[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.36 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk091-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk091-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk091.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.0 = TACTTACCATGGATGG-1

using 980 reads

====================================================================================

graph has 1528 edges initially, 2 edges after simplification

total ucounts = 416
nonsolo ucounts = 195[2^64, 3^50, 4^21, 5^21, 6^19, 7^6, 8^6, 9^2, 10^2, 11, 13^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.11 = TACTTACGTAGAGTGC-1

using 301 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 290]
surviving nonsolo ucounts = 1[290]
ids = [1]

====================================================================================

UMI info for barcode TACTTACGTAGAGTGC-1 contig 1 = AGTCTCAGTC...
umi ACCGCTTGCC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYSTPPTF at 347, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.16 = TACTTACGTAGTACCT-1

using 845 reads

====================================================================================

graph has 312 edges initially, 6 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[3^2, 8, 223, 289, 311]
surviving nonsolo ucounts = 3[223, 289, 311]
ids = [9, 4, 11]

====================================================================================

UMI info for barcode TACTTACGTAGTACCT-1 contig 1 = GAAGAGCTGC...
umi TTACTAGTGC = 316 reads: +388 validated

UMI info for barcode TACTTACGTAGTACCT-1 contig 2 = AGGAGTCAGT...
umi GACAGCATAA = 290 reads: +388 validated
umi TCACAGGGAC = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQHHGSSPPRTF at 357, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 33, 241, 367, 463
confident = true

TIG 2[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 74 reads
cdr3 = CHQYESVPYTF at 354, score = 9 + 7
umis assigned: [4, 9]
of which 2 are surviving nonsolos
reads assigned: 505
start codons at 27, 33, 89, 102, 241, 337, 364, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.46 = TACTTACGTTTAGCTG-1

using 164 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 1[160]
ids = [2]

====================================================================================

UMI info for barcode TACTTACGTTTAGCTG-1 contig 1 = AGTGACTCCT...
umi GGCATATTAG = 155 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=514]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-514 ==> 0-61 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.62 = TACTTACTCATGGTCA-1

using 19 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.69 = TACTTACTCCATGAAC-1

using 12485 reads

====================================================================================

graph has 6499 edges initially, 62 edges after simplification

total ucounts = 1260
nonsolo ucounts = 632[2^223, 3^128, 4^84, 5^62, 6^31, 7^24, 8^14, 9^10, 10^8, 11^7, 12^4, 13^2, 14^2, 18, 22, 157, 159, 192, 219, 226, 229, 254, 255, 268, 276, 282, 292, 294, 305, 309, 312, 335, 336, 338, 344, 348, 354, 359, 363, 366, 377, 382, 385, 389, 409, 411]
surviving nonsolo ucounts = 33[2, 22, 157, 159, 192, 219, 226, 229, 254, 255, 268, 276, 282, 292, 294, 305, 309, 312, 335, 336, 338, 344, 348, 354, 359, 363, 366, 377, 382, 385, 389, 409, 411]
ids = [142, 822, 448, 559, 315, 1184, 570, 338, 800, 443, ...]

====================================================================================

UMI info for barcode TACTTACTCCATGAAC-1 contig 1 = AGAGCTCTGG...
umi AAATTTCGAC = 304 reads: +385 validated
umi AAGTCTTTCT = 311 reads: +385 validated
umi ACGCCGGCCC = 387 reads: +385 validated
umi ACTCGATTTC = 335 reads: +385 validated
umi ATAGGGCATA = 357 reads: +385 validated
umi ATATCTATAT = 410 reads: +385 validated
umi ATGACGTACC = 367 reads: +385 validated
umi ATGCCTTCGC = 337 reads: +385 validated
umi ATTTACCCAG = 336 reads: +385 validated
umi CAAATACCCT = 204 reads: +102 -2XX +1 -4XX +1 -3XX +1 -6XX +2 -3XX +1 -228X +1 -1XX +1 -1XX +1 -1XX +2 -6XX +1 -3XX +2 -2XX +9 invalidated
umi CAAATGTAAC = 340 reads: +385 validated
umi CAAGTAAGGG = 281 reads: +385 validated
umi CACATTCCAG = 233 reads: +385 validated
umi CCCCCTATTT = 259 reads: +385 validated
umi CCCGCCCGCT = 160 reads: +385 validated
umi CCTACCCTTT = 269 reads: +385 validated
umi CCTTTAACCA = 295 reads: +385 validated
umi CGCACTCCGA = 350 reads: +385 validated
umi CTACCCGGTT = 229 reads: +385 validated
umi CTAGGCTCGC = 276 reads: +385 validated
umi CTTCGACACT = 414 reads: +385 validated
umi CTTTATAACT = 367 reads: +385 validated
umi GACTAGGCCA = 356 reads: +385 validated
umi GGTGTCCGGG = 310 reads: +385 validated
umi GTAGACTTCT = 255 reads: +385 validated
umi GTTGCACCGC = 393 reads: +385 validated
umi TACTTTCGCA = 388 reads: +385 validated
umi TTCACGCACC = 381 reads: +385 validated
umi TTCGGCTAGC = 219 reads: +385 validated
umi TTCTTCCGCC = 295 reads: +385 validated

UMI info for barcode TACTTACTCCATGAAC-1 contig 2 = ACTTTCTGAG...
umi CGTCCTTACC = 138 reads: +430 validated
umi GTCTCTTTCT = 20 reads: +251 -30 +82 -67 non-validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 29 umis using 1394 reads
cdr3 = CQQYGSSPWTF at 368, score = 9 + 8
umis assigned: [21, 53, 130, 149, 226, 234, 265, 273, 306, 315] and 20 others
of which 30 are surviving nonsolos
reads assigned: 9275
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=473]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=2)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
junction support: 1 umis using 8 reads
cdr3 = CARMDLITMVRRTKFDYW at 380, score = 9 + 7
umis assigned: [559, 822]
of which 2 are surviving nonsolos
reads assigned: 153
start codons at 35, 79, 389, 404
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAATGGATCTTATTACTATGGTTCGGCGAACGAAATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.71 = TACTTACTCCCAAGAT-1

using 4099 reads

====================================================================================

graph has 5348 edges initially, 44 edges after simplification

total ucounts = 1493
nonsolo ucounts = 757[2^259, 3^162, 4^110, 5^73, 6^61, 7^28, 8^22, 9^12, 10^8, 11^8, 12^3, 13^3, 14^2, 15, 17, 20, 23, 129, 232]
surviving nonsolo ucounts = 2[129, 232]
ids = [775, 539]

====================================================================================

UMI info for barcode TACTTACTCCCAAGAT-1 contig 1 = GCTCTGCTTC...
umi CGCACTTGTG = 224 reads: +391 validated
umi GATCCGTCTT = 125 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=589]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-589 ==> 0-147 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 50 reads
cdr3 = CQSYDSSLSGVVF at 375, score = 8 + 8
umis assigned: [539, 775]
of which 2 are surviving nonsolos
reads assigned: 344
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.79 = TACTTACTCCTCGCAT-1

using 45373 reads

====================================================================================

graph has 14361 edges initially, 92 edges after simplification

total ucounts = 1958
nonsolo ucounts = 975[2^364, 3^175, 4^112, 5^73, 6^42, 7^26, 8^13, 9^8, 10^10, 11^5, 12^6, 13^3, 16^2, 17, 21, 27, 31, 45, 53, 91, 93, 126, 134, 142, 146, 158, 161, 162, 165, 168, 170, 176, 180, 189, 200, 208, 214, 218, 225, 226, 228, 232, 234, 241^2, 245, 246^3, 247, 248, 249^2, 253, 256^4, 257, 259, 260, 262, 263, 265, 268^3, 273, 279, 280^2, 281, 282, 284^3, 285, 286^2, 287^3, 289, 290, 292^3, 293, 294, 295, 296^2, 298^2, 300, 302, 303, 304^2, 306^2, 307, 308, 315, 316^2, 322, 323, 326^2, 330, 332, 333^2, 335^2, 340, 342^2, 344, 348, 349, 350, 355, 360, 361^2, 363, 366, 371, 399, 411, 455, 456, 460, 462, 469, 483, 530, 545, 573, 616, 621, 647, 676, 721, 730, 770, 1143]
surviving nonsolo ucounts = 125[142, 158, 161, 162, 165, 168, 170, 176, 180, 189, 200, 208, 214, 218, 225, 226, 228, 232, 234, 241^2, 245, 246^3, 247, 248, 249^2, 253, 256^4, 257, 259, 260, 262, 263, 265, 268^3, 273, 279, 280^2, 281, 282, 284^3, 285, 286^2, 287^3, 289, 290, 292^3, 293, 294, 295, 296^2, 298^2, 300, 302, 303, 304^2, 306^2, 307, 308, 315, 316^2, 322, 323, 326^2, 330, 332, 333^2, 335^2, 340, 342^2, 344, 348, 349, 350, 355, 360, 361^2, 363, 366, 371, 399, 411, 455, 456, 460, 462, 469, 483, 530, 545, 573, 616, 621, 647, 676, 721, 730, 770, 1143]
ids = [34, 1494, 1101, 1579, 1208, 912, 1895, 792, 888, 1424, ...]

====================================================================================

UMI info for barcode TACTTACTCCTCGCAT-1 contig 1 = ATGGGGGATC...
umi AATAGAGCCC = 268 reads: +394 validated
umi AATATCTCAC = 362 reads: +394 validated
umi AATCTATATA = 200 reads: +394 validated
umi AATCTGGTCC = 298 reads: +394 validated
umi ACAGCCGTTA = 300 reads: +394 validated
umi ACAGGGGGAC = 339 reads: +394 validated
umi ACCCTCATCC = 288 reads: +394 validated
umi ACTAATTGTT = 302 reads: +394 validated
umi ACTGGACTTC = 216 reads: +394 validated
umi ACTTTGCAGG = 272 reads: +394 validated
umi AGATAGCTCG = 323 reads: +394 validated
umi AGGATTGTTT = 342 reads: +394 validated
umi AGTTTTTGGT = 351 reads: +394 validated
umi ATCCTTTCGT = 210 reads: +394 validated
umi ATCGTTCTCG = 288 reads: +394 validated
umi ATGCTCCGTG = 346 reads: +394 validated
umi ATTTACTGTA = 292 reads: +394 validated
umi CAGTGTCGCT = 247 reads: +394 validated
umi CATTTGCACG = 283 reads: +394 validated
umi CCAAATGCTA = 258 reads: +394 validated
umi CCAAGCGACT = 226 reads: +394 validated
umi CCAGGCGCGA = 288 reads: +394 validated
umi CCCCGCTCCG = 414 reads: +394 validated
umi CCCCTTCGAC = 282 reads: +394 validated
umi CCGTTGGCCT = 248 reads: +394 validated
umi CCTCAGACAT = 259 reads: +394 validated
umi CGAGAGGACG = 293 reads: +394 validated
umi CGGCCAACAC = 347 reads: +394 validated
umi CTACCGGAGT = 293 reads: +394 validated
umi CTCCGATCCT = 250 reads: +394 validated
umi CTCCGTCTGC = 255 reads: +394 validated
umi CTGAGTATCA = 312 reads: +394 validated
umi CTGCACTTGG = 370 reads: +394 validated
umi CTGCAGGCCA = 364 reads: +394 validated
umi CTGCTCCATG = 185 reads: +394 validated
umi CTTAACTGCA = 341 reads: +394 validated
umi CTTACCATGC = 168 reads: +394 validated
umi CTTTATGTAT = 304 reads: +394 validated
umi CTTTCTATTG = 319 reads: +394 validated
umi CTTTGTGTCG = 328 reads: +394 validated
umi GATGAGGGCT = 286 reads: +394 validated
umi GCAATCACAT = 273 reads: +394 validated
umi GCATTTCACG = 306 reads: +394 validated
umi GCGCAGCCAA = 398 reads: +394 validated
umi GCGCTTCGTC = 168 reads: +259 -1XX +134 invalidated
umi GCGGCTGCGA = 250 reads: +394 validated
umi GGACCGGTTA = 242 reads: +394 validated
umi GGAGGATAAG = 274 reads: +394 validated
umi GGCATACTTT = 286 reads: +394 validated
umi GGTTAATGGG = 173 reads: +43 -1XX +350 invalidated
umi GTATATGGCA = 288 reads: +394 validated
umi GTGAATCCTA = 230 reads: +394 validated
umi TAAACGCACG = 329 reads: +394 validated
umi TAACCCCCGC = 267 reads: +394 validated
umi TAACCTCCAG = 298 reads: +394 validated
umi TAATAGCGGG = 245 reads: +394 validated
umi TAGTATTACG = 326 reads: +394 validated
umi TATACGCTTG = 195 reads: +375 -6 +4 -1 +8 non-validated
umi TATATAAACC = 232 reads: +394 validated
umi TCACTATACA = 345 reads: +394 validated
umi TCATTTCAAC = 259 reads: +394 validated
umi TCCTCAGTCG = 306 reads: +394 validated
umi TCGCTAGGTG = 333 reads: +394 validated
umi TCGTGCATCA = 162 reads: +394 validated
umi TCTACTTTAC = 266 reads: +394 validated
umi TGCAAGTCTG = 259 reads: +394 validated
umi TGCCAATCTA = 334 reads: +394 validated
umi TTCAGTAGTC = 320 reads: +394 validated
umi TTCGCCACAT = 298 reads: +394 validated
umi TTGAGCCCGT = 256 reads: +394 validated
umi TTGCATTCGA = 293 reads: +394 validated
umi TTGGGTCTGA = 245 reads: +394 validated
umi TTGTCCTACC = 170 reads: +394 validated
umi TTTAGCTCCG = 303 reads: +394 validated
umi TTTCCACATG = 344 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=4)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=3)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 74 umis using 2929 reads
cdr3 = CMQALQTLTF at 372, score = 9 + 9
umis assigned: [92, 93, 101, 102, 129, 132, 153, 181, 194, 207] and 65 others
of which 75 are surviving nonsolos
reads assigned: 20829
start codons at 0, 36, 69, 105, 193, 355, 375, 472
confident = true

REJECT CONTIGS

TIG 1[bases=600]
3-101 ==> 5512-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
54-414 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=4)
425-464 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
464-600 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [15, 34, 57, 133, 212, 233, 276, 291, 293, 295] and 40 others
of which 50 are surviving nonsolos
reads assigned: 19156
start codons at 54, 87, 115, 123, 211, 373, 393, 506
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.88 = TACTTACTCGCTAGCG-1

using 68 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 65]
surviving nonsolo ucounts = 1[65]
ids = [0]

====================================================================================

UMI info for barcode TACTTACTCGCTAGCG-1 contig 1 = CAGTCTCAGT...
umi GTATGACAAC = 63 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=444]
0-21 ==> 26-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
21-372 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
409-444 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQQSYRRPITF at 348, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 21, 27, 83, 96, 232, 331
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.100 = TACTTACTCTACCAGA-1

using 691 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 217, 469]
surviving nonsolo ucounts = 2[217, 469]
ids = [4, 2]

====================================================================================

UMI info for barcode TACTTACTCTACCAGA-1 contig 1 = GCTCTGCTTC...
umi TAGTCAGGGT = 217 reads: +394 validated

UMI info for barcode TACTTACTCTACCAGA-1 contig 2 = AGGAGTCAGT...
umi CCGACCCTAG = 470 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

TIG 2[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQCYSIVLTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 462
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.109 = TACTTACTCTTCAACT-1

using 347 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode TACTTACTCTTCAACT-1 contig 1 = TGATCAGGAC...
umi ACGAATGCTA = 319 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
431-520 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CMQALQTPLFTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 31, 64, 100, 188, 350, 370, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.111 = TACTTACTCTTCCTTC-1

using 542 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 6, 529]
surviving nonsolo ucounts = 1[529]
ids = [4]

====================================================================================

UMI info for barcode TACTTACTCTTCCTTC-1 contig 1 = GGAAAACAGA...
umi CGAGTCTCCG = 502 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-590 ==> 0-162 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 83 reads
cdr3 = CSAWDSSLNVWVF at 361, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 492
start codons at 40, 179, 369, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.139 = TACTTGTAGGTGCAAC-1

using 123 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 117]
surviving nonsolo ucounts = 1[117]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=461]
0-315 ==> 38-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=3)
315-353 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
353-461 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSNHVVF at 289, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 25, 116, 167, 299, 314
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.149 = TACTTGTAGTTAACGA-1

using 232 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 5, 212]
surviving nonsolo ucounts = 1[212]
ids = [3]

====================================================================================

UMI info for barcode TACTTGTAGTTAACGA-1 contig 1 = CTGGGCCTCA...
umi CATAAAGGCT = 198 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=542]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-373 ==> 0-336 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=1)
372-410 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
410-542 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQAWDSSVVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.153 = TACTTGTCAAATTGCC-1

using 67421 reads

====================================================================================

graph has 30941 edges initially, 300 edges after simplification

total ucounts = 4175
nonsolo ucounts = 2147[2^793, 3^397, 4^283, 5^155, 6^92, 7^66, 8^37, 9^18, 10^12, 11^10, 12^7, 13^5, 14^2, 15^3, 16^6, 17^2, 19^2, 21, 22, 24, 30, 33, 45, 49^2, 51, 52, 60^2, 62, 67, 70, 72, 73^2, 76, 78, 79, 84, 86, 87, 88, 90^2, 91, 92^2, 96^2, 97, 101, 103, 104, 110, 112, 115^3, 121^2, 122, 123, 128, 131, 133, 134, 138^2, 140, 142, 143, 144^2, 145, 146, 149^2, 150, 151, 152, 155, 157^2, 162, 163^2, 165, 167^3, 168, 172, 173^2, 174^2, 176, 178, 180, 181^3, 182, 189^2, 192, 193, 194^2, 195^2, 197^3, 198, 200^3, 202, 203, 206, 207, 208^2, 209^3, 210, 211^2, 213, 214^3, 215^2, 217, 219, 220, 221, 222^2, 223, 227, 228, 229^2, 230, 231, 232, 233, 234, 235^3, 236^2, 237, 238, 239, 240, 241, 242^2, 243^2, 244, 246^2, 247^4, 248^2, 249^2, 250^3, 251^2, 252, 253^2, 254, 255, 256, 257, 258^2, 259^2, 260^3, 262, 266^2, 267, 268^2, 269^2, 270^2, 273, 274^2, 275, 276^2, 278, 281, 283^2, 285^2, 286, 288, 289, 290^3, 291, 292, 296, 299^2, 302^3, 303, 304, 305, 306, 309, 313, 315^2, 316, 317^2, 319, 320^2, 321, 326, 327, 329, 330, 333^2, 334, 339, 344, 346, 348, 358, 370, 372, 378, 406, 408, 440, 528, 535, 605, 609^2, 626, 639, 685, 1225]
surviving nonsolo ucounts = 240[49, 62, 70, 72, 76, 78, 79, 86, 87, 88, 90^2, 92, 96^2, 97, 101, 103, 104, 110, 112, 115^3, 121^2, 122, 123, 128, 131, 133, 134, 138^2, 140, 142, 143, 144^2, 145, 146, 149^2, 150, 151, 152, 155, 157^2, 162, 163^2, 165, 167^3, 168, 172, 173^2, 174^2, 176, 178, 180, 181^3, 182, 189^2, 192, 193, 194^2, 195^2, 197^3, 198, 200^3, 202, 203, 206, 207, 208^2, 209^3, 210, 211^2, 213, 214^3, 215^2, 217, 219, 220, 221, 222^2, 223, 227, 228, 229^2, 230, 231, 232, 233, 234, 235^3, 236^2, 237, 238, 239, 240, 241, 242^2, 243^2, 244, 246^2, 247^4, 248^2, 249^2, 250^3, 251^2, 252, 253^2, 254, 255, 256, 257, 258^2, 259^2, 260^3, 262, 266^2, 267, 268^2, 269^2, 270^2, 273, 274^2, 275, 276^2, 278, 281, 283^2, 285^2, 286, 288, 289, 290^3, 291, 292, 296, 299^2, 302^3, 303, 304, 305, 306, 309, 313, 315^2, 316, 317^2, 319, 320^2, 321, 326, 327, 329, 330, 333^2, 334, 339, 344, 346, 348, 358, 370, 372, 378, 406, 408, 440, 528, 535, 605, 609^2, 626, 639, 685, 1225]
ids = [1646, 746, 3041, 2336, 872, 3883, 837, 1641, 1713, 2486, ...]

====================================================================================

