graph has 10198 edges initially, 116 edges after simplification

total ucounts = 1364
nonsolo ucounts = 683[2^228, 3^133, 4^94, 5^51, 6^42, 7^29, 8^12, 9^6, 10^9, 11^7, 13^4, 14, 15, 16^3, 17, 18, 21, 38, 39, 46^2, 48, 64, 81, 91, 139, 144, 147, 154^2, 165, 181, 186, 206, 213, 217, 220, 230, 235, 239, 240, 241, 247, 248, 254^2, 255, 262, 268, 281^2, 286, 295, 297, 306, 307, 325, 326, 328, 331, 335, 336, 338, 340, 351, 353, 361, 370^2, 376, 384, 386, 414, 467, 507, 588, 696]
surviving nonsolo ucounts = 55[39, 46, 64, 81, 91, 139, 144, 147, 154, 181, 186, 206, 213, 217, 220, 230, 235, 239, 240, 241, 247, 248, 254^2, 255, 262, 268, 281^2, 286, 295, 297, 306, 307, 325, 326, 328, 331, 335, 336, 338, 340, 351, 353, 361, 370^2, 376, 384, 386, 414, 467, 507, 588, 696]
ids = [98, 104, 827, 801, 404, 793, 1351, 748, 1030, 1044, ...]

====================================================================================

UMI info for barcode TCATTACTCTACGAGT-1 contig 1 = GGGGAGGAGT...
umi AAAAAAGGGC = 295 reads: +388 validated
umi AAGGTGATGG = 418 reads: +388 validated
umi AAGGTTCGAG = 342 reads: +388 validated
umi ACATGTCGGT = 375 reads: +388 validated
umi ACCCGGTTCG = 244 reads: +388 validated
umi ACCCGGTTGG = 267 reads: +388 validated
umi AGTGCGCTAT = 355 reads: +388 validated
umi CAAACTGCAA = 377 reads: -357X +6 -2XX +15 -1XX +7 invalidated
umi CCACCTGTCA = 334 reads: +388 validated
umi CCATACGCTT = 240 reads: +388 validated
umi CCATTGCCCA = 379 reads: +388 validated
umi CCTCTTACAT = 238 reads: +388 validated
umi CTCCAGGCTT = 339 reads: +388 validated
umi CTTTCCCTCA = 330 reads: +388 validated
umi GCAACATGTA = 140 reads: +388 validated
umi GCAGTATCAA = 212 reads: +388 validated
umi GCAGTTTCCA = 347 reads: +388 validated
umi GCTAACATGG = 481 reads: +56 -1XX +1 -1XX +4 -5XX +4 -20XX +1 -3XX +3 -11XX +278 invalidated
umi GTCCCCTGCG = 366 reads: +388 validated
umi GTTGTACCCC = 334 reads: +388 validated
umi TAGGGCTGCC = 214 reads: +388 validated
umi TCCCAAATCG = 358 reads: +388 validated
umi TCCTATGGTT = 235 reads: +388 validated
umi TGATCACCAT = 270 reads: +388 validated
umi TTCAATGCAC = 297 reads: +388 validated
umi TTCAGAGTCC = 204 reads: +388 validated
umi TTCCATATCG = 247 reads: +388 validated
umi TTGGGCCCCT = 371 reads: +388 validated
umi TTTGACGGAT = 146 reads: +388 validated

UMI info for barcode TCATTACTCTACGAGT-1 contig 2 = AGCTCTGGGA...
umi AAAGTACGGT = 255 reads: +418 validated
umi AATCACTAGG = 342 reads: +418 validated
umi AATGACTCAC = 325 reads: +418 validated
umi AATGCACCAA = 37 reads: -37 +68 -1 +273 -1 +1 -37 non-validated
umi ACAACCAGGC = 258 reads: +418 validated
umi CACTATTGGA = 92 reads: +418 validated
umi CAGAGTCTGT = 7 reads: -361 +1 -1X +2 -2X +1 -3X +2 -1XX +1 -1XX +1 -1XX +40 invalidated
umi CCCGCGATAC = 217 reads: +418 validated
umi CTGAGCTGGT = 242 reads: +418 validated
umi GAAGAATGTG = 151 reads: +98 -1X +319 invalidated
umi GCACCTGGAA = 72 reads: -358X +1 -2X +1 -1X +2 -2X +1 -3X +2 -1X +1 -1X +1 -1X +40 invalidated
umi GCATGTCCGT = 723 reads: +47 -22XX +1 -164XX +1 -4XX +1 -3XX +5 -5XX +1 -1XX +163 invalidated
umi GCCCTGAGCA = 64 reads: +98 -1 +226 -1 +9 -1 +4 -1 +1 -76 non-validated
umi GTACTCTATA = 285 reads: +418 validated
umi GTTCGTTTAG = 218 reads: +418 validated
umi TACCACCTAG = 182 reads: +418 validated
umi TAGGCACGCC = 160 reads: +418 validated
umi TATAATCTGT = 182 reads: +418 validated
umi TATCACCGGT = 245 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1349 reads
cdr3 = CQQYDNPSLTF at 358, score = 9 + 9
umis assigned: [0, 67, 69, 136, 144, 145, 249, 364, 484, 497] and 19 others
of which 29 are surviving nonsolos
reads assigned: 8555
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

TIG 2[bases=569]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=1)
450-498 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 378 reads
cdr3 = CTTGSYYDFLDYW at 428, score = 8 + 7
umis assigned: [19, 83, 92, 98, 116, 404, 418, 520, 684, 748] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3933
start codons at 80, 236, 303, 360, 389
confident = true
now this is a cell
paired!

CTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGGAAGTTATTACGATTTCCTCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCCCTCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1397 = TCATTACTCTCTTGAT-1

using 237 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[63, 174]
surviving nonsolo ucounts = 2[63, 174]
ids = [0, 1]

====================================================================================

UMI info for barcode TCATTACTCTCTTGAT-1 contig 1 = GGGGGACTCC...
umi CTTCCGGGGT = 59 reads: -10 +405 non-validated
umi CTTTCGGGGT = 162 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=557]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=7)
388-436 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
436-557 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 39 reads
cdr3 = CAHCTSIDYLVYW at 366, score = 7 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 219
start codons at 21, 65, 244, 247, 327, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1409 = TCATTTGAGAAAGTGG-1

using 326 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[323]
surviving nonsolo ucounts = 1[323]
ids = [1]

====================================================================================

UMI info for barcode TCATTTGAGAAAGTGG-1 contig 1 = AGTGACTCCT...
umi CACATGCGAG = 315 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=522]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
393-441 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
441-522 ==> 0-81 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 55 reads
cdr3 = CARRRSPWFGALDYW at 365, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 20, 64, 243, 246, 326, 335, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1416 = TCATTTGAGACGCACA-1

using 203 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 201]
surviving nonsolo ucounts = 1[201]
ids = [1]

====================================================================================

UMI info for barcode TCATTTGAGACGCACA-1 contig 1 = ATCATCCAAC...
umi ATTCTTTCGA = 195 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=499]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
476-499 ==> 0-23 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CALVSTLSALPFDFW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 58, 256, 262, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1417 = TCATTTGAGAGAACAG-1

using 730 reads

====================================================================================

graph has 768 edges initially, 6 edges after simplification

total ucounts = 124
nonsolo ucounts = 45[2^18, 3^9, 4^2, 5^4, 6, 7^2, 9^2, 10, 11, 13, 14, 42, 178, 254]
surviving nonsolo ucounts = 1[254]
ids = [87]

====================================================================================

UMI info for barcode TCATTTGAGAGAACAG-1 contig 1 = AGTCTCAGTC...
umi GTACTTACCA = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-495 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSTPVTF at 347, score = 9 + 8
umis assigned: [87]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1420 = TCATTTGAGATGCCAG-1

using 293 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 7, 281]
surviving nonsolo ucounts = 1[281]
ids = [5]

====================================================================================

UMI info for barcode TCATTTGAGATGCCAG-1 contig 1 = GAGAGAGGAG...
umi TTACTTGCCT = 284 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=563]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-563 ==> 0-66 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1421 = TCATTTGAGATGTCGG-1

using 36 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 3, 7, 8^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1423 = TCATTTGAGCCACCTG-1

using 350 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3^2, 336]
surviving nonsolo ucounts = 1[336]
ids = [7]

====================================================================================

UMI info for barcode TCATTTGAGCCACCTG-1 contig 1 = GGGAGTCTCA...
umi TCTATCGCCT = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=21)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQTHSYPRAF at 350, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 23, 29, 85, 98, 171, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1428 = TCATTTGAGCTCAACT-1

using 142 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[140]
surviving nonsolo ucounts = 1[140]
ids = [1]

====================================================================================

UMI info for barcode TCATTTGAGCTCAACT-1 contig 1 = GAGAGAGGAG...
umi ACAACTTACA = 139 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=518]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-518 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1430 = TCATTTGAGCTGCGAA-1

using 33 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 29]
surviving nonsolo ucounts = 1[29]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1438 = TCATTTGAGTCCGGTC-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1442 = TCATTTGAGTGCCAGA-1

using 274 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 17, 247]
surviving nonsolo ucounts = 1[247]
ids = [5]

====================================================================================

UMI info for barcode TCATTTGAGTGCCAGA-1 contig 1 = ATCAGTCCCA...
umi CTGATACTTT = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-476 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1450 = TCATTTGAGTTCGCGC-1

using 15319 reads

====================================================================================

graph has 7444 edges initially, 58 edges after simplification

total ucounts = 723
nonsolo ucounts = 368[2^99, 3^67, 4^54, 5^29, 6^15, 7^22, 8^7, 9^6, 10^2, 11^2, 12^2, 13^4, 17, 19^2, 40, 56, 83, 107, 114, 115, 121, 126, 131^2, 146, 147, 148, 151, 154, 182, 197, 199, 200, 214, 216, 220, 228, 229, 236, 239, 242, 244, 245, 251, 253, 258, 261, 263, 277, 284, 292, 293^2, 304, 315, 318, 323, 324, 325, 328, 332, 337^2, 339, 350, 371, 384, 398, 412, 593]
surviving nonsolo ucounts = 49[56, 83, 114, 126, 146, 148, 151, 154, 182, 197, 199, 200, 214, 216, 220, 228, 229, 236, 239, 242, 244, 245, 251, 253, 258, 261, 263, 277, 284, 292, 293^2, 304, 315, 318, 323, 324, 325, 328, 332, 337^2, 339, 350, 371, 384, 398, 412, 593]
ids = [501, 402, 476, 295, 531, 440, 369, 135, 371, 203, ...]

====================================================================================

UMI info for barcode TCATTTGAGTTCGCGC-1 contig 1 = GGGGAGGAGT...
umi AAACAGCACT = 343 reads: +388 validated
umi AAAGATCTTT = 289 reads: +388 validated
umi AACTCAAACG = 341 reads: +388 validated
umi ACCTCCTAGG = 312 reads: +388 validated
umi ACCTCCTGGG = 259 reads: +388 validated
umi ACGCCATGTT = 584 reads: +388 validated
umi ACTTGCACTG = 342 reads: +388 validated
umi AGCCCTGACT = 324 reads: +388 validated
umi AGCCCTGTAT = 326 reads: +388 validated
umi AGGGATCCTA = 411 reads: +388 validated
umi AGTCACCGGG = 374 reads: +388 validated
umi AGTGCTCCGT = 395 reads: +388 validated
umi ATGGATTCGT = 198 reads: +388 validated
umi ATTGTTCTAG = 256 reads: +388 validated
umi CAGTCCTGTG = 217 reads: +388 validated
umi CATGTTATCG = 298 reads: +388 validated
umi CCCCGGACTG = 127 reads: +388 validated
umi CCCTACCGTT = 283 reads: +388 validated
umi CGCTTCACCT = 331 reads: +388 validated
umi CGGGGCTCAG = 278 reads: +388 validated
umi CTAGGATCAA = 180 reads: +388 validated
umi CTATAATACC = 302 reads: +388 validated
umi CTATGGCTGT = 254 reads: +388 validated
umi CTGGAAGTCC = 249 reads: +388 validated
umi GATACCTGCC = 235 reads: +388 validated
umi GATTGCACTA = 148 reads: +388 validated
umi GGGGTTTCAT = 116 reads: +388 validated
umi GTCTTGATTG = 242 reads: +388 validated
umi TAAACGATTA = 214 reads: +388 validated
umi TAAATTGCAC = 236 reads: +388 validated
umi TAACCCCAGA = 387 reads: +388 validated
umi TCATGTCAAA = 306 reads: +388 validated
umi TCTTACTGTA = 257 reads: +388 validated
umi TTACATTTAG = 346 reads: +388 validated
umi TTGTAATTCC = 324 reads: +388 validated
umi TTTCCTTTCT = 248 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=8)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 36 umis using 1605 reads
cdr3 = CQQYDNLSLTF at 358, score = 9 + 9
umis assigned: [6, 10, 29, 90, 91, 100, 123, 139, 140, 148] and 26 others
of which 36 are surviving nonsolos
reads assigned: 10184
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

REJECT CONTIGS

TIG 1[bases=444]
0-18 ==> 1878-1896 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
0-18 ==> 1879-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
15-262 ==> 106-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
296-342 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
342-444 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CARGAFDSSGYISPSLLDYW at 251, score = 8 + 7
umis assigned: [31, 64, 96, 135, 175, 215, 360, 369, 384, 402] and 5 others
of which 12 are surviving nonsolos
reads assigned: 1609
start codons at 65, 186, 212, 360, 421
confident = false
VJ delta = 6
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1458 = TCATTTGCAACTGGCC-1

using 314 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 310]
surviving nonsolo ucounts = 1[310]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=498]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
7-59 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
34-334 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
419-498 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 355, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 34, 239, 461
confident = false
not full
full length stopped transcript of length 498
frameshifted full length stopped transcript of length 498
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1460 = TCATTTGCAAGCCATT-1

using 237 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 4, 220]
surviving nonsolo ucounts = 1[220]
ids = [4]

====================================================================================

UMI info for barcode TCATTTGCAAGCCATT-1 contig 1 = TGAGCGCAGA...
umi CTGGTTCTAG = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=583]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-583 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1463 = TCATTTGCAAGCTGAG-1

using 225 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 209]
surviving nonsolo ucounts = 1[209]
ids = [7]

====================================================================================

UMI info for barcode TCATTTGCAAGCTGAG-1 contig 1 = GAGACTCAGT...
umi GGCCCTCCAC = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=440]
21-372 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
409-440 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNGQSRAF at 348, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 21, 27, 96, 232, 235, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1464 = TCATTTGCAAGCTGGA-1

using 111 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[104]
surviving nonsolo ucounts = 1[104]
ids = [1]

====================================================================================

UMI info for barcode TCATTTGCAAGCTGGA-1 contig 1 = TCTGGCACCA...
umi AGCCCACGCC = 97 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=528]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-528 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CLLSYSGARVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1471 = TCATTTGCACACCGAC-1

using 903 reads

====================================================================================

graph has 411 edges initially, 32 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2, 3, 4, 5, 245, 287, 352]
surviving nonsolo ucounts = 3[245, 287, 352]
ids = [9, 3, 4]

====================================================================================

UMI info for barcode TCATTTGCACACCGAC-1 contig 1 = AGGAATCAGT...
umi AGTGCATTCC = 292 reads: +22 -1XX +365 invalidated

UMI info for barcode TCATTTGCACACCGAC-1 contig 2 = AGTCTGGGCC...
umi TATCATCGCT = 233 reads: +385 validated

UMI info for barcode TCATTTGCACACCGAC-1 contig 3 = GTCAGACTCA...
umi AGTGTCCCGG = 353 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=591]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=9)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
425-591 ==> 0-166 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQVWDSSSDHLGVF at 355, score = 7 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 40, 101, 242, 338
confident = false

TIG 3[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1474 = TCATTTGCACATTAGC-1

using 167 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 157]
surviving nonsolo ucounts = 1[157]
ids = [4]

====================================================================================

UMI info for barcode TCATTTGCACATTAGC-1 contig 1 = GGGAGACTCA...
umi GCTATGTCAG = 143 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=497]
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-497 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQYNNYSPYTF at 350, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 23, 29, 85, 98, 234, 237, 330, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1478 = TCATTTGCACCAGGTC-1

using 9445 reads

====================================================================================

graph has 4046 edges initially, 76 edges after simplification

total ucounts = 612
nonsolo ucounts = 247[2^96, 3^52, 4^22, 5^20, 6^6, 7^9, 8^2, 9^2, 10^3, 11, 12, 13, 14, 16, 24, 55, 92, 129, 158, 183, 207, 209, 222, 235, 236, 239, 242, 247, 253, 255, 256, 263, 280, 281, 290, 300, 310, 337^2, 366, 434, 513, 569, 792]
surviving nonsolo ucounts = 27[55, 158, 183, 207, 209, 222, 235, 236, 239, 242, 247, 253, 255, 256, 263, 280, 281, 290, 300, 310, 337^2, 366, 434, 513, 569, 792]
ids = [291, 312, 189, 480, 391, 587, 385, 399, 515, 59, ...]

====================================================================================

UMI info for barcode TCATTTGCACCAGGTC-1 contig 1 = TGGGGAGGAA...
umi ATTAGTCCTA = 267 reads: +238 -1XX +149 invalidated
umi ATTGCATCAG = 282 reads: +388 validated
umi CAGCAGTATC = 298 reads: +388 validated
umi CCCACCGTGG = 333 reads: +388 validated
umi CGGGAAATCA = 303 reads: -285X +103 invalidated
umi CTTGTCATGC = 158 reads: +388 validated
umi GACATGCTAT = 254 reads: +388 validated
umi GAGAGGTTCA = 254 reads: +388 validated
umi GCCCCTGCCT = 367 reads: +388 validated
umi GCTTCTACCA = 239 reads: +388 validated
umi GGTACGTGTT = 236 reads: +388 validated
umi GTCCATACGC = 287 reads: +388 validated
umi TATTTAGCCT = 207 reads: +388 validated
umi TCCCAGGGGG = 348 reads: +313 -1XX +74 invalidated
umi TCTACCAGAG = 433 reads: -102X +286 invalidated
umi TTAACACCAA = 244 reads: +388 validated

UMI info for barcode TCATTTGCACCAGGTC-1 contig 2 = AGCTCTGAGA...
umi ACAGAACTTC = 245 reads: +415 validated
umi ACTATTAGCG = 292 reads: +415 validated
umi CACCCAGAAC = 182 reads: +415 validated
umi CTGGATTGGG = 57 reads: +288 -1 +41 -1 +23 -1X +34 -26 invalidated
umi GGCAAGGGGT = 209 reads: +415 validated
umi TCTCCACATT = 265 reads: +415 validated
umi TTCGCATTAG = 221 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=5)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 683 reads
cdr3 = CLQHNSYPLTF at 359, score = 9 + 9
umis assigned: [160, 167, 202, 218, 249, 312, 333, 341, 366, 385] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4434
start codons at 32, 38, 107, 189, 243, 462
confident = true

TIG 2[bases=565]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=18)
445-494 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 150 reads
cdr3 = CAKGGIKVAGFDSW at 421, score = 6 + 7
umis assigned: [59, 89, 189, 291, 391, 530, 587]
of which 7 are surviving nonsolos
reads assigned: 1447
start codons at 79, 235, 382
confident = true

REJECT CONTIGS

TIG 1[bases=340]
0-176 ==> 177-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=17)
189-238 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=5)
238-340 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CAKGGIKVAGFDSW at 165, score = 6 + 7
umis assigned: [273]
of which 1 are surviving nonsolos
reads assigned: 561
start codons at 126, 256, 317
confident = false
VJ delta = 9
not full
not full

TIG 2[bases=508]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=5)
17-261 ==> 0-244 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=10)
261-359 ==> 279-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=13) [SHIFT!]
376-437 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=6)
437-508 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [149, 515]
of which 2 are surviving nonsolos
reads assigned: 742
start codons at 17, 26, 38, 82, 251, 347, 357, 394
confident = false
frameshifted full length stopped transcript of length 508
did not find CDR3
now this is a cell
paired!

AGAGGCGACGACACGGCCGCATATTATTGTGCGAAAGGGGGTATAAAAGTAGCGGGGTTCGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTACAGCCTGAAGATTTTGCAACTTATTATTGTCTACAGCATAATAGTTATCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1486 = TCATTTGCACGAGAGT-1

using 601 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^2, 269, 322]
surviving nonsolo ucounts = 2[269, 322]
ids = [1, 4]

====================================================================================

UMI info for barcode TCATTTGCACGAGAGT-1 contig 1 = TGGGGAGGAA...
umi AGCTGTACAG = 272 reads: +382 validated
umi CTGTACGATC = 322 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 107 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 586
start codons at 37, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1495 = TCATTTGCAGAAGCAC-1

using 531 reads

====================================================================================

graph has 272 edges initially, 8 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[4, 5, 13, 196, 311]
surviving nonsolo ucounts = 2[196, 311]
ids = [6, 5]

====================================================================================

UMI info for barcode TCATTTGCAGAAGCAC-1 contig 1 = GAGTCAGTCT...
umi TGCGGACCTT = 255 reads: +78 -1XX +74 -1XX +1 -1XX +1 -1XX +18 -1XX +2 -1XX +9 -7 +5 -1XX +2 -1XX +9 -1XX +7 -1XX +7 -1XX +71 -1XX +5 -1XX +3 -1XX +3 -1XX +23 -2XX +1 -2XX +1 -2XX +2 -3XX +21 -1XX +12 -1XX invalidated
umi TGGGAACTTC = 205 reads: +55 -1XX +332 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 438
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1508 = TCATTTGCAGGGTATG-1

using 256 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^3, 243]
surviving nonsolo ucounts = 1[243]
ids = [2]

====================================================================================

UMI info for barcode TCATTTGCAGGGTATG-1 contig 1 = GTCAGACCCT...
umi CATAGTCACT = 223 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=479]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-479 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1509 = TCATTTGCAGGGTTAG-1

using 300 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 286]
surviving nonsolo ucounts = 1[286]
ids = [2]

====================================================================================

UMI info for barcode TCATTTGCAGGGTTAG-1 contig 1 = GAGAAGAGCT...
umi ATTAAAGCAG = 286 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=16)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQHYGNSPGTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1515 = TCATTTGCATAAGACA-1

using 349 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 339]
surviving nonsolo ucounts = 1[339]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=532]
1-76 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
25-378 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=2)
357-396 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=17)
396-532 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 25, 31, 87, 100, 163, 236, 438
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1518 = TCATTTGCATCACAAC-1

using 293 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=543]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-119 ==> 0-68 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
119-405 ==> 70-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11) [SHIFT!]
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-543 ==> 0-100 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 51, 203, 206, 257, 356, 383, 407
confident = false
not full
frameshifted full length stopped transcript of length 543
VJ delta = 24
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1520 = TCATTTGCATCACGAT-1

using 263 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode TCATTTGCATCACGAT-1 contig 1 = TGATCAGGAC...
umi TTCGAATCAC = 253 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=496]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
428-496 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTPCSF at 367, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1528 = TCATTTGCATTTGCCC-1

using 435 reads

====================================================================================

graph has 150 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 209, 222]
surviving nonsolo ucounts = 2[209, 222]
ids = [1, 2]

====================================================================================

UMI info for barcode TCATTTGCATTTGCCC-1 contig 1 = GAGAAAGGGG...
umi GACAGTCTAC = 208 reads: +385 validated

UMI info for barcode TCATTTGCATTTGCCC-1 contig 2 = GCAGAAGTCT...
umi GCCATTGCGC = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=621]
157-505 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
503-542 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
542-621 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYGSSPGSF at 481, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 62, 102, 157, 365, 491, 584
confident = false

TIG 2[bases=496]
0-29 ==> 2-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-496 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQKYNSAPLTF at 356, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1539 = TCATTTGGTATTAGCC-1

using 15267 reads

====================================================================================

graph has 8269 edges initially, 90 edges after simplification

total ucounts = 1657
nonsolo ucounts = 789[2^311, 3^178, 4^97, 5^56, 6^34, 7^21, 8^18, 9^12, 10^5, 11, 12^4, 13^5, 14, 25, 60, 65, 74, 82, 115, 140, 144, 147, 148, 171, 177, 180, 181, 187, 193, 200, 209, 214, 216, 223, 225, 226, 231, 236, 256, 282, 295, 297, 299, 303, 305, 314, 336, 337, 338, 339, 358, 359, 381, 384^2, 429, 472, 577, 670]
surviving nonsolo ucounts = 44[60, 65, 74, 82, 115, 140, 144, 147, 148, 171, 177, 180, 187, 193, 200, 209, 214, 216, 223, 225, 226, 231, 236, 256, 282, 295, 297, 299, 303, 305, 314, 336, 337, 338, 339, 358, 359, 381, 384^2, 429, 472, 577, 670]
ids = [1156, 775, 1519, 1284, 99, 1078, 519, 1184, 1171, 974, ...]

====================================================================================

UMI info for barcode TCATTTGGTATTAGCC-1 contig 1 = GGGGCAGGAG...
umi AAAATACCAG = 381 reads: +388 validated
umi ACCGTTGTAT = 220 reads: +359 -2XX +1 -1XX +1 -2XX +3 -2XX +1 -1XX +1 -1X +1 -2X +10 invalidated
umi ACTAAGTCAT = 311 reads: +388 validated
umi AGAAGGCTAT = 358 reads: +388 validated
umi AGCAGCCTCC = 359 reads: +388 validated
umi AGTTGTCTTT = 295 reads: +388 validated
umi ATGTGTTCCA = 179 reads: +388 validated
umi CAACACCCCT = 178 reads: +388 validated
umi CAGCTGCCCT = 143 reads: +388 validated
umi CATCCAGCTC = 387 reads: +388 validated
umi CCGTTTACCA = 384 reads: +388 validated
umi CTGTCATCCT = 334 reads: +388 validated
umi GCATTGTGCA = 697 reads: +133 -6XX +249 invalidated
umi GGACCTCGCT = 337 reads: +388 validated
umi GGCTGTCACT = 293 reads: +388 validated
umi GGTAACCTAC = 171 reads: +388 validated
umi GTTCGCCTCA = 431 reads: -96X +292 invalidated
umi TAACCGGGAA = 336 reads: +388 validated
umi TACAAGTAGC = 238 reads: +388 validated
umi TCCACAGCTT = 474 reads: -93 +1 -4XX +290 invalidated
umi TCGGCAATCA = 335 reads: +388 validated
umi TGTCACCATC = 305 reads: +388 validated
umi TTCACTGACC = 73 reads: +388 validated

UMI info for barcode TCATTTGGTATTAGCC-1 contig 2 = AGTGCTTTCT...
umi AATCAACCTT = 115 reads: +439 validated
umi ACCACGTACG = 188 reads: +439 validated
umi ACTCCGCTCA = 254 reads: +439 validated
umi AGTAACCCGC = 305 reads: +439 validated
umi ATTATTCATG = 279 reads: +439 validated
umi ATTGTATTCA = 234 reads: +355 -2XX +1 -5XX +76 invalidated
umi CATGGTGCCG = 231 reads: +423 -16 non-validated
umi CTTATCACCC = 66 reads: +416 -23 non-validated
umi GCTCCGGGCT = 225 reads: +439 validated
umi GTTTTGGTTC = 131 reads: +439 validated
umi TAGCTACACA = 62 reads: -12 +312 -4X +2 -1X +4 -1 +1 -1 +1 -3 +2 -1 +1 -2 +4 -87 invalidated
umi TAGTCGTAGC = 146 reads: +439 validated
umi TATATTGTCT = 148 reads: +439 validated
umi TCCTGCTACA = 81 reads: +439 validated
umi TCGTTTTGTC = 218 reads: +439 validated
umi TGAAGACCAT = 201 reads: +439 validated
umi TTCCACCAAC = 210 reads: +439 validated
umi TTTAGAAATC = 194 reads: +439 validated
umi TTTCGTGAAC = 298 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=20)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 23 umis using 1283 reads
cdr3 = CQQTHSPPRTF at 359, score = 8 + 8
umis assigned: [5, 189, 225, 264, 283, 346, 425, 474, 519, 536] and 13 others
of which 23 are surviving nonsolos
reads assigned: 7098
start codons at 32, 38, 94, 107, 285, 462
confident = true

TIG 2[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=24)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=9)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 233 reads
cdr3 = CARGAARSGTVIIDSW at 377, score = 9 + 6
umis assigned: [99, 167, 236, 326, 434, 457, 539, 775, 928, 1078] and 9 others
of which 19 are surviving nonsolos
reads assigned: 3542
start codons at 17, 38, 82, 168
confident = true
now this is a cell
paired!

