[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.74 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk090-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk090-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk090.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.0 = TACCTTACACCGGAAA-1

using 308 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 302]
surviving nonsolo ucounts = 1[302]
ids = [2]

====================================================================================

UMI info for barcode TACCTTACACCGGAAA-1 contig 1 = GGAGGAATCA...
umi CATTACCTGT = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.8 = TACCTTACAGCCTTGG-1

using 23 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.14 = TACCTTACAGTATGCT-1

using 490 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 240, 244]
surviving nonsolo ucounts = 2[240, 244]
ids = [0, 5]

====================================================================================

UMI info for barcode TACCTTACAGTATGCT-1 contig 1 = ATCACATAAC...
umi AAACCTTGTG = 238 reads: +418 validated

UMI info for barcode TACCTTACAGTATGCT-1 contig 2 = GCTGGGGTCT...
umi TTGTGATCCC = 240 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=517]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
476-517 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARGGGLGYYYFDYW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 58, 209, 256, 355
confident = false

TIG 2[bases=545]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
432-545 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSSYTSSSTLVVF at 365, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.21 = TACCTTACATCAGTCA-1

using 540 reads

====================================================================================

graph has 258 edges initially, 24 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[4^2, 7, 239, 281]
surviving nonsolo ucounts = 2[239, 281]
ids = [5, 7]

====================================================================================

UMI info for barcode TACCTTACATCAGTCA-1 contig 1 = GGCTGGGGTC...
umi GACGCCCCCC = 237 reads: +391 validated

UMI info for barcode TACCTTACATCAGTCA-1 contig 2 = GCTCTGCTTC...
umi GCGTACCGGA = 276 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=541]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-392 ==> 0-350 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-541 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CCSYAGSYTPVVF at 366, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false

TIG 2[bases=550]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-550 ==> 0-108 on |305|IGLC1|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 42 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.29 = TACCTTACATTCACTT-1

using 3974 reads

====================================================================================

graph has 5786 edges initially, 32 edges after simplification

total ucounts = 1715
nonsolo ucounts = 881[2^348, 3^198, 4^132, 5^77, 6^51, 7^27, 8^22, 9^12, 10^6, 11^3, 12^2, 13^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.37 = TACCTTAGTACTCGCG-1

using 260 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[254]
surviving nonsolo ucounts = 1[254]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.39 = TACCTTAGTATGCTTG-1

using 212 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 200]
surviving nonsolo ucounts = 1[200]
ids = [0]

====================================================================================

UMI info for barcode TACCTTAGTATGCTTG-1 contig 1 = AGCTCTGGGA...
umi AATGGATCCT = 201 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=546]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=5)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=37)
462-510 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
510-546 ==> 0-36 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDNSPGYGVLSPHIDSW at 422, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 80, 225, 231, 315, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.41 = TACCTTAGTCAATACC-1

using 528 reads

====================================================================================

graph has 122 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[160, 362]
surviving nonsolo ucounts = 2[160, 362]
ids = [4, 5]

====================================================================================

UMI info for barcode TACCTTAGTCAATACC-1 contig 1 = AGTGACTCCT...
umi ATTCCAGGCG = 157 reads: +433 validated

UMI info for barcode TACCTTAGTCAATACC-1 contig 2 = GAGCTGCTCA...
umi ATTTCATCCG = 347 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=505]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-505 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false

TIG 2[bases=467]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-467 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPRTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.47 = TACCTTAGTCCTCTTG-1

using 267 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 11, 247]
surviving nonsolo ucounts = 1[247]
ids = [2]

====================================================================================

UMI info for barcode TACCTTAGTCCTCTTG-1 contig 1 = GAAGAGCTGC...
umi CGCCGCTTAT = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-482 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSPPWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.52 = TACCTTAGTGCAACTT-1

using 37 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^2, 3^2, 4^2, 5, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.54 = TACCTTAGTGCGATAG-1

using 274 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 7, 262]
surviving nonsolo ucounts = 1[262]
ids = [3]

====================================================================================

UMI info for barcode TACCTTAGTGCGATAG-1 contig 1 = GGCTTTCTGA...
umi TCGTTAGGTT = 260 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=542]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
415-463 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
463-542 ==> 0-79 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CARRDYYGSERVDFDYW at 381, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 15, 24, 36, 80, 96, 184, 303, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.60 = TACCTTAGTGTTTGGT-1

using 125 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 118]
surviving nonsolo ucounts = 1[118]
ids = [2]

====================================================================================

UMI info for barcode TACCTTAGTGTTTGGT-1 contig 1 = GAAGAGCTGC...
umi GTCTTATCAT = 103 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-495 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CHQYGISPWTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.63 = TACCTTAGTTACCGAT-1

using 371 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 4, 357]
surviving nonsolo ucounts = 1[357]
ids = [2]

====================================================================================

UMI info for barcode TACCTTAGTTACCGAT-1 contig 1 = TCAGTCCCAA...
umi ACGTGAACAC = 337 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-22 ==> 9-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
22-373 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-489 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CHQYESVPYTF at 349, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 22, 28, 84, 97, 236, 332, 359, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.71 = TACCTTAGTTGATTGC-1

using 662 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[655]
surviving nonsolo ucounts = 1[655]
ids = [5]

====================================================================================

UMI info for barcode TACCTTAGTTGATTGC-1 contig 1 = GGAGGAACTG...
umi GTGCTTTCTT = 654 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=531]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-531 ==> 0-112 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 113 reads
cdr3 = CQHYHNWPPITF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 646
start codons at 34, 103, 176, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.77 = TACCTTAGTTTGGGCC-1

using 483 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[480]
surviving nonsolo ucounts = 1[480]
ids = [0]

====================================================================================

UMI info for barcode TACCTTAGTTTGGGCC-1 contig 1 = ATCAGTCCCA...
umi GCCCTCAAGT = 488 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 475
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.78 = TACCTTATCAAAGACA-1

using 251 reads

====================================================================================

graph has 97 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 6, 236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode TACCTTATCAAAGACA-1 contig 1 = GGGGGAGGAA...
umi CGTTAGCCTT = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.84 = TACCTTATCAGAGGTG-1

using 270 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=511]
3-292 ==> 5398-5687 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=2)
287-335 ==> 5681-5729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=0)
336-375 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
375-511 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 0 are surviving nonsolos
reads assigned: 259
start codons at 42, 317, 417
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.85 = TACCTTATCAGCGACC-1

using 237 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 25
nonsolo ucounts = 12[2^2, 3^4, 4^2, 5, 8, 9, 178]
surviving nonsolo ucounts = 1[178]
ids = [12]

====================================================================================

UMI info for barcode TACCTTATCAGCGACC-1 contig 1 = CTGTGGGTAG...
umi GCGCGGCAGA = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-39 ==> 75-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
39-392 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-551 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CASWDDSLRGRVF at 360, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 39, 193, 343, 368, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.88 = TACCTTATCAGTCCCT-1

using 276 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 6, 259]
surviving nonsolo ucounts = 1[259]
ids = [3]

====================================================================================

UMI info for barcode TACCTTATCAGTCCCT-1 contig 1 = GTCTCCCTCA...
umi CCTTACATCA = 253 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=494]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
428-474 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
474-494 ==> 0-20 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARPYNSYWLGFDYW at 398, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 56, 230
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.104 = TACCTTATCGGCGCAT-1

using 506 reads

====================================================================================

graph has 170 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 173, 327]
surviving nonsolo ucounts = 2[173, 327]
ids = [4, 3]

====================================================================================

UMI info for barcode TACCTTATCGGCGCAT-1 contig 1 = AATCAGTCCC...
umi TAATATGCGT = 172 reads: +388 validated

UMI info for barcode TACCTTATCGGCGCAT-1 contig 2 = GAGGAACTGC...
umi GCATTCTACA = 331 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 24, 30, 99, 235, 454
confident = false

TIG 2[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQFNKWPPTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 33, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.106 = TACCTTATCGGCTACG-1

using 1590 reads

====================================================================================

graph has 2081 edges initially, 29 edges after simplification

total ucounts = 567
nonsolo ucounts = 275[2^102, 3^56, 4^36, 5^26, 6^12, 7^14, 8^9, 9^11, 10^2, 11^3, 14^2, 15, 215]
surviving nonsolo ucounts = 1[215]
ids = [406]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.113 = TACCTTATCTCACATT-1

using 187 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 3, 175]
surviving nonsolo ucounts = 1[175]
ids = [1]

====================================================================================

UMI info for barcode TACCTTATCTCACATT-1 contig 1 = GGGGTCTCCC...
umi CATTCTGTCC = 172 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=501]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=18)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
junction support: 1 umis using 10 reads
cdr3 = CARILSYRDSSGYFDNW at 401, score = 8 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 59, 233, 257, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.114 = TACCTTATCTCATTCA-1

using 523 reads

====================================================================================

graph has 272 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 9[2^2, 3^3, 4^2, 208, 286]
surviving nonsolo ucounts = 2[208, 286]
ids = [14, 10]

====================================================================================

UMI info for barcode TACCTTATCTCATTCA-1 contig 1 = GGAGTGCTTT...
umi GCCGCTCCTT = 286 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=560]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=23)
412-458 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
458-560 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGAARSGTVIIDYW at 379, score = 9 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 19, 40, 84, 170, 476, 537
confident = false

REJECT CONTIGS

TIG 1[bases=329]
38-266 ==> 125-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=35)
280-316 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CAKNSGIYDW at 255, score = 8 + 7
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 64, 69, 148, 177, 216, 277
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.118 = TACCTTATCTGACCTC-1

using 542 reads

====================================================================================

graph has 168 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 236, 295]
surviving nonsolo ucounts = 2[236, 295]
ids = [7, 5]

====================================================================================

UMI info for barcode TACCTTATCTGACCTC-1 contig 1 = GGGGGACTCC...
umi GTTTACCTCG = 212 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=532]
21-371 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
388-439 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
439-532 ==> 0-93 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASAAAPGDWFDPW at 366, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 21, 177, 244, 336, 493
confident = false

REJECT CONTIGS

TIG 1[bases=571]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 356, score = 4 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 36, 69, 105, 193, 355, 375, 477
confident = false
not full
frameshifted full length transcript of length 571
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.120 = TACCTTATCTGCCAGG-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.121 = TACCTTATCTGCGACG-1

using 51 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 49]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.129 = TACCTTATCTTCCTTC-1

using 38 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[38]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.132 = TACGGATAGAAGAAGC-1

using 249 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode TACGGATAGAAGAAGC-1 contig 1 = GCTACAACAG...
umi ATCTAACCTC = 233 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=485]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=24)
396-428 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
428-485 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYFSTPPTF at 367, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.135 = TACGGATAGACCGGAT-1

using 73 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 69]
surviving nonsolo ucounts = 1[69]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.144 = TACGGATAGGAACTGC-1

using 406 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 394]
surviving nonsolo ucounts = 1[394]
ids = [7]

====================================================================================

UMI info for barcode TACGGATAGGAACTGC-1 contig 1 = GTCAGTCCCA...
umi GTTCTCAGGA = 390 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDNLPPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 23, 29, 85, 98, 237, 360, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.146 = TACGGATAGGATCGCA-1

using 1372 reads

====================================================================================

graph has 1984 edges initially, 48 edges after simplification

total ucounts = 614
nonsolo ucounts = 276[2^118, 3^62, 4^35, 5^19, 6^14, 7^7, 8^3, 9^4, 10^2, 11^4, 13^2, 14^2, 15, 16, 17, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.152 = TACGGATAGTACGCCC-1

using 115 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 103]
surviving nonsolo ucounts = 1[103]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=469]
5-29 ==> 5788-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
24-90 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
43-328 ==> 0-285 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=8)
328-364 ==> 286-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1) [SHIFT!]
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
433-469 ==> 0-36 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CCSFTVNTRSYVF at 366, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 43, 200, 244, 254, 397
confident = false
not full
frameshifted full length transcript of length 469
VJ delta = 28
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.154 = TACGGATAGTCCTCCT-1

using 183 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 170]
surviving nonsolo ucounts = 1[170]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.155 = TACGGATAGTCGTACT-1

using 292 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 283]
surviving nonsolo ucounts = 1[283]
ids = [2]

====================================================================================

UMI info for barcode TACGGATAGTCGTACT-1 contig 1 = AGGAGTCAGA...
umi CTGCCGCCCT = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=1)
27-347 ==> 0-320 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=22)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-478 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQGSSFPYTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.157 = TACGGATAGTGCGTGA-1

using 849 reads

====================================================================================

graph has 266 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 412, 432]
surviving nonsolo ucounts = 2[412, 432]
ids = [4, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=635]
1-37 ==> 5964-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
21-53 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
37-53 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
37-61 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
37-62 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
80-159 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
80-108 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
250-357 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
253-356 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
333-358 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 405
start codons at 37, 188, 238, 363, 385
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.163 = TACGGATAGTTCGCAT-1

using 119 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[119]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.166 = TACGGATCAATAGCGG-1

using 261 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[17, 241]
surviving nonsolo ucounts = 2[17, 241]
ids = [4, 3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=402]
0-159 ==> 194-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=14)
208-242 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
242-402 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 148, score = 7 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 124
start codons at 4, 9, 26, 70, 103, 296
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.171 = TACGGATCACAACTGT-1

using 263 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 253]
surviving nonsolo ucounts = 1[253]
ids = [4]

====================================================================================

UMI info for barcode TACGGATCACAACTGT-1 contig 1 = GAGGAACTGC...
umi TCGGGACGGG = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-520 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNWPPMYTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 33, 238, 241, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.173 = TACGGATCACCAGTTA-1

using 36 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.176 = TACGGATCACCGAATT-1

using 47 reads

====================================================================================

graph has 55 edges initially, 3 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[5, 7, 9, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.181 = TACGGATCACGGCGTT-1

using 356 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 149, 196]
surviving nonsolo ucounts = 2[149, 196]
ids = [10, 4]

====================================================================================

UMI info for barcode TACGGATCACGGCGTT-1 contig 1 = AGCTTCAGCT...
umi ATTAGTAATA = 190 reads: +382 validated

UMI info for barcode TACGGATCACGGCGTT-1 contig 2 = TCAGTCTCAG...
umi TCAATTAATC = 1 reads: -338X +2 -2X +5 -8X +1 -1X +1 -4X +1 -1 +1 -1 +5 -1 +3 -3 +2 -2 +6 invalidated
umi TCCATAAATC = 1 reads: -248 +3 -1 +8 -1 +3 -1 +1 -2 +9 -1 +8 -1X +5 -1 +3 -1 +1 -1 +5 -84 invalidated
umi TCCATTCATC = 151 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=6)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
428-488 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAAWDDSLSVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 46, 200, 350, 375, 380
confident = false