UMI info for barcode TACTTGTCAAATTGCC-1 contig 1 = TGGGGAGGAG...
umi AAAAGTAACC = 299 reads: +382 validated
umi AAACATACAT = 280 reads: +382 validated
umi AAACTCAGAG = 217 reads: +382 validated
umi AAAGATTCTG = 255 reads: +319 -1XX +1 -3XX +1 -1XX +1 -9XX +1 -4XX +2 -2XX +1 -26XX +2 -3XX +1 -4XX invalidated
umi AAATTTCTTG = 277 reads: +382 validated
umi AACAATGTCT = 323 reads: +382 validated
umi AACCGTGTCA = 312 reads: +382 validated
umi AACGGGGACG = 251 reads: +382 validated
umi AACTGCATAA = 171 reads: +382 validated
umi AACTGCCCTG = 339 reads: +176 -1XX +1 -1XX +203 invalidated
umi AAGTGACCTC = 272 reads: +382 validated
umi AATCCCTTCC = 323 reads: +382 validated
umi ACACTTCATC = 164 reads: +382 validated
umi ACAGTACAAG = 240 reads: -2X +1 -1XX +378 invalidated
umi ACATAGGCCT = 207 reads: +382 validated
umi ACATTTTGAT = 284 reads: +382 validated
umi ACCTATCCAC = 265 reads: +382 validated
umi ACGATCCGGT = 180 reads: +382 validated
umi ACGCATACAG = 270 reads: +382 validated
umi ACGTGCTGAC = 153 reads: +382 validated
umi ACTCATCATC = 709 reads: +45 -1XX +336 invalidated
umi ACTTAATTAA = 296 reads: +382 validated
umi AGAACACAGG = 280 reads: +382 validated
umi AGATGACATC = 302 reads: +382 validated
umi AGCATCTTTA = 332 reads: +382 validated
umi AGCCTCCCAA = 169 reads: +382 validated
umi AGCGGTATTC = 406 reads: +382 validated
umi AGGACCTGTG = 317 reads: +382 validated
umi AGGGTAATAG = 254 reads: +382 validated
umi AGTAGTAACG = 219 reads: +382 validated
umi AGTCGTTAGG = 227 reads: +382 validated
umi ATAAGATGGC = 122 reads: +382 validated
umi ATACCGGCAT = 294 reads: +268 -1XX +113 invalidated
umi ATCCAGGACC = 277 reads: +382 validated
umi ATCTAACTAC = 250 reads: +382 validated
umi ATCTAGTTCG = 198 reads: +382 validated
umi ATGAATGCGC = 327 reads: +382 validated
umi ATGACTACTA = 214 reads: +382 validated
umi ATGCACAGTG = 270 reads: +382 validated
umi ATGCCGTTGC = 194 reads: +382 validated
umi ATTATACTTC = 331 reads: +382 validated
umi ATTGCGGACG = 269 reads: +382 validated
umi ATTGCTATCT = 127 reads: +382 validated
umi CAACTCTTAC = 246 reads: +382 validated
umi CAAGATCCAT = 292 reads: +382 validated
umi CAAGCTCTAT = 210 reads: +382 validated
umi CAATTTAGCG = 312 reads: +382 validated
umi CACCATACTT = 235 reads: +382 validated
umi CATTGCCTTT = 139 reads: +382 validated
umi CCAAGGACCG = 253 reads: +382 validated
umi CCAGGCCTTC = 168 reads: +382 validated
umi CCATCATCCG = 229 reads: +382 validated
umi CCATCGTGGC = 258 reads: +382 validated
umi CCCAGGGGAT = 95 reads: +382 validated
umi CCGCAGTGAC = 291 reads: +382 validated
umi CCGGCTGACA = 98 reads: +382 validated
umi CCGTCCAGCA = 222 reads: +382 validated
umi CCGTTCCCTT = 222 reads: +382 validated
umi CCGTTGTCCG = 301 reads: +382 validated
umi CCTATGGCCG = 236 reads: +382 validated
umi CCTGACACTA = 285 reads: +382 validated
umi CCTGTCTGTA = 196 reads: +382 validated
umi CGAATTCGAC = 276 reads: +382 validated
umi CGACTTTAGC = 263 reads: +382 validated
umi CGGGACAACA = 233 reads: +382 validated
umi CGGTGCCCAT = 230 reads: +382 validated
umi CGTAAATATA = 372 reads: +382 validated
umi CGTCTTGCTC = 285 reads: +382 validated
umi CGTTTCTACG = 366 reads: +382 validated
umi CTAAATCCTA = 279 reads: -4X +3 -1XX +374 invalidated
umi CTAGCCGTCG = 308 reads: +382 validated
umi CTCAATGGGC = 278 reads: +382 validated
umi CTGCACGCCC = 272 reads: +382 validated
umi CTGCCCTGCA = 255 reads: +382 validated
umi CTGCCTGTGA = 604 reads: -242 +140 non-validated
umi CTGCGGTGCT = 259 reads: +382 validated
umi CTTATATCGT = 236 reads: +382 validated
umi GAAGTTCGAA = 323 reads: +382 validated
umi GACTTTGCGC = 169 reads: +382 validated
umi GAGCGAGGTT = 333 reads: +382 validated
umi GAGGCCATTC = 307 reads: +382 validated
umi GATAGATCCA = 220 reads: +382 validated
umi GATCGTATCA = 320 reads: +382 validated
umi GATCTATTCG = 235 reads: +382 validated
umi GCAACCACCG = 237 reads: +382 validated
umi GCACCCTGCG = 241 reads: +199 -1XX +182 invalidated
umi GCATGTGAGC = 280 reads: +154 -1XX +227 invalidated
umi GCCCTTATTC = 242 reads: +382 validated
umi GCGTTGTTAC = 346 reads: +382 validated
umi GCTGACAACC = 303 reads: +382 validated
umi GGCCACGCTT = 205 reads: +382 validated
umi GGCTAGACCC = 105 reads: +382 validated
umi GGCTCGCCCT = 348 reads: +382 validated
umi GGGCTTACTG = 145 reads: +382 validated
umi GGTCGACCAT = 255 reads: +382 validated
umi GGTGCGCAAC = 152 reads: +382 validated
umi GTACGTGCTC = 250 reads: +382 validated
umi GTAGGTCCGC = 282 reads: +382 validated
umi GTCAATTGCA = 200 reads: +382 validated
umi GTGCAACTGG = 200 reads: +382 validated
umi GTTACACATA = 342 reads: +382 validated
umi GTTGCCACTC = 251 reads: +382 validated
umi TAACCATGAG = 176 reads: +382 validated
umi TAATTTTTTT = 249 reads: +382 validated
umi TACGGCGTGG = 248 reads: +382 validated
umi TACGGCTCCT = 303 reads: +382 validated
umi TACTCCTTTA = 615 reads: +382 validated
umi TACTTACATT = 313 reads: +382 validated
umi TAGCGTAATG = 343 reads: +382 validated
umi TAGTGATGCC = 335 reads: +382 validated
umi TATCGACGCG = 201 reads: +382 validated
umi TATTAGCGTG = 285 reads: +382 validated
umi TCAGGCGTTG = 368 reads: +382 validated
umi TCATCAATGC = 252 reads: +382 validated
umi TCCCACTCTT = 268 reads: +382 validated
umi TCCCCAGTTG = 317 reads: +382 validated
umi TCCGCAACGC = 297 reads: +382 validated
umi TCCGCAGTCG = 440 reads: +382 validated
umi TCCGGTCGTC = 270 reads: -207 +175 non-validated
umi TCCGGTCGTG = 143 reads: -207 +175 non-validated
umi TCGACCACTG = 328 reads: +382 validated
umi TCGATGCCGT = 254 reads: +382 validated
umi TCGCCGCCTG = 262 reads: +382 validated
umi TCTAATGTCC = 96 reads: +36 -1XX +1 -2XX +1 -2XX +2 -1XX +336 invalidated
umi TCTGGGGTTA = 250 reads: +382 validated
umi TCTTCTGCTA = 240 reads: +382 validated
umi TCTTGATGAA = 216 reads: +382 validated
umi TGAACAATTG = 234 reads: +382 validated
umi TGACACGGGC = 407 reads: +382 validated
umi TGAGCGTCTT = 286 reads: +382 validated
umi TGGCCGAGTG = 176 reads: +382 validated
umi TGTAATTCCT = 254 reads: +382 validated
umi TGTCAACTAT = 300 reads: +382 validated
umi TTAATACATT = 534 reads: -279 +13 -2 +2 -1 +85 non-validated
umi TTACCATCGA = 298 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50X +1 -6XX +1 -2XX +1 -7XX +156 invalidated
umi TTACGTACTC = 632 reads: +382 validated
umi TTACTGTTAG = 307 reads: +382 validated
umi TTATGATCGC = 212 reads: +382 validated
umi TTATGTTGGG = 251 reads: +382 validated
umi TTCCCAACAG = 165 reads: +382 validated
umi TTCTACTGAT = 259 reads: +382 validated
umi TTCTTTGTAT = 284 reads: +382 validated
umi TTGGTTTAAG = 248 reads: +382 validated
umi TTTCATCTGC = 249 reads: +382 validated
umi TTTGATTGTT = 240 reads: +382 validated
umi TTTGCATCAG = 618 reads: +3 -1XX +378 invalidated
umi TTTTCGTGTG = 287 reads: +382 validated

UMI info for barcode TACTTGTCAAATTGCC-1 contig 2 = AGCCCTCAGA...
umi AAAAACTCCT = 220 reads: +61 -1XX +368 invalidated
umi AAACCTTTGG = 173 reads: +430 validated
umi AAAGTGCGGT = 206 reads: +430 validated
umi AACTCACAGC = 171 reads: +430 validated
umi ACCAGTACTA = 134 reads: +430 validated
umi ACCGCTCCTG = 85 reads: +424 -1 +5 non-validated
umi ACCTCCTTTT = 152 reads: +430 validated
umi ACGAGCAGAC = 253 reads: +430 validated
umi ACGATCTCTC = 160 reads: +105 -1 +312 -1 +10 -1 non-validated
umi ACGCCGCTCT = 204 reads: +430 validated
umi ACTCGATGTT = 545 reads: +46 -1XX +1 -5XX +1 -1XX +1 -1XX +1 -7XX +1 -4XX +1 -1XX +1 -141X +1 -3XX +1 -5XX +1 -2XX +1 -3XX +1 -1XX +2 -2XX +1 -1XX +191 invalidated
umi AGATGCTTAC = 253 reads: +430 validated
umi AGCCATGGTA = 157 reads: +95 -1X +5 -1 +1 -3X +324 invalidated
umi AGGATGCTCG = 64 reads: +412 -18 non-validated
umi AGGTCTAACC = 157 reads: +430 validated
umi AGTGCTTATA = 149 reads: +430 validated
umi AGTGGGAGGT = 79 reads: +361 -6 +63 non-validated
umi ATAAGTCGCG = 72 reads: +406 -24 non-validated
umi ATACTTTCAC = 145 reads: +401 -1 +28 non-validated
umi ATAGCACGCC = 178 reads: +95 -1XX +334 invalidated
umi ATCACTGTGG = 198 reads: +418 -1 +3 -1 +7 non-validated
umi ATCGTTTCAT = 222 reads: +420 -1 +9 non-validated
umi ATGGAGCGCC = 196 reads: +410 -20 non-validated
umi ATGGCCCTTC = 225 reads: +430 validated
umi ATGGTTCTTA = 142 reads: +400 -21 +3 -1 +5 non-validated
umi ATTGACATAG = 258 reads: +430 validated
umi CACATGTGTA = 116 reads: +430 validated
umi CCACCCCTGG = 164 reads: +430 validated
umi CCCAGGCGCG = 234 reads: +430 validated
umi CCCTGTGGCG = 218 reads: +430 validated
umi CCTAAAGCAT = 259 reads: +418 -1XX +11 invalidated
umi CCTCCCATCG = 137 reads: +430 validated
umi CCTCTCACCG = 116 reads: +398 -1 +6 -1 +9 -1 +4 -1 +9 non-validated
umi CCTGAGAGTC = 234 reads: +430 validated
umi CGACCCGGCC = 157 reads: +430 validated
umi CGAGCACGGA = 176 reads: +430 validated
umi CGCATTCCGA = 110 reads: +410 -20 non-validated
umi CGTTACGCGA = 90 reads: +43 -1 +2 -1X +1 -5X +1 -1X +1 -1X +1 -7X +1 -148X +1 -3X +1 -5X +1 -2X +1 -3X +1 -1X +2 -2XX +1 -1XX +191 invalidated
umi CGTTGGTACC = 52 reads: +375 -2X +1 -52 invalidated
umi CTCACTGTGC = 213 reads: +430 validated
umi CTCATAATGT = 218 reads: +377 -2XX +4 -4XX +1 -1XX +1 -6XX +2 -32 invalidated
umi CTCCTCTTCT = 86 reads: +95 -1 +305 -29 non-validated
umi CTGACTCCTT = 211 reads: +430 validated
umi CTTTCACCTC = 211 reads: +430 validated
umi GCACAGCTCC = 134 reads: +430 validated
umi GCACGTAGGC = 138 reads: +412 -1 +17 non-validated
umi GCATGATCAT = 114 reads: +426 -1 +3 non-validated
umi GCCCCGGAGG = 235 reads: +430 validated
umi GGCGCGTCGG = 70 reads: +425 -5 non-validated
umi GGCGCTCTGG = 200 reads: +423 -7 non-validated
umi GGCTGAAGAT = 117 reads: +430 validated
umi GGTATACCGC = 141 reads: +430 validated
umi GGTTGCCTTT = 117 reads: +423 -7 non-validated
umi GTAAGTTCCT = 197 reads: +354 -3XX +1 -4XX +68 invalidated
umi GTAGACTCTG = 89 reads: +367 -1 +13 -1 +6 -6 +36 non-validated
umi GTGCACTTAA = 88 reads: +60 -1XX +1 -1X +1 -5X +1 -169X +191 invalidated
umi GTGCATGGAG = 245 reads: +140 -1XX +289 invalidated
umi GTTAGTCCAG = 168 reads: +430 validated
umi GTTGCCTCAA = 143 reads: -243 +187 non-validated
umi GTTTTGCCTA = 647 reads: -288 +142 non-validated
umi TAATATTGAT = 258 reads: +430 validated
umi TAATCTTCGC = 57 reads: +33 -1 +2 -1XX +1 -1XX +2 -1XX +1 -1XX +98 -1XX +93 -8 +56 -130 invalidated
umi TACTCACCGA = 203 reads: +430 validated
umi TATCCAAGGT = 191 reads: +423 -7 non-validated
umi TATGAACCTC = 191 reads: +430 validated
umi TCACCATTGC = 132 reads: +407 -23 non-validated
umi TCACGTTCGC = 68 reads: +415 -1 +1 -13 non-validated
umi TCCCACGGAA = 184 reads: +430 validated
umi TCCGGCGAGC = 114 reads: +430 validated
umi TCGTCATCTG = 164 reads: +15 -5X +2 -1XX +407 invalidated
umi TGCGTGTCTA = 186 reads: +430 validated
umi TGCTCCTGTG = 216 reads: +426 -4 non-validated
umi TGTTCTCGGA = 240 reads: +430 validated
umi TTACCCACCC = 213 reads: +430 validated
umi TTCAACTTAC = 180 reads: +430 validated
umi TTCACAGGGA = 219 reads: +372 -1XX +48 -9 invalidated
umi TTCATATCTG = 192 reads: +401 -13 +16 non-validated
umi TTCCCCAATG = 199 reads: +430 validated
umi TTCTAAGTGC = 81 reads: +351 -19 +43 -1 +12 -4 non-validated
umi TTCTGTTCAG = 244 reads: +430 validated
umi TTGTACCCTC = 1107 reads: -390X +3 -2XX +6 -2XX +1 -1XX +2 -1XX +3 -2XX +8 -1XX +8 invalidated
umi TTGTAGTCCG = 230 reads: +430 validated
umi TTGTCATTGG = 100 reads: +430 validated
umi TTGTCGATAT = 99 reads: +95 -1X +285 -2 +28 -1 +1 -8 +5 -1 +3 invalidated
umi TTGTGCGCTC = 100 reads: +430 validated
umi TTTAGTACTC = 235 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=556]
38-286 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 146 umis using 6305 reads
cdr3 = CLHYDNRRRTF at 359, score = 9 + 8
umis assigned: [15, 24, 38, 44, 76, 81, 105, 115, 139, 140] and 137 others
of which 147 are surviving nonsolos
reads assigned: 39051
start codons at 38, 94, 107, 246, 369, 462
confident = true

TIG 2[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=38)
463-509 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 61 umis using 1070 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [1, 31, 56, 129, 379, 427, 446, 474, 478, 487] and 76 others
of which 85 are surviving nonsolos
reads assigned: 15593
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

REJECT CONTIGS

TIG 1[bases=436]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-366 ==> 0-330 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
cdr3 = CQQYYSTPGTLLAR at 357, score = 9 + 4
umis assigned: [386, 3476]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 36, 244
confident = false
not full
frameshifted full length transcript of length 436
VJ delta = 22
not full
now this is a cell
paired!

GCTGTGTATTACTGTGCGCGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTATCCCGACTACTGGGGTCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.154 = TACTTGTCAACACCCG-1

using 591 reads

====================================================================================

graph has 244 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 5, 9, 29, 247, 293]
surviving nonsolo ucounts = 3[29, 247, 293]
ids = [4, 8, 9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=564]
1-303 ==> 30-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=47)
315-353 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
353-564 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQVWDRSRDHVVF at 286, score = 7 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 32, 170, 269, 314
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.156 = TACTTGTCAACTGCGC-1

using 1715 reads

====================================================================================

graph has 2044 edges initially, 28 edges after simplification

total ucounts = 383
nonsolo ucounts = 269[2^47, 3^45, 4^28, 5^34, 6^28, 7^14, 8^16, 9^15, 10^6, 11^8, 12^5, 13^5, 14^5, 15^4, 16, 17^4, 18^2, 19^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.161 = TACTTGTCAATACGCT-1

using 365 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 150, 209]
surviving nonsolo ucounts = 2[150, 209]
ids = [1, 0]

====================================================================================

UMI info for barcode TACTTGTCAATACGCT-1 contig 1 = GCTCTGCCTC...
umi ACCTGAACTA = 204 reads: +394 validated
umi ACCTGAACTG = 145 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=594]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-594 ==> 0-149 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 51 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 343
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.164 = TACTTGTCAATTGCTG-1

using 293 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[291]
surviving nonsolo ucounts = 1[291]
ids = [0]

====================================================================================

UMI info for barcode TACTTGTCAATTGCTG-1 contig 1 = GGTCAGTCCC...
umi CGCTTCCGAT = 295 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
30-278 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLHYDNRRRTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 30, 86, 99, 238, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.168 = TACTTGTCACATCTTT-1

using 571 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[122, 216, 233]
surviving nonsolo ucounts = 2[216, 233]
ids = [0, 1]

====================================================================================

UMI info for barcode TACTTGTCACATCTTT-1 contig 1 = GGAGTCAGAC...
umi ATCCAATTTC = 218 reads: +388 validated
umi CAGTATGAGT = 235 reads: +388 validated
umi GAAAGTCGGC = 60 reads: +17 -1XX +33 -1XX +9 -2XX +26 -1XX +3 -2XX +15 -1XX +25 -1XX +3 -1XX +6 -4XX +2 -2XX +2 -1XX +2 -2XX +2 -4XX +4 -30 +8 -1XX +1 -1XX +5 -1XX +13 -2XX +20 -1XX +2 -1XX +17 -1XX +2 -1XX +3 -1XX +5 -69X +6 -2XX +12 -1XX +2 -2XX +6 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 83 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [0, 1, 2]
of which 2 are surviving nonsolos
reads assigned: 503
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.182 = TACTTGTCACTATCTT-1

using 2126 reads

====================================================================================

graph has 671 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 4^3, 9, 284, 1812]
surviving nonsolo ucounts = 2[284, 1812]
ids = [12, 1]

====================================================================================

UMI info for barcode TACTTGTCACTATCTT-1 contig 1 = GAAGAGCTGC...
umi TTGTTACGTC = 271 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=492]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSLFTF at 357, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.185 = TACTTGTCAGATAATG-1

using 3127 reads

====================================================================================

graph has 3642 edges initially, 46 edges after simplification

total ucounts = 988
nonsolo ucounts = 522[2^178, 3^113, 4^81, 5^46, 6^41, 7^18, 8^19, 9^16, 11^3, 12^2, 14, 82, 85, 249, 257]
surviving nonsolo ucounts = 4[82, 85, 249, 257]
ids = [538, 187, 212, 594]

====================================================================================

UMI info for barcode TACTTGTCAGATAATG-1 contig 1 = AGCTTCAGCT...
umi CACTACTACT = 241 reads: +388 validated

UMI info for barcode TACTTGTCAGATAATG-1 contig 2 = AGCTCTGAGA...
umi CAAGTACCTT = 83 reads: +424 validated
umi CTTGTCACTC = 80 reads: +388 -1 +35 non-validated

UMI info for barcode TACTTGTCAGATAATG-1 contig 3 = GGAGTCAGAC...
umi GCATATTCGT = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [212]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 47, 201, 351, 376, 381
confident = true

TIG 2[bases=563]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-563 ==> 0-60 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 19 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [187, 538]
of which 2 are surviving nonsolos
reads assigned: 161
start codons at 79, 230, 235, 382, 460
confident = true

TIG 3[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [594]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.202 = TACTTGTCATGTCTCC-1

using 2668 reads

====================================================================================

graph has 2708 edges initially, 30 edges after simplification

total ucounts = 877
nonsolo ucounts = 410[2^180, 3^86, 4^49, 5^42, 6^19, 7^13, 8^3, 9^5, 10^4, 11^2, 12, 13^2, 14^2, 237, 538]
surviving nonsolo ucounts = 2[237, 538]
ids = [110, 525]

====================================================================================

UMI info for barcode TACTTGTCATGTCTCC-1 contig 1 = GCTGTGGGTC...
umi ACGTTGGGCA = 230 reads: +382 validated
umi GGAGAACCCC = 533 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=589]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
420-589 ==> 0-169 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 139 reads
cdr3 = CQSADSSGTPWVF at 353, score = 8 + 8
umis assigned: [110, 525]
of which 2 are surviving nonsolos
reads assigned: 756
start codons at 38, 99, 168, 186
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.218 = TACTTGTGTCAAAGCG-1

using 268 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 5, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode TACTTGTGTCAAAGCG-1 contig 1 = AGTCTGGGCC...
umi GTACCCGTTA = 246 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=563]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=30)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-563 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQVWYSNSDHVVF at 355, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 40, 235, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.226 = TACTTGTGTCGAACAG-1

using 11760 reads

====================================================================================

graph has 5876 edges initially, 66 edges after simplification

total ucounts = 1015
nonsolo ucounts = 505[2^192, 3^108, 4^61, 5^31, 6^26, 7^15, 8^9, 9^7, 10^5, 11^3, 12^4, 13^2, 14^2, 15, 16, 17, 20, 24, 37, 51, 52, 88, 137, 155, 180, 188, 221, 241, 249, 259^2, 263, 264, 266, 273, 280, 286, 289, 290, 294, 299, 311, 312, 318, 339, 340, 346, 371, 374, 388, 455, 464, 531]
surviving nonsolo ucounts = 36[2, 4, 6, 37, 51, 137, 155, 180, 188, 221, 241, 249, 259^2, 263, 264, 266, 273, 280, 286, 289, 290, 294, 299, 311, 312, 318, 339, 340, 346, 371, 374, 388, 455, 464, 531]
ids = [680, 118, 556, 109, 74, 461, 374, 906, 771, 397, ...]

====================================================================================

UMI info for barcode TACTTGTGTCGAACAG-1 contig 1 = AGCTCTCAGA...
umi ACATAGGCTA = 50 reads: +424 validated
umi ACGGTAGGCA = 31 reads: -424 non-validated
umi ATCGGCACTT = 267 reads: +424 validated
umi CGAACGGAGT = 155 reads: +424 validated
umi CGGATTGTAT = 220 reads: +424 validated
umi CTGGCTTGCG = 138 reads: +424 validated
umi GCCCCGGGCA = 6 reads: +32 -6 +56 -1 +112 -217 non-validated
umi TATTTAAGCG = 189 reads: +424 validated

UMI info for barcode TACTTGTGTCGAACAG-1 contig 2 = AGAGCCCTGG...
umi AGCTATGTAG = 300 reads: +370 validated
umi AGCTGTGCTC = 308 reads: +370 validated
umi AGGTATGGGC = 390 reads: +370 validated
umi ATCAGTCATC = 341 reads: +370 validated
umi ATGCAGTGTT = 549 reads: +49 -7XX +2 -6XX +1 -4XX +1 -2XX +1 -13XX +1 -3XX +2 -4XX +1 -1XX +1 -3XX +1 -1XX +266 invalidated
umi CCTTTTACGG = 266 reads: +370 validated
umi CTCAGGCATA = 257 reads: +370 validated
umi CTCGCACGTA = 341 reads: +370 validated
umi GAACACGCCC = 471 reads: +49 -7XX +2 -6XX +1 -4XX +1 -2X +1 -13X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +1 -1XX +266 invalidated
umi GCCCTTTATA = 301 reads: +370 validated
umi GCTATACCGT = 311 reads: +370 validated
umi GCTGCCTACT = 287 reads: +370 validated
umi GGATCCTTCT = 355 reads: +49 -7XX +2 -6XX +1 -4XX +1 -2X +1 -13X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +1 -1XX +266 invalidated
umi TAATTAAGAG = 303 reads: +60 -1XX +309 invalidated
umi TACGCTGGGT = 374 reads: +370 validated
umi TACTTGTGTT = 374 reads: +370 validated
umi TCAAAGGTTC = 315 reads: +370 validated
umi TCCCGCGGGT = 243 reads: +370 validated
umi TCCTATCTTC = 268 reads: +370 validated
umi TGTCAGACCT = 281 reads: +370 validated
umi TGTTATCTTC = 186 reads: +370 validated
umi TTAGTTGCGG = 270 reads: +370 validated
umi TTATTTTCCC = 285 reads: +370 validated
umi TTCCGTATGA = 256 reads: +370 validated
umi TTTGCACGTG = 242 reads: +370 validated
umi TTTTTTATCT = 480 reads: +49 -7XX +2 -6XX +1 -4XX +1 -2XX +1 -13XX +1 -3XX +2 -4XX +1 -1XX +1 -3XX +1 -1XX +266 invalidated

GOOD CONTIGS

TIG 1[bases=685]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
79-414 ==> 0-335 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=21)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
503-685 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 6 umis using 103 reads
cdr3 = CALGYCDGGSCSALDYW at 421, score = 8 + 7
umis assigned: [74, 109, 196, 374, 397, 461, 556, 771]
of which 8 are surviving nonsolos
reads assigned: 1041
start codons at 79, 235, 325, 356, 382, 440
confident = true

TIG 2[bases=550]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-370 ==> 0-326 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=8)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 1481 reads
cdr3 = CQGPITF at 365, score = 9 + 8
umis assigned: [141, 144, 155, 192, 207, 372, 438, 445, 491, 557] and 16 others
of which 26 are surviving nonsolos
reads assigned: 8151
start codons at 44, 249, 252, 456
confident = true
now this is a cell
paired!