GCGGACACGGCTGTTTATTACTGTGCGAGGGGGGCTGCCCGGTCTGGCACAGTAATTATTGACTCCTGGGGCCGGGGAACCCTGGTCGTCGTCTCCGCAG <==> ATCAGCAGTCTACAACCTGACGATTTTGCAACTTACTACTGTCAACAGACTCACAGTCCCCCTCGAACATTCGGCCAGGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1542 = TCATTTGGTCACAAGG-1

using 286 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

UMI info for barcode TCATTTGGTCACAAGG-1 contig 1 = TGGGAGGAAT...
umi TCGTCCGTGG = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-508 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1543 = TCATTTGGTCAGAATA-1

using 31313 reads

====================================================================================

graph has 10928 edges initially, 62 edges after simplification

total ucounts = 1779
nonsolo ucounts = 898[2^307, 3^178, 4^126, 5^73, 6^43, 7^28, 8^14, 9^6, 10^5, 11^3, 12, 13, 14^2, 15, 16^3, 17^3, 18, 19, 20, 26, 33^2, 36, 38, 51, 53, 56, 82, 83, 85, 100, 109, 110, 146, 151, 155, 159, 162, 167^2, 170, 180, 183, 193, 199, 208, 209, 215, 222, 223, 231, 238, 241, 242, 243, 244, 253, 254^2, 255, 258, 267, 273, 280^2, 284, 285, 286, 287, 290, 293, 296, 299, 303, 307, 308^2, 309^2, 312, 314^2, 315^3, 316, 317^2, 319, 321, 328, 329, 331, 332, 333, 334^2, 346, 350, 351, 352, 355, 356, 362, 373, 374, 380, 387, 391, 394^2, 398, 400, 405, 409^2, 455, 495, 682, 892]
surviving nonsolo ucounts = 92[20, 33, 38, 53, 56, 85, 100, 109, 151, 155, 159, 162, 167^2, 170, 180, 183, 193, 199, 208, 209, 215, 222, 223, 231, 238, 241, 242, 243, 244, 253, 254^2, 255, 258, 267, 273, 280^2, 284, 285, 286, 287, 290, 293, 296, 299, 303, 307, 308^2, 309^2, 312, 314^2, 315^3, 316, 317^2, 319, 321, 328, 329, 331, 332, 333, 334^2, 346, 350, 351, 352, 355, 356, 362, 373, 374, 380, 387, 391, 394^2, 398, 400, 405, 409^2, 495, 682]
ids = [119, 1497, 336, 695, 772, 636, 1250, 1246, 1383, 989, ...]

====================================================================================

UMI info for barcode TCATTTGGTCAGAATA-1 contig 1 = ACTTTCTGAG...
umi AATTATATCT = 221 reads: +424 validated
umi ACAAAAGACG = 20 reads: +320 -1 +2 -1 +11 -1 +4 -1 +2 -1 +6 -59 +15 non-validated
umi ATACTCTTCT = 37 reads: +342 -56 +10 -1 +4 -1 +10 non-validated
umi ATCCCGGTAG = 560 reads: -391X +1 -4XX +2 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CCACTTCCTC = 86 reads: +2 -1 +1 -1 +419 non-validated
umi CCCTCGCCCT = 53 reads: +424 validated
umi CGCCACAGCC = 57 reads: +424 validated
umi CGTCTGTTCA = 241 reads: +424 validated
umi CTTGTCTGTG = 170 reads: +424 validated
umi GTTATTGGCC = 113 reads: +190 -1XX +233 invalidated
umi GTTCCCAGGC = 100 reads: +424 validated
umi GTTTATGCAG = 201 reads: +424 validated
umi TATGCTCCGT = 166 reads: +424 validated
umi TCCTTGCTCC = 32 reads: -9 +323 -2 +90 non-validated

UMI info for barcode TCATTTGGTCAGAATA-1 contig 2 = GGGGAGGAAC...
umi AAAGCGGATC = 162 reads: +382 validated
umi AAATTTGTCC = 261 reads: +382 validated
umi ACATATGAAG = 326 reads: +382 validated
umi ACCATTTGGG = 287 reads: +382 validated
umi ACCCCGTTTC = 399 reads: +382 validated
umi ACCTCTTTCG = 397 reads: +382 validated
umi ACGTATCCGC = 283 reads: +382 validated
umi ACTTAATTGG = 309 reads: +382 validated
umi AGAACAACTG = 376 reads: +382 validated
umi AGCAGTCCAA = 318 reads: +382 validated
umi AGCCTGTGTG = 412 reads: +382 validated
umi AGCGTCCTGG = 243 reads: +382 validated
umi AGGCCCTAAG = 208 reads: +382 validated
umi ATACTCCTGA = 167 reads: +382 validated
umi ATATACCTTA = 308 reads: +382 validated
umi ATATAGTCAT = 262 reads: +382 validated
umi ATATTCCTAA = 273 reads: +382 validated
umi ATCTCTCTGT = 348 reads: +382 validated
umi ATGAATCTCC = 314 reads: +382 validated
umi ATGTATGCTG = 339 reads: +382 validated
umi ATGTTACTTC = 258 reads: +382 validated
umi ATTCCGATCG = 406 reads: +382 validated
umi ATTCTTTGTA = 236 reads: +73 -5XX +1 -11XX +3 -1XX +2 -286X invalidated
umi CAAACGCCGT = 315 reads: +382 validated
umi CAACCATTTA = 356 reads: +382 validated
umi CAACCTCGTA = 351 reads: +382 validated
umi CAACTAACTC = 318 reads: +382 validated
umi CAATTGCATA = 307 reads: +382 validated
umi CAGTCGTGCA = 213 reads: +382 validated
umi CATAAACCGC = 320 reads: -341X +1 -6XX +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi CATATTGATA = 158 reads: +382 validated
umi CATATTTCTT = 316 reads: +382 validated
umi CCATAAATCT = 319 reads: +382 validated
umi CCCAACTTGC = 358 reads: +382 validated
umi CCGGTCGGAT = 330 reads: +382 validated
umi CCTATCGTAT = 361 reads: +382 validated
umi CCTCCTTTAA = 331 reads: +382 validated
umi CCTCGATAGT = 282 reads: +382 validated
umi CCTTTTGTAA = 401 reads: +382 validated
umi CGCTTCATTG = 318 reads: +382 validated
umi CGGATGTCCA = 283 reads: +382 validated
umi CGTCTTTCCA = 377 reads: +382 validated
umi CGTTGCCCTC = 242 reads: +382 validated
umi CTAACTAGAT = 180 reads: +382 validated
umi CTAGCTCTCA = 304 reads: +382 validated
umi CTCCAGAACA = 392 reads: +382 validated
umi CTCTCAGTCA = 209 reads: +382 validated
umi CTCTCTTCGT = 375 reads: +382 validated
umi CTTAGTGATT = 313 reads: +382 validated
umi CTTCGTCGCT = 154 reads: +382 validated
umi CTTTGATTAC = 301 reads: +382 validated
umi GAAACACGTA = 312 reads: +382 validated
umi GAATAATAAC = 488 reads: +382 validated
umi GCAAGTCCGC = 332 reads: +382 validated
umi GCCCGTTATG = 236 reads: -349 +1 -1X +6 -2X +15 -1XX +7 invalidated
umi GGCTTCCTGT = 233 reads: +382 validated
umi GTTACTCGGA = 314 reads: +382 validated
umi GTTCACCATC = 352 reads: +382 validated
umi GTTTACTCGA = 316 reads: +382 validated
umi TAATCCTACG = 393 reads: +382 validated
umi TACCACTCTC = 406 reads: +382 validated
umi TATACACCGT = 193 reads: +382 validated
umi TATACAGCCA = 393 reads: +382 validated
umi TATGTTGCCA = 151 reads: +382 validated
umi TATTCCGGCA = 353 reads: +382 validated
umi TCACATTCAT = 261 reads: +382 validated
umi TCACCATCTG = 348 reads: +193 -1XX +188 invalidated
umi TCAGCCGTTC = 252 reads: +382 validated
umi TCATAGGGCT = 225 reads: +382 validated
umi TCCAAACTAT = 569 reads: -334 +1 -2XX +1 -1XX +2 -6XX +2 -1XX +3 -1XX +3 -3XX +9 -1XX +12 invalidated
umi TCCCAGTTGC = 305 reads: +382 validated
umi TCCCGCCCAA = 305 reads: +382 validated
umi TCCTTCTCGC = 186 reads: +188 -1XX +193 invalidated
umi TCGCACCATC = 285 reads: +382 validated
umi TCTCGGGTGA = 336 reads: +382 validated
umi TCTTAACTTT = 290 reads: +382 validated
umi TTCTAACTAT = 285 reads: +382 validated
umi TTCTCCATCC = 256 reads: +382 validated
umi TTGGTTAGCC = 290 reads: +382 validated
umi TTTTATGCGA = 302 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=641]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-358 ==> 0-323 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=22)
411-459 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
459-641 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 10 umis using 162 reads
cdr3 = CAAGWVSTWYNYMDVW at 380, score = 9 + 7
umis assigned: [106, 119, 336, 365, 636, 695, 772, 813, 997, 1246] and 4 others
of which 13 are surviving nonsolos
reads assigned: 1841
start codons at 35, 79, 391, 416
confident = true

TIG 2[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 76 umis using 3661 reads
cdr3 = CQQYNDWPLTF at 357, score = 9 + 9
umis assigned: [17, 29, 154, 181, 187, 202, 223, 255, 267, 277] and 70 others
of which 79 are surviving nonsolos
reads assigned: 23954
start codons at 36, 105, 241, 370, 460
confident = true
now this is a cell
paired!

GCAGACACGGCCGTTTACTACTGTGCGGCCGGATGGGTGTCCACCTGGTACAACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATGACTGGCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1544 = TCATTTGGTCAGCTAT-1

using 201 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^3, 3^2, 188]
surviving nonsolo ucounts = 1[188]
ids = [2]

====================================================================================

UMI info for barcode TCATTTGGTCAGCTAT-1 contig 1 = CTCAGTTAGG...
umi CTCCTTTGCC = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=474]
0-24 ==> 23-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
24-369 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
369-406 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
406-474 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQRSNWPLTF at 345, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 24, 232, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1547 = TCATTTGGTCATTAGC-1

using 924 reads

====================================================================================

graph has 1394 edges initially, 16 edges after simplification

total ucounts = 455
nonsolo ucounts = 157[2^76, 3^40, 4^14, 5^11, 6^3, 7^3, 8^3, 9^2, 11, 14, 15, 21, 101]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1550 = TCATTTGGTCTAGTCA-1

using 204 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 9, 189]
surviving nonsolo ucounts = 1[189]
ids = [4]

====================================================================================

UMI info for barcode TCATTTGGTCTAGTCA-1 contig 1 = ACAGCATGGA...
umi CATTCCACGC = 180 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
5-356 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
355-393 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
393-480 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYDDLPITF at 332, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 5, 11, 67, 80, 345, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1552 = TCATTTGGTCTCATCC-1

using 13 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1563 = TCATTTGGTGTAATGA-1

using 573 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[232, 335]
surviving nonsolo ucounts = 2[232, 335]
ids = [7, 1]

====================================================================================

UMI info for barcode TCATTTGGTGTAATGA-1 contig 1 = GGGGGCAGGA...
umi CACCATCAGC = 338 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYSTPRTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 33, 39, 95, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1572 = TCATTTGGTTATGTGC-1

using 442 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 203, 232]
surviving nonsolo ucounts = 2[203, 232]
ids = [3, 6]

====================================================================================

UMI info for barcode TCATTTGGTTATGTGC-1 contig 1 = AGCTTCAGCT...
umi CCGTCCCTCA = 195 reads: +388 validated

UMI info for barcode TCATTTGGTTATGTGC-1 contig 2 = AGTGCTTTCT...
umi TTGATCGGTT = 224 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=475]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-475 ==> 0-40 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=494]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-494 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1605 = TCATTTGTCATGTCCC-1

using 206 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[10, 194]
surviving nonsolo ucounts = 1[194]
ids = [3]

====================================================================================

UMI info for barcode TCATTTGTCATGTCCC-1 contig 1 = GAGAGAGGAG...
umi GAAACACCTT = 192 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=632]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-632 ==> 0-135 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1624 = TCATTTGTCGCACTCT-1

using 16978 reads

====================================================================================

graph has 6032 edges initially, 54 edges after simplification

total ucounts = 1001
nonsolo ucounts = 508[2^192, 3^115, 4^52, 5^33, 6^19, 7^12, 8^4, 9^6, 10^6, 11^4, 13, 14, 15^3, 17, 18^2, 25, 29, 33, 38, 81, 156, 164, 174, 177, 200, 206, 207, 214, 220, 230, 231, 239, 242, 245, 247, 249, 254, 258, 260, 262, 263, 265^2, 266, 270, 271, 273, 278, 280, 284, 286, 288, 297, 298, 300, 302, 304, 311, 313, 318, 322, 330^2, 335, 342, 349, 352^2, 360, 401, 403, 620]
surviving nonsolo ucounts = 52[14, 38, 81, 156, 174, 177, 206, 207, 214, 220, 230, 231, 239, 242, 247, 249, 254, 258, 260, 262, 263, 265^2, 266, 270, 271, 273, 278, 280, 284, 286, 288, 297, 298, 300, 302, 304, 311, 313, 318, 322, 330^2, 335, 342, 349, 352^2, 360, 401, 403, 620]
ids = [762, 880, 43, 74, 570, 829, 163, 268, 34, 757, ...]

====================================================================================

UMI info for barcode TCATTTGTCGCACTCT-1 contig 1 = GGGGAGGAAC...
umi AAACATTGTC = 244 reads: +388 validated
umi AACCTCGGTA = 239 reads: +388 validated
umi AAGGGCTGAC = 216 reads: +388 validated
umi AATGTTAGAC = 314 reads: +388 validated
umi AATTATTCTA = 244 reads: +388 validated
umi ACATGATCAT = 156 reads: +388 validated
umi ACCTACGCTC = 333 reads: +388 validated
umi ACCTGAGGGT = 652 reads: +92 -1XX +2 -1XX +1 -6XX +1 -3XX +1 -5XX +275 invalidated
umi ACCTTTTGCT = 278 reads: +388 validated
umi ACGGCATAAC = 233 reads: +388 validated
umi ACTACCGTAA = 358 reads: +388 validated
umi ACTTTCTGGT = 282 reads: +388 validated
umi AGACCACATT = 270 reads: +388 validated
umi AGCATCCCTT = 304 reads: +388 validated
umi AGGTTCGGAA = 200 reads: +388 validated
umi ATGCCAACTC = 326 reads: +388 validated
umi CACGTGGCTG = 205 reads: +388 validated
umi CAGCTTTACA = 268 reads: +388 validated
umi CAGGAGGCCG = 316 reads: +388 validated
umi CAGTGTCCGC = 253 reads: +388 validated
umi CAGTTTTTAG = 271 reads: +388 validated
umi CCAACGTCCT = 318 reads: +388 validated
umi CCGGTCCTTA = 267 reads: +388 validated
umi CGATAATTCC = 29 reads: +17 -6XX +1 -1X +1 -5XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +53 -289 invalidated
umi CGCCCTCACG = 299 reads: +388 validated
umi CGGATACTGT = 341 reads: +388 validated
umi CGGATCATAA = 300 reads: +388 validated
umi CGGCAGTCAG = 261 reads: +388 validated
umi CGTAATATCA = 319 reads: +388 validated
umi CTCAAGCGCG = 358 reads: +388 validated
umi CTTCGGGTAA = 264 reads: +388 validated
umi GACTAAGGCA = 262 reads: +388 validated
umi GAGATATTCG = 283 reads: +388 validated
umi GCGTCCAGCG = 27 reads: +12 -1X +13 -5X +1 -2XX +2 -1XX +1 -5XX +1 -2XX +53 -289 invalidated
umi GCGTTCAGCC = 174 reads: +388 validated
umi GCTATGAAAC = 306 reads: +388 validated
umi GCTCTGTCGG = 403 reads: +388 validated
umi GGAAACGCAT = 357 reads: +388 validated
umi GGTGAAGTAG = 264 reads: +388 validated
umi GTACTCGCCT = 278 reads: +388 validated
umi GTGTTGACCG = 412 reads: +388 validated
umi TAATTTTATT = 335 reads: +388 validated
umi TAGTTTGTGG = 351 reads: +388 validated
umi TATGAATTTA = 221 reads: +388 validated
umi TATGACGGTC = 273 reads: +388 validated
umi TCGGCTCCAC = 173 reads: +388 validated
umi TCTTTGTGAT = 252 reads: +388 validated
umi TGGGGCCTAA = 260 reads: +388 validated
umi TGTTTACTTG = 287 reads: +388 validated
umi TTCCCGCAGG = 297 reads: +388 validated
umi TTCCTATGGG = 32 reads: -4 +9 -2X +2 -6XX +1 -1XX +1 -5XX +1 -2XX +2 -1XX +1 -5XX +1 -2XX +53 -289 invalidated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 2210 reads
cdr3 = CQQRSNWPPSLTF at 357, score = 9 + 9
umis assigned: [1, 19, 34, 54, 56, 74, 84, 87, 92, 96] and 41 others
of which 48 are surviving nonsolos
reads assigned: 13727
start codons at 36, 241, 244, 466
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1636 = TCATTTGTCGTGACAT-1

using 237 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^3, 4^2, 221]
surviving nonsolo ucounts = 1[221]
ids = [7]

====================================================================================

UMI info for barcode TCATTTGTCGTGACAT-1 contig 1 = GGGCACAAGA...
umi TATTGACGGA = 216 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-391 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-542 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 359, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 35, 189, 192, 243, 342, 369, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1645 = TCATTTGTCTGACCTC-1

using 240 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3^2, 231]
surviving nonsolo ucounts = 1[231]
ids = [3]

====================================================================================

UMI info for barcode TCATTTGTCTGACCTC-1 contig 1 = GATGCTTTCT...
umi CTCTTTACGT = 232 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=530]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARGLSGWHNPFDYW at 383, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 1, 17, 26, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1652 = TCATTTGTCTGTTTGT-1

using 332 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3, 4^2, 8, 304]
surviving nonsolo ucounts = 1[304]
ids = [9]

====================================================================================

UMI info for barcode TCATTTGTCTGTTTGT-1 contig 1 = AGCTCTCAGA...
umi GTGTGTAGCG = 280 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=510]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=13)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
488-510 ==> 0-22 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDRIYAFDIW at 421, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 79, 235, 307, 356, 382, 440, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1654 = TCATTTGTCTTCAACT-1

using 181 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 18, 156]
surviving nonsolo ucounts = 2[18, 156]
ids = [2, 3]

====================================================================================

UMI info for barcode TCATTTGTCTTCAACT-1 contig 1 = AGGAATCAGA...
umi CTTCTGTCAC = 17 reads: -27 +4 -1 +10 -1 +13 -2 +6 -1 +18 -16 +235 -8 +29 -2 +4 -1 +10 non-validated
umi GGGCACACTC = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-511 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 169
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1668 = TCCACACAGACTGTAA-1

using 243 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 5, 231]
surviving nonsolo ucounts = 1[231]
ids = [5]

====================================================================================

UMI info for barcode TCCACACAGACTGTAA-1 contig 1 = AGTCTGGGCC...
umi TTGGGCGTTT = 223 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=526]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=8)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
425-526 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQVWDSSSDHLNVF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 40, 101, 239, 338, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1675 = TCCACACAGCACCGCT-1

using 7938 reads

====================================================================================

graph has 3575 edges initially, 44 edges after simplification

total ucounts = 555
nonsolo ucounts = 240[2^91, 3^48, 4^27, 5^13, 6^8, 7^12, 8^5, 9^2, 10^2, 11^5, 13, 15, 20, 36, 43^2, 89, 149, 154, 180^2, 189, 205, 210, 217, 258, 264, 267, 272, 329, 353, 364, 398, 487, 573, 720, 831]
surviving nonsolo ucounts = 21[43, 89, 149, 154, 180^2, 189, 205, 210, 217, 258, 264, 267, 272, 329, 353, 364, 487, 573, 720, 831]
ids = [506, 207, 117, 246, 133, 549, 408, 101, 400, 519, ...]

====================================================================================

UMI info for barcode TCCACACAGCACCGCT-1 contig 1 = TGAGCGCAGA...
umi ACGCTTCCGA = 833 reads: -344 +1 -6XX +37 invalidated
umi ACTACCACGG = 265 reads: +388 validated
umi AGCTCTCTTC = 179 reads: -381X +1 -4XX +2 invalidated
umi ATAACCTCAA = 149 reads: +26 -2XX +1 -5XX +1 -1XX +1 -6XX +345 invalidated
umi ATGCACTAGT = 147 reads: +388 validated
umi CAACTTTTGG = 189 reads: +195 -3XX +190 invalidated
umi CACACTGTAC = 725 reads: -351X +37 invalidated
umi CCTTTGCCGC = 482 reads: -374 +1 -2X +11 invalidated
umi GCATCTCGAC = 261 reads: +388 validated
umi GTGGGCTGCA = 262 reads: +388 validated
umi TAAGCTGCAG = 213 reads: +388 validated
umi TACATCCTTC = 186 reads: +388 validated
umi TCACGCCCGT = 269 reads: +388 validated
umi TTAGGCCGGC = 578 reads: -186 +202 non-validated
umi TTATTTTTGT = 198 reads: -10 +1 -5X +2 -2XX +1 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +345 invalidated
umi TTTTAATTGA = 181 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=2)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 513 reads
cdr3 = CGTWDSSLSAWVF at 357, score = 7 + 8
umis assigned: [55, 60, 86, 101, 117, 133, 139, 212, 303, 377] and 6 others
of which 15 are surviving nonsolos
reads assigned: 5019
start codons at 36, 190, 241, 365
confident = true

REJECT CONTIGS

TIG 1[bases=523]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
0-20 ==> 1300-1320 on rc of segment before IGHVIII-5-1 exon 1 [len=1320] (mis=0)
0-20 ==> 7558-7578 on rc of segment before IGHVIII-26-1 exon 1 [len=7578] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
412-452 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
452-523 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CAHRLWRQQLVFEVGGTTGAREPWSPSPQGVHPPQPF at 365, score = 7 + 4
umis assigned: [102, 506]
of which 2 are surviving nonsolos
reads assigned: 400
start codons at 20, 64, 243, 246, 326, 335
confident = false
frameshifted full length transcript of length 523
VJ delta = 63
delta too large
not full
not full

TIG 2[bases=791]
3-584 ==> 1726-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
580-742 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
742-780 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
umis assigned: [207, 246, 271]
of which 3 are surviving nonsolos
reads assigned: 586
start codons at 63, 112, 119, 179, 264, 329, 361, 396, 420, 497, 550, 605, 610, 723
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1682 = TCCACACAGCCCGAAA-1

using 280 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode TCCACACAGCCCGAAA-1 contig 1 = GCTCTGCTTC...
umi TACAGTTAGG = 267 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=537]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-537 ==> 0-95 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1683 = TCCACACAGCGATGAC-1

using 1021 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 328, 685]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1689 = TCCACACAGCTCTCGG-1

using 21 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1694 = TCCACACAGGCATGTG-1

using 79 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 67]
surviving nonsolo ucounts = 1[67]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1700 = TCCACACAGGTGCAAC-1

using 223 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode TCCACACAGGTGCAAC-1 contig 1 = GATCAGGACT...
umi ACTTTGCCTA = 204 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=472]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-472 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1701 = TCCACACAGGTGCTAG-1

using 337 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 330]
surviving nonsolo ucounts = 1[330]
ids = [3]

====================================================================================

UMI info for barcode TCCACACAGGTGCTAG-1 contig 1 = GTCAGTCCCA...
umi TTATAAATTG = 331 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1707 = TCCACACAGTCTCCTC-1

using 241 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 4, 231]
surviving nonsolo ucounts = 1[231]
ids = [0]

====================================================================================

UMI info for barcode TCCACACAGTCTCCTC-1 contig 1 = TCTGGCGCCA...
umi AAATCTAGCG = 219 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-546 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLLYYGGALVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 34, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1710 = TCCACACAGTGGCACA-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1721 = TCCACACCAAGTAATG-1

using 18 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1724 = TCCACACCAATAGCAA-1

using 2185 reads

====================================================================================

graph has 2977 edges initially, 22 edges after simplification

total ucounts = 841
nonsolo ucounts = 423[2^150, 3^99, 4^65, 5^32, 6^24, 7^18, 8^11, 9^10, 10^3, 11^6, 12^2, 13, 16, 153]
surviving nonsolo ucounts = 1[153]
ids = [608]

====================================================================================

UMI info for barcode TCCACACCAATAGCAA-1 contig 1 = GAAGACAGGA...
umi TAGGTTTCCG = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-28 ==> 86-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
28-381 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-486 ==> 0-70 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 349, score = 8 + 8
umis assigned: [608]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 28, 182, 332, 357, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1737 = TCCACACCACGGATAG-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1748 = TCCACACCAGCTATTG-1

using 630 reads

====================================================================================

graph has 290 edges initially, 12 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 9, 81, 265, 266]
surviving nonsolo ucounts = 2[81, 265]
ids = [8, 0]

====================================================================================

UMI info for barcode TCCACACCAGCTATTG-1 contig 1 = ATTGGGAGTC...
umi ACGGGAGTTA = 271 reads: +96 -1XX +7 -1XX +283 invalidated
umi GCAATAAACG = 228 reads: +17 -1XX +23 -1XX +9 -2XX +83 -1XX +3 -1XX +6 -2XX +5 -1XX +2 -1XX +54 -1XX +1 -1XX +5 -1XX +2 -1XX +4 -1XX +3 -2XX +23 -1XX +20 -1XX +3 -1XX +13 -1XX +5 -1XX +6 -46 +1 -1X +6 -2XX +15 -1XX +7 invalidated
umi GTTCCTCTCG = 79 reads: +96 -1XX +7 -1XX +283 invalidated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 66 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [0, 6, 8]
of which 2 are surviving nonsolos
reads assigned: 546
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1751 = TCCACACCAGCTGTAT-1

using 13715 reads

====================================================================================

graph has 13640 edges initially, 259 edges after simplification

total ucounts = 2382
nonsolo ucounts = 1848[2^301, 3^215, 4^183, 5^175, 6^135, 7^144, 8^97, 9^106, 10^82, 11^81, 12^66, 13^49, 14^60, 15^33, 16^37, 17^26, 18^20, 19^12, 20^9, 21^4, 22, 23, 24^2, 25, 26^3, 27^2, 33, 41, 93]
surviving nonsolo ucounts = 2[12, 33]
ids = [1615, 221]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1754 = TCCACACCAGGATTGG-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1758 = TCCACACCATACCATG-1

using 261 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [1]

====================================================================================

UMI info for barcode TCCACACCATACCATG-1 contig 1 = AGTCCCAACC...
umi GAATTGGGGG = 225 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=453]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
405-453 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYDNLPTF at 347, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1770 = TCCACACCATTGGGCC-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1772 = TCCACACCATTTGCCC-1

using 450 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 21
nonsolo ucounts = 7[2^4, 7, 133, 288]
surviving nonsolo ucounts = 2[133, 288]
ids = [5, 10]

====================================================================================

UMI info for barcode TCCACACCATTTGCCC-1 contig 1 = AGCTCTGAGA...
umi ACTTTCCTGC = 134 reads: +424 validated

UMI info for barcode TCCACACCATTTGCCC-1 contig 2 = GGGAATCAGT...
umi CATCGGGTCT = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 9 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1775 = TCCACACGTAGAGGAA-1

using 361 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5^2, 349]
surviving nonsolo ucounts = 1[349]
ids = [3]

====================================================================================

UMI info for barcode TCCACACGTAGAGGAA-1 contig 1 = ATCAGTCCCA...
umi GGACTACCAG = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-481 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1777 = TCCACACGTAGCTTGT-1

using 95 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[95]
surviving nonsolo ucounts = 1[95]
ids = [0]

====================================================================================

UMI info for barcode TCCACACGTAGCTTGT-1 contig 1 = CCCAGCTGGG...
umi GGCCACTCGC = 89 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=495]
0-43 ==> 16-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
43-396 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
415-461 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
461-495 ==> 0-34 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARPYNSYWLGFDYW at 385, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 87
start codons at 43, 217
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1778 = TCCACACGTAGGAGTC-1

using 245 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^3, 236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode TCCACACGTAGGAGTC-1 contig 1 = ACCCAAAAAC...
umi GACATTGCGT = 228 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=522]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-522 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1781 = TCCACACGTCACTGGC-1

using 315 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 304]
surviving nonsolo ucounts = 1[304]
ids = [7]

====================================================================================

UMI info for barcode TCCACACGTCACTGGC-1 contig 1 = GGAGTCAGTC...
umi TTGCTTTCGC = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYSTPRTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1783 = TCCACACGTCCGTCAG-1

using 182 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3, 4, 5^2, 14, 145]
surviving nonsolo ucounts = 1[145]
ids = [10]

====================================================================================

UMI info for barcode TCCACACGTCCGTCAG-1 contig 1 = GCTCTGCTTC...
umi TTAGTCTTAC = 145 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=510]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-510 ==> 0-65 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1785 = TCCACACGTCGAACAG-1

using 153 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[149]
surviving nonsolo ucounts = 1[149]
ids = [3]