TIG 2[bases=546]
0-22 ==> 25-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
22-373 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQSYRRPITF at 349, score = 8 + 8
umis assigned: [8, 9, 10]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 22, 28, 84, 97, 233, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.196 = TACGGATCATGACGGA-1

using 305 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 297]
surviving nonsolo ucounts = 1[297]
ids = [4]

====================================================================================

UMI info for barcode TACGGATCATGACGGA-1 contig 1 = GGGAGTCTCA...
umi TTCAGTGTTG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=471]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-471 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYSTPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.199 = TACGGATCATGTAAGA-1

using 319 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [2]

====================================================================================

UMI info for barcode TACGGATCATGTAAGA-1 contig 1 = GAGGAGTCAG...
umi GCTGACGCAT = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-497 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQSYSTPYTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.206 = TACGGATGTAAGAGGA-1

using 1351 reads

====================================================================================

graph has 456 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 5, 6, 52, 1280]
surviving nonsolo ucounts = 2[52, 1280]
ids = [8, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=373]
0-59 ==> 5-64 on |299|IGKV6-21|5'UTR| [len=64] (mis=0)
0-59 ==> 10413-10472 on rc of segment before IGKV1-22 exon 2 [len=10472] (mis=0)
59-237 ==> 0-178 on |300|IGKV6-21|L-REGION+V-REGION| [len=342] (mis=6)
237-373 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 1260
start codons at 21, 28, 59, 279
confident = false
did not find CDR3

TIG 2[bases=569]
3-84 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
37-363 ==> 0-326 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=7)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWHLLLHVRHTLAFTF at 357, score = 3 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 52
start codons at 37, 70, 98, 106, 194, 356, 376, 475
confident = false
not full
frameshifted full length stopped transcript of length 569
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.209 = TACGGATGTACCCAAT-1

using 244 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode TACGGATGTACCCAAT-1 contig 1 = AGCTCTGAGA...
umi AATTAGTCTA = 245 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=570]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-570 ==> 0-67 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.213 = TACGGATGTAGAAGGA-1

using 22519 reads

====================================================================================

graph has 9342 edges initially, 142 edges after simplification

total ucounts = 1386
nonsolo ucounts = 697[2^235, 3^144, 4^92, 5^47, 6^34, 7^24, 8^13, 9^11, 10^2, 11^3, 12^5, 13^2, 14, 15^2, 23, 31, 58, 84^2, 89, 100, 104, 116, 119, 127, 128, 137, 139, 141, 142, 143^2, 150, 154, 162, 174, 175, 182, 184^2, 194, 198, 199, 207, 211, 212, 214, 218^2, 220, 223, 229, 231, 234^2, 242, 243, 244, 246, 248, 251, 260, 262^2, 265, 266^2, 268, 270, 278, 279, 290, 295, 304, 306, 308, 310, 311, 312, 316, 318, 324^2, 327, 332, 333, 338, 339, 343, 356, 362, 365, 373, 395, 484, 837]
surviving nonsolo ucounts = 78[84, 89, 100, 104, 116, 119, 127, 128, 137, 139, 141, 142, 143^2, 150, 154, 162, 174, 175, 182, 184^2, 194, 198, 199, 207, 211, 212, 214, 218^2, 220, 223, 229, 231, 234^2, 242, 243, 244, 246, 248, 251, 260, 262^2, 265, 266^2, 268, 270, 278, 279, 290, 295, 304, 306, 308, 310, 311, 312, 316, 318, 324^2, 327, 332, 333, 338, 339, 343, 356, 362, 365, 373, 395, 484, 837]
ids = [178, 1217, 1357, 1096, 37, 1300, 902, 699, 503, 146, ...]

====================================================================================

UMI info for barcode TACGGATGTAGAAGGA-1 contig 1 = AGGAGTCAGA...
umi CCTTCACTTG = 199 reads: +388 validated
umi CTAAGCTCTT = 277 reads: +388 validated
umi CTGCACTCCA = 142 reads: +388 validated
umi CTTGCCAGTA = 394 reads: +388 validated
umi CTTTTCCTCG = 244 reads: +388 validated
umi GGCCTCGTAT = 487 reads: +388 validated
umi TACGTTCCCT = 280 reads: +388 validated
umi TCCGCACTTC = 310 reads: +388 validated
umi TCTTGCTTTC = 328 reads: +388 validated
umi TCTTGTGTCT = 210 reads: +388 validated
umi TGGAGATCAT = 314 reads: +388 validated
umi TGGTGTTACT = 338 reads: +388 validated
umi TTAGCTATGA = 330 reads: +388 validated
umi TTATTGTAGG = 246 reads: +388 validated
umi TTCCGTATCT = 276 reads: +388 validated
umi TTTCCGCTTG = 100 reads: +388 validated

UMI info for barcode TACGGATGTAGAAGGA-1 contig 2 = GGGAGCATCA...
umi AAACCGCATC = 324 reads: +418 validated
umi AACATCTCAT = 143 reads: +408 -10 non-validated
umi ACATCCTACT = 91 reads: +382 -2 +25 -1 +1 -1 +6 non-validated
umi ACCATTCTCA = 231 reads: +418 validated
umi AGCTATTATC = 323 reads: +418 validated
umi ATCCCTACTA = 272 reads: +418 validated
umi ATGGCTGACA = 232 reads: +418 validated
umi CAAAGACCCG = 186 reads: +418 validated
umi CAAATAGATC = 109 reads: +279 -5 +134 non-validated
umi CACATTGTTA = 84 reads: +418 validated
umi CAGAGACATT = 235 reads: +418 validated
umi CATACTACAC = 225 reads: -23X +395 invalidated
umi CCATCTCCAT = 266 reads: +418 validated
umi CCATTTGGGT = 260 reads: +418 validated
umi CCCGTTGTTG = 365 reads: +418 validated
umi CCCTTTCAGG = 196 reads: +382 -2X +8 -1 +2 -18 +5 invalidated
umi CCTGCGGCGG = 151 reads: +418 validated
umi CCTGGACCAC = 170 reads: +418 validated
umi CGCATTTATA = 215 reads: +379 -1 +38 non-validated
umi CGCGGGCCGT = 307 reads: +418 validated
umi CGGTCGTTAG = 213 reads: -192 +226 non-validated
umi CGGTTTTCGT = 255 reads: +336 -1XX +81 invalidated
umi CGTAAATCGT = 341 reads: +416 -2 non-validated
umi CGTCACGGTC = 151 reads: +418 validated
umi CGTTAGGCTC = 228 reads: +418 validated
umi CGTTCCCCTA = 135 reads: +409 -9 non-validated
umi CGTTTCTAGA = 118 reads: +418 validated
umi CTTTAATTGC = 240 reads: +418 validated
umi GACCAAGCCC = 301 reads: +418 validated
umi GATTTCACTA = 113 reads: +418 validated
umi GCTCAATTTG = 145 reads: +418 validated
umi GTCTCTCGTG = 277 reads: +418 validated
umi TAAATACTCC = 108 reads: +403 -1 +1 -1 +3 -1 +8 non-validated
umi TAAATTACGC = 296 reads: +418 validated
umi TACGCCTCAT = 217 reads: +418 validated
umi TAGTTCATGA = 316 reads: +418 validated
umi TATGGCTTTC = 261 reads: +418 validated
umi TATTTTCCTC = 194 reads: +418 validated
umi TCACATCAGG = 267 reads: +418 validated
umi TCATGCCAGA = 334 reads: +418 validated
umi TCCCATCACA = 291 reads: +418 validated
umi TCCTGGGGTA = 106 reads: +379 -39 non-validated
umi TCGACATTGT = 327 reads: +418 validated
umi TCGTGTCAGG = 188 reads: +403 -1 +9 -1 +4 non-validated
umi TCTGTCGTAT = 271 reads: +418 validated
umi TGCCTCCGAC = 228 reads: +418 validated
umi TGTTAATGCA = 162 reads: +418 validated
umi TTACGTAGTA = 285 reads: +418 validated
umi TTCCCAGCCT = 120 reads: +327 -41 +50 non-validated
umi TTTATTCATG = 314 reads: +374 -1XX +1 -4XX +3 -2X +3 -1 +29 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 673 reads
cdr3 = CQQANSFPPTF at 354, score = 9 + 8
umis assigned: [416, 513, 593, 633, 649, 805, 943, 1078, 1167, 1168] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4392
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=553]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
431-482 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 44 umis using 1008 reads
cdr3 = CARGSSGWSNWFDPW at 406, score = 8 + 7
umis assigned: [1, 10, 37, 41, 84, 113, 127, 145, 146, 178] and 40 others
of which 50 are surviving nonsolos
reads assigned: 10990
start codons at 64, 220, 262, 267, 299, 328, 361
confident = true

REJECT CONTIGS

TIG 1[bases=759]
510-548 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
548-759 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
umis assigned: [213, 311, 1263]
of which 3 are surviving nonsolos
reads assigned: 747
start codons at 10, 46, 112, 180, 223, 319, 329, 346, 512, 680
confident = false
did not find CDR3
note long unannotated region

TIG 2[bases=578]
5-57 ==> 5948-6000 on rc of segment after IGHV1OR15-1 exon 1 [len=6000] (mis=5)
34-75 ==> 10099-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
57-403 ==> 0-346 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
404-420 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=3)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
476-578 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CITVCPTVTTMVGYFDYW at 391, score = 3 + 7
umis assigned: [175, 437, 588, 1011, 1030, 1118, 1217, 1276, 1367]
of which 9 are surviving nonsolos
reads assigned: 2107
start codons at 57, 208, 255, 260, 264, 292, 321, 354, 421, 494, 555
confident = false
frameshifted full length stopped transcript of length 578
VJ delta = 16
not full
not full
now this is a cell
paired!

TCTGACGACACGGCCGTGTATTACTGTGCGAGAGGCAGCAGTGGCTGGTCGAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCCTACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.215 = TACGGATGTAGCTAAA-1

using 820 reads

====================================================================================

graph has 272 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 198, 202, 415]
surviving nonsolo ucounts = 3[198, 202, 415]
ids = [5, 0, 4]

====================================================================================

UMI info for barcode TACGGATGTAGCTAAA-1 contig 1 = ACTTTCTGAG...
umi ACCTTCGGGG = 146 reads: +415 validated

UMI info for barcode TACGGATGTAGCTAAA-1 contig 2 = GCTCTGCTTC...
umi CTGATAAGGG = 426 reads: +394 validated
umi GCCTATGCAG = 201 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=452]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=26)
415-450 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CASTTLGYCPSFFW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 14, 35, 79
confident = true

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 606
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.216 = TACGGATGTAGGAGTC-1

using 60 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 3, 4, 5^2, 8, 12, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.218 = TACGGATGTATCAGTC-1

using 143 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 1[143]
ids = [0]

====================================================================================

UMI info for barcode TACGGATGTATCAGTC-1 contig 1 = ATACTTTCTG...
umi ACCATTTTCG = 139 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=493]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=16)
414-464 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
464-493 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARRIYDLGSYYDAFGTW at 379, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 16, 37, 81, 395, 413, 416, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.229 = TACGGATGTCTCCATC-1

using 42406 reads

====================================================================================

graph has 13533 edges initially, 76 edges after simplification

total ucounts = 1618
nonsolo ucounts = 775[2^255, 3^157, 4^95, 5^59, 6^34, 7^18, 8^9, 9^10, 10^4, 11^3, 12^6, 14, 15, 17^2, 18, 33, 43^3, 50, 52, 60, 81, 83, 106, 115, 119, 121, 136, 150, 152, 171, 176, 178, 181, 184, 190, 193, 194, 197, 218, 219, 220, 221, 232, 240, 241, 253, 262, 266, 268, 270, 271, 272, 273, 274, 275, 282, 289, 297, 302, 303, 304, 311, 312, 313, 322, 329, 337, 340, 341, 342, 344, 345, 347, 349, 351, 352, 356, 359, 360^3, 363, 364, 365, 366, 367, 369, 370, 372^2, 377^2, 381^2, 384, 389, 390, 392, 408, 413^2, 414, 415, 416, 417, 419, 420, 430, 431, 432, 435, 439, 440^3, 447, 451, 454, 462, 473, 479, 481, 515, 524, 533, 546, 547, 569, 581, 584, 621, 645, 743]
surviving nonsolo ucounts = 115[33, 43^2, 50, 52, 60, 106, 119, 136, 150, 152, 171, 176, 178, 181, 184, 190, 193, 194, 197, 218, 219, 220, 221, 232, 240, 241, 253, 262, 266, 268, 270, 271, 272, 273, 274, 275, 282, 289, 297, 302, 303, 304, 311, 312, 313, 322, 329, 337, 340, 341, 342, 344, 345, 347, 349, 351, 352, 356, 359, 360^3, 363, 364, 365, 366, 367, 369, 370, 372^2, 377^2, 381^2, 384, 389, 390, 392, 408, 413^2, 414, 415, 416, 417, 419, 420, 430, 431, 432, 435, 439, 440^3, 447, 451, 454, 462, 473, 479, 481, 515, 524, 533, 546, 547, 569, 581, 584, 621, 645, 743]
ids = [746, 674, 1408, 1412, 1404, 331, 383, 1105, 514, 1504, ...]