GACACGGCTGTCTACTACTGTGCCTTAGGATATTGTGATGGTGGTAGCTGCTCCGCACTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTATTGTCAAGGGCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAGGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.232 = TACTTGTGTGAGGGAG-1

using 503 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 5, 8, 229, 252]
surviving nonsolo ucounts = 2[229, 252]
ids = [3, 2]

====================================================================================

UMI info for barcode TACTTGTGTGAGGGAG-1 contig 1 = AGGAGTCAGT...
umi CCAAATTATG = 232 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
380-412 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYDNLPGF at 354, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false

REJECT CONTIGS

TIG 1[bases=371]
26-205 ==> 177-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
202-240 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
240-371 ==> 0-131 on |307|IGLC3|C-REGION| [len=317] (mis=1)
cdr3 = CQCYDNSLTGWGF at 173, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 3, 156, 183, 319
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.243 = TACTTGTGTTTAGCTG-1

using 302 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode TACTTGTGTTTAGCTG-1 contig 1 = GAGGAACTGC...
umi GTTATATTGC = 284 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=8)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-507 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNTWPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 33, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.245 = TACTTGTTCAAACCAC-1

using 574 reads

====================================================================================

graph has 274 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2, 6, 8^2, 27, 239, 278]
surviving nonsolo ucounts = 3[27, 239, 278]
ids = [5, 10, 0]

====================================================================================

UMI info for barcode TACTTGTTCAAACCAC-1 contig 1 = ACCCAAAAAC...
umi AAAGTTTCGT = 260 reads: +436 validated
umi ATGGTCTTCA = 28 reads: +51 -1 +2 -1 +3 -1 +1 -1 +1 -1 +1 -1 +277 -40 +5 -1 +48 non-validated

GOOD CONTIGS

TIG 1[bases=511]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-511 ==> 0-21 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0, 5]
of which 2 are surviving nonsolos
reads assigned: 285
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.246 = TACTTGTTCAACACGT-1

using 267 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 7, 251]
surviving nonsolo ucounts = 1[251]
ids = [3]

====================================================================================

UMI info for barcode TACTTGTTCAACACGT-1 contig 1 = AGGAGTCAGA...
umi CCGAGCCCCA = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.247 = TACTTGTTCAACGGGA-1

using 586 reads

====================================================================================

graph has 216 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[107, 223, 250]
surviving nonsolo ucounts = 3[107, 223, 250]
ids = [2, 7, 1]

====================================================================================

UMI info for barcode TACTTGTTCAACGGGA-1 contig 1 = GAGGAATCAG...
umi ACCTAGTGTT = 250 reads: +388 validated
umi ATTTAGTCTC = 108 reads: +388 validated
umi GTGTGAGAGC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 96 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1, 2, 7]
of which 3 are surviving nonsolos
reads assigned: 570
start codons at 28, 34, 103, 239, 458
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.252 = TACTTGTTCACTATTC-1

using 118 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 4, 10, 97]
surviving nonsolo ucounts = 1[97]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=380]
0-327 ==> 24-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
327-364 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
cdr3 = CQQLNSYPLTF at 303, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 89
start codons at 38, 187
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.253 = TACTTGTTCACTTCAT-1

using 2191 reads

====================================================================================

graph has 714 edges initially, 12 edges after simplification

total ucounts = 22
nonsolo ucounts = 14[2^2, 3, 7, 9, 79, 124, 149, 199, 214, 239, 240, 391, 525]
surviving nonsolo ucounts = 9[79, 124, 149, 199, 214, 239, 240, 391, 525]
ids = [5, 2, 21, 17, 0, 8, 15, 11, 3]

====================================================================================

UMI info for barcode TACTTGTTCACTTCAT-1 contig 1 = AGAGAGGTGC...
umi AACACGGCCG = 218 reads: +433 validated
umi AATCGTGTTC = 123 reads: +433 validated
umi ACCTCGGTCA = 519 reads: -265X +168 invalidated
umi ACTTTCTGTC = 80 reads: +413 -20 non-validated
umi ATCGCTTACC = 241 reads: +433 validated
umi CGGTTTGCAT = 385 reads: +433 validated
umi TATCTATTCT = 202 reads: +433 validated

UMI info for barcode TACTTGTTCACTTCAT-1 contig 2 = GAAGTCTCTC...
umi TACACGCGGC = 242 reads: +388 validated
umi TTGCAGCATG = 149 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=576]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=11)
456-505 ==> 12-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 107 reads
cdr3 = CASLLFYGSGRNLVYYMDVW at 414, score = 9 + 7
umis assigned: [0, 2, 3, 5, 8, 11, 17]
of which 7 are surviving nonsolos
reads assigned: 1740
start codons at 72, 228, 349, 375, 433, 462
confident = true

TIG 2[bases=550]
0-26 ==> 5-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 54 reads
cdr3 = CQKYNSAPYTF at 353, score = 9 + 8
umis assigned: [15, 21]
of which 2 are surviving nonsolos
reads assigned: 388
start codons at 26, 32, 88, 101, 237, 336, 456
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGAGTTTACTCTTCTATGGTTCGGGGAGAAACCTCGTTTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.260 = TACTTGTTCCCAAGAT-1

using 267 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [1]

====================================================================================

UMI info for barcode TACTTGTTCCCAAGAT-1 contig 1 = ATCAGTCCCA...
umi TACCTAGACC = 265 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.261 = TACTTGTTCCCAGGTG-1

using 21 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.264 = TACTTGTTCCGCGGTA-1

using 3987 reads

====================================================================================

graph has 1816 edges initially, 30 edges after simplification

total ucounts = 293
nonsolo ucounts = 123[2^53, 3^26, 4^16, 5^8, 6^5, 7^3, 8, 9, 11, 13, 186, 223, 235, 241, 287, 586, 812, 867]
surviving nonsolo ucounts = 7[186, 223, 235, 287, 586, 812, 867]
ids = [206, 139, 188, 133, 198, 286, 164]

====================================================================================

UMI info for barcode TACTTGTTCCGCGGTA-1 contig 1 = GCTCTGCTTC...
umi CTAATCGCTA = 289 reads: +391 validated
umi CTCGCCTCAT = 224 reads: +391 validated
umi GGTCAGCTTA = 237 reads: +391 validated

UMI info for barcode TACTTGTTCCGCGGTA-1 contig 2 = GGCTTTCTGA...
umi TAAGAGCCGA = 179 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 3 umis using 112 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [133, 139, 188]
of which 3 are surviving nonsolos
reads assigned: 737
start codons at 51, 205, 208, 259, 358, 385, 406, 574
confident = true

TIG 2[bases=481]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=10)
415-466 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
junction support: 1 umis using 17 reads
cdr3 = CARMVRGVIPYTNWFDPW at 381, score = 8 + 7
umis assigned: [206]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 15, 24, 36, 80, 256, 390
confident = true

REJECT CONTIGS

TIG 1[bases=357]
1-100 ==> 1439-1538 on segment before IGLJ7 exon 1 [len=1538] (mis=0)
100-146 ==> 0-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
146-357 ==> 0-211 on |308|IGLC7|C-REGION| [len=317] (mis=1)
umis assigned: [97, 164, 198, 286]
of which 3 are surviving nonsolos
reads assigned: 2259
start codons at 12, 278, 341
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCTGTATTTTACTGTGCGAGAATGGTTCGGGGAGTTATTCCATATACTAATTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTATGTCTTCGGACCTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.266 = TACTTGTTCCGTTGCT-1

using 45 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.273 = TACTTGTTCGCCAAAT-1

using 209 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [1]

====================================================================================

UMI info for barcode TACTTGTTCGCCAAAT-1 contig 1 = GCTGGGGTCT...
umi ATCCGACTTT = 198 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=593]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
432-593 ==> 0-161 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSYTSSSTLWVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.278 = TACTTGTTCTCCTATA-1

using 181 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[4, 7, 12, 156]
surviving nonsolo ucounts = 1[156]
ids = [1]

====================================================================================

UMI info for barcode TACTTGTTCTCCTATA-1 contig 1 = GGGGGGGGTC...
umi AGCAAACGCC = 153 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=590]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=3)
42-400 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=5)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
433-590 ==> 0-157 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CCSYAGSYTLYVF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 42, 181, 199, 243, 250, 253, 349, 376, 397, 565
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.285 = TACTTGTTCTGTACGA-1

using 376 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 7[2^2, 3^2, 6, 9, 341]
surviving nonsolo ucounts = 1[341]
ids = [13]

====================================================================================

UMI info for barcode TACTTGTTCTGTACGA-1 contig 1 = GAAGAGCTGC...
umi TTAAGTGCCG = 313 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYGSSPTF at 357, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.303 = TAGACCAAGCCACGCT-1

using 328 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode TAGACCAAGCCACGCT-1 contig 1 = GAGGAATCAG...
umi ACTATGCCGT = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-495 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.312 = TAGACCAAGCTACCGC-1

using 188 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3^2, 4, 171]
surviving nonsolo ucounts = 1[171]
ids = [2]

====================================================================================

UMI info for barcode TAGACCAAGCTACCGC-1 contig 1 = GGCTGGGGTC...
umi AAGAATCTGC = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-555 ==> 0-125 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.314 = TAGACCAAGCTTATCG-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.316 = TAGACCAAGGACTGGT-1

using 207 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode TAGACCAAGGACTGGT-1 contig 1 = GCTGGGGTCA...
umi CGTTTGCACT = 199 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=559]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-559 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 42 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.320 = TAGACCAAGGGATACC-1

using 307 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 299]
surviving nonsolo ucounts = 1[299]
ids = [5]

====================================================================================

UMI info for barcode TAGACCAAGGGATACC-1 contig 1 = ACAACAGGCA...
umi TCAGCTCGGT = 305 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=564]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
391-428 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYYSTPPLTF at 364, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 25, 94, 347, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.322 = TAGACCAAGGTACTCT-1

using 217 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=360]
7-207 ==> 99-299 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=11)
284-332 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
332-360 ==> 0-28 on |40|IGHG1|C-REGION| [len=884] (mis=0)
cdr3 = CVRGGRSLWFGDLLDYW at 250, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 64, 122, 125, 273
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.325 = TAGACCAAGTAGATGT-1

using 448 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 193, 249]
surviving nonsolo ucounts = 2[193, 249]
ids = [4, 2]

====================================================================================

UMI info for barcode TAGACCAAGTAGATGT-1 contig 1 = GAGGAATCAG...
umi CGTCTGTGTT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 28, 34, 103, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=474]
0-348 ==> 5-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
397-431 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
431-474 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 337, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 193, 198, 215, 259, 292
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.332 = TAGACCAAGTGCTGCC-1

using 2779 reads

====================================================================================

graph has 1436 edges initially, 14 edges after simplification

total ucounts = 163
nonsolo ucounts = 74[2^33, 3^13, 4^5, 5^7, 6^3, 7^2, 9, 13, 67, 165, 177, 216, 257, 333, 343, 347, 571]
surviving nonsolo ucounts = 8[67, 165, 216, 257, 333, 343, 347, 571]
ids = [115, 123, 67, 41, 86, 51, 87, 149]

====================================================================================

UMI info for barcode TAGACCAAGTGCTGCC-1 contig 1 = TGGGGAGGAA...
umi CACGTTACCA = 345 reads: +382 validated
umi GAGTGAAAGC = 336 reads: +382 validated
umi GAGTGAAAGG = 346 reads: +382 validated
umi TCATTCAGTT = 164 reads: +382 validated
umi TTCCCTTGGG = 574 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
37-374 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 284 reads
cdr3 = CQQYDNWSTF at 361, score = 9 + 8
umis assigned: [51, 86, 87, 123, 149]
of which 5 are surviving nonsolos
reads assigned: 1737
start codons at 37, 245, 371, 461
confident = true

REJECT CONTIGS

TIG 1[bases=523]
0-296 ==> 56-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=1)
294-345 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
345-523 ==> 0-178 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
umis assigned: [115]
of which 1 are surviving nonsolos
reads assigned: 64
start codons at 67, 115, 187, 289, 469, 507
confident = false
did not find CDR3

TIG 2[bases=409]
22-276 ==> 99-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=27)
296-344 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
344-409 ==> 0-65 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CANAPRSTYNPPFDYW at 265, score = 8 + 7
umis assigned: [41, 67]
of which 2 are surviving nonsolos
reads assigned: 360
start codons at 42, 74, 79, 140, 226, 398
confident = false
VJ delta = 8
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.354 = TAGACCACACCGATAT-1

using 257 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.366 = TAGACCACAGGCGATA-1

using 279 reads

====================================================================================

graph has 87 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode TAGACCACAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi CACGTTGGCA = 266 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=559]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-559 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.367 = TAGACCACAGGTCCAC-1

using 1658 reads

====================================================================================

graph has 2548 edges initially, 40 edges after simplification

total ucounts = 739
nonsolo ucounts = 324[2^128, 3^73, 4^35, 5^36, 6^11, 7^15, 8^9, 9^4, 10^4, 11^3, 12, 13, 14, 16, 17, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.369 = TAGACCACAGGTGCCT-1

using 168 reads

====================================================================================

graph has 90 edges initially, 12 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 4, 21, 27, 108]
surviving nonsolo ucounts = 2[27, 108]
ids = [7, 10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=511]
0-338 ==> 13-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
336-375 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
375-511 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQGNSFPYTF at 314, score = 9 + 8
umis assigned: [2, 7, 10]
of which 2 are surviving nonsolos
reads assigned: 120
start codons at 49, 62, 417
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.371 = TAGACCACAGTCAGCC-1

using 226 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 221]
surviving nonsolo ucounts = 1[221]
ids = [3]

====================================================================================

UMI info for barcode TAGACCACAGTCAGCC-1 contig 1 = GCTCTGCTTC...
umi TTCGTCCCCC = 216 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-579 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.374 = TAGACCACATCAGTAC-1

using 316 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[312]
surviving nonsolo ucounts = 1[312]
ids = [1]

====================================================================================

UMI info for barcode TAGACCACATCAGTAC-1 contig 1 = GGGGAGGAAC...
umi ATGCACATCC = 317 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPHTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.383 = TAGACCAGTAAGTGTA-1

using 255 reads

====================================================================================

graph has 57 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 245]
surviving nonsolo ucounts = 1[245]
ids = [2]

====================================================================================

UMI info for barcode TAGACCAGTAAGTGTA-1 contig 1 = GCTGTGGGTC...
umi GTCCTATGTG = 245 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=476]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
382-420 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
420-476 ==> 0-56 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQSADSSGTYYVF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 38, 99, 168, 186, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.392 = TAGACCAGTCAGATAA-1

using 349 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^3, 336]
surviving nonsolo ucounts = 1[336]
ids = [3]

====================================================================================

UMI info for barcode TAGACCAGTCAGATAA-1 contig 1 = GTCTCAGGAG...
umi CCATCACACC = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
35-396 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
423-525 ==> 0-102 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CSSYTSSSTLVF at 359, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 35, 192, 236, 243, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.393 = TAGACCAGTCATACTG-1

using 256 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [1]

====================================================================================

UMI info for barcode TAGACCAGTCATACTG-1 contig 1 = GTGGGCTCAG...
umi ATCTGATTGG = 254 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=629]
0-36 ==> 4-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
36-373 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
418-629 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CNSRDSSGNHLVF at 351, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 36, 155, 184, 235, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.402 = TAGACCAGTGCTGTAT-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.404 = TAGACCAGTGTGAATA-1

using 330 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 321]
surviving nonsolo ucounts = 1[321]
ids = [4]

====================================================================================

UMI info for barcode TAGACCAGTGTGAATA-1 contig 1 = GAGAGTCAGT...
umi GGTTAATCTG = 305 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=456]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-456 ==> 0-38 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQSYSTPPYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 27, 33, 89, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.406 = TAGACCAGTTCGAATC-1

using 280 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 274]
surviving nonsolo ucounts = 1[274]
ids = [3]

====================================================================================

UMI info for barcode TAGACCAGTTCGAATC-1 contig 1 = GTCAGTCTCA...
umi GTTACAATCG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.409 = TAGACCATCAAACCGT-1

using 318 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 307]
surviving nonsolo ucounts = 1[307]
ids = [4]

====================================================================================

UMI info for barcode TAGACCATCAAACCGT-1 contig 1 = GCTTCAGCTG...
umi CTACTAAAGC = 305 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=21)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
437-577 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQSYDSSLSGEVF at 370, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 46, 203, 254, 308, 353, 380, 569
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.411 = TAGACCATCAACGGGA-1

using 282 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 277]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TAGACCATCAACGGGA-1 contig 1 = ACTTTCTGAG...
umi CTAGGTTAGG = 276 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=583]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=42)
408-471 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
471-583 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARGREYASGQDYYYGMDVW at 380, score = 9 + 7
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 271
start codons at 35, 79, 258, 399, 428
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.420 = TAGACCATCCACTGGG-1

using 170 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================

UMI info for barcode TAGACCATCCACTGGG-1 contig 1 = GTCAGACCCT...
umi GATCAGGACC = 152 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-507 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.423 = TAGACCATCCAGTATG-1

using 1429 reads

====================================================================================

graph has 488 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 5, 420, 997]
surviving nonsolo ucounts = 2[420, 997]
ids = [1, 7]

====================================================================================

UMI info for barcode TAGACCATCCAGTATG-1 contig 1 = CAGAGCTCTG...
umi ACAATTATAG = 387 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=501]
0-45 ==> 7-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
45-393 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-501 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGSSLITF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 382
start codons at 45, 253, 379, 472
confident = false

REJECT CONTIGS

TIG 1[bases=328]
4-79 ==> 281-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
79-117 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
117-328 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 47, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 984
start codons at 30, 57, 81, 249
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.425 = TAGACCATCCATGCTC-1

using 435 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[431]
surviving nonsolo ucounts = 1[431]
ids = [1]

====================================================================================

UMI info for barcode TAGACCATCCATGCTC-1 contig 1 = AGGAGTCAGT...
umi GATAGCAATG = 432 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 81 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 425
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.427 = TAGACCATCCGCAGTG-1

using 7636 reads

====================================================================================

graph has 3490 edges initially, 62 edges after simplification

total ucounts = 502
nonsolo ucounts = 225[2^93, 3^40, 4^24, 5^10, 6^9, 7^7, 8^4, 9^4, 11^2, 13, 15, 16, 18, 22, 33, 35, 84, 86, 104, 105, 117, 158, 162, 177, 179, 184, 201, 202, 214, 222, 243, 246, 253, 256, 311, 315, 320, 350, 354, 831, 888]
surviving nonsolo ucounts = 25[84, 86, 104, 105, 117, 158, 162, 177, 179, 184, 201, 202, 214, 222, 243, 246, 253, 256, 311, 315, 320, 350, 354, 831, 888]
ids = [82, 185, 376, 223, 28, 170, 399, 439, 401, 406, ...]

====================================================================================

UMI info for barcode TAGACCATCCGCAGTG-1 contig 1 = AGTCTGGGCC...
umi AGATTACGTG = 253 reads: +382 validated
umi CATAGATCAC = 320 reads: +382 validated
umi CCAATCTGCT = 909 reads: -340X +1 -3XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi CCACGAGGTG = 158 reads: +382 validated
umi TAGAACGCGG = 105 reads: +382 validated
umi TCCCCGCACA = 170 reads: +382 validated
umi TGCCAGGCTA = 867 reads: -340X +1 -3XX +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TGTACATGGG = 205 reads: +382 validated

UMI info for barcode TAGACCATCCGCAGTG-1 contig 2 = AGCTCTGGGA...
umi CAGAAGCAGC = 250 reads: +418 validated
umi CCGGCGAGCT = 87 reads: +379 -39 non-validated
umi CTTCAGCTGT = 300 reads: +418 validated
umi CTTTAAACCC = 352 reads: +418 validated
umi GACTAAACGC = 199 reads: +418 validated
umi GGAAAAGCAA = 248 reads: +418 validated
umi GTATCTGTGC = 214 reads: +272 -1XX +145 invalidated
umi GTTATGCCAG = 204 reads: +418 validated
umi TATATCCCCT = 319 reads: +418 validated
umi TCATTTTCTT = 163 reads: +418 validated
umi TCCACGGGCA = 167 reads: +418 validated
umi TCTGGTCTTA = 318 reads: +418 validated
umi TGCCCCGCGT = 177 reads: +399 -19 non-validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-385 ==> 0-345 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=1)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=3)
junction support: 6 umis using 192 reads
cdr3 = CQVWDSSSDHYVF at 355, score = 8 + 8
umis assigned: [79, 156, 166, 170, 376, 406, 438, 457]
of which 8 are surviving nonsolos
reads assigned: 2858
start codons at 40, 101, 239, 242, 338, 386
confident = true

TIG 2[bases=569]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=7)
452-498 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
498-569 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 170 reads
cdr3 = CARDLSSSGWYSGFW at 422, score = 9 + 7
umis assigned: [147, 185, 242, 248, 260, 299, 331, 355, 382, 399] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2950
start codons at 80, 236, 383
confident = true

REJECT CONTIGS

TIG 1[bases=645]
0-476 ==> 2013-2489 on rc of segment before IGHD2-21 exon 1 [len=2489] (mis=4)
511-574 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
574-645 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [82, 135, 200, 223]
of which 3 are surviving nonsolos
reads assigned: 449
start codons at 108, 144, 186, 189, 215, 231, 237, 265, 303, 484, 531
confident = false
did not find CDR3
now this is a cell
paired!

GCCGAGGACACGGCCGTGTATTACTGTGCGAGAGATTTGAGTAGCAGTGGCTGGTACTCGGGTTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.428 = TAGACCATCCGTCATC-1

using 1498 reads

====================================================================================

graph has 2322 edges initially, 20 edges after simplification

total ucounts = 721
nonsolo ucounts = 313[2^130, 3^76, 4^43, 5^24, 6^19, 7^9, 8^5, 9, 10, 11^2, 14, 16, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.434 = TAGACCATCGGCATCG-1

using 254 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode TAGACCATCGGCATCG-1 contig 1 = ATCAGTCCCA...
umi GTTCAGTATA = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-506 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.441 = TAGACCATCTACGAGT-1

using 121 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 110]
surviving nonsolo ucounts = 1[110]
ids = [6]

====================================================================================

UMI info for barcode TAGACCATCTACGAGT-1 contig 1 = ACCCAAAAAC...
umi GCTCGCCGCC = 105 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=496]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.447 = TAGACCATCTTCAACT-1

using 241 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 228]
surviving nonsolo ucounts = 1[228]
ids = [2]

====================================================================================

UMI info for barcode TAGACCATCTTCAACT-1 contig 1 = GGCGCCAGGG...
umi CATACGCTCT = 226 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=533]
0-31 ==> 3-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=16)
378-416 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
416-533 ==> 0-117 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CLLYFGGTYVF at 355, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 31, 323, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.451 = TAGAGCTAGACAGGCT-1

using 153 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 1[150]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTAGACAGGCT-1 contig 1 = CCAGAGGGAA...
umi CGCACTCCCT = 151 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=521]
12-344 ==> 0-332 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
347-385 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
385-521 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQHLGTF at 336, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 12, 220, 427
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.456 = TAGAGCTAGCAGATCG-1

using 274 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode TAGAGCTAGCAGATCG-1 contig 1 = GGAGGAATCA...
umi ATCGTGTTTA = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.458 = TAGAGCTAGCGATAGC-1

using 280 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTAGCGATAGC-1 contig 1 = AGCTTCAGCT...
umi ATTATTTCTA = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=645]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
434-645 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAAWDDSLSGVVF at 367, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.460 = TAGAGCTAGCGGATCA-1

using 267 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [1]

====================================================================================

UMI info for barcode TAGAGCTAGCGGATCA-1 contig 1 = GTCAGACTCA...
umi GAGCTCAGGG = 259 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.467 = TAGAGCTAGGGAAACA-1

using 14 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.468 = TAGAGCTAGGGAGTAA-1

using 284 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2^2, 5, 275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.474 = TAGAGCTAGTGGTAGC-1

using 232 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [0]

====================================================================================

UMI info for barcode TAGAGCTAGTGGTAGC-1 contig 1 = GGGGTCTCAG...
umi AGCGTGGGTC = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-392 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-540 ==> 0-114 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTLVF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.475 = TAGAGCTAGTTACCCA-1

using 833 reads

====================================================================================

graph has 944 edges initially, 6 edges after simplification

total ucounts = 336
nonsolo ucounts = 114[2^60, 3^21, 4^11, 5^7, 6^2, 7^2, 8, 9, 10^2, 11, 13, 16^2, 17, 19, 194]
surviving nonsolo ucounts = 1[194]
ids = [75]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.477 = TAGAGCTCAAAGGAAG-1

using 307 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4^2, 296]
surviving nonsolo ucounts = 1[296]
ids = [1]

====================================================================================

UMI info for barcode TAGAGCTCAAAGGAAG-1 contig 1 = GATCAGGACT...
umi ACCGCAATTA = 279 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=523]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-523 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.478 = TAGAGCTCAAGAAGAG-1

using 263 reads

====================================================================================

graph has 85 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 256]
surviving nonsolo ucounts = 1[256]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTCAAGAAGAG-1 contig 1 = AGTCAGACCC...
umi CAAGTTTCCA = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-482 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNSYPRTF at 351, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 24, 30, 86, 99, 331, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.480 = TAGAGCTCAATACGCT-1

using 306 reads

====================================================================================

graph has 110 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[104, 198]
surviving nonsolo ucounts = 2[104, 198]
ids = [3, 5]

====================================================================================

UMI info for barcode TAGAGCTCAATACGCT-1 contig 1 = AGTTCATCTT...
umi CTCTAGGTAT = 92 reads: +400 validated

UMI info for barcode TAGAGCTCAATACGCT-1 contig 2 = GAGGGTCCTG...
umi TAGCAGAGGC = 184 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=425]
16-376 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=0)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQSIQLPPFTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 16, 49, 85, 173, 236, 335, 355
confident = false

TIG 2[bases=596]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=20)
444-492 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
492-596 ==> 0-104 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDWGDRSVGSPHYFDYW at 404, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 15, 59, 103, 259, 338, 546
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.481 = TAGAGCTCAATGGAGC-1

using 373 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[11, 357]
surviving nonsolo ucounts = 1[357]
ids = [1]

====================================================================================