====================================================================================

UMI info for barcode TCCACACGTCGAACAG-1 contig 1 = GGGGGACTGA...
umi TCACTTTGTA = 144 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=495]
38-398 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=6)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
435-495 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQGTHWPRTF at 374, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 38, 71, 99, 107, 195, 357, 377, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1788 = TCCACACGTCTCCACT-1

using 91 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 16[2^2, 3^2, 4^6, 5, 7, 8^2, 11, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1791 = TCCACACGTCTTGATG-1

using 326 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode TCCACACGTCTTGATG-1 contig 1 = ACAACAGGCA...
umi CAATACGATC = 326 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=558]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=12)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYYSGPTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 25, 347, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1794 = TCCACACGTGAGGCTA-1

using 762 reads

====================================================================================

graph has 312 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 286, 470]
surviving nonsolo ucounts = 2[286, 470]
ids = [2, 3]

====================================================================================

UMI info for barcode TCCACACGTGAGGCTA-1 contig 1 = ATCAGTCCCA...
umi CGTCTATTCC = 282 reads: +388 validated
umi GTGCAACTTG = 472 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 114 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 740
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1795 = TCCACACGTGGGTCAA-1

using 41 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 4, 29]
surviving nonsolo ucounts = 1[29]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=339]
7-328 ==> 0-321 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=0)
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 23
start codons at 7, 51
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1796 = TCCACACGTGTGGTTT-1

using 301 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode TCCACACGTGTGGTTT-1 contig 1 = GGGGAGGAAC...
umi GACCTGCGTC = 298 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRRTWPPAF at 357, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 36, 85, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1799 = TCCACACGTTGACGTT-1

using 131 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 121]
surviving nonsolo ucounts = 1[121]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1801 = TCCACACGTTGTACAC-1

using 269 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 3, 4, 6, 246]
surviving nonsolo ucounts = 1[246]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1804 = TCCACACTCAAACGGG-1

using 281 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[22, 255]
surviving nonsolo ucounts = 2[22, 255]
ids = [0, 2]

====================================================================================

UMI info for barcode TCCACACTCAAACGGG-1 contig 1 = GAGAGGAGCC...
umi ATCCGTGTCA = 231 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=529]
0-71 ==> 8-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
71-424 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
432-452 ==> 0-20 on |10|IGHD1-26|D-REGION| [len=20] (mis=1)
441-504 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
504-529 ==> 0-25 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDGSLYSGSYYYYGLDVW at 413, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 71, 227, 374, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1825 = TCCACACTCCGCATCT-1

using 226 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[223]
surviving nonsolo ucounts = 1[223]
ids = [3]

====================================================================================

UMI info for barcode TCCACACTCCGCATCT-1 contig 1 = GCTCTGCTTC...
umi TTTCAAATCC = 223 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=517]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-517 ==> 0-75 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1827 = TCCACACTCCTTTACA-1

using 17 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[4, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1837 = TCCACACTCTACTCAT-1

using 97 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[94]
surviving nonsolo ucounts = 1[94]
ids = [0]

====================================================================================

UMI info for barcode TCCACACTCTACTCAT-1 contig 1 = GGAGAAGAGC...
umi ACCCGTGTTC = 84 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=450]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-450 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYGSSPWTF at 360, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 36, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1838 = TCCACACTCTATCCTA-1

using 278 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 272]
surviving nonsolo ucounts = 1[272]
ids = [1]

====================================================================================

UMI info for barcode TCCACACTCTATCCTA-1 contig 1 = GGGGGACTCC...
umi AGCCCGCTCT = 257 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=528]
21-372 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
391-439 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
439-528 ==> 0-89 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CAVSSRADGYFDSW at 366, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 21, 65, 247, 327, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1842 = TCCACACTCTCCTATA-1

using 244 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 4, 6, 229]
surviving nonsolo ucounts = 1[229]
ids = [5]

====================================================================================

UMI info for barcode TCCACACTCTCCTATA-1 contig 1 = CTCAGGAGGC...
umi GGGCCCTTAG = 227 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=522]
0-33 ==> 130-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
33-359 ==> 0-326 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
424-522 ==> 0-98 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CCSYAGGNIFHVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 33, 190, 241, 250, 340, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1843 = TCCACACTCTCTGTCG-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1846 = TCCACACTCTGCTGCT-1

using 455 reads

====================================================================================

graph has 128 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 195, 252]
surviving nonsolo ucounts = 2[195, 252]
ids = [7, 5]

====================================================================================

UMI info for barcode TCCACACTCTGCTGCT-1 contig 1 = ATCAGTCCCA...
umi TTCCATTTCT = 184 reads: +388 validated

UMI info for barcode TCCACACTCTGCTGCT-1 contig 2 = GGAACTGCTC...
umi GCTTGCCTCT = 232 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=474]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-474 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=476]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-476 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYNNWPRTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1855 = TCCCGATAGAAGATTC-1

using 286 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1858 = TCCCGATAGACTTGAA-1

using 22 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1861 = TCCCGATAGAGCTATA-1

using 1092 reads

====================================================================================

graph has 363 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 5^2, 342, 735]
surviving nonsolo ucounts = 2[342, 735]
ids = [7, 4]

====================================================================================

UMI info for barcode TCCCGATAGAGCTATA-1 contig 1 = GGGAGGAACT...
umi TATATGTGTC = 734 reads: +382 validated
umi TTTTACTTCC = 347 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 174 reads
cdr3 = CQQRSNWPPTF at 356, score = 9 + 8
umis assigned: [4, 7]
of which 2 are surviving nonsolos
reads assigned: 1063
start codons at 35, 240, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1871 = TCCCGATAGCCACGTC-1

using 168 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 1[166]
ids = [2]

====================================================================================

UMI info for barcode TCCCGATAGCCACGTC-1 contig 1 = GGAGGAGTCA...
umi TAAAGGTCAG = 147 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=427]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 17 reads
cdr3 = CQQSYSTPWQF at 356, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 29, 35, 91, 104, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1878 = TCCCGATAGCGTCAAG-1

using 226 reads

====================================================================================

graph has 106 edges initially, 10 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[13, 210]
surviving nonsolo ucounts = 2[13, 210]
ids = [2, 0]

====================================================================================

UMI info for barcode TCCCGATAGCGTCAAG-1 contig 1 = ACCCAAAAAC...
umi AAGAGTAAAC = 203 reads: +436 validated
umi AGTTCTAATG = 8 reads: +33 -15 +18 -1XX +25 -1 +23 -1X +1 -23 +2 -1XX +1 -1XX +3 -1XX +1 -1XX +4 -1XX +3 -1XX +27 -1XX +18 -1X +4 -224 invalidated

GOOD CONTIGS

TIG 1[bases=579]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-579 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 207
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1882 = TCCCGATAGGACTGGT-1

using 881 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[881]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1886 = TCCCGATAGGCGATAC-1

using 456 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[455]
surviving nonsolo ucounts = 1[455]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1892 = TCCCGATAGTCAATAG-1

using 4613 reads

====================================================================================

graph has 4034 edges initially, 52 edges after simplification

total ucounts = 1122
nonsolo ucounts = 502[2^206, 3^106, 4^70, 5^31, 6^26, 7^22, 8^12, 9^5, 10^3, 11^3, 12^2, 13, 14, 15^2, 17, 25, 32, 149, 155, 160, 164, 191, 263, 288, 380, 409]
surviving nonsolo ucounts = 12[17, 25, 32, 149, 155, 160, 164, 191, 263, 288, 380, 409]
ids = [937, 128, 377, 744, 609, 138, 962, 951, 468, 850, ...]

====================================================================================

UMI info for barcode TCCCGATAGTCAATAG-1 contig 1 = GAGAGAGGAG...
umi AGGGATATTG = 161 reads: +415 validated

UMI info for barcode TCCCGATAGTCAATAG-1 contig 2 = AGTCTGGGCC...
umi CCTTATACGC = 33 reads: +237 -2 +143 non-validated
umi CTATGTTGCG = 265 reads: +382 validated
umi TCACATCACG = 286 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=538]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
488-538 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAKEDGWKYYFDYW at 415, score = 8 + 7
umis assigned: [138]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 73, 126, 224, 229, 290, 376, 428
confident = true

TIG 2[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-374 ==> 0-334 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=16)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 94 reads
cdr3 = CQVWHSTSDHVVF at 355, score = 7 + 8
umis assigned: [377, 468, 850]
of which 3 are surviving nonsolos
reads assigned: 575
start codons at 40, 101, 239, 338, 383
confident = true

REJECT CONTIGS

TIG 1[bases=916]
4-584 ==> 1727-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=2)
580-742 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
742-780 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
780-916 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [128, 542, 609, 744, 937, 951, 962, 1061]
of which 8 are surviving nonsolos
reads assigned: 1443
start codons at 63, 112, 119, 179, 264, 329, 361, 396, 420, 497, 550, 605, 610, 723, 822
confident = false
did not find CDR3
now this is a cell
paired!

AGAGCCGACGACACGGCCGTTTATTACTGTGCGAAAGAGGATGGGTGGAAATACTACTTTGACTACTGGGGCCGGGGAACCCTGGTCACCGTCGCCTCAG <==> AGGGTCGCAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGCATAGTACCAGTGATCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1893 = TCCCGATAGTCATGCT-1

using 310 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 303]
surviving nonsolo ucounts = 1[303]
ids = [2]

====================================================================================

UMI info for barcode TCCCGATAGTCATGCT-1 contig 1 = GAAGAGCTGC...
umi ACTTGATAGA = 307 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGSSLTTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1894 = TCCCGATAGTCCAGGA-1

using 1377 reads

====================================================================================

graph has 662 edges initially, 12 edges after simplification

total ucounts = 400
nonsolo ucounts = 265[2^56, 3^63, 4^41, 5^31, 6^18, 7^14, 8^17, 9^11, 10, 11^6, 13^3, 14, 16, 17, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1901 = TCCCGATAGTTAGGTA-1

using 328 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[326]
surviving nonsolo ucounts = 1[326]
ids = [0]

====================================================================================

UMI info for barcode TCCCGATAGTTAGGTA-1 contig 1 = GAAGAGCTGC...
umi AAGGAGTCCA = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1904 = TCCCGATCAAATCCGT-1

using 245 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 237]
surviving nonsolo ucounts = 1[237]
ids = [5]

====================================================================================

UMI info for barcode TCCCGATCAAATCCGT-1 contig 1 = AGGAGTCAGA...
umi GTGGATGAGC = 214 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-472 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1905 = TCCCGATCAACACCTA-1

using 770 reads

====================================================================================

graph has 304 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 759]
surviving nonsolo ucounts = 1[759]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=326]
0-71 ==> 5666-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
23-71 ==> 0-48 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
66-153 ==> 264-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=5) [SHIFT!]
151-190 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
190-326 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQGNSFPYTF at 129, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 746
start codons at 23, 29, 232
confident = false
not full
frameshifted full length stopped transcript of length 326
VJ delta = 236
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1906 = TCCCGATCAAGACGTG-1

using 270 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode TCCCGATCAAGACGTG-1 contig 1 = GTCAGTCTCA...
umi CCCACATGAC = 260 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1910 = TCCCGATCACACGCTG-1

using 265 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 8, 249]
surviving nonsolo ucounts = 1[249]
ids = [6]

====================================================================================

UMI info for barcode TCCCGATCACACGCTG-1 contig 1 = GTGGGGTCTC...
umi TTAATTCTTC = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=522]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-522 ==> 0-94 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1917 = TCCCGATCACCAGGTC-1

using 390 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 181, 198]
surviving nonsolo ucounts = 2[181, 198]
ids = [4, 6]

====================================================================================

UMI info for barcode TCCCGATCACCAGGTC-1 contig 1 = AGCTCAGGAA...
umi GTCATTTACC = 168 reads: +388 validated

UMI info for barcode TCCCGATCACCAGGTC-1 contig 2 = GCTACAACAG...
umi TAAAGCCTCC = 184 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=592]
0-33 ==> 53-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
33-386 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=6)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
421-592 ==> 0-171 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSNWVF at 360, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 33, 96, 187, 238, 370
confident = false

TIG 2[bases=492]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
428-492 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYYSTPRTF at 367, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1927 = TCCCGATCAGATGGGT-1

using 401 reads

====================================================================================

graph has 634 edges initially, 4 edges after simplification

total ucounts = 200
nonsolo ucounts = 83[2^39, 3^18, 4^7, 5^8, 6^6, 7^2, 8, 10, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1934 = TCCCGATCATACTACG-1

using 430 reads

====================================================================================

graph has 192 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 188, 236]
surviving nonsolo ucounts = 2[188, 236]
ids = [3, 6]

====================================================================================

UMI info for barcode TCCCGATCATACTACG-1 contig 1 = AGCTCTGAGA...
umi CAGCTGTTTG = 185 reads: +424 validated
umi TTCATCATGG = 231 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-593 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 56 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 409
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1937 = TCCCGATCATCACGAT-1

using 2869 reads

====================================================================================

graph has 2732 edges initially, 24 edges after simplification

total ucounts = 636
nonsolo ucounts = 321[2^139, 3^62, 4^49, 5^22, 6^14, 7^9, 8^6, 9^4, 10^3, 11^2, 12, 13, 17, 28, 59, 135, 137, 176, 238, 284, 401]
surviving nonsolo ucounts = 8[28, 59, 135, 137, 176, 238, 284, 401]
ids = [581, 45, 92, 425, 557, 418, 547, 347]

====================================================================================

UMI info for barcode TCCCGATCATCACGAT-1 contig 1 = AGCTCTGAGA...
umi ACAATAAGGC = 54 reads: +356 -1 +6 -1X +1 -1X +1 -5X +2 -2X +39 invalidated
umi AGCCACGTCT = 127 reads: +415 validated
umi GTAAATGTTC = 238 reads: +415 validated
umi TCTCCTGTAT = 278 reads: +415 validated
umi TGGTTGTGCG = 27 reads: +264 -2 +19 -1 +78 -51 non-validated

UMI info for barcode TCCCGATCATCACGAT-1 contig 2 = AGGAGTCAGA...
umi GAGGTTAAGG = 401 reads: +388 validated
umi GTATGCGTTG = 139 reads: +388 validated
umi TGATGCGTCG = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
445-494 ==> 0-49 on |52|IGHJ3|J-REGION| [len=49] (mis=5)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 71 reads
cdr3 = CARDLGGSGLFDIW at 421, score = 9 + 8
umis assigned: [45, 92, 418, 547, 581]
of which 5 are surviving nonsolos
reads assigned: 715
start codons at 79, 235, 382, 475
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 105 reads
cdr3 = CQQYNSYSWTF at 354, score = 8 + 8
umis assigned: [347, 425, 557]
of which 3 are surviving nonsolos
reads assigned: 705
start codons at 27, 33, 89, 102, 334, 457
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATCTAGGGGGGTCCGGACTCTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1940 = TCCCGATCATCCCACT-1

using 290 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 1[290]
ids = [0]

====================================================================================

UMI info for barcode TCCCGATCATCCCACT-1 contig 1 = GATCAGGACT...
umi AAACCAACCC = 274 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=485]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-485 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1946 = TCCCGATCATTCCTGC-1

using 837 reads

====================================================================================

graph has 324 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 5[2^2, 4, 326, 490]
surviving nonsolo ucounts = 2[326, 490]
ids = [2, 9]

====================================================================================

UMI info for barcode TCCCGATCATTCCTGC-1 contig 1 = GCTGGGGTCT...
umi AATGGTTATC = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=597]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-597 ==> 0-168 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 41, 249, 348, 375, 390
confident = false

REJECT CONTIGS

TIG 1[bases=526]
13-289 ==> 101-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=26)
318-366 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=8)
366-526 ==> 0-160 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
cdr3 = CASRVPIVGATVGVLFDSW at 278, score = 9 + 6
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 485
start codons at 420, 439
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1947 = TCCCGATCATTGAGCT-1

using 1044 reads

====================================================================================

graph has 1319 edges initially, 35 edges after simplification

total ucounts = 447
nonsolo ucounts = 198[2^70, 3^44, 4^26, 5^20, 6^14, 7^7, 8^6, 9^5, 11^2, 12, 13, 19, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1956 = TCCCGATGTAGATTAG-1

using 8837 reads

====================================================================================

graph has 3566 edges initially, 60 edges after simplification

total ucounts = 351
nonsolo ucounts = 197[2^56, 3^36, 4^19, 5^18, 6^15, 7^5, 8^2, 9, 10^2, 12, 13, 20, 42, 62, 67, 111, 134^2, 135, 143, 148, 159, 160, 165, 166, 174^2, 177, 180, 183, 187, 188, 202, 207^2, 211, 216, 230, 239, 241, 242, 249, 254, 266, 271, 279, 286, 288, 310, 312, 322, 361]
surviving nonsolo ucounts = 41[20, 42, 62, 67, 111, 134^2, 135, 143, 148, 159, 160, 165, 166, 174^2, 177, 180, 183, 187, 188, 202, 207^2, 211, 216, 230, 239, 241, 242, 249, 254, 266, 271, 279, 286, 288, 310, 312, 322, 361]
ids = [150, 81, 167, 193, 7, 142, 212, 8, 293, 253, ...]

====================================================================================

UMI info for barcode TCCCGATGTAGATTAG-1 contig 1 = AGATTAGGAT...
umi AAAGTCGGCT = 110 reads: +388 validated
umi AAAGTGGTTA = 137 reads: +388 validated
umi AACATTGGGT = 291 reads: +388 validated
umi AGGTAGATTC = 31 reads: -317X +1 -2X +1 -14X +4 -2XX +1 -9XX +37 invalidated
umi ATATATGTCG = 243 reads: +388 validated
umi CCGACACAGC = 185 reads: +388 validated
umi CCGTACTTGG = 35 reads: -320 +1 -14XX +4 -2XX +1 -9XX +37 invalidated
umi CCTCTTTCAT = 207 reads: +388 validated
umi CGCTGACCTT = 60 reads: +388 validated
umi CGGGCTTCCT = 240 reads: +185 -1XX +202 invalidated
umi GATATATCAA = 173 reads: +388 validated
umi GCGGGCAACA = 202 reads: +388 validated
umi GTACAAGATG = 180 reads: +388 validated
umi TAAACCAATA = 146 reads: +388 validated
umi TAAAGTGCTG = 160 reads: +388 validated
umi TACATGTCGT = 172 reads: +388 validated
umi TGCGAACATT = 277 reads: +388 validated
umi TTAACGCGGT = 208 reads: +388 validated

UMI info for barcode TCCCGATGTAGATTAG-1 contig 2 = GGGAGCATCA...
umi AATATGCAGG = 167 reads: +433 validated
umi AGACGAGCTC = 270 reads: +411 -22 non-validated
umi AGACTATCTG = 274 reads: +433 validated
umi AGAGCAGGGC = 36 reads: +270 -28 +135 non-validated
umi AGTATGAGGG = 253 reads: +433 validated
umi ATGCCGCTTG = 189 reads: +433 validated
umi CATGACCTCC = 130 reads: +418 -1 +14 non-validated
umi CATGGTAGGG = 212 reads: +433 validated
umi CCGGCGGGAT = 2 reads: -363 +46 -1X +23 invalidated
umi CGTCTTGGTC = 222 reads: +433 validated
umi GCCACCTCAT = 129 reads: +433 validated
umi GCGTTGACTC = 251 reads: +431 -2 non-validated
umi GTTAGGCGCG = 237 reads: +433 validated
umi TAGACGGGCG = 146 reads: +433 validated
umi TCTAACTCGT = 144 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=668]
69-420 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
419-457 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
457-668 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 499 reads
cdr3 = CSSYTSSSTVVF at 393, score = 8 + 8
umis assigned: [7, 8, 15, 98, 116, 149, 153, 155, 167, 170] and 8 others
of which 18 are surviving nonsolos
reads assigned: 2999
start codons at 25, 69, 226, 270, 277, 280
confident = true

TIG 2[bases=568]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=1)
417-448 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
436-497 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=5)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 171 reads
cdr3 = CARDSYCSGGSCYSYYMDVW at 406, score = 8 + 7
umis assigned: [31, 77, 80, 81, 101, 129, 142, 143, 150, 173] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2612
start codons at 64, 220, 262, 267, 299, 328, 361, 454
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGAGACTCATATTGTAGTGGTGGTAGCTGCTACTCATACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1963 = TCCCGATGTCACACGC-1

using 253 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 243]
surviving nonsolo ucounts = 1[243]
ids = [1]

====================================================================================

UMI info for barcode TCCCGATGTCACACGC-1 contig 1 = GGCTCAGCCT...
umi CATTACTTAC = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
124-475 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
474-512 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
512-570 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYRRPITF at 451, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 15, 36, 75, 124, 130, 186, 199, 335, 434, 554
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1974 = TCCCGATGTCGCATCG-1

using 339 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 4, 333]
surviving nonsolo ucounts = 1[333]
ids = [0]

====================================================================================

UMI info for barcode TCCCGATGTCGCATCG-1 contig 1 = GGAGGAACTG...
umi GATAAGTCAT = 335 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRANWPPTF at 355, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1985 = TCCCGATGTGCACCAC-1

using 56 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 1[56]
ids = [0]

====================================================================================

UMI info for barcode TCCCGATGTGCACCAC-1 contig 1 = GGTGCTTTCT...
umi TACTGGCCGC = 56 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=485]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
453-485 ==> 0-32 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARAHGDYYTLLDCW at 377, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 17, 38, 82, 168, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1990 = TCCCGATGTGCTTCTC-1

using 505 reads

====================================================================================

graph has 242 edges initially, 12 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[4, 5, 8, 188, 295]
surviving nonsolo ucounts = 3[5, 188, 295]
ids = [6, 9, 0]

====================================================================================

UMI info for barcode TCCCGATGTGCTTCTC-1 contig 1 = ACCCAAAAAC...
umi CGACACGGCT = 5 reads: -131 +3 -1X +4 -2X +4 -1X +1 -2X +2 -4X +3 -4XX +42 -4XX +2 -2X +1 -176X +1 -4XX +1 -1XX +3 -3XX +6 -1XX +1 -1XX +2 -1XX +3 -3XX +16 invalidated
umi TTAGCTAGTG = 184 reads: +436 validated

UMI info for barcode TCCCGATGTGCTTCTC-1 contig 2 = GCTCTGCTTC...
umi ACATCCACGT = 298 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-566 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6, 9]
of which 2 are surviving nonsolos
reads assigned: 185
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1991 = TCCCGATGTGGAAAGA-1

using 11030 reads

====================================================================================

graph has 4148 edges initially, 50 edges after simplification

total ucounts = 358
nonsolo ucounts = 158[2^48, 3^27, 4^6, 5^15, 6^7, 7^5, 8^3, 9^4, 10, 11, 16, 28, 67, 74, 98, 109, 118, 124, 129, 136, 153, 157, 176, 185, 194, 216, 238, 252, 259, 264, 265, 268, 278^2, 284, 285, 296, 302, 309, 313, 315, 316, 318, 323, 338^2, 385, 419, 439, 664, 670]
surviving nonsolo ucounts = 39[28, 67, 74, 98, 109, 118, 129, 136, 153, 157, 176, 185, 194, 216, 238, 252, 259, 264, 265, 268, 278^2, 284, 285, 296, 302, 309, 313, 315, 316, 318, 323, 338^2, 385, 419, 439, 664, 670]
ids = [193, 54, 43, 184, 235, 299, 138, 310, 2, 72, ...]

====================================================================================

UMI info for barcode TCCCGATGTGGAAAGA-1 contig 1 = GGAGCTGCAA...
umi AGAATTACAT = 278 reads: +379 validated
umi AGATTACTCA = 266 reads: +379 validated
umi CAAAAACCCT = 425 reads: +379 validated
umi CACAGTTTCG = 220 reads: +379 validated
umi CGACTGTTCG = 295 reads: +379 validated
umi CGGCACCCTG = 313 reads: +379 validated
umi GATGCTTGCT = 666 reads: -179X +1 -2X +1 -4X +192 invalidated
umi GCCTCGAGTA = 96 reads: +379 validated
umi GTTTTCAGCG = 315 reads: +379 validated
umi TAATCCCCTT = 111 reads: +379 validated
umi TAGCCCTCCT = 187 reads: +379 validated
umi TCCTATCCCA = 314 reads: +379 validated
umi TCTCTTACGC = 339 reads: +379 validated
umi TGATTAGAAA = 134 reads: +379 validated
umi TGTTCTGCAG = 437 reads: +379 validated
umi TTATGAGGCC = 394 reads: +379 validated
umi TTTTGCATCG = 315 reads: +379 validated

UMI info for barcode TCCCGATGTGGAAAGA-1 contig 2 = GAGCTACAAC...
umi AGAGTCCCCA = 259 reads: +403 validated
umi CACCTTAGTG = 299 reads: +403 validated
umi CAGGGTCATA = 149 reads: +403 validated
umi CTACTACGGG = 322 reads: +403 validated
umi CTGATGCTTC = 282 reads: +403 validated
umi CTTGCTTCTG = 340 reads: +403 validated
umi GAAAGACCCC = 282 reads: +403 validated
umi GACTCTTAGA = 266 reads: +403 validated
umi TGATTTAGGA = 287 reads: +403 validated
umi TTAGTTATTG = 255 reads: +403 validated
umi TTTGCTACCG = 172 reads: +403 validated

UMI info for barcode TCCCGATGTGGAAAGA-1 contig 3 = GGGAGCATCA...
umi ACACATAGCA = 155 reads: +44 -1XX +385 invalidated
umi ATCCCAGCGT = 73 reads: +358 -1 +7 -1 +8 -55 non-validated
umi ATTTAACCCC = 67 reads: +430 validated
umi CTAGTCTTAT = 130 reads: +430 validated
umi GCGTCCTGGT = 27 reads: -1 +8 -1 +5 -1 +342 -72 non-validated
umi GGTGGACCGG = 315 reads: +430 validated
umi GTCAGTGTAT = 240 reads: +430 validated
umi TCAGTGTTAC = 174 reads: +430 validated
umi TCTGTATCAT = 119 reads: +400 -1 +2 -1 +2 -1 +19 -4 non-validated
umi TTAGCTCATG = 261 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=647]
132-480 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
473-511 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
511-647 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 787 reads
cdr3 = CQQYGSSLF at 456, score = 9 + 7
umis assigned: [25, 29, 56, 64, 120, 126, 172, 184, 232, 235] and 7 others
of which 17 are surviving nonsolos
reads assigned: 5012
start codons at 37, 77, 132, 340, 466, 553
confident = true

TIG 2[bases=569]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 345 reads
cdr3 = CQQYYSTPPLTF at 369, score = 9 + 9
umis assigned: [27, 69, 72, 136, 152, 154, 161, 167, 311, 334] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2870
start codons at 30, 99, 352, 475
confident = true

TIG 3[bases=565]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
410-437 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 101 reads
cdr3 = CARNMVRGVIITPLFFDYW at 406, score = 8 + 7
umis assigned: [2, 43, 54, 138, 193, 206, 218, 271, 299, 333]
of which 10 are surviving nonsolos
reads assigned: 1539
start codons at 64, 220, 262, 267, 299, 328, 361, 418
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1996 = TCCCGATGTGTTTGTG-1

using 65 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[65]
surviving nonsolo ucounts = 1[65]
ids = [0]

====================================================================================

UMI info for barcode TCCCGATGTGTTTGTG-1 contig 1 = TGGTGATCAG...
umi TATACCCCTT = 63 reads: +388 -2 +10 non-validated

GOOD CONTIGS

TIG 1[bases=446]
0-32 ==> 47-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
32-385 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=49)
398-432 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARRSPPYW at 374, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 32, 85, 188, 249, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1997 = TCCCGATGTTAAAGAC-1

using 353 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[13, 339]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=494]
1-59 ==> 4685-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
415-446 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=1)
450-494 ==> 0-44 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
cdr3 = CARAYYDFWSGYYNWVYFDYW at 404, score = 9 + 7
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 295
start codons at 15, 59, 103
confident = false
VJ delta = 0
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.1998 = TCCCGATGTTATCCGA-1

using 499 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 223, 267]
surviving nonsolo ucounts = 2[223, 267]
ids = [0, 3]

====================================================================================

UMI info for barcode TCCCGATGTTATCCGA-1 contig 1 = GAGAAGAGCT...
umi AAAAGGCGCT = 223 reads: +388 validated

UMI info for barcode TCCCGATGTTATCCGA-1 contig 2 = GGGCACAAGA...
umi CAGGTGAGAT = 257 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGGSPPTTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 35, 243, 369, 465
confident = false

TIG 2[bases=480]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-391 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-480 ==> 0-51 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 359, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 35, 189, 192, 243, 342, 369, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2038 = TCCCGATTCCGATATG-1

using 215 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode TCCCGATTCCGATATG-1 contig 1 = GGGGGTCTCA...
umi TAACACCTTC = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=578]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
427-578 ==> 0-151 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTWVF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2039 = TCCCGATTCCGCATCT-1

using 14 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2046 = TCCCGATTCCTGCAGG-1

using 230 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 223]
surviving nonsolo ucounts = 1[223]
ids = [3]