====================================================================================

UMI info for barcode TACGGATGTCTCCATC-1 contig 1 = GGGGAGGAAC...
umi AACTAGACGA = 301 reads: +382 validated
umi AAGGGGGTAA = 351 reads: +382 validated
umi AATACCACAT = 445 reads: +382 validated
umi ACCAAAATAC = 367 reads: +382 validated
umi ACGTTACCGC = 434 reads: +382 validated
umi ACTGCGCCGT = 421 reads: +382 validated
umi ACTGTTTCCT = 273 reads: +382 validated
umi AGGCGCACTA = 315 reads: +382 validated
umi AGTTTTCTCC = 385 reads: +382 validated
umi ATCCATCCAG = 478 reads: +382 validated
umi ATCCGCTCAC = 458 reads: +382 validated
umi ATGCGTCGCT = 365 reads: +382 validated
umi ATTCCGCACA = 504 reads: +206 -3XX +173 invalidated
umi ATTGTAGCAG = 277 reads: +382 validated
umi CAAATAATAG = 416 reads: +382 validated
umi CACCGATCTT = 387 reads: +382 validated
umi CACTGTATTT = 275 reads: +382 validated
umi CACTGTTTGG = 521 reads: +382 validated
umi CATCGACCTA = 308 reads: +382 validated
umi CATTAGGGTC = 353 reads: +382 validated
umi CCAAATGCTA = 474 reads: +382 validated
umi CCAGGAGTCA = 274 reads: +382 validated
umi CCATCTTCCG = 270 reads: +382 validated
umi CCCTCATTAC = 364 reads: +382 validated
umi CCTAACACGA = 381 reads: +382 validated
umi CCTGCATAGG = 416 reads: +382 validated
umi CCTTTGGGGG = 294 reads: +382 validated
umi CGAGCAATTG = 457 reads: +382 validated
umi CGGATAAACA = 366 reads: +382 validated
umi CGGCCGGTTT = 303 reads: +382 validated
umi CGGTTATGGG = 351 reads: +382 validated
umi CGTAATTATC = 443 reads: +382 validated
umi CGTATAGCGA = 416 reads: +382 validated
umi CGTCACAAAG = 337 reads: +382 validated
umi CTATATCGTT = 364 reads: +382 validated
umi CTATTCTCAA = 372 reads: +382 validated
umi CTCCAATACA = 396 reads: +382 validated
umi CTGTAGTTGT = 198 reads: +382 validated
umi CTTAATCTTT = 361 reads: +382 validated
umi CTTGTTTGCA = 366 reads: +382 validated
umi CTTTCGCCAC = 214 reads: +382 validated
umi GAAACCCGAA = 441 reads: +382 validated
umi GAGGCCGCAT = 259 reads: +382 validated
umi GATACTGCAA = 384 reads: +382 validated
umi GATCATTCAT = 433 reads: +382 validated
umi GCCCTTCCGC = 357 reads: +382 validated
umi GCTCATGCCT = 281 reads: +382 validated
umi GGGTCAGATC = 316 reads: +382 validated
umi GGTCCGTTTT = 191 reads: +382 validated
umi GGTCCTTTTC = 315 reads: +382 validated
umi GTTCCGCGTA = 323 reads: +382 validated
umi GTTTAGCTGG = 424 reads: +382 validated
umi TAATCATCAC = 393 reads: +382 validated
umi TACCTCGACA = 428 reads: +382 validated
umi TACGGCCCGT = 359 reads: +382 validated
umi TAGCTGGGTC = 423 reads: +382 validated
umi TATATCCGCG = 420 reads: +382 validated
umi TATGCTTATG = 358 reads: +382 validated
umi TATGTGCGTT = 369 reads: +382 validated
umi TCAAATCGCT = 344 reads: +382 validated
umi TCACTCCTAG = 334 reads: +382 validated
umi TCATGGGTTC = 378 reads: +382 validated
umi TCCAGTCCCG = 363 reads: +382 validated
umi TCGGCTGTCT = 344 reads: +382 validated
umi TCGTTTACAC = 194 reads: +382 validated
umi TCTTACTATC = 447 reads: +382 validated
umi TCTTATGTCA = 171 reads: +382 validated
umi TCTTCCATAA = 196 reads: +382 validated
umi TGGACTACGG = 449 reads: +382 validated
umi TGGGTATTTA = 342 reads: +382 validated
umi TGGTTGGCAG = 420 reads: +382 validated
umi TTATTATCTC = 180 reads: +382 validated
umi TTCAATCGTA = 749 reads: +382 validated
umi TTCTATCTTC = 404 reads: +382 validated
umi TTGTACGGTT = 346 reads: +382 validated

UMI info for barcode TACGGATGTCTCCATC-1 contig 2 = AGTGACTCCT...
umi ACCTTCGTCA = 346 reads: +421 validated
umi ATCTAAGGGA = 61 reads: +421 validated
umi ATTCACCTCA = 295 reads: +421 validated
umi ATTGCATCCG = 105 reads: +421 validated
umi CCAATTCGGC = 134 reads: +421 validated
umi CCATGGGCCT = 243 reads: +421 validated
umi CCTCGGCCAG = 266 reads: +421 validated
umi CGGATCACAA = 41 reads: +421 validated
umi CGTATTCAGG = 272 reads: +421 validated
umi CTACCACTAT = 33 reads: +43 -2 +322 -19 +7 -1 +1 -1 +25 non-validated
umi CTGAGATTTG = 224 reads: +421 validated
umi CTGGCGGCCT = 274 reads: +421 validated
umi GATCATCAGC = 216 reads: +421 validated
umi GTTGATTGCT = 118 reads: +421 validated
umi TATTCCATTG = 188 reads: +421 validated
umi TGCATTCGAA = 151 reads: +421 validated
umi TGCGGCTACG = 223 reads: +421 validated
umi TGCTCATTAT = 24 reads: -399 +3 -2X +15 -1XX +1 invalidated
umi TGCTGCGTTA = 42 reads: +421 validated
umi TGCTTCGGCC = 49 reads: +33 -2 +386 non-validated
umi TGTATCTATT = 176 reads: +421 validated
umi TTATATAGCT = 252 reads: +421 validated
umi TTCAGGTTTT = 155 reads: +421 validated
umi TTCGCTTCTA = 227 reads: +421 validated
umi TTTCCCGCAA = 243 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 75 umis using 4230 reads
cdr3 = CQQYNNWPPTF at 357, score = 9 + 8
umis assigned: [44, 57, 68, 126, 164, 180, 184, 241, 276, 309] and 65 others
of which 75 are surviving nonsolos
reads assigned: 26698
start codons at 36, 241, 460
confident = true

TIG 2[bases=623]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-369 ==> 0-349 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=9)
393-441 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
441-623 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 23 umis using 633 reads
cdr3 = CVQFSGYARYYFDYW at 365, score = 7 + 7
umis assigned: [152, 331, 371, 383, 514, 531, 599, 674, 711, 746] and 15 others
of which 25 are surviving nonsolos
reads assigned: 4282
start codons at 20, 64, 237, 243, 246, 326, 335
confident = true

REJECT CONTIGS

TIG 1[bases=442]
0-80 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-239 ==> 0-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1)
244-266 ==> 325-347 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
268-306 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
306-442 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [34, 86, 199, 255, 289, 313, 404, 436, 474, 819] and 4 others
of which 14 are surviving nonsolos
reads assigned: 7046
start codons at 30, 63, 99, 150, 187, 258, 348
confident = false
did not find CDR3
now this is a cell
paired!

CCTGTGGACACAGCCACATATTACTGTGTACAGTTCAGTGGCTACGCCCGATACTATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCTG <==> ATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.231 = TACGGATGTGACTACT-1

using 164 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================

UMI info for barcode TACGGATGTGACTACT-1 contig 1 = GAGAAGAGCT...
umi CTAGTTCCAC = 137 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=465]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
420-465 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYGSSPWTF at 359, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 35, 243, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.232 = TACGGATGTGATGTCT-1

using 728 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 236, 488]
surviving nonsolo ucounts = 2[236, 488]
ids = [4, 1]

====================================================================================

UMI info for barcode TACGGATGTGATGTCT-1 contig 1 = AGCTTCAGCT...
umi TGCGAGAGGG = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=593]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-593 ==> 0-158 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.233 = TACGGATGTGCAGACA-1

using 20 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.234 = TACGGATGTGCAGGTA-1

using 271 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 262]
surviving nonsolo ucounts = 1[262]
ids = [1]

====================================================================================

UMI info for barcode TACGGATGTGCAGGTA-1 contig 1 = TGGGCCTAAG...
umi CACGGTTGGC = 248 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=574]
0-36 ==> 215-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
36-380 ==> 0-344 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=1)
380-418 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
418-574 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQVWDSSSDQGVF at 351, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 36, 97, 235, 238, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.249 = TACGGATTCATCGATG-1

using 1356 reads

====================================================================================

graph has 1744 edges initially, 8 edges after simplification

total ucounts = 504
nonsolo ucounts = 237[2^113, 3^47, 4^26, 5^17, 6^12, 7^10, 8^2, 9^4, 10, 11^3, 17, 279]
surviving nonsolo ucounts = 1[279]
ids = [255]

====================================================================================

UMI info for barcode TACGGATTCATCGATG-1 contig 1 = GGGAGGAATC...
umi CTTGGTTTAG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-514 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [255]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.251 = TACGGATTCATTATCC-1

using 267 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 254]
surviving nonsolo ucounts = 1[254]
ids = [9]

====================================================================================

UMI info for barcode TACGGATTCATTATCC-1 contig 1 = GAAGAGCTGC...
umi TTCTCCCTGG = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYGSSPPFTF at 357, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.268 = TACGGATTCTCTGAGA-1

using 134 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^4, 3, 112]
surviving nonsolo ucounts = 1[112]
ids = [4]

====================================================================================

UMI info for barcode TACGGATTCTCTGAGA-1 contig 1 = AGGAGTCAGA...
umi CAACTGCATC = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.269 = TACGGATTCTGGTGTA-1

using 224 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 10[2, 3^2, 5^2, 8, 9^2, 10, 161]
surviving nonsolo ucounts = 1[161]
ids = [4]

====================================================================================

UMI info for barcode TACGGATTCTGGTGTA-1 contig 1 = ATCAGTCCCA...
umi CCAACGACTA = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.272 = TACGGATTCTTCATGT-1

using 80000 reads

====================================================================================

graph has 14123 edges initially, 62 edges after simplification

total ucounts = 524
nonsolo ucounts = 418[2^10, 3^8, 4^7, 5^4, 6^5, 7^2, 9, 10^2, 11, 12, 15, 17, 20, 21, 23, 25, 27, 29, 30, 31, 36, 38, 39, 42, 43, 45, 48, 49, 50, 51, 54, 60, 61, 66, 67, 68^2, 70, 76, 77, 78, 79, 82, 87, 89^2, 91, 95, 96, 97^2, 99, 100, 101, 102, 103^2, 105, 107, 108, 109, 111, 113, 114, 116^3, 119^2, 124^2, 125^2, 128^2, 129, 130, 135, 136, 137, 138^2, 141^2, 143^2, 144^2, 146, 148^2, 149^2, 150, 151^2, 154^3, 156, 158^2, 159^4, 160^2, 161, 162^5, 163, 164^2, 165^4, 166^3, 167, 168, 169^2, 170^6, 172, 173, 174^3, 175^2, 176^2, 178, 179^4, 180, 182^3, 184, 185, 186^2, 187^2, 188^2, 189, 190, 191^4, 192^3, 193^2, 194^3, 195^2, 196^2, 197^2, 198^3, 199^2, 200, 201^2, 203^5, 204^3, 205, 206^2, 207^2, 208, 209^2, 210^2, 211^2, 212^3, 213^3, 214^4, 215^2, 216^2, 217^3, 218, 219^2, 220^4, 222^2, 223, 225^3, 227^3, 228^2, 229^2, 230^3, 231, 232^3, 234^4, 235^3, 236^3, 237^2, 238^2, 239, 243, 244^2, 245^2, 246^2, 248, 249, 250, 251, 252, 253, 254, 255^2, 257, 258, 259^2, 260^2, 261, 263, 264, 266^3, 267^2, 271^2, 272, 273, 276^2, 280^2, 282, 284, 285^2, 286, 287, 289^2, 293^2, 294, 295, 296, 297, 298, 299^2, 300, 301, 302, 303, 305, 307^2, 308^2, 310, 312, 314^2, 315^2, 317^3, 319^3, 321, 323, 324, 325, 327, 328^2, 329, 331, 332, 334^2, 336^2, 337, 338, 340^2, 343^2, 346^2, 349^2, 350, 360, 361, 363, 366, 368, 371, 382, 387, 391, 392, 393, 398, 407, 427, 434, 436, 621, 634, 724]
surviving nonsolo ucounts = 352[54, 60, 61, 66, 67, 68, 70, 76, 77, 78, 82, 87, 89^2, 91, 95, 96, 97^2, 99, 100, 101, 102, 103^2, 105, 107, 108, 109, 111, 113, 114, 116^2, 119^2, 124^2, 125^2, 128, 130, 135, 136, 137, 138^2, 141^2, 143^2, 144^2, 146, 148^2, 149^2, 150, 151^2, 154^3, 156, 158^2, 159^4, 160^2, 161, 162^5, 163, 164^2, 165^4, 166^3, 167, 168, 169^2, 170^6, 172, 173, 174^3, 175^2, 176^2, 178, 179^4, 180, 182^3, 184, 185, 186^2, 187^2, 188^2, 189, 190, 191^4, 192^3, 193^2, 194^3, 195^2, 196^2, 197^2, 198^3, 199^2, 200, 201^2, 203^5, 204^3, 205, 206^2, 207^2, 208, 209^2, 210^2, 211^2, 212^3, 213^3, 214^4, 215^2, 216^2, 217^3, 218, 219^2, 220^4, 222^2, 223, 225^3, 227^3, 228^2, 229^2, 230^3, 231, 232^3, 234^4, 235^3, 236^3, 237^2, 238^2, 239, 243, 244^2, 245^2, 246^2, 248, 249, 250, 251, 252, 253, 254, 255^2, 257, 258, 259^2, 260^2, 261, 263, 264, 266^3, 267^2, 271^2, 272, 273, 276^2, 280^2, 282, 284, 285^2, 286, 287, 289^2, 293^2, 294, 295, 296, 297, 298, 299^2, 300, 301, 302, 303, 305, 307^2, 308^2, 310, 312, 314^2, 315^2, 317^3, 319^3, 321, 323, 324, 325, 327, 328^2, 329, 331, 332, 334^2, 336^2, 337, 338, 340^2, 343^2, 346^2, 349^2, 350, 360, 361, 363, 366, 368, 371, 382, 387, 391, 392, 393, 398, 407, 427, 434, 436, 621, 634, 724]
ids = [497, 319, 177, 326, 134, 522, 518, 156, 154, 204, ...]