UMI info for barcode TAGAGCTCAATGGAGC-1 contig 1 = GCTGCGGGTA...
umi ATACAGTCCG = 336 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-590 ==> 0-162 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.491 = TAGAGCTCATAGAAAC-1

using 554 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[178, 372]
surviving nonsolo ucounts = 2[178, 372]
ids = [0, 2]

====================================================================================

UMI info for barcode TAGAGCTCATAGAAAC-1 contig 1 = GAGCATCACC...
umi ACCTGCCCTT = 342 reads: +445 validated

UMI info for barcode TAGAGCTCATAGAAAC-1 contig 2 = GGATGCTTTC...
umi AATCATACCC = 174 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=511]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=0)
421-448 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
460-507 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDEGRYYGSGSYYNPRLGMDVW at 404, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 62, 218, 260, 265, 297, 326, 359, 414, 429, 464
confident = false

TIG 2[bases=491]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
466-491 ==> 0-25 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARRDYYGSERVDFDYW at 384, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 2, 18, 27, 39, 83, 99, 187, 306, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.495 = TAGAGCTCATCCCATC-1

using 384 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 375]
surviving nonsolo ucounts = 1[375]
ids = [4]

====================================================================================

UMI info for barcode TAGAGCTCATCCCATC-1 contig 1 = GAGGAACTGC...
umi CATCGCAGCT = 376 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQRSSWPPEFTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 372
start codons at 33, 238, 241, 412, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.503 = TAGAGCTGTAAGGGCT-1

using 351 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 340]
surviving nonsolo ucounts = 1[340]
ids = [4]

====================================================================================

UMI info for barcode TAGAGCTGTAAGGGCT-1 contig 1 = GAGTCAGTCT...
umi TAACTAGCTG = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-506 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.505 = TAGAGCTGTACATGTC-1

using 336 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 327]
surviving nonsolo ucounts = 1[327]
ids = [3]

====================================================================================

UMI info for barcode TAGAGCTGTACATGTC-1 contig 1 = GGAGTCAGAC...
umi GCCCTGTTAG = 334 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-367 ==> 0-341 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYKTDWTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 26, 32, 88, 101, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.511 = TAGAGCTGTCATACTG-1

using 1110 reads

====================================================================================

graph has 1409 edges initially, 8 edges after simplification

total ucounts = 399
nonsolo ucounts = 178[2^68, 3^44, 4^33, 5^9, 6^9, 7^7, 8, 9, 10, 11, 12, 13, 18, 260]
surviving nonsolo ucounts = 1[260]
ids = [8]

====================================================================================

UMI info for barcode TAGAGCTGTCATACTG-1 contig 1 = GCTGTGCTGT...
umi AACCGTCCGC = 247 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=517]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-517 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSADSSGVVF at 358, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.531 = TAGAGCTTCACATACG-1

using 289 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^2, 3^3, 5, 9, 12, 245]
surviving nonsolo ucounts = 1[245]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTTCACATACG-1 contig 1 = GGGGGAGGAA...
umi AATCCGCCCT = 248 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.532 = TAGAGCTTCAGGATCT-1

using 257 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 4, 246]
surviving nonsolo ucounts = 1[246]
ids = [4]

====================================================================================

UMI info for barcode TAGAGCTTCAGGATCT-1 contig 1 = GCTCTGCTTC...
umi TATGTCCCCC = 235 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=523]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-523 ==> 0-81 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.541 = TAGAGCTTCCTTGCCA-1

using 307 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTTCCTTGCCA-1 contig 1 = CTGATCAGGA...
umi TACCTTGACT = 305 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=565]
0-32 ==> 4-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
32-392 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=7)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQVLQTPRTF at 368, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 32, 65, 101, 189, 208, 351, 371, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.542 = TAGAGCTTCGCCTGTT-1

using 347 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[344]
surviving nonsolo ucounts = 1[344]
ids = [1]

====================================================================================

UMI info for barcode TAGAGCTTCGCCTGTT-1 contig 1 = GTCAGTCTCA...
umi GTTTGCCCTT = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.545 = TAGAGCTTCTAACTGG-1

using 237 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTTCTAACTGG-1 contig 1 = GTCAGTCCCA...
umi CCCGTCAATT = 214 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=486]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-368 ==> 0-345 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
370-402 ==> 6-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
402-486 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQLNSLF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 23, 29, 85, 234, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.548 = TAGAGCTTCTCCGGTT-1

using 663 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[660]
surviving nonsolo ucounts = 1[660]
ids = [2]

====================================================================================

UMI info for barcode TAGAGCTTCTCCGGTT-1 contig 1 = GGAGTCAGAC...
umi CGTACAAGTT = 652 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 96 reads
cdr3 = CQQYNSYPYTF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 647
start codons at 26, 32, 88, 101, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.554 = TAGAGCTTCTTGGGTA-1

using 410 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[146, 261]
surviving nonsolo ucounts = 1[261]
ids = [4]

====================================================================================

UMI info for barcode TAGAGCTTCTTGGGTA-1 contig 1 = ACTGTGGGGG...
umi GCCTTAGCCT = 250 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=559]
0-28 ==> 0-28 on |380|IGLV5-45|5'UTR| [len=28] (mis=1)
28-397 ==> 0-369 on |381|IGLV5-45|L-REGION+V-REGION| [len=369] (mis=3)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
431-559 ==> 0-128 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMIWHSSAWVF at 370, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 28, 170, 302, 314, 353, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.555 = TAGAGCTTCTTGTTTG-1

using 89 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 32
nonsolo ucounts = 21[2^6, 3^5, 4^4, 5^3, 6^2, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.556 = TAGAGCTTCTTTAGGG-1

using 10272 reads

====================================================================================

graph has 4278 edges initially, 70 edges after simplification

total ucounts = 614
nonsolo ucounts = 285[2^101, 3^57, 4^33, 5^15, 6^19, 7^8, 8^2, 9^6, 10, 11^2, 12^2, 13, 21, 61, 82, 89, 96, 98, 110, 113, 124, 144, 155, 170, 186, 206, 249, 252, 255, 260, 263, 268, 269, 274, 276, 286, 290, 297, 298^2, 309, 312, 321, 337, 341, 345, 356, 378, 409, 456]
surviving nonsolo ucounts = 35[82, 96, 98, 110, 113, 124, 144, 155, 170, 186, 206, 249, 252, 255, 260, 263, 268, 269, 274, 276, 286, 290, 297, 298^2, 309, 312, 321, 337, 341, 345, 356, 378, 409, 456]
ids = [494, 516, 327, 613, 125, 302, 556, 303, 462, 12, ...]

====================================================================================

UMI info for barcode TAGAGCTTCTTTAGGG-1 contig 1 = GAGGGTCCAG...
umi AAATTATTCA = 212 reads: +439 validated
umi AAGTCTCTCA = 188 reads: +438 -1 non-validated
umi ATCGACAATC = 268 reads: +439 validated
umi ATTGCCCCTA = 114 reads: +439 validated
umi CCGCATCTTT = 279 reads: +439 validated
umi GAGGCCATAC = 144 reads: +438 -1 non-validated
umi GCCAAGTCGA = 100 reads: +5 -2 +7 -1 +324 -4X +2 -4 +90 invalidated
umi GGGTCGTTTC = 276 reads: +439 validated
umi TCACCTTTTA = 167 reads: +439 validated
umi TCTGTAGATT = 248 reads: +439 validated
umi TGTTGTTAGG = 274 reads: +439 validated
umi TTAGCGTGTA = 141 reads: +434 -5 non-validated
umi TTTTTCTTGC = 107 reads: +439 validated

UMI info for barcode TAGAGCTTCTTTAGGG-1 contig 2 = GGGGGGAGTC...
umi AAGCTTATGG = 410 reads: +388 validated
umi ACAATTGTGC = 297 reads: +388 validated
umi ACACTGCCGA = 297 reads: +388 validated
umi AGCCCTTTAG = 253 reads: +388 validated
umi AGCTGCAGCC = 309 reads: +388 validated
umi ATCGTCTCTC = 348 reads: +376 -12XX invalidated
umi ATCTTAACTA = 308 reads: +388 validated
umi CACTATAGTT = 342 reads: +388 validated
umi CCAACCTTTG = 355 reads: +388 validated
umi GAGCGGATCA = 124 reads: +388 validated
umi GCTTTGCATT = 264 reads: +388 validated
umi GTCTCAATAC = 328 reads: +376 -7X +1 -1XX +2 -1XX invalidated
umi TAAAACTGCT = 343 reads: +388 validated
umi TATTAGTCCA = 287 reads: -3X +1 -4XX +380 invalidated
umi TCTGAATTTC = 261 reads: +388 validated
umi TCTGCTACTA = 82 reads: +367 -1 +9 -1 +10 non-validated
umi TGATCCAGGG = 290 reads: +388 validated
umi TGCGTTCGGG = 255 reads: +388 validated
umi TGCTCGGCCG = 95 reads: +388 validated
umi TTCGACCTCC = 266 reads: +388 validated
umi TTCTTACGTC = 380 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
38-409 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=12)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 148 reads
cdr3 = CARGADRSATVITDYW at 398, score = 8 + 6
umis assigned: [5, 12, 97, 125, 186, 303, 327, 360, 462, 497] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2474
start codons at 15, 38, 59, 103, 189, 389
confident = true

TIG 2[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=16)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 855 reads
cdr3 = CQQSNSAPRTF at 357, score = 9 + 8
umis assigned: [8, 20, 21, 62, 66, 100, 106, 142, 171, 302] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5804
start codons at 30, 36, 92, 105, 241, 460
confident = true
now this is a cell
paired!

GCGGACACGGCTATGTATTATTGTGCGAGGGGGGCTGACCGGTCTGCTACAGTAATTACTGACTACTGGAGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAACAATCTGCAGCCTGAAGATTTCGCAACTTACTACTGTCAACAGAGTAACAGTGCCCCCCGAACGTTCGGCCAGGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.558 = TAGCCGGAGAATCTCC-1

using 720 reads

====================================================================================

graph has 351 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^3, 321, 383]
surviving nonsolo ucounts = 2[321, 383]
ids = [4, 11]

====================================================================================

UMI info for barcode TAGCCGGAGAATCTCC-1 contig 1 = AGCCTGGGCC...
umi ATCCCCAGCG = 324 reads: +376 validated

UMI info for barcode TAGCCGGAGAATCTCC-1 contig 2 = GATCAGGACT...
umi TCCGTTATGC = 383 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=627]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-386 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=28)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQAWDSSIAFF at 355, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 40, 45, 101, 170, 239, 245, 334, 338
confident = false

TIG 2[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.560 = TAGCCGGAGAGACTAT-1

using 318 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 18, 292]
surviving nonsolo ucounts = 1[292]
ids = [3]

====================================================================================

UMI info for barcode TAGCCGGAGAGACTAT-1 contig 1 = GCTGTGGGTC...
umi CATATACAGT = 3 reads: -198 +4 -2X +2 -1X +1 -3X +1 -2X +4 -1 +2 -1X +18 -1 +9 -2X +2 -125 invalidated
umi GCCCTTCCAG = 285 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=557]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=5)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
417-557 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQSTDSSGTYVF at 353, score = 8 + 8
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 38, 99, 168, 186, 230, 381, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.564 = TAGCCGGAGAGTAATC-1

using 662 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 278, 374]
surviving nonsolo ucounts = 2[278, 374]
ids = [6, 4]

====================================================================================

UMI info for barcode TAGCCGGAGAGTAATC-1 contig 1 = GGGAGAGGAG...
umi TCCAGGCTTC = 255 reads: +427 validated

UMI info for barcode TAGCCGGAGAGTAATC-1 contig 2 = GTCAGTCTCA...
umi CGCTTGTATC = 378 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=596]
0-74 ==> 6-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
74-429 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=41)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
501-596 ==> 0-95 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CAKDMFGSGSYTYYFDYW at 416, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 74, 219, 225, 230, 309, 377, 428, 555
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYSTTWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.566 = TAGCCGGAGATATACG-1

using 281 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGAGATATACG-1 contig 1 = ACCCAAAAAC...
umi ACTTTACTGC = 262 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=558]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-558 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.569 = TAGCCGGAGCAGGCTA-1

using 1099 reads

====================================================================================

graph has 408 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2^2, 4, 309, 317, 458]
surviving nonsolo ucounts = 3[309, 317, 458]
ids = [11, 2, 5]

====================================================================================

UMI info for barcode TAGCCGGAGCAGGCTA-1 contig 1 = AGTGACTCCT...
umi AACCCCGACC = 316 reads: +418 validated

UMI info for barcode TAGCCGGAGCAGGCTA-1 contig 2 = AGCTGTGGGC...
umi TTCCAATTGG = 313 reads: +382 validated

UMI info for barcode TAGCCGGAGCAGGCTA-1 contig 3 = GGGGAGAAGT...
umi CACAGTTTAT = 459 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
390-438 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
438-509 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CAHRRSGYYYFDYW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 20, 64, 243, 246, 326, 335
confident = false

TIG 2[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 8 + 9
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 40, 159, 188, 239, 338
confident = false

TIG 3[bases=555]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=28)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 92 reads
cdr3 = CHQYNSAPPTF at 358, score = 10 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 454
start codons at 31, 37, 93, 106, 341, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.573 = TAGCCGGAGCCGATTT-1

using 20 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 15]
surviving nonsolo ucounts = 1[15]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.580 = TAGCCGGAGGACTGGT-1

using 236 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGAGGACTGGT-1 contig 1 = GGAGTGCTTT...
umi CTTGCTACAA = 229 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=582]
40-177 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
177-303 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
424-470 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
470-582 ==> 0-112 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 379, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 40, 84, 349
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_91.580_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.582 = TAGCCGGAGGATGGAA-1

using 21632 reads

====================================================================================

graph has 8291 edges initially, 130 edges after simplification

total ucounts = 942
nonsolo ucounts = 419[2^152, 3^76, 4^48, 5^30, 6^15, 7^18, 8^6, 10, 11^2, 12, 15, 16, 17, 24, 37, 43, 53, 61, 66, 85, 95, 111, 121, 144, 148, 164, 196, 207, 210, 218, 219, 226, 239, 240, 243, 248, 261, 262, 268, 271, 278, 283, 293, 303, 311, 313^2, 316, 318^2, 320, 321, 323, 325, 327, 328, 332, 333, 335, 337, 340^2, 342, 345, 349, 350, 354, 362^2, 393^2, 405, 420, 440, 479, 512, 604, 612, 622, 1068]
surviving nonsolo ucounts = 60[61, 66, 85, 121, 144, 148, 164, 196, 207, 210, 218, 226, 239, 240, 243, 248, 261, 262, 268, 271, 278, 283, 293, 303, 311, 313^2, 316, 318^2, 320, 321, 323, 325, 327, 328, 332, 333, 335, 337, 340^2, 342, 345, 349, 350, 354, 362^2, 393^2, 405, 420, 440, 479, 512, 604, 612, 622, 1068]
ids = [108, 795, 637, 351, 128, 834, 94, 252, 35, 373, ...]

====================================================================================

UMI info for barcode TAGCCGGAGGATGGAA-1 contig 1 = AGGAGTCAGT...
umi ACACATCTAT = 317 reads: +388 validated
umi ACATATCCAG = 202 reads: -343 +45 non-validated
umi ACCTAATCAA = 277 reads: +388 validated
umi AGCCTAATTT = 290 reads: +388 validated
umi ATACTCGCCC = 318 reads: +388 validated
umi ATAGAATTGT = 163 reads: +388 validated
umi CAATCGTCTT = 412 reads: +388 validated
umi CATGTTGGGA = 332 reads: +388 validated
umi CATTTTGTTG = 267 reads: +388 validated
umi CCGCCGCTTG = 195 reads: +388 validated
umi CCTCTGTTGG = 321 reads: +388 validated
umi CGGGCGAGTA = 395 reads: +214 -1XX +4 -9XX +1 -1XX +1 -2XX +1 -1XX +1 -2XX +150 invalidated
umi CGTTACTTGT = 244 reads: +388 validated
umi CTATTAGCGA = 412 reads: +63 -1XX +324 invalidated
umi CTATTGCCAG = 211 reads: +388 validated
umi CTTATACTGT = 333 reads: +388 validated
umi CTTATTAGGA = 322 reads: +388 validated
umi GAGCAGCCTT = 243 reads: +388 validated
umi GGCACGTGTG = 326 reads: +388 validated
umi GGTCGATCGT = 363 reads: +388 validated
umi GTCATTAGCT = 241 reads: +388 validated
umi GTGCCATGAC = 327 reads: +376 -2X +1 -4X +1 -1XX +1 -2XX invalidated
umi GTTGCTTTCG = 258 reads: +388 validated
umi TAAGGGAGGA = 348 reads: +388 validated
umi TATCAAAGTC = 322 reads: +388 validated
umi TATCTTCTAG = 346 reads: +388 validated
umi TCCCTCTCGG = 329 reads: +388 validated
umi TCTACCCTGT = 483 reads: +388 validated
umi TCTGAACGAT = 319 reads: +388 validated
umi TCTTAGTCCC = 301 reads: +388 validated
umi TTACCTATTG = 343 reads: +388 validated
umi TTTCTTTAGT = 327 reads: +388 validated

UMI info for barcode TAGCCGGAGGATGGAA-1 contig 2 = TGGGGGTGCT...
umi ACATTATGAG = 343 reads: +439 validated
umi ATATAATCGA = 317 reads: +439 validated
umi ATTACTTCAC = 49 reads: +1 -1 +53 -1X +377 -6 invalidated
umi CAAGCCCGCA = 145 reads: +426 -4 +9 non-validated
umi CATTAACCCT = 342 reads: +439 validated
umi CGGAGCCGGG = 229 reads: +439 validated
umi CGTTTGTTTC = 119 reads: -13 +394 -1 +5 -1 +1 -24 non-validated
umi CTATCTGATC = 451 reads: +439 validated
umi GGCTTGGTTA = 275 reads: +439 validated
umi GGTTTATCGG = 295 reads: +439 validated
umi TAAGGTAGCG = 83 reads: +414 -25 non-validated
umi TCAGTCCCGG = 253 reads: +439 validated
umi TCCCGGGTAA = 364 reads: +439 validated
umi TGTCCTTGGA = 311 reads: +439 validated
umi TGTTAGGAGC = 147 reads: +439 validated
umi TTACGATTTT = 344 reads: +439 validated
umi TTCAAAGAGT = 287 reads: +439 validated
umi TTGCAAACGA = 309 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=26)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 30 umis using 1514 reads
cdr3 = CQHTYNSPRTF at 354, score = 9 + 8
umis assigned: [31, 35, 44, 72, 93, 94, 136, 177, 182, 252] and 22 others
of which 32 are surviving nonsolos
reads assigned: 9674
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=531]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=20)
414-460 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 14 umis using 373 reads
cdr3 = CARGADRSGTIVLDYW at 381, score = 9 + 6
umis assigned: [37, 95, 108, 128, 178, 314, 351, 367, 563, 580] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4584
start codons at 21, 42, 86, 172, 342
confident = true
now this is a cell
paired!

GCGGACACGGCTGTGTATTATTGTGCGAGGGGGGCTGACCGATCTGGTACAATAGTTCTTGACTACTGGAGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAACAATCTGCAGCCTGAAGATTTCGCAACTTACTACTGTCAACACACTTACAATTCCCCCCGAACGTTCGGCCAGGGGACCAAGGTGGAAATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.583 = TAGCCGGAGGCCATAG-1

using 376 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 368]
surviving nonsolo ucounts = 1[368]
ids = [1]

====================================================================================

UMI info for barcode TAGCCGGAGGCCATAG-1 contig 1 = AGGAGTCAGA...
umi ACGTATTTCA = 371 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNSLWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 27, 33, 89, 102, 238, 241, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.589 = TAGCCGGAGGTGCAAC-1

using 1156 reads

====================================================================================

graph has 1718 edges initially, 26 edges after simplification

total ucounts = 595
nonsolo ucounts = 224[2^101, 3^42, 4^33, 5^18, 6^9, 7^9, 8^4, 9^4, 10^2, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.597 = TAGCCGGAGTTAGGTA-1

using 6573 reads

====================================================================================

graph has 3476 edges initially, 80 edges after simplification

total ucounts = 643
nonsolo ucounts = 284[2^118, 3^64, 4^36, 5^22, 6^10, 7^5, 8^5, 9, 10, 11^2, 13, 15, 26, 105, 128, 139, 178, 195, 202, 205, 237, 245, 247, 278, 279, 295, 310, 371, 706, 1182]
surviving nonsolo ucounts = 15[128, 139, 195, 202, 205, 237, 245, 247, 278, 279, 295, 310, 371, 706, 1182]
ids = [387, 413, 514, 485, 601, 15, 521, 316, 252, 151, ...]

====================================================================================

UMI info for barcode TAGCCGGAGTTAGGTA-1 contig 1 = CTGGGCCTCA...
umi AACGGTTATT = 234 reads: +376 validated
umi CAGGCTTGAT = 275 reads: +376 validated
umi CCGTAATCGG = 312 reads: +376 validated
umi CGGGAGTTTA = 279 reads: +376 validated
umi GAAAATTGCC = 250 reads: +376 validated
umi GCTTCGAGCA = 132 reads: +376 validated
umi TAGCATCCCT = 188 reads: +376 validated
umi TAGGCACGGG = 296 reads: +376 validated
umi TCAGGCAGTT = 716 reads: -338X +1 -3X +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TCATTTTGTG = 166 reads: +328 -2 +32 -9 +5 non-validated
umi TCCGCGCGTT = 244 reads: +376 validated
umi TCTGTTTTCT = 1203 reads: -338X +1 -3XX +2 -1XX +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TTATGGTATA = 205 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-370 ==> 0-333 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=14)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
413-624 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 414 reads
cdr3 = CQAWDSGAYVF at 352, score = 6 + 8
umis assigned: [15, 151, 213, 252, 316, 387, 485, 486, 508, 514] and 3 others
of which 13 are surviving nonsolos
reads assigned: 4349
start codons at 37, 42, 98, 185, 331, 335, 377, 545
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.599 = TAGCCGGAGTTGAGTA-1

using 268 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 259]
surviving nonsolo ucounts = 1[259]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=495]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-495 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 27, 33, 89, 102, 238, 455
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.603 = TAGCCGGCAAATCCGT-1

using 729 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4, 6, 21, 694]
surviving nonsolo ucounts = 1[694]
ids = [4]

====================================================================================

UMI info for barcode TAGCCGGCAAATCCGT-1 contig 1 = GGAGGAATCA...
umi GTCATACACA = 693 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 137 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 683
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.604 = TAGCCGGCAACTTGAC-1

using 431 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[126, 304]
surviving nonsolo ucounts = 2[126, 304]
ids = [2, 1]

====================================================================================

UMI info for barcode TAGCCGGCAACTTGAC-1 contig 1 = GGGGACTCCT...
umi TCTCCCCCCT = 114 reads: +418 validated

UMI info for barcode TAGCCGGCAACTTGAC-1 contig 2 = GGGGAGGAAC...
umi GATTGTAGCG = 277 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=486]
20-370 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
387-438 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
438-486 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASAAAPGDWFDPW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 20, 176, 243, 335
confident = false

TIG 2[bases=480]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=6)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-480 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNNWPGTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.605 = TAGCCGGCAAGCTGAG-1

using 328 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4, 7, 8, 9, 293]
surviving nonsolo ucounts = 1[293]
ids = [6]

====================================================================================

UMI info for barcode TAGCCGGCAAGCTGAG-1 contig 1 = GAATCAGTCC...
umi CTGCGCTGTG = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.607 = TAGCCGGCAATAGCGG-1

using 260 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 256]
surviving nonsolo ucounts = 1[256]
ids = [1]

====================================================================================

UMI info for barcode TAGCCGGCAATAGCGG-1 contig 1 = GTCTCAGTCA...
umi CTTCGCGGGG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-19 ==> 4-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
19-372 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
370-407 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
407-490 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYSTPLTF at 346, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 19, 25, 81, 94, 230, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.609 = TAGCCGGCACAAGTAA-1

using 243 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [3]

====================================================================================

UMI info for barcode TAGCCGGCACAAGTAA-1 contig 1 = GGGGAGGAAC...
umi TACGCGGGCA = 225 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=513]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPYTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.613 = TAGCCGGCACCTCGTT-1

using 324 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[321]
surviving nonsolo ucounts = 1[321]
ids = [2]

====================================================================================

UMI info for barcode TAGCCGGCACCTCGTT-1 contig 1 = AGGAATCAGT...
umi TACTTGATCA = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.615 = TAGCCGGCACGAAATA-1

using 236 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 227]
surviving nonsolo ucounts = 1[227]
ids = [3]

====================================================================================