====================================================================================

UMI info for barcode TCCCGATTCCTGCAGG-1 contig 1 = ATACTTTCTG...
umi CTGTGTTGCG = 220 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=579]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=30)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=9)
479-579 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CARDRGGYYDPLTGFSQRTGFDSW at 376, score = 8 + 5
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 37, 81, 182, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2047 = TCCCGATTCCTTTCTC-1

using 256 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[6, 244]
surviving nonsolo ucounts = 1[244]
ids = [2]

====================================================================================

UMI info for barcode TCCCGATTCCTTTCTC-1 contig 1 = AACAACCACA...
umi GATATTGCCC = 245 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=530]
0-51 ==> 7-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
51-404 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=7)
436-499 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
499-530 ==> 0-31 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGGWATGTTGLEKGYYYYAMDVW at 393, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 51, 111, 202, 249, 286, 315, 348, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2050 = TCCCGATTCGATAGAA-1

using 876 reads

====================================================================================

graph has 452 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 868]
surviving nonsolo ucounts = 1[868]
ids = [5]

====================================================================================

UMI info for barcode TCCCGATTCGATAGAA-1 contig 1 = AGAGAGGTGC...
umi TCTCCGCTAT = 868 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=573]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
432-453 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=0)
454-502 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
502-573 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CARNPTGYSSGWYSFFDYW at 414, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 845
start codons at 72, 228, 349, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2053 = TCCCGATTCGCCAAAT-1

using 1464 reads

====================================================================================

graph has 1737 edges initially, 8 edges after simplification

total ucounts = 488
nonsolo ucounts = 210[2^92, 3^49, 4^23, 5^19, 6^9, 7^5, 8, 9^5, 10, 12, 13^4, 452]
surviving nonsolo ucounts = 1[452]
ids = [154]

====================================================================================

REJECT CONTIGS

TIG 1[bases=487]
1-311 ==> 35-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
312-351 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=8)
351-487 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWPPYPF at 287, score = 9 + 6
umis assigned: [154]
of which 1 are surviving nonsolos
reads assigned: 444
start codons at 171, 174, 393
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2055 = TCCCGATTCGCTTGTC-1

using 269 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2, 3^2, 251]
surviving nonsolo ucounts = 1[251]
ids = [13]

====================================================================================

UMI info for barcode TCCCGATTCGCTTGTC-1 contig 1 = AGGAGTCAGA...
umi TTAGTTTCAG = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-516 ==> 0-101 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 89, 102, 184, 187, 457, 502
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2059 = TCCCGATTCGGTCTAA-1

using 1279 reads

====================================================================================

graph has 332 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 366, 906]
surviving nonsolo ucounts = 2[366, 906]
ids = [3, 1]

====================================================================================

UMI info for barcode TCCCGATTCGGTCTAA-1 contig 1 = TGGGGAGGAA...
umi GAGACGTACG = 364 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNNWPWTF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 37, 106, 242, 461
confident = false

REJECT CONTIGS

TIG 1[bases=320]
20-77 ==> 296-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=2)
126-160 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
160-320 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 66, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 892
start codons at 21, 214
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2061 = TCCCGATTCGTACCGG-1

using 285 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

UMI info for barcode TCCCGATTCGTACCGG-1 contig 1 = ATCAGACCCA...
umi CCTCATGGGC = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-23 ==> 4-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
379-411 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-477 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYPPTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2076 = TCCCGATTCTGTTGAG-1

using 324 reads

====================================================================================

graph has 124 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 147, 168]
surviving nonsolo ucounts = 2[147, 168]
ids = [4, 3]

====================================================================================

UMI info for barcode TCCCGATTCTGTTGAG-1 contig 1 = AGCTCAGCTT...
umi GACGGAGAGG = 163 reads: +388 validated
umi GGCTCTATAT = 142 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-569 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 69 reads
cdr3 = CASWDDSLRGRVF at 373, score = 8 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 302
start codons at 52, 206, 356, 381, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2077 = TCCCGATTCTGTTTGT-1

using 8699 reads

====================================================================================

graph has 4845 edges initially, 56 edges after simplification

total ucounts = 1076
nonsolo ucounts = 489[2^190, 3^108, 4^60, 5^37, 6^18, 7^14, 8^12, 9^6, 10^3, 11^2, 13^2, 15, 19, 20, 33, 43, 56, 67^2, 90, 92, 110, 117, 125, 145, 147^2, 149, 150, 155, 171, 191, 194, 208, 215, 223, 226, 227, 232, 242, 243, 265, 276, 306, 307, 313, 379, 584]
surviving nonsolo ucounts = 32[43, 56, 67, 90, 92, 110, 117, 125, 145, 147^2, 149, 150, 155, 171, 191, 194, 208, 215, 223, 226, 227, 232, 242, 243, 265, 276, 306, 307, 313, 379, 584]
ids = [699, 693, 419, 766, 859, 941, 186, 897, 742, 14, ...]

====================================================================================

UMI info for barcode TCCCGATTCTGTTTGT-1 contig 1 = CTCTGGGGAG...
umi AGGATTCCTA = 383 reads: +391 validated
umi CAACGGCGGT = 196 reads: +391 validated
umi GAAAGGTGTA = 215 reads: +391 validated
umi GATTTATTGC = 146 reads: +391 validated
umi GCCCCTAATG = 225 reads: +391 validated
umi GGATAGTCCA = 225 reads: +391 validated
umi GTGAATACTG = 54 reads: +391 validated
umi TACTACTACC = 144 reads: +391 validated
umi TCGTATACTC = 225 reads: +391 validated
umi TCTACCATCC = 193 reads: +391 validated
umi TGGTCATCAA = 173 reads: +391 validated
umi TGTAACTGTC = 328 reads: -357X +1 -1XX +1 -2XX +1 -4XX +1 -3XX +1 -10XX +1 -1XX +1 -4XX +1 -1XX invalidated
umi TGTCACCCTG = 111 reads: +391 validated
umi TTTACTCCAG = 264 reads: +391 validated

UMI info for barcode TCCCGATTCTGTTTGT-1 contig 2 = AGCTCTCAGA...
umi AACATCATAG = 150 reads: +400 validated
umi ACGTAATTGC = 316 reads: +400 validated
umi AGCAATCCGC = 158 reads: +400 validated
umi AGTTTGGGCG = 116 reads: +400 validated
umi ATACGTGGAA = 242 reads: +400 validated
umi CAAAATTGCG = 276 reads: +400 validated
umi CACGTCACGC = 233 reads: +400 validated
umi CATAACTTTG = 145 reads: +400 validated
umi CGCCATGAGA = 69 reads: +257 -1XX +142 invalidated
umi GCTTTGTGCT = 243 reads: +400 validated
umi TAGAGTCTGG = 307 reads: +400 validated
umi TAGTCGTTCA = 89 reads: +400 validated
umi TCGGAGACTG = 91 reads: +400 validated
umi TGAGCACTTA = 125 reads: +400 validated
umi TGTTATTCCT = 147 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=620]
18-368 ==> 0-350 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=30)
371-409 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
409-620 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 467 reads
cdr3 = CQTWGTTAVF at 351, score = 8 + 8
umis assigned: [152, 278, 534, 578, 592, 627, 693, 742, 862, 867] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2837
start codons at 18, 179, 219, 232, 235, 334
confident = true

TIG 2[bases=639]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=49)
445-479 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
479-639 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 15 umis using 326 reads
cdr3 = CARRSPPYW at 421, score = 9 + 7
umis assigned: [14, 109, 138, 186, 196, 273, 292, 317, 419, 621] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2665
start codons at 79, 132, 235, 296, 382, 533
confident = true

REJECT CONTIGS

TIG 1[bases=306]
1-78 ==> 249-326 on rc of segment before IGHJ3 exon 1 [len=326] (mis=1)
76-124 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
124-306 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [450, 1074]
of which 2 are surviving nonsolos
reads assigned: 504
start codons at 56, 71
confident = false
did not find CDR3
now this is a cell
paired!

CAAATGGACAGCCTGACAAACGAGGACACGGCTGTTTATTTCTGTGCGAGAAGGAGTCCGCCTTATTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCTCCAGACTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACTTGGGGCACCACAGCGGTGTTCGGTGGAGGGACCAAGCTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2083 = TCCCGATTCTTTAGGG-1

using 497 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 5, 483]
surviving nonsolo ucounts = 1[483]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=524]
0-81 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-304 ==> 0-270 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=3)
304-393 ==> 271-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
430-524 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQTTHWPPTF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 464
start codons at 34, 67, 95, 103, 191, 352, 372, 472
confident = false
not full
frameshifted full length stopped transcript of length 524
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2084 = TCCCGATTCTTTAGTC-1

using 297 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 3, 283]
surviving nonsolo ucounts = 1[283]
ids = [9]

====================================================================================

UMI info for barcode TCCCGATTCTTTAGTC-1 contig 1 = TGGGGGATCA...
umi TCTCTTCCGT = 268 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=472]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-472 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CMQALQTPPTF at 371, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 35, 68, 104, 192, 354, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2090 = TCGAGGCAGACCACGA-1

using 79 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[79]
surviving nonsolo ucounts = 1[79]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2092 = TCGAGGCAGAGACTAT-1

using 64 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 9[2^2, 3^2, 5, 9, 12^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2093 = TCGAGGCAGAGCTATA-1

using 205 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [0]

====================================================================================

UMI info for barcode TCGAGGCAGAGCTATA-1 contig 1 = ATCACATAAC...
umi ACTATCACCG = 186 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=553]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
420-451 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=4)
446-494 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
494-553 ==> 0-59 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRLSYYYDSSGYYPLDYW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 58, 209, 256, 355, 428, 512
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2100 = TCGAGGCAGATGGGTC-1

using 197 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 6, 185]
surviving nonsolo ucounts = 1[185]
ids = [1]

====================================================================================

UMI info for barcode TCGAGGCAGATGGGTC-1 contig 1 = AGGAGTCAGT...
umi CGCAACTCCT = 188 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2111 = TCGAGGCAGGATGGTC-1

using 126 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 120]
surviving nonsolo ucounts = 1[120]
ids = [2]

====================================================================================

UMI info for barcode TCGAGGCAGGATGGTC-1 contig 1 = GTCAGACTCA...
umi CATGATCTAA = 109 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=442]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-442 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 23, 29, 85, 98, 234, 237, 330, 360
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2123 = TCGAGGCCAAACTGTC-1

using 9154 reads

====================================================================================

graph has 4058 edges initially, 26 edges after simplification

total ucounts = 667
nonsolo ucounts = 230[2^91, 3^45, 4^12, 5^6, 6^4, 8^3, 9, 10^2, 11^2, 29, 38, 48, 50, 56, 69^2, 72^2, 81, 83, 86^2, 89, 96, 97, 103^2, 105, 107, 108^2, 112^2, 114, 117, 121, 122, 123^2, 124, 125, 127, 131^2, 132, 133, 134^2, 136, 141, 142^2, 144, 145, 146^2, 147, 152, 156, 162, 165, 166, 170^2, 175^3, 177, 187, 191, 242, 297, 304]
surviving nonsolo ucounts = 62[29, 48, 50, 69^2, 72^2, 81, 83, 86^2, 89, 96, 97, 103^2, 105, 107, 108^2, 112^2, 114, 117, 121, 122, 123^2, 124, 125, 127, 131^2, 132, 133, 134^2, 136, 141, 142^2, 144, 145, 146^2, 147, 152, 156, 162, 165, 166, 170^2, 175^3, 177, 187, 191, 242, 297, 304]
ids = [209, 503, 288, 178, 401, 164, 565, 380, 49, 5, ...]

====================================================================================

UMI info for barcode TCGAGGCCAAACTGTC-1 contig 1 = TGGGGAGGAG...
umi AAGACCTGCT = 103 reads: +382 validated
umi AAGTCATCGG = 139 reads: +382 validated
umi AATAGCGCTA = 463 reads: +244 -1XX +9 -2XX +1 -6XX +1 -118XX invalidated
umi ACTCATTGGT = 147 reads: +382 validated
umi AGAAGGTTGG = 131 reads: +382 validated
umi AGAGTCCGTC = 145 reads: +382 validated
umi AGCTACTGGC = 127 reads: +382 validated
umi ATATATCGCA = 108 reads: -2 +380 non-validated
umi ATTCCGGGGA = 84 reads: +382 validated
umi CACGTCGTAC = 143 reads: +382 validated
umi CAGAGCTCAT = 73 reads: +359 -1 +22 non-validated
umi CAGCAAACTT = 101 reads: +382 validated
umi CAGCCCCGAC = 108 reads: +382 validated
umi CAGGGTATAT = 133 reads: +382 validated
umi CCCTCAGGGC = 124 reads: +382 validated
umi CCGTCATTTC = 111 reads: +343 -12 +4 -1 +2 -1 +19 non-validated
umi CCTTCACTAA = 163 reads: +382 validated
umi CGCGATTGCA = 122 reads: +382 validated
umi CGGCCTTCAT = 142 reads: +382 validated
umi CGTACCGTTC = 106 reads: +382 validated
umi CGTCCGCCTC = 122 reads: +382 validated
umi CTCACCGGGC = 135 reads: +382 validated
umi CTGCTTTGCG = 205 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -2XX +1 -47X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi GAAGCTTGTC = 176 reads: +382 validated
umi GACCTCTTCG = 145 reads: +382 validated
umi GCGCTAAGTA = 121 reads: +382 validated
umi GCGTCTCGCG = 155 reads: +382 validated
umi GCGTGATATC = 137 reads: +382 validated
umi GGGAAACGGT = 247 reads: -116 +266 non-validated
umi GGGTATAGTC = 111 reads: +382 validated
umi GTACTATACG = 71 reads: +382 validated
umi GTCCTGTGTT = 172 reads: +382 validated
umi GTGTCGCTAC = 120 reads: +382 validated
umi TAATTAGGCG = 171 reads: +382 validated
umi TACTACGCAC = 105 reads: +382 validated
umi TCAAAAACCC = 124 reads: +382 validated
umi TCCCCCTCAG = 177 reads: +382 validated
umi TCGATATGCC = 167 reads: +382 validated
umi TCTACGTGCG = 173 reads: +382 validated
umi TCTGGTCGGC = 130 reads: +382 validated
umi TGAAGTGTCC = 193 reads: +382 validated
umi TGAATTGCTC = 96 reads: +382 validated
umi TTAGTAGCGC = 144 reads: +343 -3 +4 -1 +31 non-validated
umi TTGCTCACGA = 166 reads: +382 validated
umi TTTTTACCCC = 164 reads: +382 validated
umi TTTTTTTATA = 148 reads: +382 validated

UMI info for barcode TCGAGGCCAAACTGTC-1 contig 2 = CTCAGAGAGG...
umi AAACCACGAG = 113 reads: +430 validated
umi AAAGAGTTCC = 86 reads: +430 validated
umi ACAATGTATC = 76 reads: -430 non-validated
umi ATCGTCTAAG = 86 reads: +430 validated
umi CAACGTTCTC = 73 reads: +428 -2 non-validated
umi CCGACCGATG = 28 reads: -25 +1 -1 +172 -1 +185 -45 non-validated
umi CGCGTGCAAT = 151 reads: -430 non-validated
umi CTTCGTTCTA = 49 reads: +380 -10 +4 -1 +35 non-validated
umi GGGCCCCTCG = 81 reads: +430 validated
umi GGTGTCCCAG = 132 reads: +430 validated
umi GTTATTGATC = 128 reads: +430 validated
umi TCATCGTACA = 49 reads: +430 validated
umi TCATTAACAT = 97 reads: +430 validated
umi TGCAGTGCTG = 73 reads: +389 -36 +5 non-validated
umi TTATGCTGGA = 288 reads: -386X +1 -3XX +3 -2XX +6 -1XX +2 -1XX +2 -1XX +3 -2XX +17 invalidated

GOOD CONTIGS

TIG 1[bases=556]
38-286 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 42 umis using 950 reads
cdr3 = CLHYDNRRRTF at 359, score = 9 + 8
umis assigned: [31, 37, 39, 77, 86, 92, 98, 125, 154, 173] and 36 others
of which 46 are surviving nonsolos
reads assigned: 6356
start codons at 38, 94, 107, 246, 369, 462
confident = true

TIG 2[bases=665]
0-75 ==> 4-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
75-428 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=37)
459-505 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
505-665 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 8 umis using 96 reads
cdr3 = CARESYVGLYSSTSYPDYW at 417, score = 8 + 7
umis assigned: [3, 5, 49, 132, 164, 209, 237, 288, 380, 393] and 5 others
of which 15 are surviving nonsolos
reads assigned: 1485
start codons at 75, 224, 231, 310, 352, 378, 433, 559
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2140 = TCGAGGCCACGCTTTC-1

using 249 reads

====================================================================================

graph has 272 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[249]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2142 = TCGAGGCCACTGTGTA-1

using 471 reads

====================================================================================

graph has 763 edges initially, 6 edges after simplification

total ucounts = 283
nonsolo ucounts = 106[2^70, 3^20, 4^6, 5^3, 6^2, 7^4, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2148 = TCGAGGCCAGCCTGTG-1

using 162 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[11, 149]
surviving nonsolo ucounts = 1[149]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
10-42 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
37-375 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
414-465 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 37, 42, 98, 185, 331, 335
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2149 = TCGAGGCCAGCGATCC-1

using 271 reads

====================================================================================

graph has 196 edges initially, 6 edges after simplification

total ucounts = 25
nonsolo ucounts = 20[2^4, 4^2, 5^2, 6^4, 7^3, 9, 12, 16, 71, 87]
surviving nonsolo ucounts = 2[71, 87]
ids = [10, 15]

====================================================================================

REJECT CONTIGS

TIG 1[bases=373]
0-336 ==> 27-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
334-373 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
cdr3 = CQHYYSIPPTF at 312, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 58
start codons at 42, 295
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2150 = TCGAGGCCAGGCGATA-1

using 115 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 1[115]
ids = [0]

====================================================================================

UMI info for barcode TCGAGGCCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi ATTGCTATTG = 102 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=553]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-553 ==> 0-140 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2166 = TCGAGGCGTAAGAGAG-1

using 474 reads

====================================================================================

graph has 712 edges initially, 4 edges after simplification

total ucounts = 235
nonsolo ucounts = 97[2^54, 3^18, 4^9, 5^7, 6, 7^2, 8^3, 9, 11, 39]
surviving nonsolo ucounts = 1[39]
ids = [94]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2168 = TCGAGGCGTAAGTGGC-1

using 11529 reads

====================================================================================

graph has 3797 edges initially, 28 edges after simplification

total ucounts = 341
nonsolo ucounts = 175[2^50, 3^22, 4^10, 5^5, 6^4, 7^3, 9^3, 11, 14, 15, 17^2, 28, 35, 45, 47, 50, 55^2, 59, 60, 70^2, 77, 79^2, 80, 81, 90, 96, 98, 99, 100, 107, 109, 114^4, 116, 119, 121, 122, 123, 124, 127, 128, 130, 131^2, 132, 134, 137, 140, 143, 145, 146, 149^2, 157, 162, 163^2, 165, 166, 167, 168, 169, 171, 173^2, 174, 176, 182, 193, 195, 196, 213, 218, 229, 230, 243, 248, 849, 871]
surviving nonsolo ucounts = 67[45, 47, 55, 59, 60, 70^2, 79^2, 80, 90, 96, 98, 99, 100, 107, 109, 114^4, 116, 119, 121, 122, 123, 124, 127, 128, 130, 131^2, 132, 134, 137, 140, 143, 145, 146, 149^2, 157, 162, 163^2, 165, 166, 167, 168, 169, 171, 173^2, 174, 176, 182, 193, 195, 196, 213, 218, 229, 230, 243, 248, 849, 871]
ids = [50, 171, 289, 245, 330, 155, 301, 13, 28, 5, ...]

====================================================================================

UMI info for barcode TCGAGGCGTAAGTGGC-1 contig 1 = AGGAGTCAGT...
umi AAACGATGTC = 141 reads: +388 validated
umi AAATCACAGT = 79 reads: +388 validated
umi AACTCTTTAT = 145 reads: +388 validated
umi AAGATGTTCC = 169 reads: +388 validated
umi AATTTAAGTT = 81 reads: +388 validated
umi ACAAGCTCTC = 92 reads: +388 validated
umi ACATTAGACT = 132 reads: +388 validated
umi ACTGGATAAC = 243 reads: +388 validated
umi AGTCCCTGGT = 130 reads: +2 -1 +4 -1 +380 non-validated
umi ATCACATAGC = 228 reads: +388 validated
umi ATGACTTCCT = 197 reads: +388 validated
umi ATGTTGATGA = 115 reads: +388 validated
umi ATTAAATACA = 171 reads: +388 validated
umi CAATAGCTTT = 130 reads: +388 validated
umi CACAGTTTAC = 109 reads: +388 validated
umi CACGTTATTT = 118 reads: +1 -1 +2 -1 +1 -1 +381 non-validated
umi CCCGATGGCG = 123 reads: +388 validated
umi CGACCTCCGG = 155 reads: +388 validated
umi CGTACTGTAC = 125 reads: +388 validated
umi CTCTATTAGC = 138 reads: +388 validated
umi CTCTTTATGT = 216 reads: +388 validated
umi CTGAATGACC = 131 reads: +388 validated
umi CTTCATCTAG = 129 reads: +388 validated
umi CTTTCTGCGG = 182 reads: +248 -1XX +139 invalidated
umi GAACTGTGGC = 121 reads: -13 +375 non-validated
umi GACACGTTCC = 175 reads: +388 validated
umi GACATTTCCT = 101 reads: +388 validated
umi GCACCTAGAA = 169 reads: +388 validated
umi GCCTACGATA = 216 reads: +388 validated
umi GCCTATTTAC = 160 reads: +388 validated
umi GCGACTTGGC = 120 reads: +388 validated
umi GGCGCGCAGG = 113 reads: +388 validated
umi GGGCATTTTG = 166 reads: +388 validated
umi GTAATCTTCT = 94 reads: +388 validated
umi GTATTAGGGC = 128 reads: +388 validated
umi GTCAGTTCCC = 163 reads: +388 validated
umi TAGTCTTCCC = 147 reads: +388 validated
umi TATCTGTCGG = 179 reads: +388 validated
umi TATTCTTCTG = 150 reads: +388 validated
umi TCGTCCGGTA = 233 reads: +388 validated
umi TCTCACCCGG = 166 reads: +388 validated
umi TCTGAGTGTC = 175 reads: +388 validated
umi TCTTACATAT = 100 reads: +388 validated
umi TCTTACATGG = 116 reads: +388 validated
umi TGCACGTTCT = 70 reads: +388 validated
umi TGTTCCCGCA = 137 reads: +388 validated
umi TTCTTAAAGC = 173 reads: +388 validated

UMI info for barcode TCGAGGCGTAAGTGGC-1 contig 2 = AGTGCTTTCT...
umi AACTGCCAGA = 77 reads: +354 -1 +75 -1 +1 -1 +1 -5 non-validated
umi AATGCTCTAT = 135 reads: +439 validated
umi ACACTTCTAG = 107 reads: +406 -1 +4 -1 +5 -1 +8 -1 +11 -1 non-validated
umi AGCTTTTGGT = 11 reads: +154 -6XX +2 -5XX +1 -4XX +1 -4XX +1 -4XX +1 -3X +2 -251X invalidated
umi CAAGGACCGG = 127 reads: +154 -6XX +2 -5XX +1 -4XX +1 -4XX +1 -4XX +1 -3XX +2 -251 invalidated
umi CACCCGCGTC = 162 reads: +430 -9 non-validated
umi CTCGTTTGTT = 192 reads: +439 validated
umi CTGATTGTTC = 73 reads: +439 validated
umi CTGGATGGCA = 198 reads: +426 -13 non-validated
umi CTTTTGCACA = 47 reads: +41 -1 +5 -1 +7 -2 +293 -41 +48 non-validated
umi GCCTTCGTCT = 137 reads: +154 -6XX +2 -5XX +1 -4XX +1 -4XX +1 -4XX +1 -3XX +2 -251 invalidated
umi GTTTATACTT = 111 reads: +439 validated
umi GTTTTAGATG = 58 reads: +415 -24 non-validated
umi TATGTAGTTC = 18 reads: +154 -6XX +2 -5XX +1 -4XX +1 -4XX +1 -4XX +1 -256X invalidated
umi TATGTGACTG = 51 reads: +154 -6XX +2 -5XX +1 -4XX +1 -4XX +1 -4XX +1 -3XX +2 -251XX invalidated
umi TATTTCGCTA = 124 reads: +439 validated
umi TCCTTTTACC = 148 reads: +439 validated
umi TCGCTCCCGT = 56 reads: +8 -1 +2 -1 +20 -1 +8 -1 +397 non-validated
umi TGGAAGGAAT = 171 reads: +439 validated
umi TTGGTCGTTC = 59 reads: +378 -1 +10 -1 +2 -4 +43 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=22)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 47 umis using 1114 reads
cdr3 = CQQSKISPRTF at 354, score = 9 + 8
umis assigned: [3, 5, 12, 16, 28, 30, 35, 45, 54, 62] and 37 others
of which 47 are surviving nonsolos
reads assigned: 6736
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=17)
426-456 ==> 22-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 99 reads
cdr3 = CARGSDPSSTVILDYW at 377, score = 9 + 6
umis assigned: [13, 23, 32, 50, 87, 94, 147, 155, 157, 171] and 10 others
of which 20 are surviving nonsolos
reads assigned: 2037
start codons at 17, 38, 49, 82, 168, 183
confident = true
now this is a cell
paired!