====================================================================================

UMI info for barcode TACGGATTCTTCATGT-1 contig 1 = GAAGAGCTGC...
umi AAATCACGTA = 339 reads: +388 validated
umi AAATCGTCGA = 231 reads: +388 validated
umi AATATATTCC = 253 reads: +388 validated
umi AATCAACGCT = 246 reads: +388 validated
umi AATCATGTCG = 279 reads: +388 validated
umi AATTCTCGGC = 187 reads: +208 -4XX +3 -1XX +4 -1XX +2 -1XX +2 -1XX +1 -1XX +1 -2XX +1 -2XX +2 -5XX +1 -145X invalidated
umi ACAAGTATGG = 351 reads: +108 -1XX +279 invalidated
umi ACACATTTCG = 274 reads: +388 validated
umi ACACCAAGCC = 235 reads: +388 validated
umi ACCCAATGTC = 172 reads: +388 validated
umi ACCGCGTTTC = 261 reads: +388 validated
umi ACCGTTTACA = 202 reads: +388 validated
umi ACGGCCCTTG = 236 reads: +388 validated
umi AGCTTCCATG = 290 reads: +388 validated
umi AGTAAAAGCC = 266 reads: +388 validated
umi ATACAGCGTA = 224 reads: +388 validated
umi ATACCAGGGC = 259 reads: +388 validated
umi ATATTGGCAT = 364 reads: +388 validated
umi ATCCGACAAC = 210 reads: +388 validated
umi ATCTGATTTG = 327 reads: +388 validated
umi ATGCTTAGTG = 258 reads: +388 validated
umi ATTTCACGGG = 227 reads: +388 validated
umi CAAATCCATG = 245 reads: +388 validated
umi CACACTCGTG = 236 reads: +388 validated
umi CACCAGCCGT = 267 reads: +388 validated
umi CAGTAGTGCT = 324 reads: +388 validated
umi CAGTCCGATT = 381 reads: +359 -1XX +1 -1X +2 -1 +23 invalidated
umi CATACTACGG = 341 reads: +388 validated
umi CCACACCCTC = 324 reads: +388 validated
umi CCACTTTTGG = 184 reads: +388 validated
umi CCAGTTTCGA = 262 reads: +388 validated
umi CCATTTTTAG = 339 reads: +388 validated
umi CCCACATGCG = 351 reads: +388 validated
umi CCCAGGTCCC = 728 reads: -194X +194 invalidated
umi CCCTCGATCA = 438 reads: -140X +248 invalidated
umi CCCTTCCCAA = 288 reads: +388 validated
umi CCGTCCATGT = 324 reads: +388 validated
umi CCTATCCGCG = 208 reads: +59 -1XX +328 invalidated
umi CGCCTCTGCG = 200 reads: +388 validated
umi CGGCGTTGGG = 229 reads: +388 validated
umi CGGTGGTCAT = 333 reads: +388 validated
umi CGTATACCAT = 289 reads: +388 validated
umi CGTCCGGAGC = 322 reads: +388 validated
umi CGTGAATAAT = 314 reads: +388 validated
umi CTACTATACC = 172 reads: +388 validated
umi CTAGAACCTC = 305 reads: +388 validated
umi CTATTAATGT = 331 reads: +196 -1XX +191 invalidated
umi CTCGGGGGGC = 296 reads: +388 validated
umi CTCTATTCAT = 628 reads: +388 validated
umi CTCTGTGGCT = 296 reads: +388 validated
umi CTGGTGGGGT = 147 reads: +388 validated
umi CTTGATAGAT = 184 reads: +388 validated
umi GAACTTTCAA = 319 reads: +388 validated
umi GAATCCCGTA = 427 reads: +388 validated
umi GACCAGACCT = 281 reads: +388 validated
umi GACGCTGCCT = 198 reads: +388 validated
umi GACGTATTTC = 342 reads: +388 validated
umi GACTTACTAA = 389 reads: +388 validated
umi GATATGTGGG = 294 reads: +388 validated
umi GCAATTCTTC = 318 reads: +388 validated
umi GCACTTATCA = 310 reads: +388 validated
umi GCATACTGTC = 392 reads: +388 validated
umi GCCCTGCCTT = 298 reads: +388 validated
umi GCCGCGTTTT = 305 reads: +388 validated
umi GCCTAAATCT = 297 reads: +388 validated
umi GCGACGTCCC = 329 reads: +388 validated
umi GCGACTATGC = 314 reads: +388 validated
umi GCGTACGCTC = 337 reads: +388 validated
umi GCTAAGCCAG = 305 reads: +388 validated
umi GCTCCCGCCA = 167 reads: +388 validated
umi GGATTACCCG = 308 reads: +388 validated
umi GGCGTGGTTC = 331 reads: +388 validated
umi GGCTCCTTAG = 278 reads: +388 validated
umi GGGCTTTACC = 302 reads: +388 validated
umi GTACAGTGTT = 235 reads: +388 validated
umi GTCACCGATC = 250 reads: +388 validated
umi GTCAGAATGC = 408 reads: +388 validated
umi GTCCTTCTCT = 347 reads: +388 validated
umi GTCTGGCTTG = 334 reads: +388 validated
umi GTGCTTTCTC = 255 reads: +388 validated
umi GTGTCCAGTT = 350 reads: +388 validated
umi GTTTTGTTGG = 371 reads: +378 -1XX +9 invalidated
umi TAAGTGAGCC = 296 reads: +388 validated
umi TATACCTTGA = 382 reads: +388 validated
umi TATACTACCG = 306 reads: +388 validated
umi TATTTTAGCT = 360 reads: +388 validated
umi TCACTTCCAC = 314 reads: +388 validated
umi TCAGGTACCG = 358 reads: +388 validated
umi TCAGGTTCCC = 271 reads: +388 validated
umi TCATGTTTTG = 302 reads: +388 validated
umi TCCCTATACG = 310 reads: +388 validated
umi TCCTAATGAC = 304 reads: +388 validated
umi TCGAATTAAG = 360 reads: +388 validated
umi TCGACATCGG = 207 reads: +388 validated
umi TCGATGCCGC = 391 reads: +388 validated
umi TCGCAGACTC = 202 reads: +388 validated
umi TCGTTGTTGA = 279 reads: +388 validated
umi TCTAGGGGGA = 524 reads: -351 +1 -2X +2 -1XX +2 -1XX +5 -1XX +7 -1XX +1 -1XX +4 -1XX +5 -1XX +1 invalidated
umi TCTATGCGCA = 316 reads: +388 validated
umi TCTCACTATC = 325 reads: +388 validated
umi TCTCCGTTAA = 327 reads: +388 validated
umi TCTCGATACG = 391 reads: +388 validated
umi TCTGTATCTT = 333 reads: +388 validated
umi TCTTGACCAT = 346 reads: +388 validated
umi TGCATTGGTT = 256 reads: +388 validated
umi TGCTACACGC = 281 reads: +388 validated
umi TGCTGCCGTG = 165 reads: +388 validated
umi TGGTTACCAC = 229 reads: +388 validated
umi TGTATTCTAC = 364 reads: +388 validated
umi TGTCATGTTC = 219 reads: +388 validated
umi TGTTGTCATT = 287 reads: +388 validated
umi TGTTTTATCA = 398 reads: +388 validated
umi TTATTACACT = 295 reads: +388 validated
umi TTCACATACT = 340 reads: +388 validated
umi TTCGCCGCTT = 274 reads: -356X +3 -1XX +1 -1XX +1 -2XX +3 -4X +16 invalidated
umi TTGTACGCAA = 253 reads: +388 validated
umi TTTGCCATAT = 341 reads: +388 validated

UMI info for barcode TACGGATTCTTCATGT-1 contig 2 = AGTGCTTTCT...
umi AAAAGCCCCC = 216 reads: +436 validated
umi AAAGTACGGA = 216 reads: +436 validated
umi AAAGTAGTCG = 189 reads: +436 validated
umi AAATTGACGG = 195 reads: +436 validated
umi AACAACCGAC = 272 reads: +436 validated
umi AACGCCTCTC = 171 reads: +177 -1XX +1 -3XX +1 -1X +252 invalidated
umi AACGCTTATA = 142 reads: +436 validated
umi AAGATAAGTG = 246 reads: +436 validated
umi AAGCCAACTG = 436 reads: +436 validated
umi AATCCGGCAG = 145 reads: +436 validated
umi ACAAAAAATG = 104 reads: +436 validated
umi ACAAAGTTCT = 189 reads: +339 -1 +96 non-validated
umi ACAACGTAGT = 213 reads: +436 validated
umi ACACCCTATA = 96 reads: +436 validated
umi ACACGGCCCT = 261 reads: +436 validated
umi ACACTGCTTA = 202 reads: +436 validated
umi ACAGATTCTC = 208 reads: +436 validated
umi ACAGCGTCCA = 162 reads: +1 -3 +432 non-validated
umi ACATACGGAA = 182 reads: +436 validated
umi ACATCGATGG = 178 reads: +436 validated
umi ACCAATTGCG = 103 reads: +436 validated
umi ACCTAGTTGG = 97 reads: +436 validated
umi ACGACTGATC = 231 reads: +436 validated
umi ACGTGTCTTG = 249 reads: +436 validated
umi AGCCAAGGAA = 143 reads: +436 validated
umi AGCTAACACA = 209 reads: +436 validated
umi AGCTACGGTG = 169 reads: +436 validated
umi AGCTATTCTC = 254 reads: +436 validated
umi AGGACCCGGT = 120 reads: +436 validated
umi AGGTATCTGG = 190 reads: +436 validated
umi AGTATTTTCG = 168 reads: +436 validated
umi AGTGTCCATC = 161 reads: +436 validated
umi ATAAACCGCT = 223 reads: +436 validated
umi ATACATCACT = 182 reads: +436 validated
umi ATATAACGGG = 102 reads: +436 validated
umi ATCACAAGTA = 200 reads: +436 validated
umi ATCATCTCCA = 229 reads: +436 validated
umi ATCATTTAGT = 168 reads: +436 validated
umi ATCCATCTCT = 181 reads: +436 validated
umi ATCTAATAGC = 173 reads: +436 validated
umi ATGGTCCTAG = 210 reads: +436 validated
umi ATTACCCGTG = 164 reads: +436 validated
umi ATTATGTTGG = 152 reads: +436 validated
umi ATTCAGCTCC = 224 reads: +436 validated
umi ATTCGCCACC = 122 reads: -6 +430 non-validated
umi ATTTATTACC = 93 reads: +436 validated
umi ATTTGCCAAA = 153 reads: +436 validated
umi ATTTTGTCGC = 165 reads: +436 validated
umi CAAATTATAT = 205 reads: +436 validated
umi CAAGGCTCCC = 221 reads: +436 validated
umi CAATAGCGCC = 183 reads: +436 validated
umi CAATGCATCG = 137 reads: +436 validated
umi CACATCTTGC = 229 reads: +436 validated
umi CACATTCTTC = 248 reads: +424 -2XX +1 -1XX +2 -1XX +2 -3XX invalidated
umi CACCAGGTGT = 142 reads: +436 validated
umi CACCATCCTT = 164 reads: +436 validated
umi CACCGTCTCC = 115 reads: -436 non-validated
umi CACGGTAGGC = 253 reads: +436 validated
umi CACGTATGAG = 154 reads: +436 validated
umi CAGCCGACCG = 196 reads: +436 validated
umi CAGGCGGCTC = 159 reads: +436 validated
umi CAGGTGAACG = 142 reads: +436 validated
umi CAGTAAGTGC = 222 reads: +436 validated
umi CAGTATTATC = 66 reads: +436 validated
umi CAGTCACAGA = 242 reads: +436 validated
umi CAGTGCGTCA = 219 reads: +436 validated
umi CATAAATCCT = 192 reads: +436 validated
umi CATACTCCGG = 145 reads: +436 validated
umi CATCCCTCAG = 147 reads: +436 validated
umi CATCGTACCG = 224 reads: +436 validated
umi CATGAAACTG = 123 reads: +436 validated
umi CATGCTCCAT = 111 reads: +436 validated
umi CATTCGGCCT = 211 reads: +436 validated
umi CATTTGGAGG = 267 reads: +436 validated
umi CCAATCCTCA = 267 reads: +436 validated
umi CCACCGCACT = 216 reads: +436 validated
umi CCACGCCATA = 79 reads: +3 -1 +432 non-validated
umi CCAGCTTGCA = 78 reads: +436 validated
umi CCATCGTGGC = 107 reads: +436 validated
umi CCATGCCACC = 210 reads: +436 validated
umi CCCACGCTCC = 169 reads: +436 validated
umi CCCCAACCCC = 218 reads: +436 validated
umi CCCCCTAGGA = 240 reads: +436 validated
umi CCCGACTCGG = 127 reads: +436 validated
umi CCCTAATGGC = 187 reads: +436 validated
umi CCGCTTGCGT = 61 reads: +436 validated
umi CCGGCCATCG = 131 reads: +87 -1XX +348 invalidated
umi CCGTCAAATA = 164 reads: +436 validated
umi CCTCCCAAGT = 171 reads: +436 validated
umi CCTGCACAGG = 291 reads: +436 validated
umi CCTGCTAGCC = 150 reads: +436 validated
umi CCTTACAGTT = 108 reads: +406 -1XX +29 invalidated
umi CGAACCGGCG = 227 reads: +436 validated
umi CGAATATACT = 214 reads: +436 validated
umi CGACCCATGC = 153 reads: +436 validated
umi CGAGTTAATC = 167 reads: +436 validated
umi CGATATCTTT = 194 reads: +436 validated
umi CGATCTCATG = 89 reads: +436 validated
umi CGCAGTTGTC = 274 reads: +436 validated
umi CGCTACACCG = 77 reads: +436 validated
umi CGCTGATCTC = 162 reads: +436 validated
umi CGGATAACAC = 317 reads: +436 validated
umi CGGCTCAGCC = 230 reads: +436 validated
umi CGTAGTACCC = 216 reads: +436 validated
umi CGTCAGGGTC = 202 reads: +436 validated
umi CGTGGCATCA = 172 reads: +436 validated
umi CGTTCCGGTC = 205 reads: +436 validated
umi CGTTTTTCGT = 249 reads: +436 validated
umi CTACATTACT = 234 reads: +436 validated
umi CTAGATGTAC = 233 reads: +436 validated
umi CTAGCTTTAC = 175 reads: +436 validated
umi CTATAACTGT = 211 reads: +436 validated
umi CTATGTTCGT = 207 reads: +436 validated
umi CTCAAGCAGG = 106 reads: +425 -7 +4 non-validated
umi CTCAGTTCTT = 187 reads: +436 validated
umi CTCATTCATG = 123 reads: +436 validated
umi CTCCACAACT = 259 reads: +436 validated
umi CTCGCGCTTA = 220 reads: +436 validated
umi CTCGGAGGCA = 180 reads: +436 validated
umi CTCGGGCCTC = 166 reads: +436 validated
umi CTCGTCACCA = 116 reads: +66 -1XX +369 invalidated
umi CTGCTCGTAC = 194 reads: +436 validated
umi CTGGGCGAAC = 231 reads: +436 validated
umi CTGTTTACCT = 162 reads: +436 validated
umi CTTACAGGTC = 233 reads: +436 validated
umi CTTTATCATT = 266 reads: +436 validated
umi GAACCATGTG = 167 reads: +174 -1XX +261 invalidated
umi GAACGCACTC = 169 reads: +436 validated
umi GAATTCGCGG = 156 reads: +436 validated
umi GACAATTATT = 214 reads: +436 validated
umi GACAGGTTGT = 209 reads: +436 validated
umi GACTCGAGCA = 165 reads: +436 validated
umi GAGGTCTGCG = 228 reads: +436 validated
umi GATACTGCTT = 263 reads: +436 validated
umi GATCACATCG = 200 reads: +436 validated
umi GATTTTCGGC = 145 reads: +436 validated
umi GATTTTGCCT = 191 reads: +436 validated
umi GCAATACTTG = 228 reads: +436 validated
umi GCATTTCATA = 245 reads: +436 validated
umi GCCCACCTGT = 188 reads: +436 validated
umi GCCTCAGTTG = 211 reads: +436 validated
umi GCCTGTCTTT = 63 reads: +436 validated
umi GCGATCTCCC = 192 reads: +436 validated
umi GCGCATAGAC = 170 reads: +436 validated
umi GCGCGCGAGG = 219 reads: +436 validated
umi GCGCTGCCGT = 68 reads: +426 -6 +4 non-validated
umi GCGTCATAGG = 212 reads: +436 validated
umi GCGTGGTGCG = 203 reads: +436 validated
umi GCTGTCCTTC = 207 reads: +436 validated
umi GCTTTTCACA = 219 reads: +436 validated
umi GGACCGGCGT = 190 reads: +262 -1XX +173 invalidated
umi GGACTAACTG = 195 reads: +436 validated
umi GGACTCTTGA = 200 reads: +436 validated
umi GGATCTGACG = 96 reads: +436 validated
umi GGCATCGTAG = 213 reads: +436 validated
umi GGGCTTTTTT = 194 reads: +436 validated
umi GGTATAAGCT = 215 reads: +436 validated
umi GGTCAGTTCT = 175 reads: +436 validated
umi GGTGATCCGT = 320 reads: +436 validated
umi GTAATAGCGC = 104 reads: +436 validated
umi GTACATCCTA = 200 reads: +436 validated
umi GTACCGATAC = 211 reads: +436 validated
umi GTACTCAGAG = 192 reads: +436 validated
umi GTATTTTCGC = 166 reads: +436 validated
umi GTCAGAGAAT = 125 reads: +436 validated
umi GTCCTATGGA = 231 reads: +436 validated
umi GTCCTTTGCC = 231 reads: +436 validated
umi GTCGCATCGA = 325 reads: +307 -7XX +2 -4XX +3 -1XX +1 -62XX +1 -5XX +1 -1XX +1 -4XX +2 -4XX +1 -1XX +1 -3XX +24 invalidated
umi GTCTGGCCGG = 174 reads: +436 validated
umi GTGATCCAGA = 212 reads: +436 validated
umi GTGCAGTTCT = 182 reads: +436 validated
umi GTGTCACTCA = 237 reads: +436 validated
umi GTTACCCTTT = 181 reads: +436 validated
umi GTTAGCTGTT = 137 reads: +436 validated
umi GTTCGCTCAA = 154 reads: +436 validated
umi TAAACATCCT = 239 reads: +436 validated
umi TAAGTCTATA = 180 reads: +436 validated
umi TAATTCAATA = 196 reads: +436 validated
umi TAATTGCATC = 136 reads: +436 validated
umi TACAGTTACT = 191 reads: +436 validated
umi TACCAGTTGG = 163 reads: +436 validated
umi TAGTTCTCCT = 219 reads: +436 validated
umi TATATATCGC = 168 reads: +436 validated
umi TATATATTCT = 198 reads: +436 validated
umi TATGCCACGG = 188 reads: +436 validated
umi TATGGTGCCA = 239 reads: +436 validated
umi TATGTCATGT = 112 reads: +436 validated
umi TATTAGCGTG = 128 reads: +436 validated
umi TATTGTCGTC = 142 reads: +436 validated
umi TCACTTCCAT = 91 reads: +436 validated
umi TCATCGCATC = 171 reads: +436 validated
umi TCCAGAGGCC = 135 reads: +436 validated
umi TCCATTCGGA = 203 reads: +436 validated
umi TCCCCTCCGA = 99 reads: +436 validated
umi TCCTCACTTT = 148 reads: +436 validated
umi TCGATCACTT = 219 reads: +436 validated
umi TCGATTGAAT = 164 reads: +436 validated
umi TCGCCATGAT = 106 reads: -17 +16 -1 +402 non-validated
umi TCGTGATGAT = 241 reads: +436 validated
umi TCTAAAAATG = 257 reads: +436 validated
umi TCTGAGGGGT = 88 reads: +436 validated
umi TCTGATGGGC = 100 reads: +436 validated
umi TCTGCACCTC = 245 reads: +436 validated
umi TCTTCCCCAA = 189 reads: +436 validated
umi TGCATTCTCT = 220 reads: +436 validated
umi TGCCTTGACA = 285 reads: +436 validated
umi TGCTCATCGG = 236 reads: +436 validated
umi TGCTCCCCGT = 202 reads: +436 validated
umi TGCTCTTTTA = 227 reads: +436 validated
umi TGTCTCTTGG = 230 reads: +436 validated
umi TGTTAAACGG = 216 reads: +436 validated
umi TTAACACACC = 168 reads: +436 validated
umi TTACTTAGCG = 269 reads: +436 validated
umi TTAGTGACGG = 86 reads: +436 validated
umi TTATGCTATT = 150 reads: +436 validated
umi TTCGGGGCTC = 55 reads: +424 -12 non-validated
umi TTCTCAAGTG = 207 reads: +436 validated
umi TTGACATAGA = 178 reads: +436 validated
umi TTGCTAATTC = 245 reads: +436 validated
umi TTGGAGCGGC = 189 reads: +436 validated
umi TTGGCCATGG = 171 reads: +436 validated
umi TTGTCCGACG = 167 reads: +436 validated
umi TTGTCTTTGC = 163 reads: +436 validated
umi TTGTTTCAAG = 209 reads: +436 validated
umi TTTCAATGCA = 157 reads: -1 +435 non-validated
umi TTTCCGCCCG = 193 reads: +436 validated
umi TTTCTCGCTA = 87 reads: -8X +418 -10 invalidated
umi TTTGAGCAAT = 295 reads: +436 validated
umi TTTGGGACTA = 69 reads: +436 validated
umi TTTGTGCCTA = 117 reads: +436 validated
umi TTTGTGGGCC = 154 reads: +436 validated
umi TTTTATCGGC = 137 reads: +436 validated
umi TTTTGATAAT = 68 reads: +436 validated
umi TTTTTGTGTC = 197 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 113 umis using 5496 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [5, 7, 19, 20, 21, 23, 29, 30, 31, 44] and 107 others
of which 117 are surviving nonsolos
reads assigned: 34632
start codons at 33, 82, 241, 340, 381, 463
confident = true