UMI info for barcode TAGCCGGCACGAAATA-1 contig 1 = GGAGTCTCCC...
umi ATTTGTCCAA = 223 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=526]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
417-437 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
432-495 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
495-526 ==> 0-31 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARSERGYSYANYYYYGMDVW at 401, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 59, 233, 257, 392, 429, 452, 513
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.627 = TAGCCGGCAGATGAGC-1

using 467 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 1[456]
surviving nonsolo ucounts = 1[456]
ids = [7]

====================================================================================

UMI info for barcode TAGCCGGCAGATGAGC-1 contig 1 = ACTTTCTGAG...
umi TAGGACGCAG = 454 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
391-411 ==> 0-20 on |18|IGHD3-10|D-REGION| [len=27] (mis=0)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARVTYYYGSGTLRGDYFDYW at 377, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 446
start codons at 14, 35, 79, 399
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.632 = TAGCCGGCAGGTCCAC-1

using 258 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 252]
surviving nonsolo ucounts = 1[252]
ids = [4]

====================================================================================

UMI info for barcode TAGCCGGCAGGTCCAC-1 contig 1 = TGAGCGCAGA...
umi TATCGGGCTG = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=562]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=3)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-562 ==> 0-138 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.639 = TAGCCGGCATGGAATA-1

using 96 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[94]
surviving nonsolo ucounts = 1[94]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=444]
0-348 ==> 5-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
344-383 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
383-444 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTRRSF at 322, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 81
start codons at 1, 57, 70, 206, 425
confident = false
not full
VJ delta = 17
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.644 = TAGCCGGCATTAGGCT-1

using 330 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[330]
surviving nonsolo ucounts = 1[330]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGCATTAGGCT-1 contig 1 = GGGCTGGGGT...
umi ACGGAGGCAA = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
43-387 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
431-551 ==> 0-120 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CSSYISSTTLGF at 367, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 43, 251, 254
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.652 = TAGCCGGGTCAAAGAT-1

using 280 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGGTCAAAGAT-1 contig 1 = ACTGATCAGG...
umi ACAAGTTGAG = 273 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=530]
0-33 ==> 3-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
33-393 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
399-436 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
436-530 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQSPRGLTF at 369, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 33, 66, 102, 190, 352, 372, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.653 = TAGCCGGGTCAAAGCG-1

using 393 reads

====================================================================================

graph has 170 edges initially, 4 edges after simplification

total ucounts = 25
nonsolo ucounts = 16[2^3, 3^5, 4, 5, 8^2, 11, 12, 14, 301]
surviving nonsolo ucounts = 1[301]
ids = [22]

====================================================================================

UMI info for barcode TAGCCGGGTCAAAGCG-1 contig 1 = TGGGTGATCA...
umi TCAACTGGCC = 287 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=510]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
435-510 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPLFTF at 371, score = 9 + 8
umis assigned: [22]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.655 = TAGCCGGGTCACCTAA-1

using 278 reads

====================================================================================

graph has 97 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=527]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
1-53 ==> 2818-2870 on segment before IGLV3-13 exon 1 [len=3075] (mis=4)
15-90 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=21)
412-431 ==> 51-70 on |316|IGLJ6|J-REGION| [len=70] (mis=1)
431-527 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSTDTSGTFPAVVF at 358, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 43, 104, 191, 242
confident = false
not full
full length transcript of length 527
VJ delta = 44
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.658 = TAGCCGGGTCATATCG-1

using 272 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGGTCATATCG-1 contig 1 = AGCTCTGAGA...
umi GCCTGTGGGT = 263 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=624]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-624 ==> 0-121 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.660 = TAGCCGGGTCATGCAT-1

using 1280 reads

====================================================================================

graph has 396 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 495, 773]
surviving nonsolo ucounts = 2[495, 773]
ids = [7, 10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=305]
0-126 ==> 219-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
132-169 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
169-305 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQRSNWPPQLTF at 102, score = 9 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 764
start codons at 211
confident = false
not full
VJ delta = 13
not full

TIG 2[bases=428]
8-39 ==> 5969-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
18-187 ==> 0-169 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
187-289 ==> 269-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3) [SHIFT!]
311-357 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
357-428 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARGAARSGTVTLDYW at 278, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 492
start codons at 18, 39, 83, 169
confident = false
frameshifted full length stopped transcript of length 428
VJ delta = 106
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.661 = TAGCCGGGTCCAGTAT-1

using 650 reads

====================================================================================

graph has 296 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 5, 77, 561]
surviving nonsolo ucounts = 2[77, 561]
ids = [3, 1]

====================================================================================

UMI info for barcode TAGCCGGGTCCAGTAT-1 contig 1 = ACCCAAAAAC...
umi AAAAGTGGCC = 529 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=600]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-600 ==> 0-110 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 520
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false

REJECT CONTIGS

TIG 1[bases=322]
0-187 ==> 1-188 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=2)
186-322 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 77
start codons at 5, 61, 228
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.665 = TAGCCGGGTCGCATAT-1

using 280 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGGTCGCATAT-1 contig 1 = GGGAGAGGAG...
umi ATTCTTCAGC = 277 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=557]
0-74 ==> 6-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
74-381 ==> 0-307 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=22)
462-525 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=7)
525-557 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CTRDIPHRIWFGDVLVYYYYMDVW at 422, score = 10 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 74, 127, 230, 315, 354, 383, 448, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.668 = TAGCCGGGTCGTGGCT-1

using 215 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode TAGCCGGGTCGTGGCT-1 contig 1 = GAGAGAGGAG...
umi CCGGAGGCGG = 214 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=611]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-611 ==> 0-114 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.678 = TAGCCGGGTGGCCCTA-1

using 419 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 408]
surviving nonsolo ucounts = 1[408]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGGTGGCCCTA-1 contig 1 = GGAGGAACTG...
umi ATGCTATCCA = 406 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQRSNWLITF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 399
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.686 = TAGCCGGGTTCCCTTG-1

using 421 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[420]
surviving nonsolo ucounts = 1[420]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.701 = TAGCCGGTCCACGAAT-1

using 55 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.705 = TAGCCGGTCCGCTGTT-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.707 = TAGCCGGTCCTAGTGA-1

using 348 reads

====================================================================================

graph has 122 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3^2, 33, 303]
surviving nonsolo ucounts = 1[303]
ids = [8]

====================================================================================

UMI info for barcode TAGCCGGTCCTAGTGA-1 contig 1 = ATCAGTCCCA...
umi TGTTGCAGTC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-475 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.708 = TAGCCGGTCCTTGACC-1

using 248 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 237]
surviving nonsolo ucounts = 1[237]
ids = [3]

====================================================================================

UMI info for barcode TAGCCGGTCCTTGACC-1 contig 1 = GCTCTGCTTC...
umi TAATTTGATT = 1 reads: -394 non-validated
umi TATGGACGCG = 227 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=606]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-606 ==> 0-161 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.711 = TAGCCGGTCGCATGAT-1

using 460 reads

====================================================================================

graph has 220 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 216, 235]
surviving nonsolo ucounts = 2[216, 235]
ids = [6, 1]

====================================================================================

UMI info for barcode TAGCCGGTCGCATGAT-1 contig 1 = ACCCAAAAAC...
umi CAAAGTTTAT = 225 reads: +436 validated
umi TTTGAGGGTC = 4 reads: -372X +1 -2XX +1 -13XX +1 -4XX +5 -1XX +1 -1XX +32 -2 invalidated

GOOD CONTIGS

TIG 1[bases=584]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-584 ==> 0-94 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 224
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.712 = TAGCCGGTCGGCATCG-1

using 51 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[50]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.717 = TAGCCGGTCGTTTGCC-1

using 52 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 4, 7, 31]
surviving nonsolo ucounts = 1[31]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.718 = TAGCCGGTCTAACTCT-1

using 145 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3^2, 133]
surviving nonsolo ucounts = 1[133]
ids = [2]

====================================================================================

UMI info for barcode TAGCCGGTCTAACTCT-1 contig 1 = AGTGACTCCT...
umi CACATTGATC = 127 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=484]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-369 ==> 0-349 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=9)
393-441 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
441-484 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CVQFSGYARYYFDYW at 365, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 20, 64, 237, 243, 246, 326, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.724 = TAGCCGGTCTCCTATA-1

using 463 reads

====================================================================================

graph has 222 edges initially, 28 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 4^2, 25, 163, 261]
surviving nonsolo ucounts = 3[25, 163, 261]
ids = [1, 6, 5]

====================================================================================

UMI info for barcode TAGCCGGTCTCCTATA-1 contig 1 = AGGAGTCAGT...
umi CAGCACGCCC = 4 reads: -6X +6 -1X +22 -1X +2 -2X +8 -1X +4 -1X +2 -306X +2 -2 +3 -1 +1 -5X +4 -1X +2 -1X +4 invalidated
umi GCAGCCCCCT = 163 reads: +388 validated

UMI info for barcode TAGCCGGTCTCCTATA-1 contig 2 = GCAGGAGTCA...
umi GCACTCGCAC = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYDNLLWTF at 354, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 163
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false

TIG 2[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.731 = TAGCCGGTCTTAGAGC-1

using 335 reads

====================================================================================

graph has 129 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[334]
surviving nonsolo ucounts = 1[334]
ids = [0]

====================================================================================

UMI info for barcode TAGCCGGTCTTAGAGC-1 contig 1 = CTGGGCCTCA...
umi GCGGGTCGAG = 322 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=575]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-575 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.734 = TAGCCGGTCTTGACGA-1

using 5321 reads

====================================================================================

graph has 5263 edges initially, 84 edges after simplification

total ucounts = 922
nonsolo ucounts = 683[2^98, 3^97, 4^61, 5^59, 6^49, 7^56, 8^47, 9^40, 10^37, 11^21, 12^23, 13^21, 14^14, 15^17, 16^16, 17^8, 18^3, 19^3, 20^4, 21^3, 22^2, 23^2, 28, 269]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.740 = TAGGCATAGATCGGGT-1

using 522 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[4^2, 221, 288]
surviving nonsolo ucounts = 2[221, 288]
ids = [5, 1]

====================================================================================

UMI info for barcode TAGGCATAGATCGGGT-1 contig 1 = TGGGGAGGAA...
umi CTGTTATTCG = 285 reads: +388 validated
umi TAAGGTTTCA = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 73 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 501
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.741 = TAGGCATAGATGTAAC-1

using 399 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 10, 382]
surviving nonsolo ucounts = 1[382]
ids = [4]

====================================================================================

UMI info for barcode TAGGCATAGATGTAAC-1 contig 1 = GGAGTCAGAC...
umi TCGTCAATGA = 377 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQGNSFPYTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 26, 32, 88, 101, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.742 = TAGGCATAGCACAGGT-1

using 392 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 10, 371]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TAGGCATAGCACAGGT-1 contig 1 = GAGGGTCCTG...
umi TATACTCTAG = 358 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=616]
59-415 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=42)
432-495 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
495-616 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CARGREYASGQDYYYGMDVW at 404, score = 9 + 7
umis assigned: [6]
of which 0 are surviving nonsolos
reads assigned: 357
start codons at 15, 59, 103, 282, 423, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.747 = TAGGCATAGCCCAACC-1

using 1183 reads

====================================================================================

graph has 1696 edges initially, 8 edges after simplification

total ucounts = 577
nonsolo ucounts = 232[2^105, 3^42, 4^39, 5^10, 6^6, 7^13, 8^9, 9^3, 10, 12, 14, 17^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.751 = TAGGCATAGCGTTTAC-1

using 1323 reads

====================================================================================

graph has 432 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 41, 618, 655]
surviving nonsolo ucounts = 3[41, 618, 655]
ids = [1, 7, 4]

====================================================================================

UMI info for barcode TAGGCATAGCGTTTAC-1 contig 1 = GATCAGGACT...
umi AATATAAAGT = 39 reads: -388X +1 -5XX +2 -2XX +1 -1XX invalidated
umi CATATTTCCT = 658 reads: +400 validated
umi GTCAGGTTTA = 615 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 206 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [1, 4, 7]
of which 3 are surviving nonsolos
reads assigned: 1291
start codons at 30, 63, 99, 187, 349, 369, 472
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.769 = TAGGCATAGTCAAGGC-1

using 526 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 520]
surviving nonsolo ucounts = 1[520]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
0-214 ==> 142-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=8)
214-252 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
252-463 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 182, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 517
start codons at 12, 15, 66, 165, 192, 216, 384
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.774 = TAGGCATAGTGGGATC-1

using 388 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[385]
surviving nonsolo ucounts = 1[385]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATAGTGGGATC-1 contig 1 = GGAAAATCTG...
umi GCAGCACGGG = 374 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-63 ==> 0-63 on |297|IGKV5-2|5'UTR| [len=63] (mis=2)
63-408 ==> 0-345 on |298|IGKV5-2|L-REGION+V-REGION| [len=345] (mis=0)
409-448 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
448-527 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQHDNFPPYTF at 384, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 367
start codons at 63, 153, 211, 214, 219, 322, 367, 394, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.787 = TAGGCATCAATCGAAA-1

using 192 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 189]
surviving nonsolo ucounts = 1[189]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATCAATCGAAA-1 contig 1 = AGCTTCAGCT...
umi CTCCAACAAC = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-572 ==> 0-137 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.789 = TAGGCATCAATTGCTG-1

using 149 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=476]
0-47 ==> 257-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
0-47 ==> 4218-4265 on rc of segment before IGHVII-46-1 exon 1 [len=4265] (mis=0)
42-65 ==> 10117-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=2)
47-400 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=1)
408-431 ==> 0-23 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
432-476 ==> 0-44 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
cdr3 = CARGVGPDIVVVVALNWFDPW at 389, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 47, 203, 245, 311, 344
confident = false
VJ delta = 11
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.795 = TAGGCATCACCAGGCT-1

using 505 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 498]
surviving nonsolo ucounts = 1[498]
ids = [4]

====================================================================================

UMI info for barcode TAGGCATCACCAGGCT-1 contig 1 = ACCCAAAAAC...
umi GCCATATCCG = 498 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=549]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=12)
428-478 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
478-549 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CARNFDLVTYGDSLDMW at 396, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 489
start codons at 54, 177, 205, 252, 257, 289, 318, 351, 424, 441, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.804 = TAGGCATCAGCGATCC-1

using 14 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.811 = TAGGCATCAGGTGGAT-1

using 670 reads

====================================================================================

graph has 254 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 3^2, 287, 368]
surviving nonsolo ucounts = 2[287, 368]
ids = [0, 3]

====================================================================================

UMI info for barcode TAGGCATCAGGTGGAT-1 contig 1 = GAGCTACAAC...
umi AAATGTGGAA = 273 reads: -371X +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi ATAATGTATT = 374 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=575]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-78 ==> 0-48 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
87-402 ==> 48-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
400-439 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
439-575 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYSSPYTF at 378, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 633
start codons at 30, 108, 258, 361, 481
confident = false
see insertion of GTGACTACA at pos 48 on |296|IGKV4-1|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.813 = TAGGCATCATACAGCT-1

using 355 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 7, 341]
surviving nonsolo ucounts = 2[7, 341]
ids = [5, 3]

====================================================================================

UMI info for barcode TAGGCATCATACAGCT-1 contig 1 = AGGAGTCAGT...
umi CGGTGGTCAT = 346 reads: +385 validated
umi TACGAGTAAC = 7 reads: +28 -65 +100 -6 +56 -130 non-validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYDNLPTF at 354, score = 9 + 8
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 345
start codons at 27, 33, 89, 102, 241, 364, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.816 = TAGGCATCATAGGATA-1

using 311 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 4, 5, 290]
surviving nonsolo ucounts = 1[290]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.821 = TAGGCATCATCCCATC-1

using 379 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[376]
surviving nonsolo ucounts = 1[376]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATCATCCCATC-1 contig 1 = AGCTCTGAGA...
umi CTCATTCGAT = 373 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=577]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=10)
438-459 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
458-506 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
506-577 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASGRGDIAVAGNDFDYW at 421, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 79, 235, 325, 382, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.825 = TAGGCATCATGAGCGA-1

using 893 reads

====================================================================================

graph has 280 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 4, 880]
surviving nonsolo ucounts = 1[880]
ids = [4]

====================================================================================

UMI info for barcode TAGGCATCATGAGCGA-1 contig 1 = GGGGGACTCC...
umi TCACTCCGAA = 884 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=513]
21-379 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=3)
394-442 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
442-513 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CARFVAVAGYYFDYW at 366, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 873
start codons at 21, 169, 177, 244, 327, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.829 = TAGGCATCATTAGCCA-1

using 162 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.832 = TAGGCATGTAAACCTC-1

using 326 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 317]
surviving nonsolo ucounts = 1[317]
ids = [5]

====================================================================================

UMI info for barcode TAGGCATGTAAACCTC-1 contig 1 = GATCAGGACT...
umi GAAGCCCGGT = 315 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.833 = TAGGCATGTAAGTTCC-1

using 7217 reads

====================================================================================

graph has 5760 edges initially, 58 edges after simplification

total ucounts = 1366
nonsolo ucounts = 613[2^212, 3^151, 4^68, 5^65, 6^28, 7^28, 8^10, 9^9, 10^6, 11^4, 12^2, 13^2, 14, 15, 16^4, 18, 21, 27, 74, 105, 109, 110, 117, 125, 126, 151, 197, 207^2, 231, 239, 247, 279, 301, 336, 353, 638]
surviving nonsolo ucounts = 18[74, 105, 109, 110, 117, 126, 151, 197, 207^2, 231, 239, 247, 279, 301, 336, 353, 638]
ids = [761, 803, 94, 1344, 69, 213, 933, 858, 90, 262, ...]

====================================================================================

UMI info for barcode TAGGCATGTAAGTTCC-1 contig 1 = CCTGGGTCAG...
umi AGTCAAGCAT = 206 reads: +388 validated
umi ATTTTCGGTC = 238 reads: +388 validated
umi CAGACCGCGT = 358 reads: +388 validated
umi CATCCCCGTG = 230 reads: +388 validated
umi CTCGGACCGG = 654 reads: +49 -5XX +2 -4XX +1 -5XX +1 -1XX +2 -2XX +1 -1XX +1 -248X +2 -2XX +1 -2XX +1 -14XX +43 invalidated
umi GAAGTTTGGT = 279 reads: +388 validated
umi TAATAGGCGC = 145 reads: +388 validated
umi TCCAAAATCA = 249 reads: +388 validated
umi TTAATGTAAA = 336 reads: +388 validated

UMI info for barcode TAGGCATGTAAGTTCC-1 contig 2 = GGAGTCTCCC...
umi AAGGCCTCAG = 113 reads: +427 validated
umi AATTACACTT = 207 reads: +427 validated
umi AATTCTCGCA = 108 reads: +427 validated
umi ACATTCTCTA = 148 reads: -388X +1 -3XX +9 -1XX +2 -2XX +1 -2XX +13 -1XX +4 invalidated
umi AGATTTCATC = 126 reads: +427 validated
umi GCTCCGCCGT = 78 reads: +405 -1 +2 -3 +2 -2 +1 -1 +1 -1 +2 -2 +4 non-validated
umi GGGTTTTCCG = 103 reads: +381 -4 +42 non-validated
umi GTCGTATTTA = 196 reads: +403 -15 +9 non-validated
umi TTTCTCTGCA = 106 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=576]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
402-440 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 290 reads
cdr3 = CHHYGVSPGWTF at 376, score = 9 + 8
umis assigned: [262, 379, 411, 420, 597, 647, 933, 1048, 1251]
of which 9 are surviving nonsolos
reads assigned: 2628
start codons at 52, 260, 386, 482
confident = true

TIG 2[bases=668]
0-59 ==> 0-59 on |200|IGHV5-51|5'UTR| [len=59] (mis=2)
59-397 ==> 0-338 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=23)
434-486 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=6)
486-668 ==> 0-182 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 6 umis using 75 reads
cdr3 = CVISVRHTTSLTQFLQHW at 401, score = 8 + 7
umis assigned: [69, 90, 94, 120, 213, 761, 803, 858, 1344]
of which 9 are surviving nonsolos
reads assigned: 1165
start codons at 59, 233, 276, 392
confident = true
now this is a cell
paired!

ACCGCCATGTACTATTGTGTCATTAGTGTGCGACACACGACGTCGTTAACTCAATTCCTCCAACACTGGGGCCAGGGCTCCCTGGTCACCGTCTCCTCAG <==> AGCAGACTCGAGCCTGAAGACTTTGCACTGTATTACTGTCATCATTATGGTGTCTCACCAGGGTGGACGTTCGGCCAAGGGTCCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.840 = TAGGCATGTCACAAGG-1

using 262 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode TAGGCATGTCACAAGG-1 contig 1 = ACCCAAAAAC...
umi GCCATCATCT = 262 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=644]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-644 ==> 0-181 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 49 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.841 = TAGGCATGTCAGAATA-1

using 980 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 283, 689]
surviving nonsolo ucounts = 2[283, 689]
ids = [1, 2]

====================================================================================

UMI info for barcode TAGGCATGTCAGAATA-1 contig 1 = GAGCTGCTCA...
umi CGTAAGTCTT = 278 reads: +388 validated
umi GACGTCTAGG = 701 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 159 reads
cdr3 = CQQYGSSPPWTF at 354, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 957
start codons at 30, 238, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.842 = TAGGCATGTCATATCG-1

using 222 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 218]
surviving nonsolo ucounts = 1[218]
ids = [0]

====================================================================================

UMI info for barcode TAGGCATGTCATATCG-1 contig 1 = GAGTGCTTTC...
umi ATTCGTCCAT = 218 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=596]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-596 ==> 0-142 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CARAHGDYYTLLDFW at 378, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 18, 39, 83, 169, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.845 = TAGGCATGTCCCTACT-1

using 309 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATGTCCCTACT-1 contig 1 = GGGAGGAATC...
umi TACTTTCCAT = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQHKSYPFTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.853 = TAGGCATGTGACTCAT-1

using 334 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 7, 320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATGTGACTCAT-1 contig 1 = AGAGCTGCTC...
umi CAACAGTCCT = 320 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYGSSLWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.858 = TAGGCATGTGGTACAG-1

using 429 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 6, 7, 408]
surviving nonsolo ucounts = 1[408]
ids = [6]

====================================================================================

UMI info for barcode TAGGCATGTGGTACAG-1 contig 1 = GGAGAAGAGC...
umi TGCCGAACAC = 409 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-378 ==> 0-342 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYGSLWTF at 360, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 401
start codons at 36, 244, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.863 = TAGGCATGTGTTGAGG-1

using 289 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 281]
surviving nonsolo ucounts = 1[281]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATGTGTTGAGG-1 contig 1 = AGGAATCAGA...
umi TGGAGGCCAG = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNSYPLTF at 354, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.870 = TAGGCATTCACCCTCA-1

using 794 reads

====================================================================================

graph has 288 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 3, 782]
surviving nonsolo ucounts = 1[782]
ids = [4]

====================================================================================

UMI info for barcode TAGGCATTCACCCTCA-1 contig 1 = GAAGAGCTGC...
umi CTCATTTAGC = 784 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 132 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 772
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.872 = TAGGCATTCACTCTTA-1

using 273 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[268]
surviving nonsolo ucounts = 1[268]
ids = [2]

====================================================================================

UMI info for barcode TAGGCATTCACTCTTA-1 contig 1 = TCTGGCACCA...
umi GCGTATCCAT = 253 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-551 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLLSYSGARVF at 358, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.878 = TAGGCATTCATGCTCC-1

using 337 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode TAGGCATTCATGCTCC-1 contig 1 = GAGGAACTGC...
umi ACCTCGTTAC = 333 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=12)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQRSNWWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 329
start codons at 33, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.884 = TAGGCATTCCTGCAGG-1

using 227 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[223]
surviving nonsolo ucounts = 1[223]
ids = [1]

====================================================================================

UMI info for barcode TAGGCATTCCTGCAGG-1 contig 1 = AGCTTCAGCT...
umi CCACGCCTTT = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=2)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=24)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
434-488 ==> 0-54 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAVWDDSVNGVVF at 367, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 46, 200, 350, 380, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.890 = TAGGCATTCGGAGCAA-1

using 163 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 1[160]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.893 = TAGGCATTCGTGGGAA-1

using 19 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.900 = TAGGCATTCTTGCCGT-1

using 361 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 6, 341]
surviving nonsolo ucounts = 1[341]
ids = [2]

====================================================================================