GCGGACACGGCTGTGTATTATTGTGCGAGGGGGTCTGACCCATCCAGTACAGTGATTCTTGACTATTGGAGCCAGGGCACCGTGGTCACCGTCTCCTCAG <==> ATCAACAATCTGCAACCTGAAGATTTCGCAACTTACTACTGTCAACAGAGTAAAATTTCCCCCCGAACGTTCGGCCAGGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2169 = TCGAGGCGTAAGTTCC-1

using 412 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2^2, 134, 274]
surviving nonsolo ucounts = 2[134, 274]
ids = [2, 3]

====================================================================================

UMI info for barcode TCGAGGCGTAAGTTCC-1 contig 1 = GCTCTGCTTC...
umi TCAATTTCCC = 136 reads: +379 -1 +11 non-validated
umi TTCGTGTGTC = 273 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 77 reads
cdr3 = CQSYDSSLNGSVF at 375, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 403
start codons at 51, 135, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2175 = TCGAGGCGTCAACTGT-1

using 349 reads

====================================================================================

graph has 128 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[3, 58, 130, 157]
surviving nonsolo ucounts = 3[58, 130, 157]
ids = [1, 2, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2183 = TCGAGGCGTCTCGTTC-1

using 157 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[156]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2187 = TCGAGGCGTGCTTCTC-1

using 185 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 179]
surviving nonsolo ucounts = 1[179]
ids = [1]

====================================================================================

UMI info for barcode TCGAGGCGTGCTTCTC-1 contig 1 = GGGGGGGTCT...
umi GCCCGATTCT = 168 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=528]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-364 ==> 0-323 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
397-435 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
435-528 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSFTSSGTLPYVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 41, 198, 249, 399
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2188 = TCGAGGCGTGGACGAT-1

using 137 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 1[135]
ids = [2]

====================================================================================

UMI info for barcode TCGAGGCGTGGACGAT-1 contig 1 = GGTCTGCTTC...
umi GCTTCTGATA = 128 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=491]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-491 ==> 0-46 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2189 = TCGAGGCGTGTCTGAT-1

using 154 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 142]
surviving nonsolo ucounts = 1[142]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2194 = TCGAGGCGTTATCACG-1

using 43 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^3, 3^2, 4, 5^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2196 = TCGAGGCGTTCGCTAA-1

using 549 reads

====================================================================================

graph has 742 edges initially, 6 edges after simplification

total ucounts = 224
nonsolo ucounts = 76[2^42, 3^13, 4^6, 5^4, 6^2, 8^6, 11, 18, 145]
surviving nonsolo ucounts = 1[145]
ids = [169]

====================================================================================

UMI info for barcode TCGAGGCGTTCGCTAA-1 contig 1 = AGCTCTGAGA...
umi TATACACAGA = 142 reads: +332 -1XX +91 invalidated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=19)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-593 ==> 0-90 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [169]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2197 = TCGAGGCGTTCTCATT-1

using 127 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[126]
surviving nonsolo ucounts = 1[126]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2199 = TCGAGGCTCAACACGT-1

using 423 reads

====================================================================================

graph has 487 edges initially, 10 edges after simplification

total ucounts = 213
nonsolo ucounts = 94[2^48, 3^23, 4^8, 5^5, 6^3, 7^2, 8, 10^2, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2206 = TCGAGGCTCACTTACT-1

using 196 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[195]
surviving nonsolo ucounts = 1[195]
ids = [1]

====================================================================================

UMI info for barcode TCGAGGCTCACTTACT-1 contig 1 = AATCAGTCCC...
umi TGCATTTGCA = 180 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-498 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2213 = TCGAGGCTCATAGCAC-1

using 221 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3^2, 205]
surviving nonsolo ucounts = 1[205]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=456]
0-57 ==> 44-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
0-57 ==> 3459-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=1)
0-57 ==> 3528-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=1)
57-413 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=17)
415-442 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=7)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 13, 57, 101, 423
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2215 = TCGAGGCTCATGCTCC-1

using 324 reads

====================================================================================

graph has 170 edges initially, 12 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^3, 3, 115, 193]
surviving nonsolo ucounts = 2[115, 193]
ids = [11, 5]

====================================================================================

UMI info for barcode TCGAGGCTCATGCTCC-1 contig 1 = GCTCTGCTTC...
umi CGCAACTTGT = 187 reads: +391 validated

UMI info for barcode TCGAGGCTCATGCTCC-1 contig 2 = TCCAGGAGGC...
umi TGATTCGAAG = 109 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=588]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-588 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false

TIG 2[bases=561]
0-30 ==> 13-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
30-367 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
377-415 ==> 8-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
415-561 ==> 0-146 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CQSADSSGTYPAVF at 345, score = 8 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 30, 91, 160, 178
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2234 = TCGAGGCTCTCGAGTA-1

using 175 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 165]
surviving nonsolo ucounts = 1[165]
ids = [2]

====================================================================================

UMI info for barcode TCGAGGCTCTCGAGTA-1 contig 1 = GGGAGCATCA...
umi ATAGTTTCAC = 164 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=540]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
488-540 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARSLVSYSSSWIFDYW at 406, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 64, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2244 = TCGCGAGAGACAGGCT-1

using 169 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 162]
surviving nonsolo ucounts = 1[162]
ids = [3]

====================================================================================

UMI info for barcode TCGCGAGAGACAGGCT-1 contig 1 = AGTGCTTTCT...
umi GCATGTTTCT = 134 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=470]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
408-459 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CARGPAYGDYENWFDPW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2245 = TCGCGAGAGACGCAAC-1

using 466 reads

====================================================================================

graph has 194 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 5, 7, 8, 172, 268]
surviving nonsolo ucounts = 2[172, 268]
ids = [8, 5]

====================================================================================

UMI info for barcode TCGCGAGAGACGCAAC-1 contig 1 = GAATCAGTCC...
umi GTGAGCGCAT = 173 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 25, 31, 100, 236, 455
confident = false

REJECT CONTIGS

TIG 1[bases=393]
1-220 ==> 132-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=1)
284-322 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
322-393 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CANPQLGYCTGGVCCWVTTVTTLRATGAREPWSPSPQGVHPPQPF at 211, score = 9 + 4
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 20, 25, 83, 86, 104, 172, 249
confident = false
VJ delta = 59
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2248 = TCGCGAGAGAGGTTGC-1

using 158 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[156]
surviving nonsolo ucounts = 1[156]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGAGAGGTTGC-1 contig 1 = GAGTCAGTCC...
umi TATCCCCGGT = 135 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=418]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
junction support: 1 umis using 33 reads
cdr3 = CQQYDNLPTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 25, 31, 87, 100, 239, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2251 = TCGCGAGAGATCTGAA-1

using 172 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 168]
surviving nonsolo ucounts = 1[168]
ids = [3]

====================================================================================

UMI info for barcode TCGCGAGAGATCTGAA-1 contig 1 = GGAGGAACTG...
umi GGTGCTCATG = 164 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYNNWPRTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2253 = TCGCGAGAGCAGATCG-1

using 63 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2255 = TCGCGAGAGCTTCGCG-1

using 89 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 5, 73]
surviving nonsolo ucounts = 1[73]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2257 = TCGCGAGAGGAGCGTT-1

using 4464 reads

====================================================================================

graph has 1603 edges initially, 28 edges after simplification

total ucounts = 164
nonsolo ucounts = 71[2^15, 3^4, 4^4, 5^3, 6^2, 7^2, 9, 10, 14, 16, 57, 58, 60, 64, 66^2, 69, 70, 71, 72, 81, 84, 86^2, 93^2, 96, 98^2, 111, 112, 114, 121, 122, 126, 127, 129, 135, 137, 138, 142, 153, 157, 172, 203, 274, 282]
surviving nonsolo ucounts = 37[57, 58, 60, 64, 66^2, 69, 70, 71, 72, 81, 84, 86^2, 93^2, 96, 98^2, 111, 112, 114, 121, 122, 126, 127, 129, 135, 137, 138, 142, 153, 157, 172, 203, 274, 282]
ids = [153, 50, 122, 141, 66, 161, 72, 86, 116, 43, ...]

====================================================================================

UMI info for barcode TCGCGAGAGGAGCGTT-1 contig 1 = GAGCATCACA...
umi AATATAAGCA = 282 reads: +433 validated
umi ACGCCACGAC = 205 reads: +433 validated
umi CAGTCTATCA = 130 reads: +433 validated
umi CAGTTACTGT = 71 reads: +358 -8 +52 -1X +3 -1 +1 -2 +7 invalidated
umi CGATTCTTGC = 98 reads: +431 -2 non-validated
umi CGGCCGCATG = 76 reads: +433 validated
umi CGGTAAGGCT = 66 reads: +409 -24 non-validated
umi CTGTCCTAGC = 100 reads: +433 validated
umi GGAAGCTCGA = 162 reads: -13 +2 -1XX +1 -2XX +2 -1XX +3 -1XX +2 -3XX +1 -8XX +1 -1XX +391 invalidated
umi TATCATCAAG = 123 reads: +413 -20 non-validated
umi TGCAAGGGGA = 135 reads: +433 validated
umi TGTAGTTCGG = 135 reads: +433 validated
umi TTAGTTTTGT = 57 reads: +31 -1 +309 -1 +9 -1 +1 -1 +11 -6 +62 non-validated

UMI info for barcode TCGCGAGAGGAGCGTT-1 contig 2 = ATTTGCATCA...
umi AACGGAACAG = 93 reads: +376 validated
umi AATCTTCTCG = 95 reads: +376 validated
umi AATGAATGTG = 129 reads: +376 validated
umi ACGAGCCCCT = 126 reads: +376 validated
umi ACGATTCACG = 145 reads: +376 validated
umi ACGCCATCTT = 111 reads: +376 validated
umi ATACGCCCCT = 156 reads: +376 validated
umi ATTGGCACTT = 95 reads: +376 validated
umi CCCTCCCCGG = 58 reads: +376 validated
umi CGATACTCGG = 112 reads: +376 validated
umi CTACCTGGTC = 69 reads: +376 validated
umi CTGAACGGAG = 140 reads: +376 validated
umi CTGTAGAGCA = 85 reads: +376 validated
umi CTTATGGCAC = 70 reads: +376 validated
umi CTTCAGTTAG = 90 reads: +376 validated
umi GATCGGTAAT = 81 reads: +376 validated
umi GCAAGGTCAA = 96 reads: +376 validated
umi GTTGCTTGGC = 70 reads: +376 validated
umi TAACATATTC = 66 reads: +236 -1XX +139 invalidated
umi TAGTATTACA = 98 reads: +376 validated
umi TGAGCATCGA = 64 reads: +324 -2 +5 -1 +3 -1 +1 -1 +7 -2 +2 -2 +25 non-validated
umi TTTTGGGGTA = 65 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=565]
61-414 ==> 0-353 on |86|IGHV1-69-2|L-REGION+V-REGION| [len=353] (mis=0)
445-494 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=4)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 73 reads
cdr3 = CATDQQPGNYGDYGLRFDPW at 403, score = 9 + 7
umis assigned: [3, 16, 42, 43, 62, 64, 66, 84, 103, 129] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1619
start codons at 61, 217, 259, 281, 358
confident = true

TIG 2[bases=688]
101-441 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
439-477 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
477-688 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 347 reads
cdr3 = CQAWDSSTVVF at 416, score = 6 + 8
umis assigned: [1, 5, 6, 14, 15, 17, 29, 34, 50, 61] and 12 others
of which 22 are surviving nonsolos
reads assigned: 2077
start codons at 101, 106, 162, 249, 395, 399
confident = true

REJECT CONTIGS

TIG 1[bases=367]
2-185 ==> 302-485 on rc of segment before IGHD6-25 exon 1 [len=485] (mis=1)
219-265 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
265-367 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [112, 147]
of which 2 are surviving nonsolos
reads assigned: 324
start codons at 1, 283, 344
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCAACAGATCAACAACCGGGGAACTACGGTGACTACGGTCTTCGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2258 = TCGCGAGAGGGTGTTG-1

using 135 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[132]
surviving nonsolo ucounts = 1[132]
ids = [0]

====================================================================================

UMI info for barcode TCGCGAGAGGGTGTTG-1 contig 1 = AGTGCTTTCT...
umi CAGCGCCGGG = 121 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=542]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-542 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 17, 38, 82, 168, 255, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2270 = TCGCGAGCAACTGGCC-1

using 67 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 1[67]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=391]
0-21 ==> 31-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
0-26 ==> 5629-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
21-359 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
359-391 ==> 0-32 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 21, 26, 82, 169, 315, 319
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2272 = TCGCGAGCAAGGTTTC-1

using 138 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[27, 110]
surviving nonsolo ucounts = 1[110]
ids = [2]

====================================================================================

UMI info for barcode TCGCGAGCAAGGTTTC-1 contig 1 = GGGGTGATCA...
umi CGACTAATAC = 102 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=492]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-492 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CMQALQTRETF at 371, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2274 = TCGCGAGCAATGCCAT-1

using 454 reads

====================================================================================

graph has 300 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 5^3, 9, 148, 274]
surviving nonsolo ucounts = 2[148, 274]
ids = [9, 3]

====================================================================================

UMI info for barcode TCGCGAGCAATGCCAT-1 contig 1 = CTCAGGAAGC...
umi CGTATAACAG = 252 reads: +25 -1XX +362 invalidated
umi GCCTATAGCG = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-31 ==> 55-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
31-384 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=11)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
419-543 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 80 reads
cdr3 = CQSYDISIWVF at 358, score = 6 + 8
umis assigned: [3, 9]
of which 2 are surviving nonsolos
reads assigned: 368
start codons at 31, 94, 185, 236, 242, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2275 = TCGCGAGCACAACGTT-1

using 78 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[75]
surviving nonsolo ucounts = 1[75]
ids = [2]

====================================================================================

UMI info for barcode TCGCGAGCACAACGTT-1 contig 1 = GGGACTGATC...
umi CTCTTTACAG = 64 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=446]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CMQALQTPLFTF at 372, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 36, 69, 105, 193, 355, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2281 = TCGCGAGCACCCATTC-1

using 123 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 120]
surviving nonsolo ucounts = 1[120]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGCACCCATTC-1 contig 1 = GCTCAGAAGC...
umi AACCTAGCCA = 113 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=476]
0-32 ==> 8-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
32-369 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=8)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
414-476 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CNSRDSSGNHVVF at 347, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 32, 151, 231, 330, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2282 = TCGCGAGCACCTCGTT-1

using 3534 reads

====================================================================================

graph has 1704 edges initially, 28 edges after simplification

total ucounts = 231
nonsolo ucounts = 84[2^33, 3^12, 4^6, 6, 7^2, 8^2, 9^2, 10, 15, 30, 73, 93, 101^3, 103, 108, 109^3, 120, 127, 129, 130, 156^3, 157, 167, 176, 187, 200, 284]
surviving nonsolo ucounts = 22[30, 73, 93, 101^3, 103, 108, 109^3, 127, 129, 130, 156^3, 157, 167, 176, 187, 200]
ids = [32, 195, 87, 40, 85, 202, 63, 79, 197, 198, ...]

====================================================================================

UMI info for barcode TCGCGAGCACCTCGTT-1 contig 1 = GGGCAGGAGT...
umi AAAATCAAGA = 130 reads: +391 validated
umi ACAATGCTGC = 195 reads: +391 validated
umi ACTGATATAC = 28 reads: -9 +72 -1X +115 -24 +170 invalidated
umi AGGTCGCCAC = 103 reads: +391 validated
umi ATACCGGGTA = 166 reads: +391 validated
umi ATTGATGCTT = 102 reads: +391 validated
umi CATTTTGCTG = 109 reads: +391 validated
umi CCACGGTATC = 130 reads: +391 validated
umi CCAGGCGGCT = 100 reads: +391 validated
umi CGCAATGCTT = 153 reads: +391 validated
umi CGCCCACGCT = 152 reads: +391 validated
umi CTTACTGGGA = 154 reads: +391 validated
umi GCATGTAGTA = 126 reads: +391 validated
umi GGCGAACGCA = 154 reads: +391 validated
umi TACCTACACT = 187 reads: +391 validated
umi TCCTCTTAGG = 111 reads: +391 validated
umi TCTATGCCAT = 100 reads: +1 -1 +6 -1 +382 non-validated
umi TGTCTTCTCG = 109 reads: +391 validated

UMI info for barcode TCGCGAGCACCTCGTT-1 contig 2 = CCAGCCCTGA...
umi AACATCACCA = 329 reads: -397 +1 -5XX +1 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TCCGGATCAC = 71 reads: +430 validated
umi TCCTCCGGTG = 106 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=558]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=1)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 327 reads
cdr3 = CQQYDNLPSLTF at 358, score = 9 + 9
umis assigned: [0, 23, 32, 40, 45, 63, 79, 81, 85, 99] and 8 others
of which 18 are surviving nonsolos
reads assigned: 2278
start codons at 31, 37, 93, 106, 245, 368, 464
confident = true

TIG 2[bases=674]
0-62 ==> 0-62 on |115|IGHV3-20|5'UTR| [len=62] (mis=2)
62-415 ==> 0-353 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=31)
448-492 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
492-674 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 2 umis using 17 reads
cdr3 = CARDREPLGTYYYNAMDVW at 404, score = 9 + 7
umis assigned: [10, 195, 197]
of which 2 are surviving nonsolos
reads assigned: 388
start codons at 62, 207, 213, 218, 297, 365, 449
confident = true

REJECT CONTIGS

TIG 1[bases=560]
0-37 ==> 15-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-37 ==> 5963-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
37-385 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [48, 87, 133]
of which 2 are surviving nonsolos
reads assigned: 300
start codons at 37, 245, 371, 466
confident = false
did not find CDR3
now this is a cell
paired!

GCCTTGTATTACTGTGCAAGAGATCGGGAACCGCTGGGTACTTACTACTACAACGCTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCCTCGCTCACTTTCGGCGGAGGGACCAAGGTGGACATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2290 = TCGCGAGCAGCCACCA-1

using 660 reads

====================================================================================

graph has 288 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[165, 183, 312]
surviving nonsolo ucounts = 3[165, 183, 312]
ids = [2, 1, 0]

====================================================================================

UMI info for barcode TCGCGAGCAGCCACCA-1 contig 1 = GAAGAGCTGC...
umi AGGGATATTA = 311 reads: +385 validated
umi ATCATTCATT = 183 reads: +385 validated
umi CTGATATCAC = 114 reads: -209 +1 -3X +1 -2XX +2 -1XX +1 -3XX +5 -1XX +1 -1XX +2 -2XX +4 -1XX +20 -1XX +2 -1XX +2 -1XX +5 -1XX +2 -1XX +2 -1XX +2 -1XX +1 -2XX +8 -50X +1 -1X +2 -2X +7 -1XX +3 -3XX +9 -1XX +12 invalidated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 69 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [0, 1, 2]
of which 3 are surviving nonsolos
reads assigned: 598
start codons at 33, 241, 244, 367, 460
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2291 = TCGCGAGCAGCTTAAC-1

using 134 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=444]
0-344 ==> 9-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
341-379 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
383-444 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSSPRTF at 318, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 53, 66, 202, 425
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2293 = TCGCGAGCAGTCGATT-1

using 235 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2296 = TCGCGAGCATACTACG-1

using 191 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[186]
surviving nonsolo ucounts = 1[186]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGCATACTACG-1 contig 1 = AGCTCTGAGA...
umi ACGTATTTTA = 184 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=577]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
435-462 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
458-506 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
506-577 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CARGTYYYGSGSSHFDYW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 79, 235, 382, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2297 = TCGCGAGCATCACGAT-1

using 112 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================

UMI info for barcode TCGCGAGCATCACGAT-1 contig 1 = GTTCACCTTC...
umi CGCTAACTTC = 94 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=448]
15-375 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
412-448 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQALQTPCSF at 351, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 15, 48, 84, 172, 334, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2311 = TCGCGAGCATTTGCCC-1

using 81 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[81]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2314 = TCGCGAGGTAACGTTC-1

using 258 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 98, 155]
surviving nonsolo ucounts = 3[4, 98, 155]
ids = [2, 3, 1]

====================================================================================

UMI info for barcode TCGCGAGGTAACGTTC-1 contig 1 = AGGAGTCAGT...
umi TCAATGGCTC = 98 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQSYSTPYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2320 = TCGCGAGGTCCTCTTG-1

using 154 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 150]
surviving nonsolo ucounts = 1[150]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGGTCCTCTTG-1 contig 1 = AGGAGTCAGA...
umi GTCTCTTTAC = 137 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNSYSRTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 27, 33, 89, 102, 238, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2328 = TCGCGAGGTGTTTGGT-1

using 111 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 104]
surviving nonsolo ucounts = 1[104]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2329 = TCGCGAGGTTACGTCA-1

using 770 reads

====================================================================================

graph has 1011 edges initially, 6 edges after simplification

total ucounts = 373
nonsolo ucounts = 114[2^68, 3^20, 4^10, 5^8, 6, 7, 8^3, 10, 12, 176]
surviving nonsolo ucounts = 1[176]
ids = [267]

====================================================================================

UMI info for barcode TCGCGAGGTTACGTCA-1 contig 1 = AGTCAGACTC...
umi TACCTGGCTC = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-508 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNGQSRAF at 351, score = 8 + 7
umis assigned: [267]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 24, 30, 99, 235, 238, 331, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2338 = TCGCGAGTCACCACCT-1

using 8759 reads

====================================================================================

graph has 4047 edges initially, 30 edges after simplification

total ucounts = 733
nonsolo ucounts = 266[2^105, 3^41, 4^13, 5^13, 6^8, 7^3, 8^5, 9^2, 10^3, 11, 15, 16^3, 23^2, 24, 25, 28, 29, 39, 44, 49, 51, 53, 54, 66, 69, 76, 77, 81, 85, 86, 91^3, 92, 94, 96, 98, 99, 100, 101, 102, 107, 109, 110, 111, 112, 113, 120^2, 124^3, 125^2, 126, 128^2, 131, 133, 136, 138^2, 139, 140, 143, 146, 148, 149, 150, 152, 153, 158, 160, 176, 192, 213, 236, 264, 272]
surviving nonsolo ucounts = 65[23, 25, 28, 29, 39, 49, 51, 53, 54, 66, 69, 76, 77, 81, 85, 86, 91^3, 92, 94, 96, 98, 99, 100, 101, 102, 107, 109, 110, 111, 112, 113, 120^2, 124^3, 125^2, 126, 128^2, 131, 133, 136, 138^2, 139, 140, 143, 146, 148, 149, 150, 152, 153, 158, 160, 176, 192, 213, 236, 264, 272]
ids = [368, 201, 239, 36, 34, 73, 489, 19, 528, 677, ...]

====================================================================================

UMI info for barcode TCGCGAGTCACCACCT-1 contig 1 = TGAGCGCAGA...
umi AAATGGCAAG = 128 reads: +388 validated
umi AAGAGGCCTA = 50 reads: +388 validated
umi AATCCGGGAC = 70 reads: +33 -12 +1 -1 +341 non-validated
umi AATCTCTGAA = 39 reads: +388 validated
umi AATGACAGCC = 28 reads: +255 -2 +122 -1 +8 non-validated
umi ACAAATCTGC = 136 reads: +388 validated
umi ACGCAACTAT = 154 reads: +388 validated
umi ACTGTATACC = 91 reads: +388 validated
umi ATACCTCTCT = 123 reads: +388 validated
umi ATCCGCTTAG = 162 reads: +388 validated
umi ATCTTTGTTG = 193 reads: -41X +1 -5X +341 invalidated
umi ATTATGGCTC = 134 reads: +388 validated
umi CACCCTTGGG = 25 reads: -22 +2 -1 +336 -27 non-validated
umi CACTTTTGGC = 98 reads: +7 -1 +380 non-validated
umi CATCTTTAAT = 73 reads: +40 -4XX +4 -1 +339 invalidated
umi CATGTTATAC = 101 reads: +388 validated
umi CCACCGGCCC = 28 reads: +79 -1 +215 -1 +8 -84 non-validated
umi CCGCACGATG = 142 reads: +388 validated
umi CGCAACCACC = 124 reads: +388 validated
umi CGGCTTTGGG = 147 reads: +388 validated
umi CGGGTAGCCG = 137 reads: +388 validated
umi CTATATTGTC = 127 reads: +388 validated
umi CTCCCTTTGC = 157 reads: +388 validated
umi CTGGATTAAC = 108 reads: +388 validated
umi CTGTGTGTCA = 22 reads: +191 -17 +72 -25 +83 non-validated
umi GATGATCATG = 122 reads: +388 validated
umi GATTTCCTTG = 122 reads: +388 validated
umi GCAGCGCTCA = 148 reads: +388 validated
umi GCCTCTGAAC = 152 reads: +388 validated
umi GCTCAACCAT = 74 reads: +388 validated
umi GCTTCTTTCG = 154 reads: +388 validated
umi GGCGCGCGTA = 119 reads: +388 validated
umi GGTATCAGCC = 129 reads: +388 validated
umi GTACTCTGTC = 91 reads: +388 validated
umi GTCTTAAGGG = 113 reads: +388 validated
umi GTGAACCCCT = 101 reads: +388 validated
umi GTGCACCACG = 132 reads: +388 validated
umi GTTCGTTGTG = 53 reads: +388 validated
umi TAAATTTCGC = 129 reads: +388 validated
umi TAATTGGACC = 97 reads: +388 validated
umi TAGCGCTTAA = 125 reads: +388 validated
umi TATGTTCCCG = 114 reads: +342 -1 +45 non-validated
umi TATTTTGCGG = 108 reads: +388 validated
umi TCACACGGCG = 280 reads: +388 validated
umi TCCCTGCGTC = 96 reads: +388 validated
umi TCGCGACCCT = 126 reads: +388 validated
umi TCTAAGCCTC = 89 reads: +388 validated
umi TGCTAGGCCC = 76 reads: +388 validated
umi TGCTGGAACA = 174 reads: +388 validated
umi TGTGAACCGT = 65 reads: +388 validated
umi TTACCTTTTC = 82 reads: +388 validated
umi TTAGAAACAG = 96 reads: +388 validated
umi TTAGCGACAC = 144 reads: +388 validated
umi TTGAGATCGC = 87 reads: +388 validated
umi TTTGCTAGTA = 107 reads: +388 validated

UMI info for barcode TCGCGAGTCACCACCT-1 contig 2 = ACTTAAGCAC...
umi AATCTTTGAA = 80 reads: -427 non-validated
umi AATTATCCGT = 115 reads: +279 -1XX +73 -1XX +46 -1 +2 -1 +7 -16 invalidated
umi ACGGAAATGT = 49 reads: +322 -29 +76 non-validated
umi CACAGTGCAC = 50 reads: -383 +1 -1XX +1 -1XX +2 -2XX +9 -1XX +6 -1XX +1 -1XX +6 -1XX +10 invalidated
umi CTGAGTTCAG = 89 reads: -387X +2 -3XX +8 -2XX +2 -1XX +2 -2XX +7 -1XX +10 invalidated
umi GGTATCGCAT = 51 reads: +427 validated
umi GTTTCTTACA = 216 reads: -290X +137 invalidated
umi TAATGTTCGG = 243 reads: -293 +134 non-validated
umi TTTCTCTCCG = 239 reads: -393X +2 -10XX +1 -7XX +2 -2XX +1 -5XX +1 -2XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=11)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 52 umis using 978 reads
cdr3 = CATWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [8, 19, 30, 34, 36, 50, 70, 85, 132, 140] and 45 others
of which 55 are surviving nonsolos
reads assigned: 5978
start codons at 36, 190, 197, 241, 250, 365
confident = true

TIG 2[bases=710]
0-101 ==> 44-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
101-451 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=20)
478-528 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
528-710 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 92 reads
cdr3 = CARGCERCMLSNNDAFDIW at 440, score = 9 + 8
umis assigned: [35, 41, 73, 197, 355, 489, 532, 549, 724]
of which 9 are surviving nonsolos
reads assigned: 1106
start codons at 57, 101, 295, 464, 477, 480, 509
confident = true
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGAGGGTGCGAGCGGTGTATGCTTTCCAACAATGATGCTTTTGATATCTGGGGCCGAGGGACAATGGTCACGGTCTCCTCAG <==> GGACTCCAGACTGGGGACGAGGCCGATTATTATTGCGCAACATGGGACAGCAGCCTGAGTGCTGGAGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2344 = TCGCGAGTCATGTCCC-1

using 127 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 121]
surviving nonsolo ucounts = 1[121]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGTCATGTCCC-1 contig 1 = GGGGTCTCAG...
umi ATCACAGTTG = 110 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
426-538 ==> 0-112 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CSSHAGSTRVLF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 38, 195, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2349 = TCGCGAGTCCCTGACT-1

using 117 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[117]
surviving nonsolo ucounts = 1[117]
ids = [0]

====================================================================================

UMI info for barcode TCGCGAGTCCCTGACT-1 contig 1 = GAGCTACAAC...
umi CACAGCCCAC = 95 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=461]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-461 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 27, 30, 85, 99, 352, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2352 = TCGCGAGTCGAGAGCA-1

using 11019 reads

====================================================================================

graph has 4165 edges initially, 60 edges after simplification

total ucounts = 523
nonsolo ucounts = 221[2^66, 3^22, 4^9, 5^8, 6^9, 7^3, 8^7, 9, 10, 11, 12, 13, 14, 15, 17^2, 18, 21, 28, 31, 32, 33, 38, 42^2, 50, 52, 53, 54, 55^2, 56, 58, 64, 71, 72^2, 79, 85, 86^2, 88, 90, 95^2, 96, 100, 105, 106, 107^2, 110, 112^2, 114^2, 115^2, 116, 117^2, 119, 120^3, 121^2, 122^2, 127, 128, 129, 131^2, 134, 135^2, 137, 139, 140, 141^2, 142^2, 148, 150, 151, 152^2, 155^2, 157, 162, 163, 165, 168, 174, 175, 181, 190, 195, 202, 365, 373]
surviving nonsolo ucounts = 87[8, 14, 15, 17, 28, 32, 33, 42^2, 50, 52, 53, 54, 55^2, 56, 58, 64, 71, 72^2, 79, 85, 86^2, 88, 90, 95^2, 96, 100, 105, 106, 107^2, 110, 112^2, 114^2, 115, 116, 117^2, 119, 120^3, 121^2, 122^2, 127, 128, 129, 131^2, 134, 135^2, 137, 139, 140, 141^2, 142^2, 148, 150, 151, 152^2, 155^2, 157, 162, 163, 165, 168, 174, 175, 181, 190, 195, 202, 365, 373]
ids = [347, 11, 44, 64, 75, 151, 398, 349, 389, 338, ...]