TIG 2[bases=635]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-635 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 225 umis using 5798 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [0, 3, 4, 8, 9, 12, 13, 16, 17, 22] and 224 others
of which 234 are surviving nonsolos
reads assigned: 42188
start codons at 17, 38, 82
confident = true
now this is a cell
paired!

GCCGCAGACACGGCTGTTTATTACTGTGCGAGATACTTCGCCTTCGTGAACTACTACTTTGACAAGTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAGGATGTTGCAGTGTATTTCTGTCAGCAATACGGTTCCTCACCCATGTACACTTTTGGCCAGGGGACCAGGCTGGAGATCAATC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.281 = TACGGGCAGAGCTATA-1

using 1158 reads

====================================================================================

graph has 1512 edges initially, 34 edges after simplification

total ucounts = 579
nonsolo ucounts = 238[2^96, 3^55, 4^36, 5^23, 6^11, 7^8, 8^6, 9^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.285 = TACGGGCAGATGCCAG-1

using 680 reads

====================================================================================

graph has 362 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3, 9^2, 314, 342]
surviving nonsolo ucounts = 2[314, 342]
ids = [1, 5]

====================================================================================

UMI info for barcode TACGGGCAGATGCCAG-1 contig 1 = GAGCTGCTCA...
umi TACGTATCAC = 343 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSPVTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 30, 238, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.288 = TACGGGCAGCAGCGTA-1

using 308 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 301]
surviving nonsolo ucounts = 1[301]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=566]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 28, 97, 350, 472
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.292 = TACGGGCAGCGAGAAA-1

using 149 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 142]
surviving nonsolo ucounts = 1[142]
ids = [0]

====================================================================================

UMI info for barcode TACGGGCAGCGAGAAA-1 contig 1 = AAAGAAGCCC...
umi CACACACTGG = 143 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=526]
0-31 ==> 27-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
31-384 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=6)
417-455 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARSLLNDYGGTGLAYW at 373, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 31, 182, 229, 328, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.296 = TACGGGCAGCGTGTCC-1

using 511 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[507]
surviving nonsolo ucounts = 1[507]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=449]
0-196 ==> 157-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=14)
220-267 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
267-449 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
cdr3 = CARDRAATARLGGMDVW at 185, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 497
start codons at 146, 224
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.301 = TACGGGCAGGCAAAGA-1

using 654 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 152, 157, 335]
surviving nonsolo ucounts = 3[152, 157, 335]
ids = [7, 9, 6]

====================================================================================

UMI info for barcode TACGGGCAGGCAAAGA-1 contig 1 = GGGAATCAGT...
umi GCAACCGCTT = 331 reads: +388 validated
umi GTATAAGCTC = 151 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 93 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 478
start codons at 27, 33, 102, 238, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.307 = TACGGGCAGGTGCTTT-1

using 282 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 6, 266]
surviving nonsolo ucounts = 1[266]
ids = [4]

====================================================================================

UMI info for barcode TACGGGCAGGTGCTTT-1 contig 1 = GGGGATCAGT...
umi CAGACGAATA = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.308 = TACGGGCAGGTGTTAA-1

using 264 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 251]
surviving nonsolo ucounts = 1[251]
ids = [7]

====================================================================================

UMI info for barcode TACGGGCAGGTGTTAA-1 contig 1 = GGAGGAACTG...
umi TACGATCCAT = 221 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=484]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 34, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.309 = TACGGGCAGTACGACG-1

using 127 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[120]
surviving nonsolo ucounts = 1[120]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.312 = TACGGGCAGTATTGGA-1

using 293 reads

====================================================================================

graph has 130 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 31, 124, 131]
surviving nonsolo ucounts = 3[31, 124, 131]
ids = [2, 1, 5]

====================================================================================

UMI info for barcode TACGGGCAGTATTGGA-1 contig 1 = CAGCTGTGGG...
umi CAACAGCTAG = 113 reads: +388 validated

UMI info for barcode TACGGGCAGTATTGGA-1 contig 2 = GAGAGGAGCC...
umi TGCCTCGATA = 126 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=481]
0-42 ==> 72-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
42-395 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-481 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CASWDDSLRGRVF at 363, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 112
start codons at 42, 196, 346, 371, 376
confident = false

TIG 2[bases=515]
0-71 ==> 8-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
71-424 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
448-495 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
495-515 ==> 0-20 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARDRAATARLGGMDVW at 413, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 71, 222, 227, 374, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.313 = TACGGGCAGTCCGTAT-1

using 288 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 279]
surviving nonsolo ucounts = 1[279]
ids = [6]

====================================================================================

UMI info for barcode TACGGGCAGTCCGTAT-1 contig 1 = AGGAGTCAGA...
umi TATCCAAGTC = 283 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
380-412 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNSYPLF at 354, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 27, 33, 89, 102, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.315 = TACGGGCAGTGAAGAG-1

using 5131 reads

====================================================================================

graph has 2523 edges initially, 52 edges after simplification

total ucounts = 512
nonsolo ucounts = 211[2^82, 3^42, 4^29, 5^15, 6^14, 7^6, 8, 9^2, 10^3, 11, 12^2, 13, 15, 37, 46, 49, 53, 61, 109, 139, 227, 696, 776, 840, 1071]
surviving nonsolo ucounts = 7[46, 139, 227, 696, 776, 840, 1071]
ids = [128, 475, 367, 389, 355, 125, 502]

====================================================================================

UMI info for barcode TACGGGCAGTGAAGAG-1 contig 1 = GAGAGACTGA...
umi TAGATGGTCC = 221 reads: +406 validated
umi TGTTTCCATC = 139 reads: +39 -1 +366 non-validated

GOOD CONTIGS

TIG 1[bases=577]
0-37 ==> 0-37 on |391|IGLV9-49|5'UTR| [len=37] (mis=0)
37-406 ==> 0-369 on |392|IGLV9-49|L-REGION+V-REGION| [len=369] (mis=8)
405-443 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
443-577 ==> 0-134 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 2 umis using 48 reads
cdr3 = CGADHGSGSNFLWVF at 370, score = 5 + 8
umis assigned: [367, 475]
of which 2 are surviving nonsolos
reads assigned: 350
start codons at 37, 235, 275, 353, 383
confident = true

REJECT CONTIGS

TIG 1[bases=342]
0-85 ==> 1453-1538 on segment before IGLJ7 exon 1 [len=1538] (mis=0)
85-131 ==> 0-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
131-342 ==> 0-211 on |308|IGLC7|C-REGION| [len=317] (mis=1)
umis assigned: [125, 128, 355, 389, 502]
of which 5 are surviving nonsolos
reads assigned: 1854
start codons at 263, 326
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.319 = TACGGGCCAAAGGTGC-1

using 10 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.320 = TACGGGCCAAATACAG-1

using 20 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.324 = TACGGGCCAAGTTGTC-1

using 1006 reads

====================================================================================

graph has 1120 edges initially, 10 edges after simplification

total ucounts = 335
nonsolo ucounts = 124[2^55, 3^30, 4^13, 5^9, 6^2, 7^4, 8^2, 9^3, 10^2, 13, 14, 20, 348]
surviving nonsolo ucounts = 2[13, 348]
ids = [168, 114]

====================================================================================

UMI info for barcode TACGGGCCAAGTTGTC-1 contig 1 = GGAGGAACTG...
umi CCCCTCGTCC = 346 reads: +388 validated
umi GAATAGTGTT = 12 reads: -388 non-validated

GOOD CONTIGS

TIG 1[bases=558]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPPRYTF at 355, score = 9 + 8
umis assigned: [114, 168]
of which 2 are surviving nonsolos
reads assigned: 353
start codons at 34, 239, 242, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.325 = TACGGGCCAATAAGCA-1

using 180 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[180]
surviving nonsolo ucounts = 1[180]
ids = [0]

====================================================================================

UMI info for barcode TACGGGCCAATAAGCA-1 contig 1 = CAGTTAGGAC...
umi GACGTCGGCG = 164 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=480]
0-22 ==> 25-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
22-367 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
366-404 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
404-480 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQRSNWPGTF at 343, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 22, 227, 230, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.331 = TACGGGCCACATAACC-1

using 741 reads

====================================================================================

graph has 278 edges initially, 18 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[80, 309, 343]
surviving nonsolo ucounts = 3[80, 309, 343]
ids = [8, 7, 1]

====================================================================================

UMI info for barcode TACGGGCCACATAACC-1 contig 1 = AGTTCACCTT...
umi GCGTCCGGGC = 310 reads: +397 validated

UMI info for barcode TACGGGCCACATAACC-1 contig 2 = GGGGCAGGAG...
umi GCTAATCATC = 81 reads: +388 validated