UMI info for barcode TAGGCATTCTTGCCGT-1 contig 1 = TGGGTGCTGG...
umi ATTGCTGGGC = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
46-407 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
396-434 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
434-554 ==> 0-120 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSSSTLVF at 370, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 46, 203, 247, 254, 257
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.901 = TAGGCATTCTTTCCTC-1

using 27 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^3, 4, 15]
surviving nonsolo ucounts = 1[15]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.908 = TAGTGGTAGATCCGAG-1

using 130 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 29
nonsolo ucounts = 21[2^5, 3^3, 4^3, 6^2, 7, 8^2, 10^2, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.917 = TAGTGGTAGCGCTTAT-1

using 4272 reads

====================================================================================

graph has 3968 edges initially, 92 edges after simplification

total ucounts = 1520
nonsolo ucounts = 884[2^307, 3^193, 4^116, 5^82, 6^50, 7^39, 8^33, 9^18, 10^10, 11^14, 12^8, 13^4, 14^6, 16^2, 21, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.920 = TAGTGGTAGCTTCGCG-1

using 24 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.924 = TAGTGGTAGGATATAC-1

using 363 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 4^2, 8, 337]
surviving nonsolo ucounts = 1[337]
ids = [1]

====================================================================================

UMI info for barcode TAGTGGTAGGATATAC-1 contig 1 = ATCAGTCCCA...
umi AGGGCAGCTG = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.933 = TAGTGGTAGTAGTGCG-1

using 371 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 13[2^3, 3^5, 4, 6^2, 26, 296]
surviving nonsolo ucounts = 1[296]
ids = [12]

====================================================================================

UMI info for barcode TAGTGGTAGTAGTGCG-1 contig 1 = ATCAGTCCCA...
umi CTTTTTTCAC = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.934 = TAGTGGTAGTCCAGGA-1

using 291 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode TAGTGGTAGTCCAGGA-1 contig 1 = AGAAGAGCTG...
umi AACGGTAATC = 274 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYGSSLITF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 34, 242, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.938 = TAGTGGTAGTGAAGTT-1

using 271 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2^3, 5, 6^2, 240]
surviving nonsolo ucounts = 1[240]
ids = [13]

====================================================================================

UMI info for barcode TAGTGGTAGTGAAGTT-1 contig 1 = ACCCAAAAAC...
umi TCATCGGGTC = 218 reads: +420 -1 non-validated

GOOD CONTIGS

TIG 1[bases=490]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
425-475 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 25 reads
cdr3 = CARERGTGSSGAFDIW at 396, score = 8 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.949 = TAGTGGTCAAGCCGCT-1

using 196 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 7, 179]
surviving nonsolo ucounts = 1[179]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
15-227 ==> 140-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=17)
225-263 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
263-474 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSAWDSSLNVWVF at 196, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 14, 204, 221
confident = false
not full
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.957 = TAGTGGTCACCAGGTC-1

using 312 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 301]
surviving nonsolo ucounts = 1[301]
ids = [4]

====================================================================================

UMI info for barcode TAGTGGTCACCAGGTC-1 contig 1 = CAGACCCAGT...
umi ATGCGATACA = 276 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-21 ==> 26-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
21-372 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
368-406 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
406-481 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQANSFPTF at 348, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 21, 27, 83, 96, 232, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.960 = TAGTGGTCACGGCTAC-1

using 376 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 16, 349]
surviving nonsolo ucounts = 1[349]
ids = [6]

====================================================================================

UMI info for barcode TAGTGGTCACGGCTAC-1 contig 1 = TGGGGAGGAA...
umi TGTAGACTTT = 345 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYNNWPPYTF at 358, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 37, 106, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.963 = TAGTGGTCAGACACTT-1

using 380 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 2[3, 361]
surviving nonsolo ucounts = 1[361]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.967 = TAGTGGTCAGATGGCA-1

using 68 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3, 5, 7, 46]
surviving nonsolo ucounts = 1[46]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.971 = TAGTGGTCAGCTGTAT-1

using 815 reads

====================================================================================

graph has 288 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^3, 3, 4, 6, 789]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=351]
4-39 ==> 2319-2354 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
35-202 ==> 2483-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
236-280 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
280-351 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [11]
of which 0 are surviving nonsolos
reads assigned: 771
start codons at 103, 227, 237
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.976 = TAGTGGTCAGTTTACG-1

using 112 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[2, 3^4, 5^2, 6, 76]
surviving nonsolo ucounts = 1[76]
ids = [3]

====================================================================================

UMI info for barcode TAGTGGTCAGTTTACG-1 contig 1 = AGTCCCAGTC...
umi ACCAAGACCA = 62 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=462]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-462 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQLNSYPRTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 62
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.987 = TAGTGGTGTACTCAAC-1

using 3665 reads

====================================================================================

graph has 3614 edges initially, 100 edges after simplification

total ucounts = 1329
nonsolo ucounts = 698[2^261, 3^170, 4^89, 5^59, 6^51, 7^32, 8^11, 9^5, 10^6, 11^2, 12^5, 13^2, 21, 22, 23, 148, 306]
surviving nonsolo ucounts = 2[148, 306]
ids = [654, 21]

====================================================================================

REJECT CONTIGS

TIG 1[bases=723]
0-25 ==> 19-44 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
14-43 ==> 1009-1038 on segment before IGLV3-2 exon 1 [len=1181] (mis=2)
27-173 ==> 0-146 on segment before IGLV3-19 exon 2 [len=146] (mis=0)
171-464 ==> 44-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
474-512 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
512-723 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CNSRDSSGNHLEVF at 442, score = 8 + 8
umis assigned: [21, 654]
of which 2 are surviving nonsolos
reads assigned: 448
start codons at 60, 246, 275, 326, 425
confident = false
not full
VJ delta = -134
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1003 = TAGTGGTGTCGGATCC-1

using 2005 reads

====================================================================================

graph has 2166 edges initially, 66 edges after simplification

total ucounts = 875
nonsolo ucounts = 424[2^152, 3^111, 4^60, 5^41, 6^29, 7^10, 8^2, 9^12, 10, 11, 12, 13, 17, 19, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1007 = TAGTGGTGTCTAGTCA-1

using 4974 reads

====================================================================================

graph has 4201 edges initially, 78 edges after simplification

total ucounts = 1728
nonsolo ucounts = 1014[2^388, 3^242, 4^144, 5^99, 6^47, 7^33, 8^22, 9^15, 10^9, 11^2, 12^6, 13^3, 14, 17, 282, 327]
surviving nonsolo ucounts = 2[282, 327]
ids = [1283, 112]

====================================================================================

UMI info for barcode TAGTGGTGTCTAGTCA-1 contig 1 = TGGGGAGGAA...
umi ACAACGCACC = 287 reads: +382 validated
umi TAAAACGCGA = 251 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=13)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
419-505 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CQQYNNWPRTF at 358, score = 8 + 8
umis assigned: [112, 1283]
of which 2 are surviving nonsolos
reads assigned: 529
start codons at 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1017 = TAGTGGTGTGCTTCTC-1

using 513 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2^6, 4, 8, 11, 155, 319]
surviving nonsolo ucounts = 1[319]
ids = [1]

====================================================================================

UMI info for barcode TAGTGGTGTGCTTCTC-1 contig 1 = ATCAGTCCCA...
umi ACGCCTCGCT = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 23, 29, 98, 234, 453
confident = false

REJECT CONTIGS

TIG 1[bases=433]
0-214 ==> 139-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=7)
233-273 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
273-433 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CAREGAAGLGDYW at 203, score = 9 + 7
umis assigned: [9]
of which 0 are surviving nonsolos
reads assigned: 85
start codons at 12, 17, 55, 59, 75, 78, 164, 327
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1020 = TAGTGGTGTGTTCGAT-1

using 280 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^3, 3, 4, 5, 256]
surviving nonsolo ucounts = 1[256]
ids = [12]

====================================================================================

UMI info for barcode TAGTGGTGTGTTCGAT-1 contig 1 = GAAGAGCTGC...
umi TTTCGTCCGT = 237 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=484]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
383-412 ==> 9-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGTSPC at 357, score = 9 + 6
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 33, 82, 241, 367, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1031 = TAGTGGTGTTGACGTT-1

using 888 reads

====================================================================================

graph has 372 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^3, 3^2, 132, 342, 398]
surviving nonsolo ucounts = 2[342, 398]
ids = [9, 10]

====================================================================================

UMI info for barcode TAGTGGTGTTGACGTT-1 contig 1 = AATCAGTCCC...
umi CACACATGTC = 20 reads: -367 +7 -1XX +5 -1XX +7 invalidated
umi GCCAACTTGT = 343 reads: +388 validated
umi GTCACGCTTC = 405 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 123 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [4, 9, 10]
of which 2 are surviving nonsolos
reads assigned: 750
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1037 = TAGTGGTTCAAACGGG-1

using 188 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 178]
surviving nonsolo ucounts = 1[178]
ids = [7]

====================================================================================

UMI info for barcode TAGTGGTTCAAACGGG-1 contig 1 = CACAAGAGGC...
umi TTGTCCGAGT = 170 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=489]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-489 ==> 0-65 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CCSYAGSSSHVVF at 357, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 33, 172, 234, 241, 367, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1038 = TAGTGGTTCAACGGCC-1

using 1835 reads

====================================================================================

graph has 1926 edges initially, 42 edges after simplification

total ucounts = 678
nonsolo ucounts = 332[2^125, 3^75, 4^45, 5^36, 6^21, 7^12, 8^7, 9, 11^3, 12, 13, 14^2, 17, 28, 248]
surviving nonsolo ucounts = 1[248]
ids = [553]

====================================================================================

UMI info for barcode TAGTGGTTCAACGGCC-1 contig 1 = GCAGAAGTCT...
umi TCGATAGGCG = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-29 ==> 2-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
29-380 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
417-477 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQKYNSAPFTF at 356, score = 9 + 8
umis assigned: [553]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1044 = TAGTGGTTCACTTCAT-1

using 310 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 7[2^3, 4, 8, 9, 274]
surviving nonsolo ucounts = 1[274]
ids = [10]

====================================================================================

UMI info for barcode TAGTGGTTCACTTCAT-1 contig 1 = GAGCATCACC...
umi GGGCGCATGG = 276 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=557]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARSLVSYSSSWIFDYW at 404, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 62, 260, 265, 297, 326, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1049 = TAGTGGTTCATCGATG-1

using 17655 reads

====================================================================================

graph has 9076 edges initially, 177 edges after simplification

total ucounts = 2015
nonsolo ucounts = 1033[2^388, 3^219, 4^161, 5^72, 6^53, 7^34, 8^13, 9^19, 10^6, 11^4, 12^2, 13^3, 14^2, 16, 18, 27, 39, 57, 58, 62, 65, 71, 80, 82, 133, 136, 146, 164, 167, 177, 186, 201^2, 210, 213, 218, 227, 228, 231, 237, 242, 243, 244, 252, 270, 272^2, 273, 278, 279, 283^2, 287, 289^2, 291, 297, 313, 317, 319, 328, 335, 349, 352, 356, 371, 372, 392, 393, 719]
surviving nonsolo ucounts = 49[57, 71, 82, 133, 136, 146, 164, 167, 177, 186, 201^2, 210, 213, 218, 227, 228, 231, 237, 242, 243, 244, 252, 270, 272^2, 273, 278, 279, 283^2, 287, 289^2, 291, 297, 313, 317, 319, 328, 335, 349, 352, 356, 371, 372, 392, 393, 719]
ids = [1500, 902, 579, 1977, 1418, 73, 717, 342, 587, 1503, ...]

====================================================================================

UMI info for barcode TAGTGGTTCATCGATG-1 contig 1 = AGCTCTGAGA...
umi AAGACGACAA = 147 reads: +355 -66 non-validated
umi AAGCAACGTC = 242 reads: +421 validated
umi AATCCCACTC = 296 reads: +243 -6XX +3 -4XX +1 -4XX +2 -3XX +2 -1XX +1 -2XX +149 invalidated
umi ACATTGTCTG = 210 reads: +421 validated
umi ACTGCCCCTG = 276 reads: +421 validated
umi AGGGGGAATG = 246 reads: +421 validated
umi AGGTTTAGCG = 290 reads: +421 validated
umi ATGGCACCAA = 243 reads: +421 validated
umi CAATGCGCAG = 322 reads: +421 validated
umi CATTTTTAGC = 288 reads: +421 validated
umi CCCATTTGTT = 319 reads: +421 validated
umi CCCCGTTAGT = 83 reads: +397 -24 non-validated
umi CCGAACGATT = 244 reads: +421 validated
umi CCGACTCTGC = 408 reads: +41 -1XX +379 invalidated
umi CCTATCAGCA = 193 reads: +421 validated
umi CCTTTGATGC = 198 reads: +310 -1XX +110 invalidated
umi CGATTTCGTA = 167 reads: +419 -1 +1 non-validated
umi GCTACTTCCC = 291 reads: +421 validated
umi GTTATGCGGG = 285 reads: +421 validated
umi TAGACAGGAC = 46 reads: +358 -1 +38 -24 non-validated
umi TAGCCCTGCG = 193 reads: +421 validated
umi TTCACGCTAC = 276 reads: +421 validated
umi TTCATTTTTA = 273 reads: +421 validated
umi TTGTACATCC = 257 reads: +421 validated
umi TTTTGCTCGG = 234 reads: +421 validated

UMI info for barcode TAGTGGTTCATCGATG-1 contig 2 = GGGGAGGAAC...
umi AAACTCGCTC = 282 reads: +382 validated
umi AACATCACGT = 405 reads: +382 validated
umi AATGAGCATC = 356 reads: +382 validated
umi AATGCACGGG = 299 reads: +382 validated
umi ACTGTTGCGA = 371 reads: +382 validated
umi ATTATGCAGA = 284 reads: +382 validated
umi CAAATCAGTC = 311 reads: +382 validated
umi CAACCATCGG = 165 reads: +382 validated
umi CACGAACACT = 374 reads: +382 validated
umi CATAACAGTG = 233 reads: +382 validated
umi CCCGTATGTA = 321 reads: +382 validated
umi CCTCGGATAC = 228 reads: +382 validated
umi CTATTATCTG = 292 reads: +382 validated
umi CTCGTCACTC = 3 reads: -382 non-validated
umi CTTCACTCAA = 337 reads: +382 validated
umi GTACATTTAA = 199 reads: +382 validated
umi GTGAGTGTCG = 723 reads: -173X +209 invalidated
umi GTTTTATCGG = 136 reads: +382 validated
umi TAAGTGTCCG = 25 reads: -348X +1 -2X +1 -1 +5 -2X +8 -1XX +5 -1XX +7 invalidated
umi TGAGGTCGTA = 250 reads: +382 validated
umi TTGAATTATT = 334 reads: +382 validated
umi TTTCATCCAC = 1 reads: -382 non-validated

GOOD CONTIGS

TIG 1[bases=571]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=6)
463-500 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 19 umis using 390 reads
cdr3 = CAKIPQVGATPGMWYW at 421, score = 9 + 7
umis assigned: [73, 78, 99, 139, 173, 211, 213, 294, 365, 501] and 15 others
of which 25 are surviving nonsolos
reads assigned: 5860
start codons at 79, 230, 235, 382, 457
confident = true

TIG 2[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 983 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [14, 43, 104, 106, 180, 307, 335, 342, 394, 439] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5828
start codons at 36, 241, 244, 460
confident = true
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAAATCCCTCAGGTGGGAGCTACGCCGGGGATGTGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1055 = TAGTGGTTCCAGATCA-1

using 570 reads

====================================================================================

graph has 248 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 4, 12, 227, 319]
surviving nonsolo ucounts = 2[227, 319]
ids = [10, 5]

====================================================================================

UMI info for barcode TAGTGGTTCCAGATCA-1 contig 1 = ATCAGTCCCA...
umi CCGGAACTCT = 322 reads: +388 validated

UMI info for barcode TAGTGGTTCCAGATCA-1 contig 2 = GGGGTCTCAG...
umi TCTACACCTT = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 23, 29, 98, 234, 453
confident = false

TIG 2[bases=554]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-389 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
426-554 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CSSYTTSSTVVF at 362, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 38, 174, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1061 = TAGTGGTTCCGGCACA-1

using 179 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 7, 162]
surviving nonsolo ucounts = 1[162]
ids = [7]

====================================================================================

UMI info for barcode TAGTGGTTCCGGCACA-1 contig 1 = ACCACATCCC...
umi TTTAAATCTC = 153 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=520]
0-47 ==> 257-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
47-400 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=33)
424-477 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
477-520 ==> 0-43 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARNPGDNSWDSYFHLDLW at 389, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 47, 201, 241, 245, 311, 344
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1066 = TAGTGGTTCCTTGGTC-1

using 213 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[3^3, 5, 6^2, 7^2, 10, 11^2, 136]
surviving nonsolo ucounts = 1[136]
ids = [8]

====================================================================================

UMI info for barcode TAGTGGTTCCTTGGTC-1 contig 1 = AAAAACCACA...
umi CGGCTATTTT = 127 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=517]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-517 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1070 = TAGTGGTTCGCTTAGA-1

using 23 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1073 = TAGTGGTTCGTTTGCC-1

using 64 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 24
nonsolo ucounts = 10[2^2, 3^2, 4, 5, 6, 8^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1075 = TAGTGGTTCTATGTGG-1

using 605 reads

====================================================================================

graph has 207 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 5[2^2, 4, 254, 332]
surviving nonsolo ucounts = 2[254, 332]
ids = [8, 2]

====================================================================================

UMI info for barcode TAGTGGTTCTATGTGG-1 contig 1 = AAGAACCTGC...
umi AGCGCGATTT = 336 reads: +376 validated
umi TAATGGCATT = 254 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=639]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-398 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=8)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
428-639 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 114 reads
cdr3 = CQAWDSSTVVF at 367, score = 6 + 8
umis assigned: [2, 8]
of which 2 are surviving nonsolos
reads assigned: 582
start codons at 52, 57, 113, 198, 346, 350
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1077 = TAGTGGTTCTCCAACC-1

using 253 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 9, 236]
surviving nonsolo ucounts = 1[236]
ids = [5]

====================================================================================

UMI info for barcode TAGTGGTTCTCCAACC-1 contig 1 = GCTGTGCTGT...
umi GACAGTTCAT = 222 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=523]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-523 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSADSSGTYVVF at 358, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 43, 104, 173, 191, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1096 = TAGTTGGAGAGCTGCA-1

using 297 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 8, 281]
surviving nonsolo ucounts = 1[281]
ids = [5]

====================================================================================

UMI info for barcode TAGTTGGAGAGCTGCA-1 contig 1 = TCCTCAGTTC...
umi GTCGTAATCA = 267 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=513]
0-21 ==> 9-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
21-381 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
421-513 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTPLFTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 21, 54, 90, 178, 340, 360, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1112 = TAGTTGGAGCGCCTCA-1

using 331 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGAGCGCCTCA-1 contig 1 = AGAAGAGCTG...
umi CAGCCGCCTG = 325 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-188 ==> 0-154 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
191-385 ==> 154-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGISPRTF at 361, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 34, 245, 371, 464
confident = false
see insertion of ACT at pos 154 on |283|IGKV3-20|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1119 = TAGTTGGAGGACTGGT-1

using 301 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[301]
surviving nonsolo ucounts = 1[301]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGAGGACTGGT-1 contig 1 = GTGCTGGGGT...
umi TTATGGTAAC = 295 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=581]
0-43 ==> 119-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
43-383 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
437-581 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 51 reads
cdr3 = CCSEAGGGVPGLLF at 367, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 43, 197
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1120 = TAGTTGGAGGAGTTTA-1

using 953 reads

====================================================================================

graph has 308 edges initially, 12 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 363, 579]
surviving nonsolo ucounts = 2[363, 579]
ids = [0, 3]

====================================================================================

UMI info for barcode TAGTTGGAGGAGTTTA-1 contig 1 = GAGAAGAGCT...
umi AAACACTCAT = 360 reads: +388 validated

UMI info for barcode TAGTTGGAGGAGTTTA-1 contig 2 = TAGGATTTTA...
umi AGAGATAGGA = 577 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPPATF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 35, 243, 369, 465
confident = false

TIG 2[bases=583]
59-412 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
408-447 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
447-583 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 100 reads
cdr3 = CQQSYSTLYTF at 386, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 570
start codons at 59, 65, 121, 134, 270, 489
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1121 = TAGTTGGAGGCTAGCA-1

using 200 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 192]
surviving nonsolo ucounts = 1[192]
ids = [2]

====================================================================================

UMI info for barcode TAGTTGGAGGCTAGCA-1 contig 1 = TGGGAGGAGT...
umi CGCCAATAAC = 169 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=3)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYDNLPTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 31, 37, 93, 106, 245, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1127 = TAGTTGGAGGTTCCTA-1

using 5543 reads

====================================================================================

graph has 4439 edges initially, 68 edges after simplification

total ucounts = 1140
nonsolo ucounts = 604[2^211, 3^120, 4^74, 5^58, 6^37, 7^25, 8^15, 9^15, 10^9, 11^15, 12^4, 13^2, 16, 21, 24, 26, 31, 58^2, 68, 99, 125, 126, 151, 172, 210, 223, 228, 308, 319, 395]
surviving nonsolo ucounts = 15[10, 24, 31, 58, 99, 125, 126, 151, 172, 210, 223, 228, 308, 319, 395]
ids = [318, 370, 189, 0, 37, 1028, 708, 250, 193, 532, ...]

====================================================================================

UMI info for barcode TAGTTGGAGGTTCCTA-1 contig 1 = GATCAGGACT...
umi ATTAATTCTT = 151 reads: +397 validated
umi ATTACTCCTA = 317 reads: +397 validated
umi CCCCACTCCG = 314 reads: +397 validated
umi CGTATACGGG = 210 reads: +397 validated
umi CTCTTATGGC = 399 reads: +397 validated

UMI info for barcode TAGTTGGAGGTTCCTA-1 contig 2 = GGAGTCTCCC...
umi AAAAGATGCT = 56 reads: +401 -38 non-validated
umi AAGCTGTATG = 69 reads: +37 -1 +4 -2X +251 -11 +63 -1 +6 -1 +4 -58 invalidated
umi ATAAGCCACT = 31 reads: -16 +359 -1 +10 -53 non-validated
umi ATACATCCAT = 171 reads: +436 -3 non-validated
umi CACCGAGAGA = 11 reads: -16 +147 -140 +56 -60 +20 non-validated
umi CATCTCGAGC = 25 reads: -17 +63 -2 +315 -42 non-validated
umi CTTGCATCTC = 225 reads: +439 validated
umi GCATACTCTT = 125 reads: +410 -29 non-validated
umi TGGATATCCC = 113 reads: +135 -1XX +15 -1XX +1 -1XX +1 -4XX +1 -105XX +2 -6XX +1 -5XX +1 -2XX +1 -10XX +1 -1XX +144 invalidated
umi TTGAGTTCAT = 220 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 199 reads
cdr3 = CMQGLQTLRTF at 366, score = 9 + 8
umis assigned: [250, 254, 423, 532, 598]
of which 5 are surviving nonsolos
reads assigned: 1366
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true

TIG 2[bases=627]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=5)
435-498 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
498-627 ==> 0-129 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 3 umis using 71 reads
cdr3 = CARQRGGSGSEGAYYYYGLDVW at 401, score = 9 + 7
umis assigned: [0, 37, 189, 193, 318, 370, 637, 708, 1028, 1107]
of which 10 are surviving nonsolos
reads assigned: 1030
start codons at 59, 233, 257, 392
confident = true
now this is a cell
paired!