====================================================================================

UMI info for barcode TCGCGAGTCGAGAGCA-1 contig 1 = TGGGGAGGAG...
umi AAAGCCTGGT = 128 reads: +388 validated
umi AAATTACCCG = 193 reads: +388 validated
umi AACCCACCGT = 106 reads: +388 validated
umi AAGGGGTATA = 72 reads: -40 +341 -4 +3 non-validated
umi AAGTGCCACA = 179 reads: +388 validated
umi AATCGCACCG = 122 reads: +388 validated
umi ACAATGCCGA = 144 reads: +388 validated
umi ACATATATTG = 103 reads: +388 validated
umi ACCCTGTTCC = 155 reads: +388 validated
umi ACCGGGATTC = 120 reads: +388 validated
umi ACTCCATCGG = 114 reads: -1 +8 -1 +3 -1 +1 -1 +372 non-validated
umi ACTTTGTGCC = 153 reads: +388 validated
umi AGACCCAACT = 142 reads: +388 validated
umi AGTCATCTAT = 158 reads: +388 validated
umi AGTGTTTGTG = 120 reads: +388 validated
umi ATACACTACA = 182 reads: +388 validated
umi ATACCGGCCG = 110 reads: +388 validated
umi ATCACTATAT = 158 reads: +388 validated
umi ATCGATCGGT = 120 reads: +388 validated
umi ATGCCCCGGT = 198 reads: +388 validated
umi ATGGGCGTCG = 126 reads: +71 -1X +1 -3X +312 invalidated
umi ATTTACCGGT = 122 reads: +13 -17 +358 non-validated
umi ATTTAGTCAC = 120 reads: +388 validated
umi CAAGTTATTT = 168 reads: +388 validated
umi CACAGAAGCA = 139 reads: +388 validated
umi CACTAGTCCA = 139 reads: +388 validated
umi CCCAATAGAG = 378 reads: -188 +67 -1XX +132 invalidated
umi CGTCGTTAAC = 153 reads: +388 validated
umi CTCGTCTATG = 124 reads: +55 -1XX +332 invalidated
umi CTCGTTCGGA = 108 reads: +388 validated
umi CTGGGGATAG = 132 reads: +388 validated
umi CTGGTATTGC = 174 reads: +388 validated
umi CTTCAAACGT = 137 reads: +388 validated
umi GAACTTCACC = 129 reads: +388 validated
umi GACACCGAGG = 139 reads: +388 validated
umi GATCATATTA = 65 reads: -5 +383 non-validated
umi GATCGGTGGC = 143 reads: +388 validated
umi GCAGAAAGTG = 133 reads: +388 validated
umi GGCTTTTTCT = 110 reads: -5 +383 non-validated
umi GGGACTTGGC = 68 reads: +388 validated
umi GGTACCAATT = 87 reads: +388 validated
umi GGTAGTTTTG = 115 reads: +388 validated
umi GTCAAGCCCT = 133 reads: +388 validated
umi GTTAGCCGGA = 88 reads: +388 validated
umi TAAATATTCG = 154 reads: +388 validated
umi TACGCCGCGG = 148 reads: +388 validated
umi TAGTCATATT = 117 reads: +388 validated
umi TATATGAGGC = 71 reads: +388 validated
umi TCGGGCGTAC = 123 reads: +388 validated
umi TTCCTTCGAT = 115 reads: +388 validated
umi TTCTTGGTAC = 135 reads: +388 validated
umi TTGCACCTTG = 96 reads: +388 validated
umi TTTATCGCCA = 166 reads: +388 validated

UMI info for barcode TCGCGAGTCGAGAGCA-1 contig 2 = GGAGTGCTTT...
umi AACCGCAGTG = 14 reads: +44 -2 +149 -2 +10 -1 +3 -2 +114 -37 +38 -1 +17 -16 non-validated
umi ACCGCCCTCA = 14 reads: +28 -1 +2 -36 +56 -3 +149 -1X +94 -17 +15 -1 +23 -1 +9 invalidated
umi AGAAAGCCGT = 13 reads: -432 +4 non-validated
umi AGCCAACGTA = 87 reads: +436 validated
umi AGCTAATTAG = 112 reads: +436 validated
umi AGGTCTCCAT = 55 reads: +26 -6 +404 non-validated
umi CAAGTTAGGC = 23 reads: -407 +1 -1X +1 -1X +2 -1X +3 -2XX +17 invalidated
umi CACATATCTA = 85 reads: +436 validated
umi CACATTCACT = 57 reads: +436 validated
umi CACGCGCGGT = 96 reads: +436 validated
umi CACTTTCCTC = 84 reads: +436 validated
umi GAAGCTTGGA = 108 reads: +436 validated
umi GAGTTTCGAA = 46 reads: +64 -1X +1 -1X +3 -2 +301 -1 +62 invalidated
umi GCTCTGCTTA = 51 reads: +436 validated
umi GGATTCACAA = 113 reads: +436 validated
umi GGCACGAGCA = 40 reads: -4 +432 non-validated
umi GTACTTCTCA = 59 reads: +405 -1 +3 -1 +26 non-validated
umi GTTCAGCCTT = 40 reads: +358 -4 +1 -3 +1 -1 +1 -2 +4 -1 +10 -1 +1 -2 +15 -2 +14 -1 +14 non-validated
umi TAACAGTCAC = 34 reads: +427 -1X +1 -7 invalidated
umi TAGTACAGGG = 129 reads: +436 validated
umi TCTTAAACGG = 55 reads: -26 +410 non-validated
umi TGGCAAAGGT = 51 reads: -6 +430 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 52 umis using 1087 reads
cdr3 = CQQSYTTLLTF at 359, score = 9 + 9
umis assigned: [2, 7, 10, 16, 17, 21, 29, 36, 42, 46] and 43 others
of which 53 are surviving nonsolos
reads assigned: 6992
start codons at 32, 38, 94, 107, 243, 462
confident = true

TIG 2[bases=637]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
409-455 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
455-637 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 13 umis using 155 reads
cdr3 = CARAHGDYYTLLDWW at 379, score = 8 + 7
umis assigned: [11, 44, 64, 79, 85, 94, 151, 160, 162, 167] and 12 others
of which 22 are surviving nonsolos
reads assigned: 1350
start codons at 19, 40, 84, 170, 370
confident = true
now this is a cell
paired!

GCCGCGGACACGGCTATGTATTACTGTGCGAGAGCACACGGTGACTACTACACCCTCCTTGACTGGTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACACTACCCTCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2353 = TCGCGAGTCGATAGAA-1

using 646 reads

====================================================================================

graph has 268 edges initially, 24 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 108, 154, 163, 216]
surviving nonsolo ucounts = 4[108, 154, 163, 216]
ids = [1, 4, 2, 3]

====================================================================================

UMI info for barcode TCGCGAGTCGATAGAA-1 contig 1 = ACCCAGAGGG...
umi GCTCTATGTA = 198 reads: +382 validated

UMI info for barcode TCGCGAGTCGATAGAA-1 contig 2 = TGAGCGCAGA...
umi CTTTAGCGCG = 164 reads: +388 validated

UMI info for barcode TCGCGAGTCGATAGAA-1 contig 3 = GAGGAATCAG...
umi GGGTTATAAG = 139 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
14-359 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
358-396 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
396-460 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQRSNWPFTF at 335, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 14, 219, 222, 438
confident = false

TIG 2[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=4)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CGTWDSSLSASVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 36, 190, 241, 365
confident = false

TIG 3[bases=480]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-480 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 28, 34, 103, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=596]
0-334 ==> 6-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
347-385 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
385-596 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDKSLRGAVF at 318, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 78, 151, 301, 328
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2357 = TCGCGAGTCTACTCAT-1

using 171 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 167]
surviving nonsolo ucounts = 1[167]
ids = [1]

====================================================================================

UMI info for barcode TCGCGAGTCTACTCAT-1 contig 1 = GAAGAGCTGC...
umi CCATCTTCTT = 150 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-481 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYGSSPRVTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2361 = TCGCGAGTCTCGATGA-1

using 626 reads

====================================================================================

graph has 752 edges initially, 22 edges after simplification

total ucounts = 232
nonsolo ucounts = 73[2^40, 3^13, 4^6, 5^2, 6, 7, 8^3, 10, 11^2, 12^2, 95, 126]
surviving nonsolo ucounts = 2[95, 126]
ids = [226, 74]

====================================================================================

REJECT CONTIGS

TIG 1[bases=537]
0-348 ==> 5-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
345-383 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
383-537 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 316, score = 8 + 8
umis assigned: [226]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 149, 299, 324, 329
confident = false
not full
VJ delta = 22
not full

TIG 2[bases=525]
0-336 ==> 11-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=8)
333-371 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
371-525 ==> 0-154 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CYSADSSGDLWVF at 304, score = 7 + 8
umis assigned: [74]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 50, 119, 137, 188, 250, 287
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2363 = TCGCGAGTCTTCGAGA-1

using 147 reads

====================================================================================

graph has 57 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 145]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2367 = TCGCGTTAGAAGCCCA-1

using 278 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^3, 3^2, 5^3, 121, 127]
surviving nonsolo ucounts = 2[121, 127]
ids = [6, 10]

====================================================================================

UMI info for barcode TCGCGTTAGAAGCCCA-1 contig 1 = GAGGAATCAG...
umi CCTCGCCTGT = 120 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
0-28 ==> 153-181 on |247|IGKV1D-17|5'UTR| [len=181] (mis=0)
28-379 ==> 0-351 on |248|IGKV1D-17|L-REGION+V-REGION| [len=351] (mis=14)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQHSSYPYTF at 355, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 28, 34, 103, 124, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=552]
5-33 ==> 5972-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=0)
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=0)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
438-552 ==> 0-114 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 46
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2372 = TCGCGTTAGAGTGAGA-1

using 117 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^2, 3^2, 4^2, 5^2, 6, 9, 68]
surviving nonsolo ucounts = 1[68]
ids = [11]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2375 = TCGCGTTAGATGCGAC-1

using 12419 reads

====================================================================================

graph has 6476 edges initially, 148 edges after simplification

total ucounts = 804
nonsolo ucounts = 487[2^107, 3^59, 4^56, 5^41, 6^40, 7^35, 8^26, 9^18, 10^17, 11^11, 12^3, 13, 14^2, 15^3, 16^2, 17^2, 19, 20, 29, 30, 31, 32, 37, 46^2, 64, 68, 69, 72, 73, 78, 85^2, 98, 102, 105, 106^2, 107, 112^2, 113, 114, 117, 120, 124^2, 125, 127, 131, 132, 138, 142, 143, 144^2, 149^2, 150, 154, 160, 168, 169, 171, 180, 184, 189, 210, 213, 231, 234, 269, 298, 302, 334, 359, 364, 384, 617, 640]
surviving nonsolo ucounts = 61[16, 20, 29, 30, 31, 32, 46^2, 68, 72, 73, 78, 85^2, 98, 102, 105, 106^2, 107, 112^2, 113, 114, 117, 120, 124^2, 125, 127, 131, 132, 138, 142, 143, 144^2, 149^2, 150, 154, 160, 168, 169, 171, 180, 184, 189, 210, 213, 231, 234, 269, 298, 302, 334, 359, 364, 384, 617, 640]
ids = [163, 110, 568, 172, 25, 147, 438, 584, 21, 312, ...]

====================================================================================

UMI info for barcode TCGCGTTAGATGCGAC-1 contig 1 = AGCTCTGGGA...
umi AACATCACGA = 1 reads: -396X +28 invalidated
umi AATTCTTCAG = 86 reads: +353 -31 +40 non-validated
umi ACGTGTCCTT = 124 reads: +424 validated
umi ATAACTGTCT = 116 reads: +424 validated
umi ATACTCACGG = 27 reads: -424 non-validated
umi CACGGATTGT = 144 reads: +424 validated
umi CCAGGCTAGG = 185 reads: +47 -189XX +1 -6X +1 -2XX +2 -3XX +1 -1XX +171 invalidated
umi GAAGGACCGT = 40 reads: -376 +3 -1X +1 -5X +1 -2X +1 -5X +2 -1 +2 -1 +23 invalidated
umi GCAACTCGCA = 121 reads: +377 -5 +7 -1 +3 -1 +30 non-validated
umi GTACCGTTCT = 21 reads: -262 +39 -3 +1 -1 +118 non-validated
umi TACAAAGGGG = 125 reads: +424 validated
umi TATTTCAACT = 310 reads: +47 -19XX +1 -169X +1 -6XX +1 -2XX +2 -3XX +1 -1XX +171 invalidated
umi TCTGAGCTGT = 152 reads: +424 validated
umi TTCTCATGGA = 106 reads: +424 validated

UMI info for barcode TCGCGTTAGATGCGAC-1 contig 2 = TGAGCGCAGA...
umi AACGATAGTA = 30 reads: +382 -6 non-validated
umi AATGACAGAC = 140 reads: +388 validated
umi ACGTGTTAGG = 142 reads: +388 validated
umi AGAAAATAGG = 18 reads: +271 -2 +59 -13 +43 non-validated
umi AGGTTGCTCG = 28 reads: +282 -1X +29 -37 +39 invalidated
umi AGTTTCGGTT = 15 reads: +223 -119 +27 -1 +18 non-validated
umi ATCCCAGTCT = 172 reads: +388 validated
umi ATCTATTGTG = 105 reads: +388 validated
umi ATTCCATCTT = 132 reads: +388 validated
umi CCGATACGAA = 74 reads: +388 validated
umi CCGCATATTA = 60 reads: +306 -1X +81 invalidated
umi CGTCATCCAT = 197 reads: -353 +2 -2XX +1 -2XX +3 -5XX +1 -1XX +2 -4XX +1 -3XX +1 -2XX +1 -2XX +2 invalidated
umi GCTACAGGGT = 112 reads: +388 validated
umi TAATGAGTCC = 100 reads: +388 validated
umi TCAAAGATCA = 72 reads: +70 -1 +317 non-validated
umi TCAAAGTACG = 144 reads: +388 validated
umi TGGCTTCGTT = 116 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=1)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=16)
456-504 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 159 reads
cdr3 = CTICGGRCPPRFDYW at 428, score = 8 + 7
umis assigned: [21, 56, 91, 164, 172, 252, 292, 438, 480, 555] and 4 others
of which 14 are surviving nonsolos
reads assigned: 1523
start codons at 80, 133, 231, 236, 303, 360, 389
confident = true

TIG 2[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 197 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [25, 51, 92, 110, 147, 163, 189, 200, 225, 312] and 7 others
of which 17 are surviving nonsolos
reads assigned: 1623
start codons at 36, 190, 241, 365
confident = true

REJECT CONTIGS

TIG 1[bases=419]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
13-68 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
22-88 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
41-193 ==> 0-152 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
208-419 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [187, 232, 273, 296, 308, 379, 403, 467, 563, 584] and 2 others
of which 11 are surviving nonsolos
reads assigned: 2954
start codons at 41, 180
confident = false
did not find CDR3

TIG 2[bases=553]
3-36 ==> 5967-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=3)
17-78 ==> 5676-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
30-381 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=9)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [127, 173, 201, 475, 481, 568, 740, 779]
of which 8 are surviving nonsolos
reads assigned: 954
start codons at 30, 36, 92, 105, 140, 241, 459
confident = false
did not find CDR3

TIG 3[bases=543]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-27 ==> 5973-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-27 ==> 5269-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-27 ==> 782-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-27 ==> 9983-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-27 ==> 786-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
27-187 ==> 0-160 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
190-349 ==> 160-319 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [13, 100, 168, 343, 410, 632, 727, 788]
of which 8 are surviving nonsolos
reads assigned: 1066
start codons at 27, 33, 89, 102, 241, 244, 337, 449
confident = false
see insertion of GAA at pos 160 on |233|IGKV1-5|L-REGION+V-REGION|
did not find CDR3
now this is a cell
paired!

ACCGAGGACACAGCCGTGTATTACTGTACTATCTGTGGTGGTCGCTGCCCGCCCCGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGACTCCAGATTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTGGTATTCGGCGGAGGGACCAGGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2387 = TCGCGTTAGGCATGGT-1

using 340 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 11[2^2, 3, 5, 6^2, 8^2, 10, 120, 168]
surviving nonsolo ucounts = 2[120, 168]
ids = [11, 4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=417]
0-341 ==> 12-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
335-373 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
373-417 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTITF at 315, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 50, 63, 199
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2388 = TCGCGTTAGGCGACAT-1

using 161 reads

====================================================================================

graph has 174 edges initially, 6 edges after simplification

total ucounts = 38
nonsolo ucounts = 30[2^8, 3^7, 4, 5^2, 6^4, 7^4, 8, 12, 15^2]
surviving nonsolo ucounts = 1[15]
ids = [21]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2390 = TCGCGTTAGGGTCTCC-1

using 169 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 4, 5, 6^2, 142]
surviving nonsolo ucounts = 1[142]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=440]
1-32 ==> 5969-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
1-32 ==> 5969-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
1-32 ==> 5969-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
5-46 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
32-382 ==> 0-350 on |286|IGKV3/OR2-268|L-REGION+V-REGION| [len=350] (mis=5)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
419-440 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CSLLLSAGLLLTQITF at 343, score = 3 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 32, 101
confident = false
not full
frameshifted full length transcript of length 440
VJ delta = 29
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2391 = TCGCGTTAGGTGCAAC-1

using 174 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3, 4, 5, 6^2, 142]
surviving nonsolo ucounts = 1[142]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=421]
0-23 ==> 6-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
0-23 ==> 11706-11729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=0)
0-23 ==> 5977-6000 on rc of segment after IGKV1-13 exon 1 [len=6000] (mis=0)
11-80 ==> 8898-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
11-80 ==> 8907-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
11-80 ==> 8906-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
23-314 ==> 0-291 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=12)
310-421 ==> 25-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 23, 29, 85, 327
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2395 = TCGCGTTAGTCGCCGT-1

using 198 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[4, 6, 8, 12, 167]
surviving nonsolo ucounts = 1[167]
ids = [5]

====================================================================================

UMI info for barcode TCGCGTTAGTCGCCGT-1 contig 1 = GTCAGTCTCA...
umi TGCCCTCTCT = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQGYSIPLTF at 350, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 23, 29, 85, 234, 288, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2398 = TCGCGTTCAAAGTGCG-1

using 94 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 86]
surviving nonsolo ucounts = 1[86]
ids = [0]

====================================================================================

UMI info for barcode TCGCGTTCAAAGTGCG-1 contig 1 = GGACACAGCA...
umi CCATCAGGTT = 75 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=444]
9-360 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
359-397 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
397-444 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CLQYSSSPWTF at 336, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 75
start codons at 9, 15, 84, 220, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2403 = TCGCGTTCAAGTTCTG-1

using 143 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 9[2, 3, 4^2, 5^2, 6^2, 107]
surviving nonsolo ucounts = 1[107]
ids = [2]

====================================================================================

UMI info for barcode TCGCGTTCAAGTTCTG-1 contig 1 = GCCTGGGCCT...
umi CGTTTGTATA = 104 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=553]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
39-373 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=11)
380-418 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
418-553 ==> 0-135 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQAWDSTTDWVF at 354, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 39, 44, 100, 187, 333, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2410 = TCGCGTTCACATAACC-1

using 151 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[151]
surviving nonsolo ucounts = 1[151]
ids = [0]

====================================================================================

UMI info for barcode TCGCGTTCACATAACC-1 contig 1 = AGCTCTCAGA...
umi TATTTTCGCA = 155 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=547]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=4)
438-476 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CATLEGYW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 79, 230, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2424 = TCGCGTTCAGCCACCA-1

using 160 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 153]
surviving nonsolo ucounts = 1[153]
ids = [1]

====================================================================================

UMI info for barcode TCGCGTTCAGCCACCA-1 contig 1 = AGGACACAGC...
umi AACATTGCGG = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=534]
10-363 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
360-398 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYSTPFTF at 337, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 10, 16, 72, 85, 221, 440
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2425 = TCGCGTTCAGCCTTGG-1

using 132 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 123]
surviving nonsolo ucounts = 1[123]
ids = [4]

====================================================================================

UMI info for barcode TCGCGTTCAGCCTTGG-1 contig 1 = GGGGAGGAGT...
umi TTCGGTCCAG = 113 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=477]
37-285 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=33)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
419-477 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CLHYDNRRRTF at 358, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 37, 93, 106, 245, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2426 = TCGCGTTCAGCGAACA-1

using 4587 reads

====================================================================================

graph has 3072 edges initially, 40 edges after simplification

total ucounts = 772
nonsolo ucounts = 287[2^124, 3^58, 4^26, 5^14, 6^8, 7^9, 8^6, 9^4, 10^3, 11^4, 12, 13^3, 14, 15, 23, 31, 58, 67^2, 74, 77, 95, 101, 111, 122^2, 128, 130, 138, 140, 160, 161, 168, 170, 172, 179, 193, 210, 260]
surviving nonsolo ucounts = 25[23, 31, 58, 67^2, 74, 77, 95, 101, 111, 122^2, 128, 130, 138, 140, 160, 161, 168, 170, 172, 179, 193, 210, 260]
ids = [453, 444, 721, 440, 559, 695, 139, 746, 270, 301, ...]

====================================================================================

UMI info for barcode TCGCGTTCAGCGAACA-1 contig 1 = TGGGGACTCC...
umi AAACCATCTG = 177 reads: +433 validated
umi ACCATGGCTG = 131 reads: +431 -2 non-validated
umi ACCCATTTGG = 96 reads: -25 +380 -2 +26 non-validated
umi AGCTTGCGGC = 77 reads: +433 validated
umi AGTCAATGCG = 208 reads: +433 validated
umi CCTCAAATCT = 81 reads: +433 validated
umi CTTGCGGGTT = 90 reads: +433 validated
umi GATGTCGTCA = 161 reads: +433 validated
umi GCAGTACGTT = 30 reads: +221 -24 +138 -8 +42 non-validated
umi GGGCCTGGGG = 169 reads: +433 validated
umi GGTCTTTATC = 139 reads: +433 validated
umi TAATCACCTT = 53 reads: +36 -18X +1 -2 +262 -1 +99 -14 invalidated
umi TTGATCTTTT = 95 reads: +373 -1 +1 -1 +11 -12 +34 non-validated

UMI info for barcode TCGCGTTCAGCGAACA-1 contig 2 = AGGAGTCAGT...
umi AACTTCCAGA = 138 reads: +388 validated
umi ACAATAATGG = 122 reads: -1 +387 non-validated
umi CACATTATTA = 259 reads: +388 validated
umi CCATGCCATC = 105 reads: +388 validated
umi CGCCCCGGGG = 140 reads: +388 validated
umi CTATATCAGT = 120 reads: +388 validated
umi CTGGTGCCAT = 190 reads: +388 validated
umi GCACACGGCC = 65 reads: -343X +45 invalidated
umi GTACTAAGGT = 159 reads: -28X +1 -5XX +1 -2XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +336 invalidated
umi TGTGTACTAC = 77 reads: -11 +377 non-validated
umi TTATGTCAGT = 54 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
406-454 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
454-525 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 121 reads
cdr3 = CAHMRRGLIGDYLNGMDVW at 366, score = 7 + 7
umis assigned: [7, 86, 87, 139, 151, 301, 397, 435, 444, 479] and 3 others
of which 13 are surviving nonsolos
reads assigned: 1488
start codons at 21, 65, 244, 247, 327, 336, 375, 411
confident = true

TIG 2[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 215 reads
cdr3 = CQQYDNLPLTF at 354, score = 9 + 9
umis assigned: [38, 70, 214, 270, 321, 357, 384, 440, 503, 695] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1406
start codons at 27, 33, 89, 102, 241, 364, 457
confident = true
now this is a cell
paired!

GCCACATATTACTGTGCACACATGCGTAGGGGGCTAATAGGTGACTACTTGAACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCACTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2429 = TCGCGTTCAGGGATTG-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2431 = TCGCGTTCATACGCCG-1

using 177 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 9, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode TCGCGTTCATACGCCG-1 contig 1 = TCCCCTAGAT...
umi AACCTCAGCC = 145 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=547]
0-24 ==> 35-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
24-377 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
426-460 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
460-547 ==> 0-87 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 366, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 24, 222, 227, 244, 288, 321, 514
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2432 = TCGCGTTCATAGTAAG-1

using 156 reads

====================================================================================

graph has 62 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[59, 96]
surviving nonsolo ucounts = 2[59, 96]
ids = [2, 1]

====================================================================================

UMI info for barcode TCGCGTTCATAGTAAG-1 contig 1 = GAGCTTCAGC...
umi ACGCCCTGCC = 84 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=446]
32-384 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
420-446 ==> 0-26 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSAWDSSLNVWVF at 353, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 32, 171, 361, 378
confident = false

REJECT CONTIGS

TIG 1[bases=331]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
12-44 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
39-331 ==> 0-292 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 40
start codons at 39, 44, 100, 187
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2434 = TCGCGTTCATGGAATA-1

using 130 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[128]
surviving nonsolo ucounts = 1[128]
ids = [2]

====================================================================================

UMI info for barcode TCGCGTTCATGGAATA-1 contig 1 = CTGTGGGCAC...
umi TCCAGCTTTA = 121 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=534]
0-39 ==> 12-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
39-395 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-534 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSLSGLYVF at 363, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 39, 193, 196, 247, 346, 373, 397
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2440 = TCGCGTTGTACATCCA-1

using 5337 reads

====================================================================================

graph has 2331 edges initially, 73 edges after simplification

total ucounts = 279
nonsolo ucounts = 120[2^48, 3^16, 4^7, 5^3, 6^2, 7^3, 8^3, 16, 55, 74, 75, 78, 87, 88, 93, 94, 101, 112, 114^2, 120^3, 123, 126, 128, 132, 133^3, 137, 140, 143, 152^2, 154, 162^2, 169, 170, 184, 185, 186, 197, 272]
surviving nonsolo ucounts = 38[16, 55, 74, 75, 78, 87, 88, 93, 94, 101, 112, 114^2, 120^3, 123, 126, 128, 132, 133^3, 137, 140, 143, 152^2, 154, 162^2, 169, 170, 184, 185, 186, 197, 272]
ids = [183, 132, 151, 194, 50, 214, 258, 221, 36, 90, ...]

====================================================================================

UMI info for barcode TCGCGTTGTACATCCA-1 contig 1 = ATACTTTCTG...
umi ACATACGCTA = 78 reads: +397 -18 non-validated
umi AGCACCGGAG = 143 reads: +415 validated
umi ATCCCTTTTA = 95 reads: +415 validated
umi CATAGCTATA = 132 reads: +415 validated
umi CGCCATGTAT = 51 reads: -373X +1 -1X +3 -2XX +7 -1XX +1 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CTCACGCCTT = 53 reads: +415 validated
umi GCCCGCGGAC = 17 reads: -25 +150 -25 +2 -1 +99 -61 +2 -1 +2 -1X +46 invalidated
umi TCATTAAACT = 93 reads: +415 validated
umi TGCAACGGCC = 187 reads: +415 validated

UMI info for barcode TCGCGTTGTACATCCA-1 contig 2 = GTCAGAGCCC...
umi AATGCTCACT = 173 reads: +382 validated
umi ACAACATCCG = 136 reads: +382 validated
umi ACGCAATTCA = 173 reads: +382 validated
umi ACTACAGTCG = 151 reads: +382 validated
umi ACTCCTTTAG = 88 reads: +382 validated
umi ACTGGCTTCG = 178 reads: +382 validated
umi AGAGGAGTTG = 135 reads: +382 validated
umi AGTATATGGC = 79 reads: +382 validated
umi CAGGAGCGGT = 102 reads: +382 validated
umi CAGGGCAACC = 119 reads: +382 validated
umi CGACGCTTGG = 152 reads: +382 validated
umi CGCCCGTTCT = 167 reads: +382 validated
umi CGTCCGCCCA = 129 reads: +382 validated
umi GATATACCTT = 134 reads: +382 validated
umi GCCTCACCAC = 144 reads: +382 validated
umi GCCTCCTGCC = 120 reads: +382 validated
umi GCGTCGCTCG = 74 reads: +373 -9 non-validated
umi GGATCCTTTT = 156 reads: +382 validated
umi GGTTGCGCGC = 115 reads: +382 validated
umi GTCTAAGGAC = 85 reads: +382 validated
umi TACAACCTTT = 198 reads: +382 validated
umi TCCAGCTTGA = 127 reads: +382 validated
umi TCGAACGCCC = 163 reads: +382 validated
umi TGACTTCGCG = 84 reads: +382 validated
umi TTTATTAGCA = 116 reads: +382 validated
umi TTTCTACCCG = 190 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=4)
404-452 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
452-554 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 75 reads
cdr3 = CATRSGWPRYFDYW at 379, score = 9 + 7
umis assigned: [21, 43, 58, 93, 132, 151, 183, 240, 259]
of which 9 are surviving nonsolos
reads assigned: 832
start codons at 16, 37, 81, 470, 531
confident = true

TIG 2[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 519 reads
cdr3 = CQQRSNWPWTF at 368, score = 9 + 8
umis assigned: [14, 17, 31, 33, 36, 37, 41, 50, 90, 92] and 16 others
of which 26 are surviving nonsolos
reads assigned: 3423
start codons at 47, 252, 255, 471
confident = true
now this is a cell
paired!