UMI info for barcode TACGGGCCACATAACC-1 contig 3 = GCAGGAGTCA...
umi ATCAGATCGA = 342 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
16-376 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=15)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQATYWPKTF at 352, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 16, 49, 77, 85, 173, 335, 355, 455
confident = false

TIG 2[bases=556]
32-364 ==> 0-332 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=21)
398-420 ==> 16-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQAHVSPRSF at 359, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 32, 38, 87, 94, 107, 243, 372, 462
confident = false

TIG 3[bases=553]
0-29 ==> 18-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQANSFPLTF at 356, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 335
start codons at 29, 35, 91, 104, 243, 261, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.334 = TACGGGCCACCATCCT-1

using 281 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 12, 261]
surviving nonsolo ucounts = 1[261]
ids = [3]

====================================================================================

UMI info for barcode TACGGGCCACCATCCT-1 contig 1 = GCTCTGCTTC...
umi TACGGCCTGA = 247 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=568]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-568 ==> 0-126 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.349 = TACGGGCCAGTGACAG-1

using 1082 reads

====================================================================================

graph has 1192 edges initially, 30 edges after simplification

total ucounts = 550
nonsolo ucounts = 229[2^92, 3^68, 4^31, 5^16, 6^9, 7^5, 8, 9^4, 10, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.350 = TACGGGCCATAAGACA-1

using 440 reads

====================================================================================

graph has 199 edges initially, 14 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 140, 292]
surviving nonsolo ucounts = 2[140, 292]
ids = [4, 6]

====================================================================================

UMI info for barcode TACGGGCCATAAGACA-1 contig 1 = AGCTGTTTGG...
umi GCCGCGGCCG = 140 reads: +400 validated
umi TACAGTAGAG = 255 reads: +171 -1XX +1 -1XX +14 -1XX +6 -2XX +15 -1XX +2 -1XX +88 -1XX +42 -1XX +6 -2XX +2 -1XX +4 -3XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=608]
0-72 ==> 103-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
72-435 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
434-472 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
472-608 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CQQYYSTPKTF at 411, score = 9 + 8
umis assigned: [4, 6]
of which 2 are surviving nonsolos
reads assigned: 383
start codons at 72, 141, 394, 514
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.351 = TACGGGCCATCACCCT-1

using 257 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 12, 238]
surviving nonsolo ucounts = 1[238]
ids = [4]

====================================================================================

UMI info for barcode TACGGGCCATCACCCT-1 contig 1 = CACTCAGGAC...
umi GCGTCGGTCA = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
15-366 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
365-403 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
403-539 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 342, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 15, 21, 90, 226, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.369 = TACGGGCGTATAGGTA-1

using 315 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^5, 3, 4, 6, 285]
surviving nonsolo ucounts = 1[285]
ids = [2]

====================================================================================

UMI info for barcode TACGGGCGTATAGGTA-1 contig 1 = GAATCAGTCC...
umi ATTGATTGCT = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-481 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.372 = TACGGGCGTCAAAGAT-1

using 201 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [1]

====================================================================================

UMI info for barcode TACGGGCGTCAAAGAT-1 contig 1 = CTGATCAGGA...
umi GGATCTATTT = 190 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=509]
0-32 ==> 4-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
32-392 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-509 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQSPRGLTF at 368, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 32, 65, 101, 189, 351, 371, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.379 = TACGGGCGTCCATGAT-1

using 188 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[185]
surviving nonsolo ucounts = 1[185]
ids = [0]

====================================================================================

UMI info for barcode TACGGGCGTCCATGAT-1 contig 1 = GCTCTGCTTC...
umi CCGTTTATTT = 172 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=598]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-598 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.381 = TACGGGCGTCGACTAT-1

using 64 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 3[2^2, 48]
surviving nonsolo ucounts = 1[48]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.385 = TACGGGCGTCTTGATG-1

using 177 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 168]
surviving nonsolo ucounts = 1[168]
ids = [3]

====================================================================================

UMI info for barcode TACGGGCGTCTTGATG-1 contig 1 = GAATCAGTCC...
umi CTCTGATTGG = 155 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=466]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-466 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.386 = TACGGGCGTCTTGCGG-1

using 153 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 3, 4, 144]
surviving nonsolo ucounts = 1[144]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=587]
1-219 ==> 5782-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
219-567 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
566-587 ==> 0-21 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 47, 124, 164, 219, 427, 553
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.388 = TACGGGCGTGACGCCT-1

using 268 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [1]

====================================================================================

UMI info for barcode TACGGGCGTGACGCCT-1 contig 1 = GGTGACTCCT...
umi ATATCGATCC = 272 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=617]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=1)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=13)
387-435 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
435-617 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 47 reads
cdr3 = CAHCTSIDFLLYW at 365, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 20, 64, 176, 243, 246, 326, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.413 = TACGGGCTCAGGATCT-1

using 544 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^3, 85, 452]
surviving nonsolo ucounts = 2[85, 452]
ids = [3, 4]

====================================================================================

UMI info for barcode TACGGGCTCAGGATCT-1 contig 1 = GAATCAGTCC...
umi GGAAACAGTT = 85 reads: +388 validated
umi GGGACAGAAT = 448 reads: -252X +1 -2X +133 invalidated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 524
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.430 = TACGGGCTCGTTTGCC-1

using 366 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2^2, 354]
surviving nonsolo ucounts = 1[354]
ids = [2]

====================================================================================

UMI info for barcode TACGGGCTCGTTTGCC-1 contig 1 = GAAGAGCTGC...
umi AGTAGATTAT = 326 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=495]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-495 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPETF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.438 = TACGGGCTCTTGAGGT-1

using 269 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 5, 252]
surviving nonsolo ucounts = 1[252]
ids = [8]

====================================================================================

UMI info for barcode TACGGGCTCTTGAGGT-1 contig 1 = AGCTGTGGGC...
umi TCTATCATCA = 245 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=11)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-552 ==> 0-130 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CNCRDSSGNHWVF at 355, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.439 = TACGGGCTCTTTAGTC-1

using 513 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 224, 285]
surviving nonsolo ucounts = 2[224, 285]
ids = [3, 0]

====================================================================================

UMI info for barcode TACGGGCTCTTTAGTC-1 contig 1 = AGCTTCAGCT...
umi TAGGCCGCGC = 211 reads: +388 validated

UMI info for barcode TACGGGCTCTTTAGTC-1 contig 2 = GGAATCAGTC...
umi ATTTCCTCTT = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-563 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.444 = TACGGTAAGACTAGGC-1

using 8 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.445 = TACGGTAAGACTCGGA-1

using 320 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [3]

====================================================================================

UMI info for barcode TACGGTAAGACTCGGA-1 contig 1 = GCAGGAGTCA...
umi GTTATGTCCA = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-514 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.446 = TACGGTAAGACTTGAA-1

using 262 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode TACGGTAAGACTTGAA-1 contig 1 = GAGGAATCAG...
umi CATCACCCTC = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-506 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.452 = TACGGTAAGATCTGAA-1

using 796 reads

====================================================================================

graph has 184 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[345, 449]
surviving nonsolo ucounts = 2[345, 449]
ids = [2, 3]

====================================================================================

UMI info for barcode TACGGTAAGATCTGAA-1 contig 1 = AGTCTCAGTC...
umi TATTCACTCT = 443 reads: +388 validated

UMI info for barcode TACGGTAAGATCTGAA-1 contig 2 = TGGGGTCTCA...
umi TACGCATGCT = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 81 reads
cdr3 = CQQSYSTPRTF at 347, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 20, 26, 82, 95, 231, 450
confident = false

TIG 2[bases=638]
0-39 ==> 124-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
39-393 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CSSHAGSTRVLF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 39, 196, 247, 346, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.453 = TACGGTAAGATGTTAG-1

using 187 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 4, 5, 169]
surviving nonsolo ucounts = 1[169]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=460]
18-376 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=3)
392-423 ==> 0-31 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
432-460 ==> 8-36 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 18, 174, 241, 244, 324, 333, 444
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.455 = TACGGTAAGCCAGGAT-1

using 176 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [6]

====================================================================================

UMI info for barcode TACGGTAAGCCAGGAT-1 contig 1 = GCTCTGCTTC...
umi TGCCGGTTCA = 163 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-588 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.457 = TACGGTAAGCGTAGTG-1

using 190 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode TACGGTAAGCGTAGTG-1 contig 1 = AGCATCATCC...
umi AACAGAACCC = 183 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=500]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
433-479 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
479-500 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CALVSTLSALPFDFW at 403, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 61, 259, 265, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.468 = TACGGTAAGGTAAACT-1

using 571 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3, 4, 263, 291]
surviving nonsolo ucounts = 2[263, 291]
ids = [3, 7]

====================================================================================

UMI info for barcode TACGGTAAGGTAAACT-1 contig 1 = CAGAGCTCTG...
umi AGCATCCTCG = 241 reads: +385 validated
umi CGAAATTGAT = 267 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=523]
0-45 ==> 7-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
45-393 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
430-523 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 78 reads
cdr3 = CQQYGSSPYTF at 369, score = 9 + 8
umis assigned: [3, 7]
of which 2 are surviving nonsolos
reads assigned: 501
start codons at 45, 253, 379, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.469 = TACGGTAAGGTGCAAC-1

using 204 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [1]

====================================================================================

UMI info for barcode TACGGTAAGGTGCAAC-1 contig 1 = ACCCAAAAAC...
umi GTCTACCTCA = 196 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-564 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.475 = TACGGTAAGTGTCCCG-1

using 232 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[35, 194]
surviving nonsolo ucounts = 2[35, 194]
ids = [0, 3]

====================================================================================

UMI info for barcode TACGGTAAGTGTCCCG-1 contig 1 = AAAAACCACA...
umi GCTAAGCTTG = 180 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=498]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.478 = TACGGTACAAAGTGCG-1

using 151 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 145]
surviving nonsolo ucounts = 1[145]
ids = [2]

====================================================================================

UMI info for barcode TACGGTACAAAGTGCG-1 contig 1 = AGACTCAGTC...
umi GACCGATCCG = 137 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-487 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYNSYPLTF at 347, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 20, 26, 82, 95, 231, 234, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.481 = TACGGTACAAGCCTAT-1

using 342 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[338]
surviving nonsolo ucounts = 1[338]
ids = [4]

====================================================================================

UMI info for barcode TACGGTACAAGCCTAT-1 contig 1 = GGAAATCAGT...
umi CGTCGCCCCT = 342 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.487 = TACGGTACACATAACC-1

using 371 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[367]
surviving nonsolo ucounts = 1[367]
ids = [3]

====================================================================================

UMI info for barcode TACGGTACACATAACC-1 contig 1 = GGGGAGGAAC...
umi GTGCTTTGTA = 371 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQFNKWPPTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 36, 105, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.488 = TACGGTACACATGGGA-1

using 108 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 31
nonsolo ucounts = 19[2^4, 3^2, 4^4, 5^2, 6^4, 9, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.495 = TACGGTACACTACAGT-1

using 267 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^2, 3^2, 5, 240]
surviving nonsolo ucounts = 1[240]
ids = [1]

====================================================================================

UMI info for barcode TACGGTACACTACAGT-1 contig 1 = GCTCTGCTTC...
umi ACAATTACAC = 229 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-564 ==> 0-119 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.501 = TACGGTACAGCTCGAC-1

using 262 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 255]
surviving nonsolo ucounts = 1[255]
ids = [5]

====================================================================================

UMI info for barcode TACGGTACAGCTCGAC-1 contig 1 = GGAGGAACTG...
umi TGCAAGTCTC = 231 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=443]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-443 ==> 0-30 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNWLTF at 355, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 34, 239, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.503 = TACGGTACAGGCGATA-1

using 282 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[282]
surviving nonsolo ucounts = 1[282]
ids = [0]

====================================================================================

UMI info for barcode TACGGTACAGGCGATA-1 contig 1 = GCCTGGGCCT...
umi GCAACTCTTC = 281 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=626]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
39-373 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
415-626 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQAWDSTEVVF at 354, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 39, 44, 333, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.505 = TACGGTACAGTAGAGC-1

using 50 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[4, 5, 10, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.508 = TACGGTACATCACGTA-1

using 504 reads

====================================================================================

graph has 236 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 5, 194, 296]
surviving nonsolo ucounts = 2[194, 296]
ids = [3, 5]

====================================================================================

UMI info for barcode TACGGTACATCACGTA-1 contig 1 = GGCTTTCTGA...
umi CATTAAGCCC = 299 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=547]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
399-445 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
445-547 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CASRGVTSNEDYW at 375, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 15, 36, 80, 166, 400, 463, 524
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.516 = TACGGTAGTAGCGCTC-1

using 280 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [3]

====================================================================================

UMI info for barcode TACGGTAGTAGCGCTC-1 contig 1 = AGCACTGAAC...
umi CGGGTTAAGC = 279 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=516]
0-24 ==> 56-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
24-375 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=7)
377-404 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=5)
397-445 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
445-516 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDGNYGSGSYFDFW at 366, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 24, 180, 233, 238, 241, 259, 327, 376, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.521 = TACGGTAGTCCAACTA-1

using 231 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode TACGGTAGTCCAACTA-1 contig 1 = GGAACTGCTC...
umi AGTACACTGC = 200 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=445]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-445 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNNWPPYTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 31, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.526 = TACGGTAGTCGCGGTT-1

using 231 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 223]
surviving nonsolo ucounts = 1[223]
ids = [5]

====================================================================================

UMI info for barcode TACGGTAGTCGCGGTT-1 contig 1 = CTCAGGAGGC...
umi TACTCATTCT = 219 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=519]
33-355 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-519 ==> 0-95 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CCSFTVNTRSYVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 33, 190, 234, 244, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.537 = TACGGTAGTGCAGGTA-1

using 212 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=466]
0-344 ==> 7-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
343-381 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
381-466 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 320, score = 9 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 68, 204, 423
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.540 = TACGGTAGTGTCAATC-1

using 665 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4, 249, 408]
surviving nonsolo ucounts = 2[249, 408]
ids = [1, 5]

====================================================================================

UMI info for barcode TACGGTAGTGTCAATC-1 contig 1 = AGGAATCAGT...
umi TCCTGCGCGT = 248 reads: +388 validated
umi TGCTGGGGGA = 424 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 126 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 648
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.559 = TACGGTATCATGTAGC-1

using 9855 reads

====================================================================================

graph has 4986 edges initially, 148 edges after simplification

total ucounts = 972
nonsolo ucounts = 420[2^169, 3^104, 4^52, 5^17, 6^14, 7^12, 8^3, 9^6, 10, 11, 13, 35, 45, 51, 53, 80, 110, 120, 135, 138, 158, 159, 160, 165, 170, 189, 190, 192, 199, 201, 206, 209, 218, 222, 230, 235, 239^2, 242, 246, 248, 251, 254, 258, 269, 273, 292, 297, 316, 343, 443]
surviving nonsolo ucounts = 38[45, 51, 80, 110, 120, 135, 138, 158, 159, 160, 165, 170, 189, 190, 192, 199, 201, 206, 209, 218, 222, 230, 235, 239^2, 242, 246, 248, 251, 254, 258, 269, 273, 292, 297, 316, 343, 443]
ids = [526, 340, 833, 862, 23, 499, 263, 504, 187, 683, ...]