TTCTGTGCGAGACAAAGAGGCGGTTCAGGGAGTGAAGGGGCCTACTACTACTACGGTTTGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTCTACAAACTCTCCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1139 = TAGTTGGCAACTGCTA-1

using 309 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 305]
surviving nonsolo ucounts = 1[305]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGCAACTGCTA-1 contig 1 = GACTGATCAG...
umi AATGCATTTG = 306 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=570]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
395-434 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CMQALQTPPYTF at 370, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 34, 67, 103, 191, 353, 373, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1143 = TAGTTGGCAATGAAAC-1

using 195 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 188]
surviving nonsolo ucounts = 1[188]
ids = [6]

====================================================================================

UMI info for barcode TAGTTGGCAATGAAAC-1 contig 1 = GGGGGTCTCA...
umi TTCTTGTCAC = 186 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
39-400 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-484 ==> 0-57 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSSYTSSSTLVF at 363, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1145 = TAGTTGGCACAACTGT-1

using 57 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 4, 5, 7, 9, 10, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1149 = TAGTTGGCACATCTTT-1

using 363 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^2, 6, 7, 15, 329]
surviving nonsolo ucounts = 1[329]
ids = [4]

====================================================================================

UMI info for barcode TAGTTGGCACATCTTT-1 contig 1 = ATCACATAAC...
umi CCTGATTGCG = 333 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=602]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
449-500 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
500-602 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CAREESMQGVPAAIGAPNWFDPW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 58, 209, 256, 355, 418, 518, 579
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1150 = TAGTTGGCACATGGGA-1

using 409 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 10, 392]
surviving nonsolo ucounts = 1[392]
ids = [1]

====================================================================================

UMI info for barcode TAGTTGGCACATGGGA-1 contig 1 = GGAGTCAGAC...
umi CTCGACTCCT = 361 reads: +388 validated
umi GGGCCATAGG = 3 reads: +28 -78 +4 -1X +29 -1X +6 -1X +1 -2X +2 -3X +1 -36X +7 -1X +9 -1X +3 -1X +3 -1X +4 -1X +3 -2X +20 -139 invalidated

GOOD CONTIGS

TIG 1[bases=490]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-490 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 75 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1152 = TAGTTGGCACCCTATC-1

using 481 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3^2, 5, 192, 269]
surviving nonsolo ucounts = 2[192, 269]
ids = [1, 9]

====================================================================================

UMI info for barcode TAGTTGGCACCCTATC-1 contig 1 = ATACTTTCTG...
umi AGCTTAGGTA = 186 reads: +415 validated

UMI info for barcode TAGTTGGCACCCTATC-1 contig 2 = TGAGCGCAGA...
umi TACTCCCCGG = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
452-490 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDFPGNYFTFDIW at 376, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 37, 81, 161, 231, 433
confident = false

TIG 2[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-537 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1157 = TAGTTGGCAGACGCCT-1

using 138 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 131]
surviving nonsolo ucounts = 1[131]
ids = [5]

====================================================================================

UMI info for barcode TAGTTGGCAGACGCCT-1 contig 1 = CATGGACATG...
umi GGCTGGAGTA = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
1-354 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
350-389 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
389-468 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQSYSTPRTF at 328, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 1, 7, 63, 76, 212, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1166 = TAGTTGGCAGGCGATA-1

using 323 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[323]
surviving nonsolo ucounts = 1[323]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi GTCGCCCATC = 300 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=552]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-552 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1178 = TAGTTGGCATATACGC-1

using 12 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1179 = TAGTTGGCATCCGTGG-1

using 200 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 195]
surviving nonsolo ucounts = 1[195]
ids = [1]

====================================================================================

UMI info for barcode TAGTTGGCATCCGTGG-1 contig 1 = TCAGTTAGGA...
umi GAGTTACCTG = 163 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=455]
0-23 ==> 74-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
23-368 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
367-405 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
405-455 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSDWPRTF at 344, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 23, 92, 228, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1180 = TAGTTGGCATCGATGT-1

using 258 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 9, 12, 229]
surviving nonsolo ucounts = 1[229]
ids = [6]

====================================================================================

UMI info for barcode TAGTTGGCATCGATGT-1 contig 1 = GGCTGGGGTC...
umi GGGCAGGTGT = 227 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=572]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-385 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=12)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
433-572 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CCSYAGTSTNWVF at 366, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 42, 181, 193, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1184 = TAGTTGGCATGCCCGA-1

using 56 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[55]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1186 = TAGTTGGCATGTTCCC-1

using 87 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 75]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1188 = TAGTTGGCATTCGACA-1

using 949 reads

====================================================================================

graph has 352 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[3, 5, 8, 229, 244, 455]
surviving nonsolo ucounts = 3[229, 244, 455]
ids = [3, 4, 0]

====================================================================================

UMI info for barcode TAGTTGGCATTCGACA-1 contig 1 = TGGGGACTCC...
umi CTGAGTCCGG = 226 reads: +433 validated

UMI info for barcode TAGTTGGCATTCGACA-1 contig 2 = TGGGGAGGAA...
umi ACTCGCCCTA = 452 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=593]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-593 ==> 0-139 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 21, 65, 244, 247, 250, 336, 406
confident = false

TIG 2[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CQQYSNWPLAF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 443
start codons at 37, 106, 242, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1191 = TAGTTGGGTAAATGTG-1

using 12396 reads

====================================================================================

graph has 5508 edges initially, 82 edges after simplification

total ucounts = 888
nonsolo ucounts = 430[2^151, 3^87, 4^54, 5^42, 6^20, 7^11, 8^9, 9^6, 10^3, 12^3, 15, 16, 19, 27, 38, 46, 72, 77, 87^2, 106, 142, 153, 158, 162, 163, 173, 183^2, 193, 194, 218, 222, 224^2, 227, 239, 240, 247, 254, 269, 278^2, 289, 296, 336, 340, 399, 436, 455, 526, 646, 811, 812]
surviving nonsolo ucounts = 41[27, 38, 46, 72, 77, 87^2, 106, 142, 153, 158, 162, 163, 173, 183^2, 193, 194, 218, 222, 224^2, 227, 239, 240, 247, 254, 269, 278^2, 289, 296, 336, 340, 399, 436, 455, 526, 646, 811, 812]
ids = [846, 342, 188, 118, 799, 15, 137, 251, 218, 539, ...]

====================================================================================

UMI info for barcode TAGTTGGGTAAATGTG-1 contig 1 = TGAGCGCAGA...
umi AAAGTAGCCT = 86 reads: +394 validated
umi AACCACGGTT = 158 reads: +394 validated
umi AACGTATAGC = 163 reads: +394 validated
umi ACACGCTCGC = 651 reads: -363X +30 -1XX invalidated
umi ACTCTTACCT = 194 reads: +394 validated
umi ATGCTATGGC = 48 reads: +278 -7 +81 -1 +27 non-validated
umi CAACAAGGAG = 144 reads: +394 validated
umi CAGGTAGATT = 74 reads: +42 -1X +256 -10 +65 -20 invalidated
umi CGATGGCTCA = 812 reads: -351 +1 -8XX +2 -1XX +30 -1XX invalidated
umi GGTAAATGTA = 219 reads: +394 validated
umi GTAGATGGCG = 118 reads: +40 -3X +238 -1X +3 -3X +5 -2X +5 -1 +67 -1X +25 invalidated
umi TACCCACTCA = 520 reads: +394 validated
umi TCAAAGCCCT = 181 reads: -394 non-validated
umi TCTTTTTCAG = 221 reads: +394 validated
umi TGACATGTTT = 183 reads: +394 validated
umi TGTACCGATA = 168 reads: +362 -32 non-validated

UMI info for barcode TAGTTGGGTAAATGTG-1 contig 2 = GGGAGCATCA...
umi AGACTTGACC = 20 reads: +33 -1XX +7 -1XX +5 -1XX +4 -1XX +21 -1XX +6 -1XX +4 -2XX +23 -1XX +3 -2XX +11 -1XX +16 -282X invalidated
umi AGGCAATCTG = 33 reads: +33 -1XX +7 -1XX +5 -1XX +4 -1XX +21 -1XX +6 -1XX +4 -2XX +23 -1XX +3 -2XX +11 -1XX +16 -282X invalidated
umi ATTAATGCCG = 244 reads: +427 validated
umi CACGTACTGA = 254 reads: +427 validated
umi CCCAGATACG = 297 reads: +427 validated
umi CCTGCGTCCT = 809 reads: -321X +106 invalidated
umi CCTGGTAGGG = 38 reads: +309 -1 +5 -1 +9 -1 +15 -2 +2 -1 +81 non-validated
umi CGTACATTCT = 221 reads: +427 validated
umi CTAGTCAGGA = 229 reads: +427 validated
umi CTCTGGCGGA = 163 reads: +427 validated
umi CTTCTCGCCC = 273 reads: +427 validated
umi GCGTATCGGG = 158 reads: +427 validated
umi GTATGGCTTG = 281 reads: +427 validated
umi TCATTCGTCA = 228 reads: +427 validated
umi TTTAGGCCTG = 238 reads: +422 -1 +4 non-validated

GOOD CONTIGS

TIG 1[bases=641]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 253 reads
cdr3 = CATWDSSLSAGEVVF at 357, score = 7 + 8
umis assigned: [15, 25, 32, 65, 110, 188, 218, 251, 351, 578] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3874
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=651]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=16)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
491-651 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 11 umis using 283 reads
cdr3 = CARDRGSIIYGDYSLDYW at 406, score = 7 + 7
umis assigned: [118, 137, 197, 236, 298, 339, 342, 375, 392, 424] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3427
start codons at 64, 262, 267, 299, 328, 361, 397, 434, 545
confident = true
now this is a cell
paired!

ACGGCCATGTATTACTGTGCGAGAGATCGCGGCAGTATTATCTATGGTGACTACTCACTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGTCAG <==> CAGACTGGGGACGAGGCCGACTATTACTGCGCAACATGGGATAGCAGCCTGAGTGCCGGCGAAGTTGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1196 = TAGTTGGGTACCAGTT-1

using 263 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 252]
surviving nonsolo ucounts = 1[252]
ids = [1]

====================================================================================

UMI info for barcode TAGTTGGGTACCAGTT-1 contig 1 = ATCCAACAAC...
umi ACGTTCATCT = 244 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=522]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=33)
432-485 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
485-522 ==> 0-37 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARNPGDNSWDSYFHLDLW at 397, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 55, 209, 249, 253, 319, 352
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1199 = TAGTTGGGTAGCCTCG-1

using 274 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[6, 7, 10, 248]
surviving nonsolo ucounts = 1[248]
ids = [1]

====================================================================================

UMI info for barcode TAGTTGGGTAGCCTCG-1 contig 1 = GCTCTGCTTC...
umi AGTAACTCAC = 254 reads: +276 -1XX +2 -2X +113 invalidated

GOOD CONTIGS

TIG 1[bases=578]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-578 ==> 0-133 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1203 = TAGTTGGGTATAGGGC-1

using 319 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 312]
surviving nonsolo ucounts = 1[312]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGGTATAGGGC-1 contig 1 = GAGGAACTGC...
umi ATTATGGCCC = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-473 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQRSNWPPLYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 33, 238, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1204 = TAGTTGGGTATTCTCT-1

using 550 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 264, 281]
surviving nonsolo ucounts = 2[264, 281]
ids = [2, 3]

====================================================================================

UMI info for barcode TAGTTGGGTATTCTCT-1 contig 1 = GAATCAGTCC...
umi ACTGAAATTA = 242 reads: +388 validated

UMI info for barcode TAGTTGGGTATTCTCT-1 contig 2 = ACAAGAGGCA...
umi CCGGCGGCTG = 260 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=508]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-508 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=568]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
422-568 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQSYDTSLSGSVF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 31, 185, 188, 239, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1205 = TAGTTGGGTCAAAGAT-1

using 293 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[293]
surviving nonsolo ucounts = 1[293]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGGTCAAAGAT-1 contig 1 = GGGACTGATC...
umi TTCCGTGTTC = 280 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=492]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
402-439 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
439-492 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQSPRGLTF at 372, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 36, 69, 105, 193, 355, 375, 481
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1216 = TAGTTGGGTCTGCCAG-1

using 30 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1221 = TAGTTGGGTGATAAAC-1

using 192 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 6, 178]
surviving nonsolo ucounts = 1[178]
ids = [5]

====================================================================================

UMI info for barcode TAGTTGGGTGATAAAC-1 contig 1 = ACCCAAAAAC...
umi TATATAGGGG = 1 reads: -395 +4 -3X +19 -1X +14 invalidated
umi TATGTCGCCT = 174 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=541]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-541 ==> 0-51 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4, 5]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1238 = TAGTTGGGTTATGTGC-1

using 84 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 78]
surviving nonsolo ucounts = 1[78]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1239 = TAGTTGGGTTATTCTC-1

using 245 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 6, 229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TAGTTGGGTTATTCTC-1 contig 1 = GGGGAGGAAT...
umi AATACATTTG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1244 = TAGTTGGTCAAAGACA-1

using 921 reads

====================================================================================

graph has 342 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4^2, 6, 904]
surviving nonsolo ucounts = 1[904]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=397]
3-151 ==> 1952-2100 on segment after IGLV3-12 exon 2 [len=6000] (mis=0)
148-186 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
186-397 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 894
start codons at 8, 79, 107
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1248 = TAGTTGGTCACCGGGT-1

using 64 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[64]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1252 = TAGTTGGTCAGTACGT-1

using 308 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [2]

====================================================================================

UMI info for barcode TAGTTGGTCAGTACGT-1 contig 1 = CTGGGCCTCA...
umi GCCTACACAA = 291 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=567]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-374 ==> 0-337 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
413-567 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQAWDSSIGVF at 352, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 37, 42, 98, 185, 331, 335, 545
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1254 = TAGTTGGTCAGTTTGG-1

using 228 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [2]

====================================================================================

UMI info for barcode TAGTTGGTCAGTTTGG-1 contig 1 = ACCACACCCC...
umi TATGCTCATT = 205 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=555]
0-46 ==> 13-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
46-399 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
448-482 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
482-555 ==> 0-73 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 388, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 46, 244, 249, 266, 310, 343, 536
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1258 = TAGTTGGTCCACGTGG-1

using 440 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[433]
surviving nonsolo ucounts = 1[433]
ids = [4]

====================================================================================

UMI info for barcode TAGTTGGTCCACGTGG-1 contig 1 = AGTCCCACTC...
umi CCACTTTACT = 433 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 427
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1266 = TAGTTGGTCCTATGTT-1

using 271 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 265]
surviving nonsolo ucounts = 1[265]
ids = [3]

====================================================================================

UMI info for barcode TAGTTGGTCCTATGTT-1 contig 1 = GGAGTCAGTC...
umi TCTTCATCAG = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-361 ==> 0-335 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
414-498 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQIFSNLSTF at 353, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 26, 32, 88, 101, 237, 258, 407, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1275 = TAGTTGGTCGGAAATA-1

using 195 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 190]
surviving nonsolo ucounts = 1[190]
ids = [2]

====================================================================================

UMI info for barcode TAGTTGGTCGGAAATA-1 contig 1 = GATGCTTTCT...
umi TTCGTCCGCT = 161 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=484]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=2)
420-471 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARQGPRYSYGLYNWFDPW at 383, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 1, 17, 26, 38, 82, 411
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1277 = TAGTTGGTCGTACCGG-1

using 767 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2^3, 4, 6, 743]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1278 = TAGTTGGTCGTTGACA-1

using 189 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 178]
surviving nonsolo ucounts = 1[178]
ids = [5]

====================================================================================

UMI info for barcode TAGTTGGTCGTTGACA-1 contig 1 = AAGAGGCAGC...
umi GGCGACTTCT = 177 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=583]
0-30 ==> 132-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
30-370 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
424-583 ==> 0-159 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CCSYAGSSTIPYVF at 354, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 30, 231, 238, 364, 388, 556
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1289 = TAGTTGGTCTGGTATG-1

using 260 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

UMI info for barcode TAGTTGGTCTGGTATG-1 contig 1 = AGATCTCAGA...
umi TGTGCGCTGG = 257 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=574]
0-79 ==> 0-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=8)
457-503 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDRSSIGVAGTVEYW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 79, 235, 296, 314, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1296 = TAGTTGGTCTTTACGT-1

using 99 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 87]
surviving nonsolo ucounts = 1[87]
ids = [3]

====================================================================================

UMI info for barcode TAGTTGGTCTTTACGT-1 contig 1 = TATCCACTTG...
umi GACCCCGCTT = 83 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=508]
0-40 ==> 39-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
40-393 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
394-421 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
429-482 ==> 10-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDLLLWFRELPHPGYYGMDVW at 382, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 40, 196, 343, 402, 439, 488
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1300 = TATCAGGAGAAGGGTA-1

using 338 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[11, 327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode TATCAGGAGAAGGGTA-1 contig 1 = TACAACAGGC...
umi AGTCATTAGT = 316 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=515]
0-26 ==> 149-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
26-389 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
429-515 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYYSTRMYTF at 365, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 26, 95, 348, 389, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1301 = TATCAGGAGAATTGTG-1

using 339 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[336]
surviving nonsolo ucounts = 1[336]
ids = [0]

====================================================================================

UMI info for barcode TATCAGGAGAATTGTG-1 contig 1 = GATCAGGACT...
umi AAGCGGGGGG = 322 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-522 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1307 = TATCAGGAGATCCCAT-1

using 288 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 282]
surviving nonsolo ucounts = 1[282]
ids = [2]

====================================================================================

UMI info for barcode TATCAGGAGATCCCAT-1 contig 1 = GGAGTCAGTC...
umi CTCGATGCGT = 282 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-89 ==> 0-63 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
89-374 ==> 66-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=22)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQINSYPLTF at 350, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 26, 32, 183, 234, 453
confident = false
see deletion of 3 bases at pos 63 on |239|IGKV1-9|L-REGION+V-REGION|
>vscore_91.1307_63.7%
ATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAGAGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGCAGGAGACAGAGTCACCATCACTTGTCGGGCCAGTCTGGACATTGACACTTATGTAGCCTGGTATCAGCAAAAACCAGGGAGAGCCCCTAAACTCCTAATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGGTCTGGGACACATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTACAACTTATTACTGTCAACAAATTAACAGTTATCCT
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1308 = TATCAGGAGATCGGGT-1

using 49 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 4^3, 5, 6, 8, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1311 = TATCAGGAGCCACGTC-1

using 445 reads

====================================================================================

graph has 184 edges initially, 18 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[197, 242]
surviving nonsolo ucounts = 2[197, 242]
ids = [4, 2]

====================================================================================

UMI info for barcode TATCAGGAGCCACGTC-1 contig 1 = GTGGGCTCAG...
umi CCGTTCTTTC = 239 reads: +379 validated

UMI info for barcode TATCAGGAGCCACGTC-1 contig 2 = GCTCTGCTTC...
umi GACTATGCCT = 186 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-371 ==> 0-336 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=6)
376-414 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=5)
414-527 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CYSTDSSLRGVF at 350, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false

TIG 2[bases=545]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=7)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
436-545 ==> 0-109 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLKVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1312 = TATCAGGAGCGATTCT-1

using 561 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 244, 310]
surviving nonsolo ucounts = 2[244, 310]
ids = [7, 1]

====================================================================================

UMI info for barcode TATCAGGAGCGATTCT-1 contig 1 = AGGAATCAGT...
umi ATATAATCTA = 311 reads: +388 validated
umi TTTTCTAAAC = 244 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 98 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1, 7]
of which 2 are surviving nonsolos
reads assigned: 545
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1313 = TATCAGGAGCGCCTTG-1

using 244 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 238]
surviving nonsolo ucounts = 1[238]
ids = [4]

====================================================================================

UMI info for barcode TATCAGGAGCGCCTTG-1 contig 1 = AGTCTGGGCC...
umi GGACAACCTT = 231 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=513]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-379 ==> 0-339 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-513 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQVWDGSSLSRVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 40, 101, 239, 242, 245, 338, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1320 = TATCAGGAGGCTCATT-1

using 179 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 173]
surviving nonsolo ucounts = 1[173]
ids = [5]

====================================================================================

UMI info for barcode TATCAGGAGGCTCATT-1 contig 1 = TGGGGGCAGG...
umi TGCGTAGGTA = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQSYTTLLTF at 361, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 34, 40, 96, 109, 245, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1326 = TATCAGGAGTACCGGA-1

using 4405 reads

====================================================================================

graph has 3200 edges initially, 22 edges after simplification

total ucounts = 736
nonsolo ucounts = 328[2^116, 3^72, 4^50, 5^30, 6^14, 7^13, 8^11, 9^4, 10^3, 13^2, 26, 165, 171, 205, 207, 223, 234, 241, 253, 259, 266, 276, 318]
surviving nonsolo ucounts = 12[26, 171, 205, 207, 223, 234, 241, 253, 259, 266, 276, 318]
ids = [404, 315, 447, 386, 637, 145, 691, 677, 614, 456, ...]

====================================================================================

UMI info for barcode TATCAGGAGTACCGGA-1 contig 1 = TGGGAGGAAT...
umi GCTTACAGTT = 264 reads: +388 validated
umi TCGACGGCCT = 282 reads: +388 validated

UMI info for barcode TATCAGGAGTACCGGA-1 contig 2 = AGCTCTGGGA...
umi ATGCTGTACG = 227 reads: +427 validated
umi CAAGCTAGAT = 307 reads: +427 validated
umi CGTGGGTTCG = 172 reads: +398 -24 +5 non-validated
umi GAAAGTATCT = 199 reads: +427 validated
umi GAGCCGTTTT = 26 reads: +303 -3 +79 -1 +5 -36 non-validated
umi GCGTGTCTCT = 200 reads: +427 validated
umi TCTGTAGGAC = 257 reads: +427 validated
umi TTACTTCTCA = 251 reads: +427 validated
umi TTCAGTTGAG = 239 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CLQHNSYPPTF at 358, score = 9 + 8
umis assigned: [456, 591]
of which 2 are surviving nonsolos
reads assigned: 537
start codons at 31, 37, 106, 188, 242, 461
confident = true

TIG 2[bases=596]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=12)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
507-596 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 7 umis using 161 reads
cdr3 = CASVKPIQLWLTPVFDYW at 422, score = 9 + 7
umis assigned: [145, 178, 315, 386, 404, 447, 614, 677, 691]
of which 9 are surviving nonsolos
reads assigned: 1847
start codons at 80, 236, 308, 383, 448, 561
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGTGTCAAGCCGATTCAGCTATGGCTAACTCCTGTATTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCCGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1328 = TATCAGGAGTATCGAA-1

using 27 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 1[23]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1329 = TATCAGGAGTCTCCTC-1

using 817 reads

====================================================================================

graph has 386 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 5, 220, 262, 327]
surviving nonsolo ucounts = 3[220, 262, 327]
ids = [4, 5, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=561]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2, 4, 5]
of which 3 are surviving nonsolos
reads assigned: 791
start codons at 30, 63, 91, 99, 187, 349, 369, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1334 = TATCAGGCAAACTGCT-1

using 481 reads

====================================================================================

graph has 172 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 196, 270]
surviving nonsolo ucounts = 2[196, 270]
ids = [4, 7]

====================================================================================

UMI info for barcode TATCAGGCAAACTGCT-1 contig 1 = GAGGAATCAG...
umi GACCGCCGCT = 179 reads: +388 validated

UMI info for barcode TATCAGGCAAACTGCT-1 contig 2 = AGGCCCCTCC...
umi GGTTTTAGCA = 264 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=511]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-511 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=591]
0-93 ==> 82-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
93-456 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
459-496 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
496-591 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYYSTPQLTF at 432, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 93, 162, 415, 538
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1336 = TATCAGGCAAAGTGCG-1

using 384 reads

====================================================================================

graph has 198 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 11[2, 3^2, 4, 6, 9, 10^2, 11, 12, 310]
surviving nonsolo ucounts = 1[310]
ids = [2]

====================================================================================

UMI info for barcode TATCAGGCAAAGTGCG-1 contig 1 = GGGAGTCAGT...
umi ACCTAACTTG = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSGSSPRTF at 354, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 27, 33, 89, 102, 238, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1343 = TATCAGGCAATGGATA-1

using 285 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [5]

====================================================================================

UMI info for barcode TATCAGGCAATGGATA-1 contig 1 = GCTCTGCCTC...
umi GGTAAGCGGA = 268 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-579 ==> 0-134 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1347 = TATCAGGCACATTAGC-1

using 61 reads

====================================================================================

graph has 83 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^4, 3, 4, 6^4, 7, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1350 = TATCAGGCACGGACAA-1

using 409 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 6, 397]
surviving nonsolo ucounts = 1[397]
ids = [3]

====================================================================================

UMI info for barcode TATCAGGCACGGACAA-1 contig 1 = GAAGAGCTGC...
umi GGGGCCTGTA = 398 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYGSSSLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1354 = TATCAGGCAGCATGAG-1

using 293 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 281]
surviving nonsolo ucounts = 1[281]
ids = [4]

====================================================================================

UMI info for barcode TATCAGGCAGCATGAG-1 contig 1 = AGACCCAGTC...
umi GTCGGACTCG = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-494 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQANSFPPTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1356 = TATCAGGCAGGAATGC-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1358 = TATCAGGCAGTAACGG-1

using 982 reads

====================================================================================

graph has 368 edges initially, 8 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[6, 49, 226, 697]
surviving nonsolo ucounts = 3[49, 226, 697]
ids = [4, 2, 6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=350]
5-177 ==> 176-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
176-214 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
214-350 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGTSPLTF at 153, score = 9 + 9
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 911
start codons at 37, 163, 256
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1361 = TATCAGGCATACCATG-1

using 67 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 61]
surviving nonsolo ucounts = 1[61]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1364 = TATCAGGCATATGGTC-1

using 154 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 150]
surviving nonsolo ucounts = 1[150]
ids = [3]

====================================================================================