ACCGCCGCGGACACGGCCGTGTATTACTGTGCGACCCGCAGTGGCTGGCCCCGCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2444 = TCGCGTTGTATCGCAT-1

using 146 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 142]
surviving nonsolo ucounts = 1[142]
ids = [1]

====================================================================================

UMI info for barcode TCGCGTTGTATCGCAT-1 contig 1 = ATCATCCAAC...
umi CACATTCACA = 113 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=517]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
413-444 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=5)
440-488 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
488-517 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARSPVTIFGVVIMYFDYW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 58, 214, 256, 322, 355, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2449 = TCGCGTTGTCAGTGGA-1

using 104 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 99]
surviving nonsolo ucounts = 1[99]
ids = [4]

====================================================================================

UMI info for barcode TCGCGTTGTCAGTGGA-1 contig 1 = CTGGGGTCTC...
umi TGCTTCTCCG = 91 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-483 ==> 0-55 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 90
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2453 = TCGCGTTGTCTAGTGT-1

using 61 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 56]
surviving nonsolo ucounts = 1[56]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2455 = TCGCGTTGTCTGCAAT-1

using 167 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [2]

====================================================================================

UMI info for barcode TCGCGTTGTCTGCAAT-1 contig 1 = GTCCCAACCA...
umi GCTATGTCTT = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-19 ==> 12-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
19-370 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
368-407 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYDNLPVTF at 346, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 19, 25, 81, 94, 233, 356, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2457 = TCGCGTTGTGAAAGAG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2458 = TCGCGTTGTGGCCCTA-1

using 131 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [0]

====================================================================================

UMI info for barcode TCGCGTTGTGGCCCTA-1 contig 1 = GGAGGAACTG...
umi CGTTTCACGT = 112 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=484]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNNWPLTF at 355, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2462 = TCGCGTTGTTCGGCAC-1

using 108 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[106]
surviving nonsolo ucounts = 1[106]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=483]
0-327 ==> 29-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
327-365 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
365-483 ==> 0-118 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 295, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 125, 128, 179, 278, 305, 329
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2463 = TCGCGTTGTTCGTTGA-1

using 211 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2466 = TCGCGTTGTTGTACAC-1

using 284 reads

====================================================================================

graph has 392 edges initially, 6 edges after simplification

total ucounts = 176
nonsolo ucounts = 62[2^34, 3^16, 4^9, 5^2, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2469 = TCGCGTTTCAACGCTA-1

using 245 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 114, 126]
surviving nonsolo ucounts = 2[114, 126]
ids = [1, 3]

====================================================================================

UMI info for barcode TCGCGTTTCAACGCTA-1 contig 1 = CTCCTCTAAA...
umi CAGATATCTT = 106 reads: +415 validated
umi CGTACATTCT = 120 reads: +410 -1X +4 invalidated

GOOD CONTIGS

TIG 1[bases=502]
0-38 ==> 20-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
38-323 ==> 0-285 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=15)
417-453 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
453-502 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 23 reads
cdr3 = CAGDPGDVEGRGSW at 380, score = 8 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 220
start codons at 38, 107, 189, 236, 254
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2470 = TCGCGTTTCAACGGCC-1

using 208 reads

====================================================================================

graph has 66 edges initially, 10 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[13, 73, 120]
surviving nonsolo ucounts = 3[13, 73, 120]
ids = [2, 3, 0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=652]
1-55 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
39-71 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
55-71 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
55-79 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
55-80 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
98-177 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
98-126 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
268-375 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
271-374 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
351-376 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
403-441 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
441-652 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 71
start codons at 55, 206, 256, 381
confident = false
did not find CDR3

TIG 2[bases=604]
0-352 ==> 1-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=0)
355-393 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
393-604 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSNQGVVF at 326, score = 6 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 129
start codons at 62, 153, 204, 336
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2481 = TCGCGTTTCCATGAGT-1

using 168 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 164]
surviving nonsolo ucounts = 1[164]
ids = [2]

====================================================================================

UMI info for barcode TCGCGTTTCCATGAGT-1 contig 1 = GGGGAGGAAC...
umi TTCTGCTCTT = 165 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWPPFTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 36, 241, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2484 = TCGCGTTTCCCTAACC-1

using 38 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 35]
surviving nonsolo ucounts = 1[35]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=357]
0-279 ==> 72-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
279-316 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
316-357 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPLTF at 255, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 26
start codons at 3, 139, 142, 235
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2493 = TCGCGTTTCGCTAGCG-1

using 366 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 44
nonsolo ucounts = 31[2^7, 3^2, 4^3, 5, 6^5, 7, 8^3, 9^2, 10, 12, 13, 14, 16, 18, 154]
surviving nonsolo ucounts = 1[154]
ids = [24]

====================================================================================

UMI info for barcode TCGCGTTTCGCTAGCG-1 contig 1 = CAGAGCCCTG...
umi GGTAGTTTGT = 116 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=438]
0-45 ==> 2-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
45-390 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
junction support: 1 umis using 22 reads
cdr3 = CQQRSNPGTF at 366, score = 9 + 8
umis assigned: [24]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 45, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2502 = TCGCGTTTCTTCCTTC-1

using 7856 reads

====================================================================================

graph has 3566 edges initially, 58 edges after simplification

total ucounts = 828
nonsolo ucounts = 326[2^169, 3^60, 4^28, 5^10, 6^10, 7^2, 8, 9^4, 10, 11, 12, 13, 14, 15, 29, 36, 46, 48, 51, 69, 93, 99, 131, 139, 142, 161^3, 167, 179, 182, 189, 190, 191, 194, 198, 207, 210, 217, 218, 223^2, 225, 230, 233, 235, 257, 267, 390, 490]
surviving nonsolo ucounts = 29[99, 131, 139, 142, 161^3, 167, 179, 182, 189, 190, 191, 194, 198, 207, 210, 217, 218, 223^2, 225, 230, 233, 235, 257, 267, 390, 490]
ids = [745, 559, 285, 659, 174, 408, 577, 18, 291, 312, ...]

====================================================================================

UMI info for barcode TCGCGTTTCTTCCTTC-1 contig 1 = GGAGAAGAGC...
umi AACATATTCG = 169 reads: +385 validated
umi AACCGGAGTC = 230 reads: +385 validated
umi AACCTAAGCC = 220 reads: +385 validated
umi ACCAGAATAT = 200 reads: +385 validated
umi ACCTGTCCCG = 292 reads: +50 -4XX +1 -3XX +1 -3XX +1 -1XX +1 -10XX +1 -266XX +1 -4X +2 -2XX +2 -1XX +2 -1XX +2 -1XX +2 -1XX +9 -1XX +4 -1XX +7 invalidated
umi ACGCGCTTTA = 257 reads: +49 -2XX +2 -3XX +2 -315XX +1 -5X +2 -2XX +1 -1XX invalidated
umi ACTGCCATGG = 226 reads: +385 validated
umi AGTGGATACG = 158 reads: +385 validated
umi AGTTTCCGAC = 190 reads: +385 validated
umi CAACTCAGGG = 224 reads: +385 validated
umi CATGTAAAGG = 138 reads: +385 validated
umi CCAATCTGTT = 181 reads: +49 -2XX +2 -3XX +2 -2XX +1 -7XX +1 -1X +1 -302X +1 -5XX +2 -2XX +1 -1XX invalidated
umi CCGCGCAACT = 184 reads: +385 validated
umi CGGGCCGATC = 218 reads: +385 validated
umi CTACACTCCG = 212 reads: +385 validated
umi CTATAATAAC = 213 reads: +49 -2XX +2 -3XX +2 -2XX +1 -7XX +1 -1XX +1 -288XX +1 -13X +1 -5X +2 -2X +1 -1X invalidated
umi CTTGCACACT = 159 reads: +385 validated
umi GGTCATGACT = 236 reads: +385 validated
umi GTCTATTTTG = 133 reads: +385 validated
umi GTTCCTTACT = 165 reads: +385 validated
umi TATATAGGTG = 191 reads: -2 +383 non-validated
umi TCCACTGACG = 273 reads: +385 validated
umi TCCCGATCTT = 143 reads: +374 -1 +7 -3X invalidated
umi TCTTTACAGA = 194 reads: +385 validated
umi TGTCAACTCC = 98 reads: +385 validated
umi TTCCTTGCTG = 506 reads: +50 -1XX +1 -6XX +1 -1XX +1 -2XX +1 -1XX +2 -2XX +1 -142XX +1 -3XX +1 -1XX +1 -2XX +2 -1XX +1 -10XX +150 invalidated
umi TTTCCCTTGC = 221 reads: +385 validated
umi TTTTATTTGC = 232 reads: +385 validated
umi TTTTTTTCTA = 193 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=21)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 847 reads
cdr3 = CQQYSRSPWTF at 360, score = 9 + 8
umis assigned: [18, 24, 25, 83, 98, 106, 130, 174, 181, 250] and 19 others
of which 29 are surviving nonsolos
reads assigned: 5941
start codons at 36, 240, 244, 463
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2504 = TCGCGTTTCTTTAGTC-1

using 154 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 1[150]
ids = [4]

====================================================================================

UMI info for barcode TCGCGTTTCTTTAGTC-1 contig 1 = GGAACTGCTC...
umi TACTACTCCG = 133 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=505]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
416-505 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNNWPPVTF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 31, 100, 236, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2511 = TCGGGACAGCCCAACC-1

using 158 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[157]
surviving nonsolo ucounts = 1[157]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACAGCCCAACC-1 contig 1 = GAGTCAGTCC...
umi CACACCAGGC = 131 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
410-481 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYDNLPTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 25, 31, 87, 100, 239, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2512 = TCGGGACAGCCTATGT-1

using 496 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[493]
surviving nonsolo ucounts = 1[493]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=324]
0-75 ==> 281-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
75-113 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
113-324 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 43, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 481
start codons at 26, 53, 77, 245
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2519 = TCGGGACAGGGAACGG-1

using 135 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 127]
surviving nonsolo ucounts = 1[127]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACAGGGAACGG-1 contig 1 = GGGGAGGAAC...
umi AATCCTCGGT = 112 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
424-510 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNLWPPMCSF at 357, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 36, 105, 178, 241, 384, 417, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2520 = TCGGGACAGGGCTTCC-1

using 142 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[142]
surviving nonsolo ucounts = 1[142]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACAGGGCTTCC-1 contig 1 = GGAAGCTCAG...
umi CTCTATGACC = 124 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
0-55 ==> 59-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
55-408 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
443-540 ==> 0-97 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAAWDDSLNGYVF at 376, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 55, 359, 384, 389, 401, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2523 = TCGGGACAGTTACCCA-1

using 186 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 103
nonsolo ucounts = 32[2^14, 3^6, 4^4, 5^5, 6, 8, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2531 = TCGGGACCAATCTACG-1

using 5498 reads

====================================================================================

graph has 2882 edges initially, 28 edges after simplification

total ucounts = 397
nonsolo ucounts = 181[2^68, 3^37, 4^20, 5^7, 6^2, 7^4, 8^7, 9^2, 10^3, 12, 15, 20, 60, 79, 89^2, 92, 109, 110^2, 111, 118, 123, 130, 131, 138, 147^2, 151, 158, 163, 173^2, 181, 184, 275, 338, 382, 383, 385]
surviving nonsolo ucounts = 29[20, 60, 79, 89^2, 92, 109, 110^2, 111, 118, 123, 130, 131, 138, 147^2, 151, 158, 163, 173^2, 181, 184, 275, 338, 382, 383, 385]
ids = [380, 170, 229, 155, 208, 91, 136, 300, 381, 98, ...]

====================================================================================

UMI info for barcode TCGGGACCAATCTACG-1 contig 1 = CCACATCCCT...
umi GCTAAAACGG = 412 reads: -381X +2 -2XX +1 -5XX +1 -2XX +1 -1XX +1 -10XX +1 -2XX +1 -2XX +1 -2XX +2 invalidated
umi TACGGTCCCT = 110 reads: +418 validated
umi TTGGGTCCGC = 19 reads: +115 -6 +204 -15 +35 -1 +20 -16 +6 non-validated

UMI info for barcode TCGGGACCAATCTACG-1 contig 2 = GGGGTCACAA...
umi AACCGTTGGT = 159 reads: +388 validated
umi ACCAATGCCA = 171 reads: +388 validated
umi AGTTCAGATA = 120 reads: +351 -1XX +36 invalidated
umi ATTACGCCAA = 145 reads: +388 validated
umi ATTCGGTGGG = 184 reads: +388 validated
umi CACAGACTTG = 92 reads: +388 validated
umi CAGAACAATT = 111 reads: +388 validated
umi CCACATTCAC = 163 reads: +388 validated
umi CCCCACGGCA = 179 reads: +388 validated
umi CCCGGAGCAA = 124 reads: +235 -1XX +152 invalidated
umi CCTTTCATTA = 110 reads: +388 validated
umi CGCAAACAGC = 150 reads: +388 validated
umi CGGTATGGGT = 91 reads: +388 validated
umi CGTCAGCCCT = 277 reads: +388 validated
umi CGTTATTCTT = 61 reads: +388 validated
umi CTACTCCCAA = 173 reads: +388 validated
umi CTTGTATGCC = 92 reads: +388 validated
umi GAGCGGTCCG = 128 reads: +388 validated
umi GATAACGTTA = 140 reads: +388 validated
umi GATTTCGTCC = 78 reads: +349 -13 +26 non-validated
umi TCCTTACCAA = 137 reads: +345 -1X +5 -1X +2 -2 +32 invalidated
umi TGCGTTTATG = 149 reads: +388 validated
umi TTGTTGTTTA = 112 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=642]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=17)
409-460 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
460-642 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 1 umis using 22 reads
cdr3 = CARGGIVAITWFDPW at 384, score = 9 + 7
umis assigned: [245, 300, 380]
of which 3 are surviving nonsolos
reads assigned: 398
start codons at 42, 193, 240, 262, 339
confident = true

TIG 2[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 461 reads
cdr3 = CCSYAGSGFWVF at 362, score = 8 + 8
umis assigned: [8, 35, 62, 78, 80, 91, 98, 109, 118, 121] and 13 others
of which 23 are surviving nonsolos
reads assigned: 3091
start codons at 38, 177, 239, 246, 372
confident = true

REJECT CONTIGS

TIG 1[bases=348]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
27-80 ==> 0-53 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
80-158 ==> 60-138 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=2) [SHIFT!]
174-212 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
212-348 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [126, 308]
of which 2 are surviving nonsolos
reads assigned: 753
start codons at 27, 33, 82, 95, 254
confident = false
did not find CDR3
now this is a cell
paired!

TCTGAAGACACGGCTGTCTATTATTGTGCGAGAGGGGGTATAGTAGCCATTACCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCCG <==> TCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTGGCTTTTGGGTGTTCGGCGGAGGGACCAAATTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2536 = TCGGGACCACGAAGCA-1

using 172 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[8, 162]
surviving nonsolo ucounts = 1[162]
ids = [2]

====================================================================================

UMI info for barcode TCGGGACCACGAAGCA-1 contig 1 = GGAGAAGAGC...
umi GGTTATCTCG = 130 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-499 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYGSSPWTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2540 = TCGGGACCAGAAGCAC-1

using 159 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[157]
surviving nonsolo ucounts = 1[157]
ids = [1]

====================================================================================

UMI info for barcode TCGGGACCAGAAGCAC-1 contig 1 = GGCACCAGGG...
umi AGACACCTCT = 136 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=462]
0-31 ==> 3-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-462 ==> 0-43 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLLSYSGARRVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 31, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2541 = TCGGGACCAGATCCAT-1

using 165 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACCAGATCCAT-1 contig 1 = AGGAATCAGT...
umi GAGATTGGCT = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2543 = TCGGGACCAGCGATCC-1

using 99 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 95]
surviving nonsolo ucounts = 1[95]
ids = [3]

====================================================================================

UMI info for barcode TCGGGACCAGCGATCC-1 contig 1 = GGGGTCTCAG...
umi TTCATCCGGG = 87 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-529 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 86
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2547 = TCGGGACCAGTAGAGC-1

using 220 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 18, 196]
surviving nonsolo ucounts = 1[196]
ids = [5]

====================================================================================

UMI info for barcode TCGGGACCAGTAGAGC-1 contig 1 = TGATCAGGAC...
umi CACTGGAAAT = 3 reads: -400 non-validated
umi TGCGAACTTC = 195 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=567]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [2, 5]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 31, 64, 100, 188, 350, 370, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2548 = TCGGGACCAGTATAAG-1

using 157 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 155]
surviving nonsolo ucounts = 1[155]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=410]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-35 ==> 5965-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-410 ==> 0-28 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 35, 243, 369
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2551 = TCGGGACCATCACCCT-1

using 525 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[112, 124, 286]
surviving nonsolo ucounts = 3[112, 124, 286]
ids = [0, 1, 3]

====================================================================================

UMI info for barcode TCGGGACCATCACCCT-1 contig 1 = GACTGATCAG...
umi AAGTGGCTCC = 116 reads: +397 validated
umi CATCCAAGAC = 2 reads: -355X +2 -1XX +1 -2XX +11 -3XX +8 -2XX +12 invalidated
umi CCAAATTCTG = 290 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=567]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CMQALQTTLTF at 370, score = 9 + 9
umis assigned: [0, 1, 3]
of which 3 are surviving nonsolos
reads assigned: 396
start codons at 34, 67, 103, 191, 353, 373, 473
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2557 = TCGGGACGTAAATACG-1

using 369 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[8, 9, 144, 206]
surviving nonsolo ucounts = 2[144, 206]
ids = [5, 4]

====================================================================================

UMI info for barcode TCGGGACGTAAATACG-1 contig 1 = GGGAGTCTCA...
umi TACTATGTGG = 173 reads: +388 validated

UMI info for barcode TCGGGACGTAAATACG-1 contig 2 = AAAAACCACA...
umi TCTAATGAGT = 124 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=456]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-456 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQSYSTPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 23, 29, 85, 98, 234
confident = false

TIG 2[bases=551]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-551 ==> 0-65 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2560 = TCGGGACGTACATCCA-1

using 166 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACGTACATCCA-1 contig 1 = GATCAGGACT...
umi CACCTTCCGC = 165 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2561 = TCGGGACGTAGAAGGA-1

using 225 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACGTAGAAGGA-1 contig 1 = CAGCAACCAC...
umi CCGGTGCGAG = 186 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=498]
0-52 ==> 12-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
52-405 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
419-470 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
470-498 ==> 0-28 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGSSGWSNWFDPW at 394, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 52, 208, 250, 255, 287, 316, 349, 488
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2563 = TCGGGACGTAGCACGA-1

using 82 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[82]
surviving nonsolo ucounts = 1[82]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2570 = TCGGGACGTCCGAGTC-1

using 1109 reads

====================================================================================

graph has 764 edges initially, 6 edges after simplification

total ucounts = 200
nonsolo ucounts = 56[2^26, 3^10, 4^6, 5^6, 6, 7^2, 8, 12, 26, 309, 454]
surviving nonsolo ucounts = 3[26, 309, 454]
ids = [180, 6, 163]

====================================================================================

REJECT CONTIGS

TIG 1[bases=436]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-205 ==> 0-175 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=9)
244-300 ==> 60-116 on rc of segment before IGKJ4 exon 1 [len=280] (mis=3)
300-436 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6, 163]
of which 2 are surviving nonsolos
reads assigned: 753
start codons at 30, 63, 99, 187, 342
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2572 = TCGGGACGTCGCATAT-1

using 252 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[8^2, 78, 155]
surviving nonsolo ucounts = 2[78, 155]
ids = [3, 6]

====================================================================================

UMI info for barcode TCGGGACGTCGCATAT-1 contig 1 = AGTCTGGGCC...
umi TGCGAACGAC = 137 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=577]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-577 ==> 0-155 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQVWDSDGHYVVF at 355, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 40, 101, 170, 338, 374, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2574 = TCGGGACGTGCAGTAG-1

using 119 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[118]
surviving nonsolo ucounts = 1[118]
ids = [1]

====================================================================================

UMI info for barcode TCGGGACGTGCAGTAG-1 contig 1 = TGGGAGTCAG...
umi CGTTTTCCGT = 2 reads: -76 +3 -1 +1 -2 +3 -1 +2 -1 +13 -3X +3 -2 +2 -1 +1 -1 +4 -1 +1 -2 +1 -1 +2 -2 +1 -260 invalidated
umi CTTTTTCCTT = 106 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=505]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
419-505 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYSTLLWTF at 355, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 28, 34, 90, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2575 = TCGGGACGTGCATCTA-1

using 127 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[126]
surviving nonsolo ucounts = 1[126]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACGTGCATCTA-1 contig 1 = GTCAGTCTCA...
umi GGTTTCTTCA = 106 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=456]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=19)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-456 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQSYNTITF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 23, 29, 85, 98, 234, 282, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2582 = TCGGGACGTTGGTTTG-1

using 165 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 163]
surviving nonsolo ucounts = 1[163]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACGTTGGTTTG-1 contig 1 = GCTCTGCTTC...
umi GTATACGCGC = 149 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=576]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-576 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2584 = TCGGGACGTTTCGCTC-1

using 191 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[189]
surviving nonsolo ucounts = 1[189]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACGTTTCGCTC-1 contig 1 = AGTCCCACTC...
umi AATCAATGCC = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2588 = TCGGGACTCACGATGT-1

using 836 reads

====================================================================================

graph has 765 edges initially, 8 edges after simplification

total ucounts = 239
nonsolo ucounts = 98[2^59, 3^24, 4^7, 5^3, 6, 7, 8, 9, 432]
surviving nonsolo ucounts = 1[432]
ids = [151]

====================================================================================

REJECT CONTIGS

TIG 1[bases=347]
4-98 ==> 262-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
98-136 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
136-347 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
cdr3 = CQSYDSSLSGLYVF at 66, score = 7 + 8
umis assigned: [151]
of which 1 are surviving nonsolos
reads assigned: 427
start codons at 49, 76, 100, 268
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2589 = TCGGGACTCAGAGGTG-1

using 329 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 4, 316]
surviving nonsolo ucounts = 1[316]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=412]
2-163 ==> 195-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
163-201 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
201-412 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 131, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 15, 114, 141, 165, 333
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2591 = TCGGGACTCAGCTCGG-1

using 146 reads

====================================================================================

graph has 84 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[20, 123]
surviving nonsolo ucounts = 2[20, 123]
ids = [2, 0]

====================================================================================

UMI info for barcode TCGGGACTCAGCTCGG-1 contig 1 = GCTGGCGCCA...
umi CACCCACAGT = 124 reads: +385 validated
umi GCATCTCATC = 2 reads: -355 +15 -1X +14 invalidated

GOOD CONTIGS

TIG 1[bases=630]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=1)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
419-630 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CLLYYGGALVF at 358, score = 8 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 122
start codons at 34, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2594 = TCGGGACTCCAAACTG-1

using 13 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2598 = TCGGGACTCCGAAGAG-1

using 168 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[168]
surviving nonsolo ucounts = 1[168]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACTCCGAAGAG-1 contig 1 = GATCAGGACT...
umi ATGCTCCCTA = 148 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=504]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=16)
399-427 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
427-504 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQCIQLPWTF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 30, 63, 99, 199, 250, 349, 369, 374, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2602 = TCGGGACTCGCCAGCA-1

using 94 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 91]
surviving nonsolo ucounts = 1[91]
ids = [2]

====================================================================================

UMI info for barcode TCGGGACTCGCCAGCA-1 contig 1 = TGAGCGCAGA...
umi TCTGCACAAA = 84 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=515]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-515 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2610 = TCGGGACTCTCGTATT-1

using 65 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[65]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2616 = TCGGGACTCTTTAGTC-1

using 156 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 1[155]
ids = [0]

====================================================================================

UMI info for barcode TCGGGACTCTTTAGTC-1 contig 1 = CTCTGCTTCA...
umi CTTGACCTCT = 143 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=528]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=7)
406-444 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
444-528 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQSYDISLSGSRVF at 374, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 50, 204, 207, 258, 357, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2618 = TCGGTAAAGAGCTGGT-1

using 670 reads

====================================================================================

graph has 994 edges initially, 26 edges after simplification

total ucounts = 317
nonsolo ucounts = 118[2^50, 3^27, 4^11, 5^8, 6^5, 7, 8, 9^6, 10^2, 11^3, 12, 13, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2620 = TCGGTAAAGAGGTTGC-1

using 129 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[128]
surviving nonsolo ucounts = 1[128]
ids = [0]

====================================================================================

UMI info for barcode TCGGTAAAGAGGTTGC-1 contig 1 = CCATGGCCTG...
umi CATTCGATAT = 119 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=454]
2-347 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
346-384 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
384-454 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQVWDSSSDHYVF at 317, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 2, 63, 201, 204, 300, 348
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2621 = TCGGTAAAGAGTTGGC-1

using 142 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[19, 122]
surviving nonsolo ucounts = 1[122]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2625 = TCGGTAAAGCAGGTCA-1

using 492 reads

====================================================================================

graph has 576 edges initially, 6 edges after simplification

total ucounts = 221
nonsolo ucounts = 89[2^40, 3^21, 4^9, 5, 6^5, 7^4, 8^4, 9, 10, 11, 12, 44]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2632 = TCGGTAAAGCTAGTGG-1

using 229 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TCGGTAAAGCTAGTGG-1 contig 1 = GGAACTGCTC...
umi AGTGATCGGG = 231 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSDWPRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2634 = TCGGTAAAGCTGCAAG-1

using 8 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2635 = TCGGTAAAGCTTATCG-1

using 160 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 1[160]
ids = [0]

====================================================================================

UMI info for barcode TCGGTAAAGCTTATCG-1 contig 1 = GCTGGGGTCA...
umi TATGCAGGGC = 158 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=574]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-574 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 17 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2637 = TCGGTAAAGGCATGTG-1

using 1100 reads

====================================================================================

graph has 1542 edges initially, 8 edges after simplification

total ucounts = 545
nonsolo ucounts = 232[2^108, 3^54, 4^32, 5^11, 6^9, 7^7, 8^3, 9^2, 11, 12^2, 13, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2640 = TCGGTAAAGGCTACGA-1

using 181 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[177]
surviving nonsolo ucounts = 1[177]
ids = [3]

====================================================================================

UMI info for barcode TCGGTAAAGGCTACGA-1 contig 1 = AGCTGTGGGC...
umi CCTCTGCTGC = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=536]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-536 ==> 0-114 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CNSRDSSGVIMVF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 40, 159, 188, 239, 338, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2641 = TCGGTAAAGGGAAACA-1

using 1354 reads

====================================================================================

graph has 1920 edges initially, 12 edges after simplification

total ucounts = 623
nonsolo ucounts = 286[2^118, 3^73, 4^38, 5^19, 6^12, 7^8, 8^6, 9^3, 10^2, 12^4, 13, 14, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2643 = TCGGTAAAGTATTGGA-1

using 436 reads

====================================================================================

graph has 602 edges initially, 10 edges after simplification

total ucounts = 187
nonsolo ucounts = 78[2^27, 3^21, 4^16, 5^5, 6^3, 7^3, 8, 10, 64]
surviving nonsolo ucounts = 1[64]
ids = [117]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2646 = TCGGTAAAGTTACGGG-1

using 152 reads

====================================================================================

graph has 172 edges initially, 6 edges after simplification

total ucounts = 36
nonsolo ucounts = 28[2^3, 3^6, 4^2, 5^6, 6^6, 7, 8^2, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2648 = TCGGTAACAAACGCGA-1

using 113 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 109]
surviving nonsolo ucounts = 1[109]
ids = [2]

====================================================================================

UMI info for barcode TCGGTAACAAACGCGA-1 contig 1 = GCTCTGCTTC...
umi TCTAACGGTA = 95 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=462]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-462 ==> 0-20 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2651 = TCGGTAACAAGCGTAG-1

using 125 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[10, 114]
surviving nonsolo ucounts = 1[114]
ids = [1]

====================================================================================

UMI info for barcode TCGGTAACAAGCGTAG-1 contig 1 = GGAACTGCTC...
umi GGTCTTACTT = 116 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQRSNWPLTF at 352, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 31, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2653 = TCGGTAACAATAAGCA-1

using 433 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 171, 254]
surviving nonsolo ucounts = 2[171, 254]
ids = [5, 4]

====================================================================================

UMI info for barcode TCGGTAACAATAAGCA-1 contig 1 = AGGAGTCAGA...
umi CATCACTAAG = 231 reads: +385 validated
umi GAAAGGGCCT = 154 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=485]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-353 ==> 0-326 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-485 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 77 reads
cdr3 = CQQYNVYGTF at 354, score = 8 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 381
start codons at 27, 33, 89, 102, 259, 334, 367, 373, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2658 = TCGGTAACACTGTTAG-1

using 748 reads

====================================================================================

graph has 1142 edges initially, 2 edges after simplification

total ucounts = 313
nonsolo ucounts = 163[2^71, 3^38, 4^24, 5^11, 6^6, 7^4, 8^3, 9, 10, 12^2, 13, 47]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2665 = TCGGTAACAGCTCGAC-1

using 767 reads

====================================================================================

graph has 1161 edges initially, 10 edges after simplification

total ucounts = 399
nonsolo ucounts = 150[2^66, 3^42, 4^10, 5^11, 6^6, 7^9, 8, 9^2, 11, 13, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2669 = TCGGTAACAGGGCATA-1

using 23 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 1[22]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2688 = TCGGTAAGTATATGAG-1

using 275 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[7, 267]
surviving nonsolo ucounts = 1[267]
ids = [0]

====================================================================================

UMI info for barcode TCGGTAAGTATATGAG-1 contig 1 = GGAGAAGAGC...
umi CCAGACTCTA = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPPYTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2694 = TCGGTAAGTCGGCATC-1

using 90 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 85]
surviving nonsolo ucounts = 1[85]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2701 = TCGGTAAGTGGTCTCG-1

using 146 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 8, 134]
surviving nonsolo ucounts = 1[134]
ids = [1]

====================================================================================

UMI info for barcode TCGGTAAGTGGTCTCG-1 contig 1 = GCTGGGGTCT...
umi CATATCTTTG = 127 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-517 ==> 0-88 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 41, 198, 242, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2717 = TCGGTAATCATCGCTC-1

using 193 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [0]

====================================================================================

UMI info for barcode TCGGTAATCATCGCTC-1 contig 1 = AGGAGTCAGA...
umi GGGTTCCGGT = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2718 = TCGGTAATCCAAAGTC-1

using 210 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 200]
surviving nonsolo ucounts = 1[200]
ids = [3]

====================================================================================

UMI info for barcode TCGGTAATCCAAAGTC-1 contig 1 = GAGAAGAGCT...
umi TCTATCTTCT = 180 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=454]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-454 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGSSRTF at 359, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 35, 243, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2719 = TCGGTAATCCAAGTAC-1

using 9978 reads

====================================================================================

graph has 3818 edges initially, 46 edges after simplification

total ucounts = 482
nonsolo ucounts = 241[2^83, 3^47, 4^19, 5^19, 6^7, 7^3, 8^4, 10, 11, 15, 19, 20, 22^2, 23, 34, 43, 55, 67, 77, 83, 85^2, 92, 94, 101, 109, 117, 128, 129, 132, 134, 140, 141, 142, 144, 154, 155, 160, 161, 169, 173^2, 176, 177, 179^2, 180, 184^2, 189, 190, 192, 194, 199, 200, 205, 208, 230^2, 231, 236, 344, 375, 542, 720]
surviving nonsolo ucounts = 50[43, 55, 67, 77, 83, 85^2, 92, 94, 101, 109, 117, 128, 129, 132, 134, 140, 141, 142, 144, 154, 155, 160, 161, 169, 173^2, 176, 177, 179^2, 180, 184^2, 189, 190, 192, 194, 199, 200, 205, 208, 230^2, 231, 236, 344, 375, 542, 720]
ids = [313, 220, 57, 335, 54, 62, 346, 391, 228, 458, ...]