====================================================================================

UMI info for barcode TACGGTATCATGTAGC-1 contig 1 = TGGGGGAGGA...
umi AAAGGTATTA = 249 reads: +388 validated
umi AAATGCGGGT = 254 reads: +388 validated
umi AACACACTTT = 114 reads: +388 validated
umi ACCTTGTTAT = 186 reads: +388 validated
umi ATACCTTTGC = 160 reads: +388 validated
umi ATCGGCTGGG = 229 reads: +388 validated
umi CAAGCATACG = 138 reads: +388 validated
umi CACTACCTCG = 189 reads: +388 validated
umi CATATTCCAT = 273 reads: +388 validated
umi CATCCATTTG = 241 reads: +388 validated
umi CCGTCTAGGC = 201 reads: +388 validated
umi CGAATTGGCA = 298 reads: +388 validated
umi CGACAAACTG = 169 reads: +388 validated
umi GATAGACTCT = 155 reads: +388 validated
umi TATACTTTTT = 429 reads: -282 +106 non-validated
umi TATCACTTCG = 250 reads: +388 validated
umi TCCGACTTCT = 236 reads: +388 validated
umi TGACTAGTCC = 210 reads: +388 validated
umi TGTATAGGTT = 254 reads: +388 validated
umi TTAAAGATCT = 111 reads: +378 -1 +1 -2 +2 -1 +2 -1 non-validated

UMI info for barcode TACGGTATCATGTAGC-1 contig 2 = GGAGCTCTGG...
umi ATGTATGGGT = 164 reads: +339 -1 +78 -2X +1 -1 +2 invalidated
umi CCCTGTTCTG = 50 reads: +154 -2XX +35 -1XX +44 -1XX +112 -2XX +1 -1XX +1 -6XX +2 -2X +1 -34X +2 -1X +3 -2X +11 -1 +4 -1 invalidated
umi GCATTGCTCA = 44 reads: +348 -1 +1 -1 +13 -1 +8 -51 non-validated
umi GCTTCATATA = 238 reads: +154 -2XX +35 -1XX +44 -1XX +112 -2XX +1 -1XX +1 -21XX +1 -1X +1 -6X +1 -1XX +1 -2XX +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi TATACTAATC = 160 reads: +420 -4 non-validated
umi TCTTCGGTCG = 214 reads: +424 validated
umi TTCATACCGG = 240 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=557]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 20 umis using 654 reads
cdr3 = CQQSYSTPLTF at 360, score = 9 + 9
umis assigned: [12, 18, 23, 101, 187, 210, 263, 284, 306, 310] and 10 others
of which 20 are surviving nonsolos
reads assigned: 4280
start codons at 33, 39, 95, 108, 244, 463
confident = true

TIG 2[bases=576]
81-434 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=4)
456-505 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 30 reads
cdr3 = CARGYGSGSYLYGMDVW at 423, score = 9 + 7
umis assigned: [226, 340, 526, 557, 683, 792, 893]
of which 7 are surviving nonsolos
reads assigned: 1075
start codons at 81, 232, 237, 295, 298, 384, 436, 462
confident = true

REJECT CONTIGS

TIG 1[bases=333]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-32 ==> 5705-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
31-333 ==> 0-302 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
umis assigned: [159]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 31, 239
confident = false
did not find CDR3

TIG 2[bases=576]
4-51 ==> 5953-6000 on rc of segment after IGKV1-16 exon 1 [len=6000] (mis=0)
34-98 ==> 5672-5736 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
36-108 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=8)
36-108 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=8)
36-108 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=8)
51-402 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
403-440 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [11, 38, 139, 376, 499, 555, 580, 587, 833]
of which 9 are surviving nonsolos
reads assigned: 1871
start codons at 51, 57, 113, 126, 262, 482
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGGGGCTATGGTTCAGGGAGTTATCTGTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.565 = TACGGTATCCCTAACC-1

using 321 reads

====================================================================================

graph has 155 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 312]
surviving nonsolo ucounts = 1[312]
ids = [6]

====================================================================================

UMI info for barcode TACGGTATCCCTAACC-1 contig 1 = ACACCCTGTG...
umi TTGGCCTACT = 313 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=556]
0-38 ==> 9-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
38-389 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQAKSFSF at 365, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 38, 44, 100, 113, 249, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.577 = TACGGTATCGTCCAGG-1

using 317 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[313]
surviving nonsolo ucounts = 1[313]
ids = [2]

====================================================================================

UMI info for barcode TACGGTATCGTCCAGG-1 contig 1 = AGAGCTCTGG...
umi CCTTCTTCTG = 316 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNWTWTF at 365, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 44, 113, 249, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.578 = TACGGTATCGTGGTCG-1

using 221 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 211]
surviving nonsolo ucounts = 1[211]
ids = [1]

====================================================================================

UMI info for barcode TACGGTATCGTGGTCG-1 contig 1 = AGCTGTGGGC...
umi CATGGGCAGC = 205 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-550 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CNSRDSSGNHLVF at 355, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.580 = TACGGTATCTGCTTGC-1

using 453 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 447]
surviving nonsolo ucounts = 1[447]
ids = [3]

====================================================================================

UMI info for barcode TACGGTATCTGCTTGC-1 contig 1 = TGGGGGTCAG...
umi GCCGATTATA = 452 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQDYTYPFSF at 355, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 28, 34, 90, 103, 185, 188, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.582 = TACGGTATCTTACCTA-1

using 350 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[350]
surviving nonsolo ucounts = 1[350]
ids = [0]

====================================================================================

UMI info for barcode TACGGTATCTTACCTA-1 contig 1 = GTCAGTCCCA...
umi ATTTCTGATT = 345 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=9)
370-408 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYDNLSLF at 350, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.587 = TACTCATAGAAGGACA-1

using 1499 reads

====================================================================================

graph has 1920 edges initially, 30 edges after simplification

total ucounts = 579
nonsolo ucounts = 273[2^92, 3^41, 4^39, 5^26, 6^23, 7^17, 8^13, 9^13, 10^2, 11^2, 13, 14, 15, 16, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.588 = TACTCATAGAATGTGT-1

using 430 reads

====================================================================================

graph has 90 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 93, 330]
surviving nonsolo ucounts = 1[330]
ids = [3]

====================================================================================

UMI info for barcode TACTCATAGAATGTGT-1 contig 1 = TGGGGAGGAA...
umi TAGAACGATC = 329 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNDWQFTF at 358, score = 10 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 37, 106, 242, 245, 371, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.602 = TACTCATAGCGTTTAC-1

using 21 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.607 = TACTCATAGGACTGGT-1

using 91 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[91]
surviving nonsolo ucounts = 1[91]
ids = [0]

====================================================================================

UMI info for barcode TACTCATAGGACTGGT-1 contig 1 = CTCCACCATG...
umi CTAATTTTCT = 91 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=439]
7-347 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
363-401 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
401-439 ==> 0-38 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CCSEAGGGVPGLLF at 331, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 90
start codons at 7, 161
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.611 = TACTCATAGGCACATG-1

using 617 reads

====================================================================================

graph has 361 edges initially, 20 edges after simplification

total ucounts = 49
nonsolo ucounts = 36[2^4, 3^7, 4^2, 5^2, 6^2, 7^4, 8^5, 9^2, 10^2, 11^2, 12, 19, 24, 362]
surviving nonsolo ucounts = 1[362]
ids = [11]

====================================================================================

UMI info for barcode TACTCATAGGCACATG-1 contig 1 = GGAGAAGAGC...
umi ATCTCCGCTA = 370 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSRTF at 360, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 36, 244, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.615 = TACTCATAGGCATTGG-1

using 2719 reads

====================================================================================

graph has 3640 edges initially, 46 edges after simplification

total ucounts = 1114
nonsolo ucounts = 550[2^215, 3^123, 4^82, 5^44, 6^20, 7^20, 8^15, 9^8, 10^3, 11^7, 12^2, 13^2, 14, 15, 16, 19^2, 20, 21, 25, 50]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.619 = TACTCATAGGGCATGT-1

using 11886 reads

====================================================================================

graph has 4824 edges initially, 52 edges after simplification

total ucounts = 803
nonsolo ucounts = 342[2^109, 3^82, 4^43, 5^24, 6^16, 7^7, 8^6, 9^6, 10^5, 12^2, 13, 14, 15^2, 17, 48, 83, 86, 90, 92, 127, 136, 180, 185, 193, 197, 199, 211, 234, 236, 270, 288, 293, 301, 305, 308, 316, 321, 332, 334, 336, 340, 341, 349, 355, 356, 365, 369, 405, 419, 566, 708]
surviving nonsolo ucounts = 35[86, 90, 92, 127, 136, 180, 185, 193, 197, 199, 211, 234, 236, 270, 288, 293, 301, 305, 308, 316, 321, 332, 334, 336, 340, 341, 349, 355, 356, 365, 369, 405, 419, 566, 708]
ids = [440, 384, 425, 168, 370, 412, 239, 267, 125, 486, ...]

====================================================================================

UMI info for barcode TACTCATAGGGCATGT-1 contig 1 = GAGAGAGGAG...
umi AGCGATCCTT = 192 reads: +430 validated
umi ATTATCCGTT = 467 reads: -148X +1 -1XX +1 -1XX +2 -2XX +2 -1XX +2 -1XX +20 -1XX +17 -2XX +2 -3XX +2 -2XX +1 -2XX +2 -2XX +3 -1XX +3 -1XX +1 -1XX +1 -1XX +1 -1XX +4 -1XX +1 -1XX +6 -1XX +4 -1XX +27 -3XX +5 -1XX +1 -1XX +1 -1XX +6 -1XX +34 -1XX +12 -1XX +7 -2XX +1 -3XX +1 -3XX +1 -4XX +1 -5XX +1 -1XX +1 -3XX +1 -1XX +1 -4XX +21 -1XX +9 -1XX +11 invalidated
umi CAGTTAGTCC = 185 reads: +385 -1 +3 -1 +4 -1 +8 -1 +16 -10 non-validated
umi CCCATTCCCT = 309 reads: +430 validated
umi CTGATTAGGG = 91 reads: +388 -1 +20 -21 non-validated
umi TTCCTCAGTA = 304 reads: +430 validated

UMI info for barcode TACTCATAGGGCATGT-1 contig 2 = AGAGCTCTGG...
umi ACTCAGACGA = 709 reads: +385 validated
umi AGACTACTAG = 341 reads: +385 validated
umi ATATAGGGCG = 407 reads: +385 validated
umi ATCAGCCATA = 124 reads: +385 validated
umi CAGATAGTTT = 237 reads: +385 validated
umi CCACTAGCGA = 333 reads: +385 validated
umi CCATAGGTAT = 196 reads: +385 validated
umi CGAGCAATAA = 421 reads: +385 validated
umi CGCCGCCCGA = 367 reads: +385 validated
umi CTCGATGCTA = 135 reads: +385 validated
umi CTGATTTTAC = 314 reads: +385 validated
umi CTTTCTCTCC = 183 reads: +385 validated
umi GAATGACCCC = 90 reads: +385 validated
umi GACCTCAACC = 338 reads: +385 validated
umi GAGTAGCCAA = 87 reads: +385 validated
umi GAGTTTTGCT = 322 reads: +385 validated
umi GCGCACCTCT = 335 reads: +385 validated
umi GCTCCCAGCA = 193 reads: +385 validated
umi GGCCCTCGGA = 310 reads: +385 validated
umi GTTTAACGGA = 358 reads: +385 validated
umi TAAGCACCAC = 288 reads: +385 validated
umi TACACGTTTG = 371 reads: +385 validated
umi TCCTCACGGA = 334 reads: +385 validated
umi TCGAAGGGGG = 214 reads: +385 validated
umi TCTCCCTGGG = 272 reads: +385 validated
umi TGTTATGTTA = 291 reads: +385 validated
umi TTCCTTGAGA = 235 reads: +385 validated
umi TTTAAATCCG = 353 reads: +385 validated
umi TTTACATCCA = 305 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=574]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=11)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
503-574 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 71 reads
cdr3 = CTRDGPNEFCGGDCPVDYW at 415, score = 9 + 6
umis assigned: [125, 193, 239, 278, 384, 763]
of which 6 are surviving nonsolos
reads assigned: 1516
start codons at 73, 224, 234, 376, 434
confident = true

TIG 2[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 29 umis using 1330 reads
cdr3 = CQQYNNWPPYTF at 365, score = 9 + 7
umis assigned: [84, 102, 162, 168, 231, 261, 267, 318, 327, 370] and 19 others
of which 29 are surviving nonsolos
reads assigned: 8338
start codons at 44, 113, 249, 471
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTACGAGAGACGGACCCAATGAATTTTGTGGTGGTGATTGCCCAGTTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCGTACACTTTTGGCCAGGGGACCAAGGTGGAGAGCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.622 = TACTCATAGTAAGTAC-1

using 152 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 147]
surviving nonsolo ucounts = 1[147]
ids = [2]

====================================================================================

UMI info for barcode TACTCATAGTAAGTAC-1 contig 1 = ACAAGAGGCA...
umi GGGCATTCGG = 142 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=490]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
425-490 ==> 0-65 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDSSLSGLYVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 31, 185, 188, 239, 338, 365, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.624 = TACTCATAGTACGCCC-1

using 351 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2^2, 3^2, 4, 5^2, 6, 14, 301]
surviving nonsolo ucounts = 2[2, 301]
ids = [11, 12]

====================================================================================

UMI info for barcode TACTCATAGTACGCCC-1 contig 1 = TGGGGAGGAA...
umi GTCTTTTCAT = 2 reads: -100 +56 -104 +56 -66 non-validated
umi GTCTTTTTCA = 275 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=502]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYYNWPRTF at 358, score = 9 + 8
umis assigned: [11, 12]
of which 2 are surviving nonsolos
reads assigned: 272
start codons at 37, 92, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.632 = TACTCATAGTGACTCT-1

using 482 reads

====================================================================================

graph has 162 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 231, 242]
surviving nonsolo ucounts = 2[231, 242]
ids = [0, 4]

====================================================================================

UMI info for barcode TACTCATAGTGACTCT-1 contig 1 = GGAATCAGTC...
umi AACAGTATGT = 231 reads: +388 validated
umi TCGATTGGTT = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 82 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 467
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.636 = TACTCATAGTTAGCGG-1

using 217 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 205]
surviving nonsolo ucounts = 1[205]
ids = [6]

====================================================================================

UMI info for barcode TACTCATAGTTAGCGG-1 contig 1 = GCTTCAGCTG...
umi TATTAGGCTC = 200 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=591]
0-46 ==> 5-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
46-402 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
399-437 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
437-591 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSFDSSLSGYVF at 370, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 46, 200, 203, 250, 254, 353, 401, 569
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.644 = TACTCATCAACTGGCC-1

using 226 reads

====================================================================================

graph has 210 edges initially, 14 edges after simplification

total ucounts = 40
nonsolo ucounts = 35[2^6, 3, 4^10, 5^2, 6^2, 7^5, 8, 9, 10, 12^2, 13^2, 16^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.653 = TACTCATCAATGTTGC-1

using 9029 reads

====================================================================================

graph has 5003 edges initially, 92 edges after simplification

total ucounts = 1010
nonsolo ucounts = 479[2^215, 3^106, 4^44, 5^33, 6^18, 7^13, 8^11, 9^6, 10^7, 11^3, 12, 13, 14, 16, 21, 26, 48, 96, 99, 193, 223, 227, 237, 239, 268, 305, 372, 421, 479, 611, 758, 1134, 1153]
surviving nonsolo ucounts = 15[48, 99, 193, 227, 237, 239, 268, 305, 372, 421, 479, 611, 758, 1134, 1153]
ids = [158, 886, 436, 668, 36, 548, 414, 558, 951, 46, ...]