UMI info for barcode TATCAGGCATATGGTC-1 contig 1 = GGCTGGGGTC...
umi TATGAATAGG = 147 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
42-394 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=22)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
430-480 ==> 0-50 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CTSYTSSGTRVF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 42, 178, 199, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1367 = TATCAGGCATCGTCGG-1

using 42 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 37]
surviving nonsolo ucounts = 1[37]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1368 = TATCAGGCATCTGGTA-1

using 167 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1370 = TATCAGGCATGCATGT-1

using 160 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[155]
surviving nonsolo ucounts = 1[155]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
1-287 ==> 67-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=18)
316-364 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
364-463 ==> 0-99 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGDRRAAAFYYHYMDVW at 276, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 90, 132, 198, 231, 321, 418
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1372 = TATCAGGCATTGGCGC-1

using 39 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1389 = TATCAGGTCCAGAGGA-1

using 135 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 129]
surviving nonsolo ucounts = 1[129]
ids = [2]

====================================================================================

UMI info for barcode TATCAGGTCCAGAGGA-1 contig 1 = GGAGTCTCCC...
umi CATGTACACC = 126 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=509]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-509 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 59, 233
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1402 = TATCAGGTCGTGACAT-1

using 613 reads

====================================================================================

graph has 280 edges initially, 4 edges after simplification

total ucounts = 47
nonsolo ucounts = 19[2^8, 3^4, 4, 5, 9, 10, 12, 217, 300]
surviving nonsolo ucounts = 3[2, 217, 300]
ids = [45, 44, 14]

====================================================================================

UMI info for barcode TATCAGGTCGTGACAT-1 contig 1 = TCTGGCACCA...
umi CATCCACGTA = 286 reads: +385 validated

UMI info for barcode TATCAGGTCGTGACAT-1 contig 2 = ATGGAGGATC...
umi TTTTTACGGG = 207 reads: +397 validated
umi TTTTTTACGG = 2 reads: -124 +56 -115 +56 -46 non-validated
umi TTTTTTCTGG = 1 reads: -258 +16 -2 +1 -1 +3 -1 +18 -1 +2 -1 +2 -1 +7 -83 non-validated

GOOD CONTIGS

TIG 1[bases=538]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-538 ==> 0-119 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLLSYSGAWVF at 358, score = 8 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 34, 242, 341
confident = false

TIG 2[bases=502]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=4)
36-362 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
433-502 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CMNTLPGGFTF at 372, score = 8 + 7
umis assigned: [44, 45, 46]
of which 2 are surviving nonsolos
reads assigned: 210
start codons at 0, 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1404 = TATCAGGTCTAGAGTC-1

using 354 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[2^2, 3, 5, 86, 246]
surviving nonsolo ucounts = 2[86, 246]
ids = [8, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1407 = TATCAGGTCTCTGTCG-1

using 266 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 263]
surviving nonsolo ucounts = 1[263]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=498]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-27 ==> 5973-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-27 ==> 5269-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-27 ==> 782-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-27 ==> 9983-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-27 ==> 786-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
12-45 ==> 5674-5707 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
45-377 ==> 19-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-498 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYTFSHTF at 353, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 27, 33, 88, 101, 184, 237, 240, 333, 456
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1410 = TATCAGGTCTGTGCAA-1

using 132 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 128]
surviving nonsolo ucounts = 1[128]
ids = [2]

====================================================================================

UMI info for barcode TATCAGGTCTGTGCAA-1 contig 1 = CAGCTGTGGG...
umi CTCCCGACCC = 122 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=498]
0-42 ==> 9-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
42-398 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
398-436 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
436-498 ==> 0-62 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQSYDSSLSGLYVF at 366, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 42, 196, 199, 250, 349, 376, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1412 = TATCAGGTCTTGTTTG-1

using 222 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 9, 208]
surviving nonsolo ucounts = 1[208]
ids = [4]

====================================================================================

UMI info for barcode TATCAGGTCTTGTTTG-1 contig 1 = AGCTTCAGCT...
umi TCCGTCCCGC = 212 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-565 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1416 = TATCTCAAGACCTTTG-1

using 701 reads

====================================================================================

graph has 202 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 340, 351]
surviving nonsolo ucounts = 2[340, 351]
ids = [7, 6]

====================================================================================

UMI info for barcode TATCTCAAGACCTTTG-1 contig 1 = GGGGGAAGGA...
umi TCTCATTATC = 345 reads: +382 validated

UMI info for barcode TATCTCAAGACCTTTG-1 contig 2 = GGAGGAGTCA...
umi AGACTAATGA = 4 reads: -1 +21 -1X +7 -1 +11 -1 +5 -1X +13 -1X +4 -1X +6 -1X +24 -169 +1 -1X +3 -1X +1 -1X +11 -1X +3 -2X +24 -1X +2 -1X +3 -64 invalidated
umi GTGTCTAGAA = 352 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
38-383 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNWPRTF at 359, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 38, 107, 243, 462
confident = false

TIG 2[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=22)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQDHNYPFTF at 356, score = 9 + 8
umis assigned: [0, 6]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 29, 35, 91, 104, 186, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1425 = TATCTCAAGCACAGGT-1

using 477 reads

====================================================================================

graph has 232 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[13, 130, 330]
surviving nonsolo ucounts = 2[130, 330]
ids = [2, 5]

====================================================================================

UMI info for barcode TATCTCAAGCACAGGT-1 contig 1 = GTCAGTCTCA...
umi CTCAAAATGC = 123 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=474]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
414-474 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQSYSTLWSSF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 23, 29, 85, 98, 234, 456
confident = false

REJECT CONTIGS

TIG 1[bases=416]
0-272 ==> 105-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=26)
301-349 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=8)
349-416 ==> 0-67 on |3|IGHA2|C-REGION| [len=1019] (mis=1)
cdr3 = CASRVPIVGATVGVLFDSW at 261, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 403
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1429 = TATCTCAAGCCGCCTA-1

using 368 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[366]
surviving nonsolo ucounts = 1[366]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=332]
0-161 ==> 192-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
159-196 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
196-332 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYTTLLTF at 135, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 19, 238
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1433 = TATCTCAAGCTAACAA-1

using 286 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode TATCTCAAGCTAACAA-1 contig 1 = TGATCAGGAC...
umi AGCCGACCCT = 268 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=482]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
397-434 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
434-482 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQSPRGLTF at 367, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 31, 64, 100, 188, 350, 370, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1439 = TATCTCAAGCTTATCG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1443 = TATCTCAAGGCAGTCA-1

using 8014 reads

====================================================================================

graph has 5177 edges initially, 96 edges after simplification

total ucounts = 1028
nonsolo ucounts = 496[2^162, 3^95, 4^69, 5^41, 6^27, 7^24, 8^17, 9^10, 10^7, 11^6, 12^5, 13^2, 16^2, 27^2, 28, 32, 83, 98, 110, 112, 114, 137, 141, 165, 174, 213, 224, 225^2, 227, 229, 230, 240, 245, 247, 249, 263, 277, 323, 428, 489]
surviving nonsolo ucounts = 25[4, 32, 83, 98, 110, 114, 137, 165, 174, 213, 224, 225^2, 227, 229, 230, 240, 245, 247, 249, 263, 277, 323, 428, 489]
ids = [347, 508, 424, 646, 888, 625, 348, 937, 901, 1012, ...]

====================================================================================

UMI info for barcode TATCTCAAGGCAGTCA-1 contig 1 = GGGGTCACAA...
umi ACTGGCACTC = 231 reads: +391 validated
umi AGGCTTTTCA = 335 reads: +246 -1XX +144 invalidated
umi ATGTTATCAT = 250 reads: +391 validated
umi ATTTAACGCT = 224 reads: +391 validated
umi CCAAAGTCGC = 136 reads: +391 validated
umi CCACCGTCCA = 245 reads: +391 validated
umi CCTTATGGTT = 249 reads: +391 validated
umi CGCAACACTA = 85 reads: +391 validated
umi GAATCACTAT = 265 reads: +391 validated
umi GATCGACAGT = 240 reads: +391 validated
umi GCATAGGGTT = 222 reads: +391 validated
umi GCCTTTTATT = 232 reads: +391 validated
umi GCTCGGCGGT = 98 reads: +391 validated
umi GTTACTTGGA = 429 reads: +391 validated
umi TAGTCTAATA = 224 reads: +391 validated
umi TCATGGCCTC = 228 reads: +391 validated
umi TCTGATGTAC = 491 reads: +391 validated
umi TGGTCAGATT = 177 reads: +391 validated
umi TTAGTGTGGT = 166 reads: +391 validated
umi TTTACGTGGA = 278 reads: +391 validated
umi TTTCTCGTCG = 210 reads: +391 validated

UMI info for barcode TATCTCAAGGCAGTCA-1 contig 2 = GGTGATCATC...
umi CTGACACATA = 11 reads: +8 -1XX +6 -1XX +13 -1XX +6 -1XX +6 -1X +13 -1XX +29 -1XX +4 -1XX +9 -1XX +9 -1XX +25 -1XX +2 -1XX +1 -1XX +3 -2XX +1 -1XX +3 -2XX +3 -1XX +22 -1XX +17 -257X invalidated
umi GCCTTGGTTC = 115 reads: +457 validated
umi TGCGAATGGG = 3 reads: -417X +3 -2XX +9 -1XX +2 -2XX +2 -2XX +5 -1XX +11 invalidated

GOOD CONTIGS

TIG 1[bases=640]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=14)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=8)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 21 umis using 794 reads
cdr3 = CCSYAGDGTSVVF at 362, score = 8 + 5
umis assigned: [155, 185, 247, 259, 348, 357, 410, 424, 553, 582] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4915
start codons at 38, 177, 246, 372, 381
confident = true

TIG 2[bases=596]
0-31 ==> 36-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
31-384 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=25)
446-488 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
488-596 ==> 0-108 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CARVLQKPMAQGLIITWLDLYYSGLDVW at 373, score = 9 + 7
umis assigned: [508, 625, 888]
of which 3 are surviving nonsolos
reads assigned: 127
start codons at 31, 187, 245, 248, 334, 397
confident = true
now this is a cell
paired!

CAAAAACCGATGGCTCAGGGACTTATTATAACCTGGCTAGACCTCTACTACTCCGGTCTGGACGTCTGGGGCCAAGGGACCACGGTCAGCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCGGGTGATGGCACTTCCGTGGTCTTTGGCGGACGGACCAGCCTGGCCGTCGTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1445 = TATCTCAAGGCTAGCA-1

using 60 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[58]
surviving nonsolo ucounts = 1[58]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=330]
0-303 ==> 42-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
302-330 ==> 0-28 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 44
start codons at 27, 163
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1462 = TATCTCACAAACTGCT-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1463 = TATCTCACAAAGTCAA-1

using 5573 reads

====================================================================================

graph has 3102 edges initially, 80 edges after simplification

total ucounts = 362
nonsolo ucounts = 241[2^42, 3^31, 4^24, 5^23, 6^21, 7^13, 8^13, 9^15, 10^18, 11^7, 12^4, 13, 14^3, 15^6, 17, 18^2, 19^3, 20^2, 23, 26, 172, 189, 224, 283, 344, 356, 375, 378, 404, 1234]
surviving nonsolo ucounts = 10[172, 189, 224, 283, 344, 356, 375, 378, 404, 1234]
ids = [52, 328, 332, 78, 292, 25, 307, 151, 134, 360]

====================================================================================

UMI info for barcode TATCTCACAAAGTCAA-1 contig 1 = GAGCTCTGGG...
umi AGTTACCTCT = 169 reads: +412 validated
umi TGGTTCCGCT = 190 reads: +412 validated

UMI info for barcode TATCTCACAAAGTCAA-1 contig 2 = AGACCCACTC...
umi ACCATAGCCC = 354 reads: +388 validated
umi TCTGTATATG = 373 reads: +388 validated
umi TGTGTAACTC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=4)
446-492 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
492-563 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 23 reads
cdr3 = CGQGIAVGGIDYW at 422, score = 9 + 6
umis assigned: [52, 328]
of which 2 are surviving nonsolos
reads assigned: 353
start codons at 80, 231, 236, 294, 297, 315, 383
confident = true

TIG 2[bases=544]
0-20 ==> 9-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
20-371 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=3)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 180 reads
cdr3 = CLQDYNYPLTF at 347, score = 9 + 9
umis assigned: [25, 307, 332]
of which 3 are surviving nonsolos
reads assigned: 939
start codons at 20, 26, 82, 95, 177, 231, 450
confident = true

REJECT CONTIGS

TIG 1[bases=362]
0-79 ==> 1-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
0-79 ==> 7067-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-79 ==> 7061-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
48-115 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
79-260 ==> 0-181 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
260-362 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [360]
of which 1 are surviving nonsolos
reads assigned: 1218
start codons at 79, 230, 235, 278, 339
confident = false
did not find CDR3

TIG 2[bases=480]
1-254 ==> 2292-2545 on rc of segment before IGHD1-20 exon 1 [len=2612] (mis=4)
245-314 ==> 2581-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
346-409 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
409-480 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [134]
of which 1 are surviving nonsolos
reads assigned: 399
start codons at 214, 366
confident = false
did not find CDR3

TIG 3[bases=575]
0-47 ==> 134-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
0-53 ==> 5947-6000 on rc of segment after IGKV1-8 exon 1 [len=6000] (mis=3)
17-98 ==> 5659-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
47-400 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=5)
402-439 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
439-575 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [78, 151, 292]
of which 3 are surviving nonsolos
reads assigned: 995
start codons at 16, 47, 53, 109, 122, 185, 258, 481
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGAGCTGAGGACACGGCTGTGTATTACTGTGGTCAGGGGATAGCAGTGGGTGGGATTGACTACTGGGGCCAGGGAACCCTGGTCATCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1477 = TATCTCACACCTATCC-1

using 749 reads

====================================================================================

graph has 856 edges initially, 8 edges after simplification

total ucounts = 207
nonsolo ucounts = 79[2^26, 3^21, 4^8, 5^7, 6^5, 7^4, 8^2, 9^2, 16^2, 23, 292]
surviving nonsolo ucounts = 1[292]
ids = [190]

====================================================================================

UMI info for barcode TATCTCACACCTATCC-1 contig 1 = GAGAGAGGAG...
umi TTCATAGCCT = 268 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=489]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CANLAVQYYFDYW at 415, score = 9 + 7
umis assigned: [190]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 73, 224, 229, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1479 = TATCTCACACGACTCG-1

using 9 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1489 = TATCTCACAGTACACT-1

using 140 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [1]

====================================================================================

UMI info for barcode TATCTCACAGTACACT-1 contig 1 = GAGCTCTGGG...
umi GCTGCAACCC = 136 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=525]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=3)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=15)
459-510 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
junction support: 1 umis using 8 reads
cdr3 = CARGAGYDFLSGHHWFDPW at 422, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 80, 236, 287, 294, 297, 315, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1491 = TATCTCACATACTACG-1

using 135 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1497 = TATCTCACATCGGACC-1

using 291 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 287]
surviving nonsolo ucounts = 1[287]
ids = [2]

====================================================================================

UMI info for barcode TATCTCACATCGGACC-1 contig 1 = TCAGGAAGCA...
umi GGCCTTCCCT = 283 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=545]
0-30 ==> 22-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
30-362 ==> 0-332 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=7)
368-406 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
406-545 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQAWDSNSRVF at 345, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 30, 35, 91, 178, 324, 328
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1505 = TATCTCAGTAAGTGGC-1

using 17 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1519 = TATCTCAGTCAACATC-1

using 22143 reads

====================================================================================

graph has 9220 edges initially, 102 edges after simplification

total ucounts = 1304
nonsolo ucounts = 654[2^236, 3^136, 4^73, 5^55, 6^25, 7^21, 8^11, 9^5, 10^3, 11^6, 12, 14, 16^2, 17, 19, 26, 36, 43, 68, 69, 94, 96, 97, 100, 113, 126, 129, 132, 145, 151, 157, 161, 162, 170^2, 180, 183, 185, 196, 202, 206, 208^2, 212^2, 216, 219, 225, 228, 229, 230, 236, 238, 247, 252, 255, 267, 273, 275, 279^2, 281, 283^2, 289, 290, 291, 294^2, 297, 302, 305, 306, 310^2, 312, 313, 316, 327^2, 328, 344, 345, 347, 355, 359, 360, 363, 406, 449, 799, 1055]
surviving nonsolo ucounts = 74[36, 69, 94, 96, 97, 100, 113, 126, 129, 132, 145, 151, 157, 161, 162, 170^2, 180, 183, 185, 196, 202, 206, 208^2, 212^2, 216, 219, 225, 228, 229, 230, 236, 238, 247, 252, 255, 267, 273, 275, 279^2, 281, 283^2, 289, 290, 291, 294^2, 297, 302, 305, 306, 310^2, 312, 313, 316, 327^2, 328, 344, 345, 347, 355, 359, 360, 363, 406, 449, 799, 1055]
ids = [719, 473, 188, 418, 1269, 580, 613, 154, 1089, 478, ...]

====================================================================================

UMI info for barcode TATCTCAGTCAACATC-1 contig 1 = AGCTCTGGGA...
umi ACTCGTCCTT = 271 reads: +421 validated
umi AGAATTCCTC = 218 reads: +409 -1 +11 non-validated
umi AGCCTACCGG = 231 reads: +421 validated
umi ATCATGCGAC = 153 reads: +421 validated
umi CTTCGGCACA = 275 reads: +421 validated
umi GACTCAATTG = 303 reads: +421 validated
umi GCATTGTGGG = 33 reads: +91 -22 +293 -1 +14 non-validated
umi GGGATCCTTT = 288 reads: +421 validated
umi TACCATTCCA = 205 reads: +421 validated
umi TCAGACCCAT = 209 reads: +421 validated
umi TGTCAAGTAC = 314 reads: +421 validated

UMI info for barcode TATCTCAGTCAACATC-1 contig 2 = GGGGTCACAA...
umi AAAACAGCTG = 179 reads: +382 validated
umi AAAATTGTTT = 216 reads: +382 validated
umi AACATGACGG = 238 reads: +382 validated
umi AAGCATTAGA = 278 reads: +382 validated
umi AATCCACAGA = 157 reads: +382 validated
umi ACAAATTATG = 1064 reads: -273 +109 non-validated
umi ACATCGTTAT = 305 reads: +382 validated
umi ACGTATGAAT = 244 reads: +382 validated
umi AGCTTTTGGT = 332 reads: +214 -6XX +1 -3XX +1 -1XX +1 -10XX +1 -39XX +3 -2XX +1 -1XX +1 -1XX +2 -10XX +84 invalidated
umi AGTATTGCCG = 174 reads: +382 validated
umi ATATACACGG = 226 reads: +382 validated
umi CAACCACACC = 153 reads: +382 validated
umi CAAGACTCTT = 225 reads: +382 validated
umi CAATAGCATT = 255 reads: +382 validated
umi CAATTCGCGG = 185 reads: +382 validated
umi CACTCATTAA = 204 reads: +382 validated
umi CATACTTGAG = 96 reads: +382 validated
umi CCCAGATTGG = 165 reads: +382 validated
umi CCGAAGTTTA = 266 reads: +382 validated
umi CCTCTAATTA = 137 reads: +382 validated
umi GCACTTGGGT = 344 reads: +382 validated
umi GGATAGTCCG = 211 reads: +382 validated
umi GGCAACAGTC = 349 reads: +382 validated
umi GGTACAAGGC = 293 reads: +382 validated
umi GTTTTTCCAC = 194 reads: +382 validated
umi TAGACTTCAG = 284 reads: +382 validated
umi TAGTCCTCCT = 319 reads: +382 validated
umi TATAATCCTC = 216 reads: +382 validated
umi TCCATGGGTT = 213 reads: +382 validated
umi TCGAGTGGGT = 160 reads: +382 validated
umi TCGTCGAACG = 147 reads: +382 validated
umi TCTGTCGCAA = 127 reads: +382 validated
umi TCTTACCCGC = 809 reads: -193X +189 invalidated
umi TGAACTTGGC = 296 reads: +382 validated
umi TTTACAGTCA = 305 reads: +382 validated
umi TTTCCCAGTC = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=26)
431-451 ==> 0-20 on |10|IGHD1-26|D-REGION| [len=20] (mis=3)
452-501 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 176 reads
cdr3 = CAKDILGATTYGMDVW at 422, score = 9 + 7
umis assigned: [174, 192, 205, 274, 612, 662, 719, 800, 908, 1001] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2458
start codons at 80, 225, 231, 236, 315, 383, 458
confident = true

TIG 2[bases=631]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 35 umis using 1421 reads
cdr3 = CCSYAGRGVF at 362, score = 8 + 8
umis assigned: [2, 8, 30, 51, 74, 96, 117, 156, 215, 233] and 26 others
of which 36 are surviving nonsolos
reads assigned: 9472
start codons at 38, 177, 239, 246, 372
confident = true

REJECT CONTIGS

TIG 1[bases=507]
0-180 ==> 30-210 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
196-337 ==> 210-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
333-371 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
371-507 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDNLPTF at 313, score = 9 + 8
umis assigned: [690]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 32, 45, 184, 200, 323, 413
confident = false
not full
VJ delta = -2
not full

TIG 2[bases=540]
0-54 ==> 3156-3210 on rc of segment before IGHV7-56 exon 2 [len=3210] (mis=0)
54-395 ==> 0-341 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=16)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [104, 225, 413, 848, 1167]
of which 5 are surviving nonsolos
reads assigned: 1861
start codons at 10, 33, 54, 98, 318
confident = false
full length stopped transcript of length 540
frameshifted full length stopped transcript of length 540
did not find CDR3

TIG 3[bases=564]
4-85 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
38-388 ==> 0-350 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
391-428 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARYEGTF at 358, score = 3 + 8
umis assigned: [21, 24, 70, 71, 154, 188, 208, 473, 580, 613] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2896
start codons at 38, 71, 99, 107, 195, 357, 377, 470
confident = false
not full
frameshifted full length transcript of length 564
VJ delta = 29
not full

TIG 4[bases=562]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
388-426 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNFF at 356, score = 4 + 7
umis assigned: [181, 434, 483, 520, 1135, 1186, 1269]
of which 7 are surviving nonsolos
reads assigned: 1955
start codons at 36, 69, 105, 193, 355, 375, 468
confident = false
not full
frameshifted full length transcript of length 562
VJ delta = 30
not full
now this is a cell
paired!

GAGGACACGGCCTTGTATTACTGTGCAAAAGATATTTTGGGAGCTACTACTTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGAGGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1529 = TATCTCAGTCTTCTCG-1

using 284 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 281]
surviving nonsolo ucounts = 1[281]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1531 = TATCTCAGTGAGGGAG-1

using 328 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[4, 315]
surviving nonsolo ucounts = 1[315]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=477]
5-304 ==> 52-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
304-341 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
341-477 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPPTF at 280, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 15, 28, 164, 383
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1534 = TATCTCAGTGCATCTA-1

using 90 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 4, 5, 73]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1538 = TATCTCAGTGGTTTCA-1

using 371 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 361]
surviving nonsolo ucounts = 1[361]
ids = [4]

====================================================================================

UMI info for barcode TATCTCAGTGGTTTCA-1 contig 1 = CCTGGGTCAG...
umi CTCCTCGACA = 338 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=516]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
399-437 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
437-516 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQCGSSPRTF at 376, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 52, 260, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1540 = TATCTCAGTGTGAAAT-1

using 320 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 313]
surviving nonsolo ucounts = 1[313]
ids = [5]

====================================================================================

UMI info for barcode TATCTCAGTGTGAAAT-1 contig 1 = GGGGTCACAA...
umi TGTCAACCGG = 311 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=541]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-541 ==> 0-112 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CCSYAGSSTPYVF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 38, 177, 239, 246, 372, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1545 = TATCTCAGTTATCACG-1

using 285 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 4, 270]
surviving nonsolo ucounts = 1[270]
ids = [5]

====================================================================================

UMI info for barcode TATCTCAGTTATCACG-1 contig 1 = AGCTTCAGCT...
umi TGAAATGACC = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-537 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1547 = TATCTCAGTTCACGGC-1

using 236 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [0]

====================================================================================

UMI info for barcode TATCTCAGTTCACGGC-1 contig 1 = GATCAGGACT...
umi AGCCTTGTTT = 234 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=511]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
424-511 ==> 0-87 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CMQALQTPSF at 366, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1549 = TATCTCAGTTCCCTTG-1

using 149 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 144]
surviving nonsolo ucounts = 1[144]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=456]
0-355 ==> 8-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
353-392 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
392-456 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYGSPRTF at 331, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 47, 61, 314, 344, 434
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 91.1552 = TATCTCAGTTGGTAAA-1

using 364 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[362]
surviving nonsolo ucounts = 1[362]
ids = [1]

====================================================================================

UMI info for barcode TATCTCAGTTGGTAAA-1 contig 1 = ATCAGTCCCA...
umi GGTAACCATC = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!
sorting bam, mem = 0.13
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk091-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk091-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

83.284 seconds used processing barcodes, peak mem = 0.31