====================================================================================

UMI info for barcode TCGGTAATCCAAGTAC-1 contig 1 = GGGGGGCTTT...
umi AAATACTCGT = 142 reads: +448 validated
umi AACAAAGCTT = 202 reads: +448 validated
umi AACATATACC = 130 reads: +448 validated
umi AATTGCAGGT = 150 reads: +448 validated
umi ACAGTGCGCG = 189 reads: +439 -1XX +2 -6 invalidated
umi ACAGTTCTAA = 144 reads: +448 validated
umi ACGCTTCTTC = 67 reads: +351 -4 +78 -15 non-validated
umi ACTCCACGGG = 82 reads: -6 +418 -24 non-validated
umi AGTTGATCAC = 176 reads: +448 validated
umi ATACGATATG = 154 reads: +448 validated
umi ATCCCACCTC = 171 reads: +448 validated
umi CAGTAATGCT = 181 reads: +448 validated
umi CCCCAGCCAA = 192 reads: +448 validated
umi CCTGTGGCGA = 158 reads: +448 validated
umi CGATGCGCGC = 242 reads: +141 -4XX +1 -1XX +2 -9XX +1 -3XX +1 -1XX +1 -100X +1 -1XX +2 -4XX +1 -9XX +165 invalidated
umi CGCTCTGGTC = 55 reads: +35 -10 +302 -21 +56 -24 non-validated
umi CTTCCCGTTA = 203 reads: +448 validated
umi GAACCTTTTA = 112 reads: +448 validated
umi GACTCTGGTC = 120 reads: +351 -4X +92 -1 invalidated
umi GCAATTATCA = 177 reads: +448 validated
umi GGAATGACTT = 134 reads: +427 -1 +20 non-validated
umi GTAGTTTCCA = 182 reads: +448 validated
umi GTCTCTTTCA = 189 reads: +448 validated
umi GTTTATATGA = 80 reads: -15 +409 -24 non-validated
umi TAAGTTCTCC = 85 reads: -8 +377 -1 +62 non-validated
umi TATACAATTC = 177 reads: +448 validated
umi TCCCACTCCG = 92 reads: +439 -9 non-validated
umi TCTATTAACC = 204 reads: +440 -1 +1 -6 non-validated
umi TGTAATATTA = 232 reads: +448 validated
umi TTCACTCCAG = 85 reads: +419 -1 +28 non-validated

UMI info for barcode TCGGTAATCCAAGTAC-1 contig 2 = GGGCTCAGGA...
umi ACCTCGGGAA = 83 reads: +382 validated
umi AGCAATGCAC = 347 reads: -340X +1 -3XX +1 -1XX +4 -1XX +31 invalidated
umi CGAGTTCATG = 163 reads: +382 validated
umi CGTCCCTTTA = 90 reads: +382 validated
umi CTAACACACC = 401 reads: -345X +1 -2XX +1 -4XX +1 -4XX +1 -3XX +1 -10XX +1 -1XX +1 -4XX +2 invalidated
umi GCCGCACCCA = 716 reads: -334X +1 -1X +2 -2XX +1 -3XX +1 -1XX +4 -1XX +31 invalidated
umi GCTTTACGCT = 109 reads: +382 validated
umi GGCCAAGGGC = 44 reads: -280 +102 non-validated
umi GTCAGCCGGT = 136 reads: +382 validated
umi TATCATTATG = 136 reads: +147 -2X +1 -1X +231 invalidated
umi TCTCAGCCTG = 378 reads: -337 +1 -2XX +1 -3XX +1 -1XX +4 -1XX +31 invalidated
umi TGGCCTCCGA = 143 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=538]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=4)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
467-538 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 270 reads
cdr3 = CARHVDDDYGEYYFDYW at 385, score = 9 + 7
umis assigned: [4, 7, 11, 36, 42, 43, 57, 62, 83, 89] and 20 others
of which 30 are surviving nonsolos
reads assigned: 4433
start codons at 19, 28, 40, 84, 395, 404
confident = true

TIG 2[bases=626]
0-33 ==> 2-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
33-380 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=1)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
415-626 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 171 reads
cdr3 = CYSTDSSGNHGVF at 348, score = 7 + 8
umis assigned: [54, 71, 209, 228, 234, 288, 300, 313, 324, 371] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2700
start codons at 33, 94, 163, 181, 232, 294, 331, 376
confident = true

REJECT CONTIGS

TIG 1[bases=575]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-52 ==> 5948-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
400-439 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
439-575 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1, 48, 102, 245, 302, 306, 355, 364]
of which 8 are surviving nonsolos
reads assigned: 1566
start codons at 52, 260, 386, 481
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGACATGTAGACGATGACTACGGGGAGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGGCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCATGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2723 = TCGGTAATCCATGAAC-1

using 151 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^2, 3, 5, 10^2, 113]
surviving nonsolo ucounts = 1[113]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=435]
0-343 ==> 10-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
340-378 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
378-435 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 311, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 101
start codons at 144, 294, 319, 324
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2724 = TCGGTAATCCTTGACC-1

using 41 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4^2, 5, 28]
surviving nonsolo ucounts = 1[28]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2734 = TCGGTAATCTCCCTGA-1

using 38 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[31]
surviving nonsolo ucounts = 1[31]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2740 = TCGGTAATCTGCAGTA-1

using 176 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 4, 163]
surviving nonsolo ucounts = 1[163]
ids = [1]

====================================================================================

UMI info for barcode TCGGTAATCTGCAGTA-1 contig 1 = GAGTCAGTCC...
umi ATTGCCGTGC = 143 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=447]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
413-447 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYDNLPFTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 25, 31, 87, 100, 239, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2741 = TCGGTAATCTGTCTAT-1

using 1814 reads

====================================================================================

graph has 2454 edges initially, 10 edges after simplification

total ucounts = 678
nonsolo ucounts = 321[2^143, 3^81, 4^42, 5^22, 6^9, 7^7, 8^6, 9^2, 10, 11, 12^2, 14, 15, 18, 56, 333]
surviving nonsolo ucounts = 1[333]
ids = [519]

====================================================================================

REJECT CONTIGS

TIG 1[bases=368]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-230 ==> 0-194 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=12)
232-368 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [519]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 36, 274
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2748 = TCGTACCAGAAGGGTA-1

using 208 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [1]

====================================================================================

UMI info for barcode TCGTACCAGAAGGGTA-1 contig 1 = GGGGAGGAAT...
umi CGAAGATTCA = 158 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-507 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2750 = TCGTACCAGAGAACAG-1

using 115 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 110]
surviving nonsolo ucounts = 1[110]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2754 = TCGTACCAGATGCGAC-1

using 1221 reads

====================================================================================

graph has 598 edges initially, 8 edges after simplification

total ucounts = 158
nonsolo ucounts = 62[2^33, 3^13, 4^4, 5, 6, 8, 55, 78, 80, 115, 116, 129, 131, 133, 148]
surviving nonsolo ucounts = 9[8, 78, 80, 115, 116, 129, 131, 133, 148]
ids = [134, 146, 132, 121, 101, 2, 69, 87, 129]

====================================================================================

UMI info for barcode TCGTACCAGATGCGAC-1 contig 1 = GGGGGCTGGT...
umi GAAGTGCCAC = 132 reads: +391 validated
umi GCTTGACCTG = 135 reads: +391 validated
umi GTACAAATAC = 117 reads: +391 validated
umi TATCTGGCTT = 117 reads: +391 validated
umi TCATGGTGGA = 148 reads: +391 validated
umi TCGGCCCCGT = 80 reads: +391 validated
umi TGTTGCCATT = 80 reads: -12 +379 non-validated

GOOD CONTIGS

TIG 1[bases=576]
49-402 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
402-440 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 7 umis using 118 reads
cdr3 = CQQSYSTPRFTF at 376, score = 9 + 7
umis assigned: [69, 87, 101, 121, 129, 132, 146]
of which 7 are surviving nonsolos
reads assigned: 794
start codons at 49, 55, 111, 124, 260, 482
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2767 = TCGTACCAGGCGATAC-1

using 64 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[64]
surviving nonsolo ucounts = 1[64]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=416]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
10-65 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
19-85 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
388-416 ==> 0-28 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
cdr3 = CCSYAGSSTY at 362, score = 8 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 56
start codons at 38, 177, 239, 246, 372, 390
confident = false
not full
VJ delta = 0
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2771 = TCGTACCAGTGAAGAG-1

using 147 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[65, 82]
surviving nonsolo ucounts = 2[65, 82]
ids = [0, 1]

====================================================================================

UMI info for barcode TCGTACCAGTGAAGAG-1 contig 1 = AGTCCCACTC...
umi CCATCTCTCC = 61 reads: +388 validated
umi CCCTTCTGGT = 71 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-474 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 130
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2772 = TCGTACCAGTGACTCT-1

using 78 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[78]
surviving nonsolo ucounts = 1[78]
ids = [0]

====================================================================================

UMI info for barcode TCGTACCAGTGACTCT-1 contig 1 = GAGCTCTGGG...
umi AGTCCCCTTA = 75 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-43 ==> 54-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
43-388 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=8)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
431-471 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYNTWPPMYTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 73
start codons at 43, 112, 248, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2774 = TCGTACCAGTGTACTC-1

using 58 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[58]
surviving nonsolo ucounts = 1[58]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=337]
0-261 ==> 90-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=9)
260-298 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
298-337 ==> 0-39 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CAAWDDSLRGMLF at 231, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 47
start codons at 121, 214, 239, 244, 261
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2775 = TCGTACCAGTGTCCAT-1

using 186 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 174]
surviving nonsolo ucounts = 1[174]
ids = [3]

====================================================================================

UMI info for barcode TCGTACCAGTGTCCAT-1 contig 1 = GCTGGGGTCT...
umi TGTTCATCGT = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-544 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CSSHAGSTRVLF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 41, 198, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2780 = TCGTACCCAAATACAG-1

using 55 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 1[54]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2784 = TCGTACCCACAAGACG-1

using 271 reads

====================================================================================

graph has 136 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[39, 55, 85, 91]
surviving nonsolo ucounts = 4[39, 55, 85, 91]
ids = [3, 1, 4, 0]

====================================================================================

UMI info for barcode TCGTACCCACAAGACG-1 contig 1 = AATCAGTCCC...
umi CCTGCGAATG = 51 reads: -1 +387 non-validated
umi GGATTTTACA = 34 reads: +388 validated
umi TACGTATAAA = 78 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-502 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 25 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [1, 3, 4]
of which 3 are surviving nonsolos
reads assigned: 161
start codons at 24, 30, 99, 235, 454
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2785 = TCGTACCCACACATGT-1

using 595 reads

====================================================================================

graph has 592 edges initially, 6 edges after simplification

total ucounts = 184
nonsolo ucounts = 38[2^17, 3^5, 4^5, 5, 6, 8, 9^3, 10, 14, 48, 72, 190]
surviving nonsolo ucounts = 3[48, 72, 190]
ids = [63, 110, 163]

====================================================================================

REJECT CONTIGS

TIG 1[bases=433]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
0-33 ==> 5967-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-15 exon 1 [len=6000] (mis=0)
6-47 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-314 ==> 0-281 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
314-433 ==> 17-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [163]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 33, 102, 238, 339
confident = false
did not find CDR3

TIG 2[bases=376]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
8-40 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
35-376 ==> 0-341 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=15)
umis assigned: [110]
of which 1 are surviving nonsolos
reads assigned: 64
start codons at 35, 40, 96, 183, 329, 333
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2799 = TCGTACCCAGGCAGTA-1

using 795 reads

====================================================================================

graph has 474 edges initially, 12 edges after simplification

total ucounts = 79
nonsolo ucounts = 33[2^12, 3^3, 4^4, 5, 6^2, 7, 10, 35, 49, 54, 55, 59, 60, 75, 93, 186]
surviving nonsolo ucounts = 10[7, 35, 49, 54, 55, 59, 60, 75, 93, 186]
ids = [50, 16, 7, 29, 70, 49, 78, 41, 5, 14]

====================================================================================

UMI info for barcode TCGTACCCAGGCAGTA-1 contig 1 = GAGCTACAAC...
umi ACCCCCAGTT = 48 reads: +403 validated
umi AGTATGAGGG = 174 reads: -331 +2 -2X +1 -1X +1 -5XX +1 -2XX +1 -5XX +1 -4XX +2 -1XX +1 -4XX +1 -1XX +25 -1XX +10 invalidated
umi ATATCCTCGA = 34 reads: +1 -1 +2 -1 +323 -31 +44 non-validated
umi CCCTACCGCG = 55 reads: +403 validated
umi CTCTGTGATA = 74 reads: +403 validated
umi TCGGTTCACG = 54 reads: +380 -1 +11 -1X +10 invalidated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=17)
395-433 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 29 reads
cdr3 = CQQYYGSPPRTF at 369, score = 9 + 8
umis assigned: [7, 14, 16, 29, 41, 70]
of which 6 are surviving nonsolos
reads assigned: 436
start codons at 30, 352, 382, 475
confident = true

REJECT CONTIGS

TIG 1[bases=465]
15-269 ==> 99-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=37)
300-340 ==> 23-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
340-465 ==> 0-125 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CAKCRLWLEDAEPFDVW at 258, score = 9 + 7
umis assigned: [5, 49, 50, 78]
of which 4 are surviving nonsolos
reads assigned: 106
start codons at 39, 67, 72, 133, 286
confident = false
VJ delta = 23
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2800 = TCGTACCCAGGGCATA-1

using 86 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[86]
surviving nonsolo ucounts = 1[86]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2805 = TCGTACCCATCTGGTA-1

using 74 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[69]
surviving nonsolo ucounts = 1[69]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2806 = TCGTACCCATGGGACA-1

using 1384 reads

====================================================================================

graph has 881 edges initially, 20 edges after simplification

total ucounts = 240
nonsolo ucounts = 75[2^40, 3^6, 4^4, 5, 6, 7, 10^2, 24, 25, 28, 33, 36, 37, 38, 44, 47, 48, 54, 63, 66, 67, 69, 70, 75^2, 80, 88]
surviving nonsolo ucounts = 20[10, 24, 25, 28, 33, 36, 37, 38, 44, 47, 48, 54, 63, 66, 67, 70, 75^2, 80, 88]
ids = [110, 108, 34, 111, 78, 189, 218, 203, 233, 54, ...]

====================================================================================

UMI info for barcode TCGTACCCATGGGACA-1 contig 1 = TGAGTCTCCC...
umi AATTACATTG = 74 reads: +427 validated
umi AGAAATTCGA = 66 reads: +427 validated
umi AGCCACCCTT = 83 reads: +370 -1 +56 non-validated
umi ATATCTGTAT = 25 reads: +162 -2 +87 -1 +7 -1 +100 -67 non-validated
umi CTAGGATTCT = 69 reads: +427 validated
umi CTGCTTCCGA = 22 reads: -9 +279 -17 +56 -66 non-validated
umi CTTACTACGG = 25 reads: +2 -10 +359 -1 +26 -1 +3 -25 non-validated
umi GAGACCGGCT = 48 reads: +416 -1 +8 -1 +1 non-validated
umi TACTCGTTTG = 76 reads: +376 -13 +38 non-validated
umi TATCCTTGTG = 69 reads: +331 -1 +95 non-validated
umi TCATGAGCGC = 32 reads: +263 -1 +5 -1 +6 -59 +56 -5 +3 -1 +5 -2 +1 -1 +1 -1 +1 -1 +1 -2 +3 -1 +7 non-validated
umi TGTTTTTCCT = 56 reads: +427 validated
umi TTAATTCAGG = 26 reads: +34 -1 +3 -1 +102 -4XX +2 -2XX +1 -1XX +1 -2XX +1 -4XX +1 -1XX +1 -4XX +1 -44X +1 -13X +1 -1XX +1 -1XX +1 -2XX +191 -4 invalidated
umi TTGTAATCAC = 45 reads: +393 -17 +17 non-validated

UMI info for barcode TCGTACCCATGGGACA-1 contig 2 = GTGGGTCCAG...
umi CACTGTTCGT = 45 reads: +382 validated
umi CCTAAAGACA = 33 reads: +316 -1 +6 -1 +58 non-validated
umi CCTTTAAACA = 11 reads: -273X +6 -4X +1 -2XX +5 -1XX +1 -1XX +2 -1XX +2 -1XX +20 -2XX +1 -4XX +1 -1XX +2 -3XX +1 -6XX +2 -5XX +3 -10X +1 -1X +6 -1X +10 -1XX +1 invalidated
umi CTGTAGGGAC = 11 reads: +2 -1 +2 -1 +3 -1 +2 -3 +3 -1 +2 -1 +1 -1 +13 -1 +3 -44 +52 -1 +28 -36X +2 -11X +1 -1X +84 -5 +76 invalidated
umi CTTCCATATA = 61 reads: +382 validated
umi TCGGTTAGCA = 37 reads: -6 +376 non-validated

GOOD CONTIGS

TIG 1[bases=588]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
435-486 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
486-588 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 33 reads
cdr3 = CARRPIAARRGLVWFDPW at 401, score = 8 + 7
umis assigned: [11, 19, 22, 34, 98, 108, 111, 124, 171, 178] and 4 others
of which 14 are surviving nonsolos
reads assigned: 700
start codons at 59, 233, 257, 392, 504, 565
confident = true

TIG 2[bases=578]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
417-578 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=3)
junction support: 3 umis using 17 reads
cdr3 = CQSADSSGTYWVF at 350, score = 8 + 8
umis assigned: [54, 78, 81, 110, 112, 203]
of which 6 are surviving nonsolos
reads assigned: 196
start codons at 35, 96, 165, 183
confident = true
now this is a cell
paired!

ACCGCCATGTATTACTGTGCGAGACGCCCTATAGCAGCTCGTCGTGGGCTTGTCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2812 = TCGTACCGTAATTGGA-1

using 2105 reads

====================================================================================

graph has 680 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 17[5, 62, 68, 80, 82, 90, 92, 100, 102, 105, 114, 119, 121, 133, 157, 331, 342]
surviving nonsolo ucounts = 16[62, 68, 80, 82, 90, 92, 100, 102, 105, 114, 119, 121, 133, 157, 331, 342]
ids = [2, 10, 4, 6, 8, 1, 15, 11, 3, 17, ...]

====================================================================================

UMI info for barcode TCGTACCGTAATTGGA-1 contig 1 = ACTTTCTGAG...
umi TCATTCCGTC = 332 reads: -234X +184 invalidated
umi TTCTGAACTT = 131 reads: +390 -1 +4 -18 +5 non-validated

UMI info for barcode TCGTACCGTAATTGGA-1 contig 2 = GGGGAGGAAC...
umi ATTAATCAGC = 118 reads: +388 validated
umi CAAACAGCGA = 92 reads: +388 validated
umi CATTTCCGTT = 64 reads: +388 validated
umi CCAGCAACTT = 107 reads: +388 validated
umi CCCAATCAGC = 81 reads: +388 validated
umi CCTGCGACCA = 82 reads: +388 validated
umi CGGTTGACCA = 92 reads: +388 validated
umi CGTCAACCGG = 339 reads: +388 validated
umi CTTGCGCCTC = 69 reads: +388 validated
umi GGTCCATATA = 102 reads: +388 validated
umi GGTTGTACCC = 153 reads: -1 +387 non-validated
umi TACCAGCTCA = 121 reads: +388 validated
umi TAGTAATCCC = 101 reads: +341 -26 +21 non-validated
umi TTATTTTGTA = 117 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=613]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=39)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-613 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CARLDGGQFTYFEYW at 377, score = 9 + 7
umis assigned: [16, 18]
of which 2 are surviving nonsolos
reads assigned: 459
start codons at 14, 35, 79, 299, 305, 390, 507
confident = true

TIG 2[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=21)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 233 reads
cdr3 = CQQRYNWPREYTF at 357, score = 9 + 8
umis assigned: [0, 1, 2, 3, 4, 6, 8, 9, 10, 11] and 4 others
of which 14 are surviving nonsolos
reads assigned: 1613
start codons at 36, 241, 466
confident = true
now this is a cell
paired!

GCCGCGGACACGGCCGTCTACTACTGTGCGAGATTGGATGGTGGGCAGTTCACCTACTTTGAATACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTTACAACTGGCCCCGGGAGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2817 = TCGTACCGTAGCTGCC-1

using 140 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 132]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2824 = TCGTACCGTCGCCATG-1

using 191 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 79
nonsolo ucounts = 23[2^13, 3^3, 4^2, 5, 6, 8, 10, 63]
surviving nonsolo ucounts = 1[63]
ids = [42]

====================================================================================

UMI info for barcode TCGTACCGTCGCCATG-1 contig 1 = CTCAGGAGGC...
umi GCAACAACGG = 57 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-33 ==> 8-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
33-384 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
383-421 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
421-506 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CSSYTSSSTVVF at 357, score = 8 + 8
umis assigned: [42]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 33, 190, 234, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2828 = TCGTACCGTCTAGTGT-1

using 73 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[71]
surviving nonsolo ucounts = 1[71]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2833 = TCGTACCGTGCGAAAC-1

using 91 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[89]
surviving nonsolo ucounts = 1[89]
ids = [1]

====================================================================================

UMI info for barcode TCGTACCGTGCGAAAC-1 contig 1 = CCCAGAGGGA...
umi GGATCTCGGC = 81 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=438]
13-361 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
359-398 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
398-438 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQHYGMSPGTF at 337, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 13, 221, 347, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2836 = TCGTACCGTGTGACCC-1

using 2630 reads

====================================================================================

graph has 1428 edges initially, 26 edges after simplification

total ucounts = 334
nonsolo ucounts = 115[2^48, 3^20, 4^5, 5, 6^7, 7, 8, 9, 10, 11, 18, 43, 44, 45, 58^2, 60, 65^2, 67, 68, 69, 71, 72, 73, 76, 78, 79, 81^2, 83, 87^2, 89, 93, 94, 103, 105, 131]
surviving nonsolo ucounts = 27[43, 44, 45, 58^2, 60, 65^2, 68, 69, 71, 72, 73, 76, 78, 79, 81^2, 83, 87^2, 89, 93, 94, 103, 105, 131]
ids = [7, 115, 256, 85, 105, 77, 222, 263, 95, 316, ...]

====================================================================================

UMI info for barcode TCGTACCGTGTGACCC-1 contig 1 = AGGAGTCAGA...
umi AACACAGTTT = 43 reads: +300 -1XX +87 invalidated
umi ACCTGATCTC = 70 reads: +388 validated
umi ATAGATCATA = 91 reads: +388 validated
umi ATCAACTGCC = 63 reads: +388 validated
umi ATGTGTCTGC = 58 reads: +388 validated
umi ATTACATCTA = 86 reads: +388 validated
umi ATTTCTGCAT = 83 reads: +388 validated
umi CACACTATCG = 67 reads: +388 validated
umi CACCGTGTCT = 80 reads: +388 validated
umi CACTCTTCAC = 59 reads: +1 -1 +386 non-validated
umi CAGGACCGTG = 87 reads: +388 validated
umi CCAAGTCCGC = 74 reads: +14 -1XX +310 -2 +5 -1 +55 invalidated
umi CCACCTGCAG = 43 reads: +388 validated
umi CCCAGCAGCA = 48 reads: +147 -1XX +2 -1XX +3 -1XX +1 -3XX +3 -1XX +5 -46X +1 -1XX +1 -2XX +2 -1XX +5 -1XX +14 -1XX +20 -1XX +2 -1XX +3 -1XX +1 -1XX +2 -1XX +2 -1XX +60 -2XX +2 -1XX +1 -20 +6 -3X +1 -2X +6 -1X +1 -1X +2 invalidated
umi CCGATATCGC = 72 reads: +388 validated
umi CCGTAGGTCG = 102 reads: +365 -3X +2 -2 +4 -1 +1 -6 +4 invalidated
umi CTGCCACTGT = 92 reads: +388 validated
umi GGCCACCCAA = 79 reads: +388 validated
umi GTACATACAT = 86 reads: +188 -1XX +199 invalidated
umi GTCACTGGGC = 68 reads: +115 -1X +272 invalidated
umi TCAATTTCTC = 45 reads: -36 +352 non-validated
umi TCACTCCGAG = 76 reads: +388 validated
umi TCAGTGGTGC = 74 reads: +388 validated
umi TCCATTAGGC = 67 reads: +388 validated
umi TGACACAGCC = 104 reads: +2 -2 +384 non-validated
umi TGGACAGTTC = 133 reads: +388 validated
umi TTCTATTCCT = 72 reads: +388 validated

UMI info for barcode TCGTACCGTGTGACCC-1 contig 2 = GGATCACATA...
umi ACATCGAACA = 96 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-366 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 290 reads
cdr3 = CQQYLTSTITF at 354, score = 8 + 8
umis assigned: [7, 37, 75, 77, 85, 87, 91, 95, 98, 105] and 17 others
of which 26 are surviving nonsolos
reads assigned: 1983
start codons at 27, 33, 89, 102, 181, 334, 457
confident = true

TIG 2[bases=531]
60-411 ==> 0-351 on |83|IGHV1-69|L-REGION+V-REGION| [len=351] (mis=22)
433-481 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
481-531 ==> 0-50 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARRGGYGDSYYFDYW at 402, score = 9 + 7
umis assigned: [26]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 60, 254, 258, 357, 421
confident = true
now this is a cell
paired!

GAGGACACGGCCGTCTTTTACTGTGCGCGACGGGGGGGTTATGGTGACTCCTATTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATCTTACTTCCACGATCACTTTCGGCCAAGGGACACGGCTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2850 = TCGTACCTCACAACGT-1

using 19 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2857 = TCGTACCTCATTGCGA-1

using 167 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 5, 152]
surviving nonsolo ucounts = 1[152]
ids = [0]

====================================================================================

UMI info for barcode TCGTACCTCATTGCGA-1 contig 1 = AGAAGTCGGC...
umi ACACCACTTG = 121 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=494]
0-54 ==> 26-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
54-405 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
432-478 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
junction support: 1 umis using 18 reads
cdr3 = CAKGRKRVVVISVVDYW at 396, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 54, 205, 210, 268, 271, 289, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2861 = TCGTACCTCCATGAAC-1

using 189 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[67, 119]
surviving nonsolo ucounts = 2[67, 119]
ids = [4, 0]

====================================================================================

UMI info for barcode TCGTACCTCCATGAAC-1 contig 1 = GCAGGAGTCA...
umi AATCCGGGGT = 118 reads: +388 validated
umi TTTGAGCCTC = 66 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 26 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 183
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 95.2868 = TCGTACCTCGATCCCT-1

using 101 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[100]
surviving nonsolo ucounts = 1[100]
ids = [0]

====================================================================================

UMI info for barcode TCGTACCTCGATCCCT-1 contig 1 = AGCTTCAGCT...
umi ATCCTACTAT = 97 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=508]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
435-508 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAAWDDSLNGPVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!
sorting bam, mem = 0.09
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk095-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk095-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

139.250 seconds used processing barcodes, peak mem = 0.23