====================================================================================

UMI info for barcode TACTCATCAATGTTGC-1 contig 1 = GGGGTCTCAG...
umi AAGATTGTGG = 231 reads: +391 validated
umi ATGCTGTCTG = 608 reads: -379X +1 -1XX +8 -1XX +1 invalidated
umi CCCCAGTCTC = 1143 reads: -325X +1 -3XX +1 -1XX +3 -2XX +2 -2XX +1 -1XX +4 -10XX +33 -1XX +1 invalidated
umi CGGGGTTTTT = 268 reads: +391 validated
umi CTGCGTGTTC = 476 reads: -391 non-validated
umi GATAACCGAT = 244 reads: +391 validated
umi GATTGACCCG = 304 reads: +391 validated
umi TAAATTTGTG = 773 reads: -379X +1 -1X +8 -1XX +1 invalidated
umi TGGCGCAGTA = 99 reads: -369 +22 non-validated
umi TTCCGTTCCA = 386 reads: -391 non-validated

GOOD CONTIGS

TIG 1[bases=640]
38-389 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
429-640 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 161 reads
cdr3 = CSSYTSTSTSGVF at 362, score = 8 + 8
umis assigned: [36, 239, 351, 414, 476, 548, 558, 697, 886, 951]
of which 10 are surviving nonsolos
reads assigned: 4374
start codons at 38, 195, 239, 246, 249, 561
confident = true

REJECT CONTIGS

TIG 1[bases=457]
5-282 ==> 45-322 on rc of segment before IGKJ1 exon 1 [len=322] (mis=1)
282-321 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
321-457 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2, 46, 436]
of which 3 are surviving nonsolos
reads assigned: 1744
start codons at 18, 186, 205, 363
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.656 = TACTCATCACAGGAGT-1

using 291 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 6, 281]
surviving nonsolo ucounts = 1[281]
ids = [1]

====================================================================================

UMI info for barcode TACTCATCACAGGAGT-1 contig 1 = GAGTCAGTCT...
umi ATACCCAGGC = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-483 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTPLTF at 352, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.665 = TACTCATCAGCCTTTC-1

using 246 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 237]
surviving nonsolo ucounts = 1[237]
ids = [5]

====================================================================================

UMI info for barcode TACTCATCAGCCTTTC-1 contig 1 = ATCAGTCCCA...
umi GTTGTGCCGC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.671 = TACTCATCAGTCAGAG-1

using 240 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 4, 227]
surviving nonsolo ucounts = 1[227]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=532]
0-355 ==> 1-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
355-393 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
393-532 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 323, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 153, 156, 207, 306, 333, 357, 525
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.676 = TACTCATCATCACGAT-1

using 351 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[351]
surviving nonsolo ucounts = 1[351]
ids = [0]

====================================================================================

UMI info for barcode TACTCATCATCACGAT-1 contig 1 = GATCAGGACT...
umi CGGACCGTCA = 353 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CMQALQTPCSF at 366, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.680 = TACTCATCATGCAACT-1

using 249 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode TACTCATCATGCAACT-1 contig 1 = GAATCAGTCC...
umi CACTCTGCTT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.689 = TACTCATGTAAACCTC-1

using 346 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^4, 3^2, 331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

UMI info for barcode TACTCATGTAAACCTC-1 contig 1 = AGGCCCCTCC...
umi CTCATTAGTT = 324 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=524]
0-93 ==> 82-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
93-456 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=18)
455-493 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
493-524 ==> 0-31 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYYILPWTF at 432, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 93, 162, 256, 415, 484
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.690 = TACTCATGTAAAGGAG-1

using 157 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 154]
surviving nonsolo ucounts = 1[154]
ids = [2]

====================================================================================

UMI info for barcode TACTCATGTAAAGGAG-1 contig 1 = TGGGGCTGGG...
umi TTCGGGCACT = 155 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=521]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=7)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=40)
465-501 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
junction support: 1 umis using 9 reads
cdr3 = CATAPPSLIWFGLQSW at 422, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 80, 182, 236, 289, 297, 315, 383, 510
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.694 = TACTCATGTAAGTAGT-1

using 59 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 56]
surviving nonsolo ucounts = 1[56]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.697 = TACTCATGTACCATCA-1

using 228 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 34, 188]
surviving nonsolo ucounts = 2[34, 188]
ids = [1, 0]

====================================================================================

UMI info for barcode TACTCATGTACCATCA-1 contig 1 = AGCTTCAGCT...
umi ACCACGGCAT = 186 reads: +388 validated
umi ACCATGGCAT = 30 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-548 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 47 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 213
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.700 = TACTCATGTAGAGGAA-1

using 53 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^2, 3^2, 4, 8, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.702 = TACTCATGTAGCTTGT-1

using 157 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[150]
surviving nonsolo ucounts = 1[150]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.707 = TACTCATGTCAGAATA-1

using 300 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[293]
surviving nonsolo ucounts = 1[293]
ids = [2]

====================================================================================

UMI info for barcode TACTCATGTCAGAATA-1 contig 1 = ATCAGTCCCA...
umi CCATCCCACC = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-480 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.712 = TACTCATGTCTCATCC-1

using 206 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3^2, 198]
surviving nonsolo ucounts = 1[198]
ids = [4]

====================================================================================

UMI info for barcode TACTCATGTCTCATCC-1 contig 1 = AGCTTCAGCT...
umi GTTTCGAGCG = 195 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-568 ==> 0-133 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDTLNGWVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 47, 261, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.713 = TACTCATGTCTCTTTA-1

using 75 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[75]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.714 = TACTCATGTCTTCGTC-1

using 267 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 263]
surviving nonsolo ucounts = 1[263]
ids = [1]

====================================================================================

UMI info for barcode TACTCATGTCTTCGTC-1 contig 1 = GAGTCAGTCC...
umi CCGCACAGGC = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=488]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
413-488 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDNLPVTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.729 = TACTCATGTTGCTCCT-1

using 407 reads

====================================================================================

graph has 213 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 133, 268]
surviving nonsolo ucounts = 2[133, 268]
ids = [1, 6]

====================================================================================

UMI info for barcode TACTCATGTTGCTCCT-1 contig 1 = AGAGCTCTGG...
umi TTTATACCCC = 255 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=461]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
429-461 ==> 0-32 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPYTF at 368, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 44, 252, 378
confident = false

REJECT CONTIGS

TIG 1[bases=417]
28-275 ==> 106-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=15)
298-346 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
346-417 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARSPRVQSFDWPFDYW at 264, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 78, 199, 225
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.748 = TACTCATTCCAAATGC-1

using 38 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[37]
surviving nonsolo ucounts = 1[37]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.756 = TACTCATTCCGGGTGT-1

using 194 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4, 7, 21, 158]
surviving nonsolo ucounts = 2[21, 158]
ids = [2, 4]

====================================================================================

UMI info for barcode TACTCATTCCGGGTGT-1 contig 1 = GGGGTCACAA...
umi TATTTTGGAA = 21 reads: +306 -73 non-validated
umi TGCACACCCT = 156 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=552]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-163 ==> 0-125 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
163-363 ==> 140-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
417-552 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CCSYAGTSSSHYVF at 347, score = 8 + 7
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 175
start codons at 38, 224, 231, 240, 357, 381
confident = false
see deletion of 15 bases at pos 125 on |343|IGLV2-23|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.762 = TACTCATTCCTCCTAG-1

using 335 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 9, 11, 306]
surviving nonsolo ucounts = 1[306]
ids = [4]

====================================================================================

UMI info for barcode TACTCATTCCTCCTAG-1 contig 1 = AGTCAGACTC...
umi GTATCCCCCT = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
412-497 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNSYALSF at 351, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 24, 30, 86, 99, 235, 238, 331, 370, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.766 = TACTCATTCGCCTGTT-1

using 384 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[7, 127, 248]
surviving nonsolo ucounts = 2[127, 248]
ids = [2, 4]

====================================================================================

UMI info for barcode TACTCATTCGCCTGTT-1 contig 1 = AGAGCTCTGG...
umi CTAACCCACG = 117 reads: +385 validated

UMI info for barcode TACTCATTCGCCTGTT-1 contig 2 = GTCAGTCCCA...
umi TCTAGTCGGA = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=439]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYGSSPWTF at 368, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 117
start codons at 44, 252, 378
confident = false

TIG 2[bases=547]
0-23 ==> 35-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
23-355 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQHLVTHPISF at 350, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 23, 29, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.769 = TACTCATTCGGTGTTA-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.775 = TACTCATTCTGAGGGA-1

using 910 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[906]
surviving nonsolo ucounts = 1[906]
ids = [1]

====================================================================================

UMI info for barcode TACTCATTCTGAGGGA-1 contig 1 = GAGCTACAAC...
umi ACCACGTAAT = 921 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 120 reads
cdr3 = CQQYYTTPLTF at 369, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 898
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.779 = TACTCATTCTGGAGCC-1

using 326 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[320]
surviving nonsolo ucounts = 1[320]
ids = [6]

====================================================================================

UMI info for barcode TACTCATTCTGGAGCC-1 contig 1 = GGAACTGCTC...
umi TTTTGCACCT = 320 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=546]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRSNWLTF at 352, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 31, 236, 239, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.789 = TACTCATTCTTCGGTC-1

using 610 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 8, 105, 490]
surviving nonsolo ucounts = 2[105, 490]
ids = [2, 0]

====================================================================================

UMI info for barcode TACTCATTCTTCGGTC-1 contig 1 = ACAAGAGGCA...
umi GCTGCACGGT = 99 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=443]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 10 reads
cdr3 = CQSYDSSLSGLYVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 31, 185, 188, 239, 338, 365, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.793 = TACTCATTCTTTAGGG-1

using 157 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 146]
surviving nonsolo ucounts = 1[146]
ids = [3]

====================================================================================

UMI info for barcode TACTCATTCTTTAGGG-1 contig 1 = GTCTCAGGAG...
umi GTGCACGTTT = 146 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=529]
0-35 ==> 6-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
35-389 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-529 ==> 0-103 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CSSYTSSSTLGVF at 359, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 35, 192, 236, 243
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.796 = TACTCGCAGAATTGTG-1

using 793 reads

====================================================================================

graph has 278 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 7[2, 5, 8, 9, 13, 349, 399]
surviving nonsolo ucounts = 2[349, 399]
ids = [12, 13]

====================================================================================

UMI info for barcode TACTCGCAGAATTGTG-1 contig 1 = GGAGGAACTG...
umi GTTGTGTCTG = 349 reads: +385 validated
umi TCAACCTAGT = 395 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 111 reads
cdr3 = CQHYHNWPPITF at 355, score = 9 + 8
umis assigned: [12, 13]
of which 2 are surviving nonsolos
reads assigned: 738
start codons at 34, 103, 176, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.801 = TACTCGCAGAGCTGCA-1

using 986 reads

====================================================================================

graph has 476 edges initially, 54 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4, 133, 201, 289, 352]
surviving nonsolo ucounts = 4[133, 201, 289, 352]
ids = [9, 4, 6, 5]

====================================================================================

UMI info for barcode TACTCGCAGAGCTGCA-1 contig 1 = AGGAGTCAGA...
umi CTGATCCCAG = 268 reads: +119 -1XX +30 -1XX +2 -1XX +3 -1XX +230 invalidated

UMI info for barcode TACTCGCAGAGCTGCA-1 contig 2 = AGGAGTCAGA...
umi TCGTCCATCT = 114 reads: +275 -1XX +112 invalidated

UMI info for barcode TACTCGCAGAGCTGCA-1 contig 3 = GGGAGTCAGT...
umi CCGTATCTAC = 315 reads: +388 validated

UMI info for barcode TACTCGCAGAGCTGCA-1 contig 4 = GGGGATCTCA...
umi CATACGGCCT = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=23)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNTYIWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 102, 240, 457
confident = false

TIG 2[bases=499]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYNSYSYTF at 354, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 27, 33, 89, 102, 334, 457
confident = false

TIG 3[bases=499]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSTPFTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 4[bases=542]
39-393 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=6)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-542 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSSTFLF at 363, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 39, 240, 247
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.805 = TACTCGCAGCCGCCTA-1

using 1003 reads

====================================================================================

graph has 914 edges initially, 16 edges after simplification

total ucounts = 265
nonsolo ucounts = 91[2^27, 3^19, 4^8, 5^9, 6^4, 7^5, 8^4, 9^3, 10^3, 11, 12, 13^4, 14, 20, 384]
surviving nonsolo ucounts = 1[384]
ids = [135]

====================================================================================

UMI info for barcode TACTCGCAGCCGCCTA-1 contig 1 = GAAGAGCTGC...
umi CTTGGGTCTA = 386 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [135]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.808 = TACTCGCAGCGATTCT-1

using 264 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 251]
surviving nonsolo ucounts = 1[251]
ids = [4]

====================================================================================

UMI info for barcode TACTCGCAGCGATTCT-1 contig 1 = AGTGACTCCT...
umi CACCTCGCTC = 248 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=539]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-539 ==> 0-86 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.811 = TACTCGCAGGACAGAA-1

using 412 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 7, 12, 383]
surviving nonsolo ucounts = 1[383]
ids = [0]

====================================================================================

UMI info for barcode TACTCGCAGGACAGAA-1 contig 1 = GGCAGAGCCC...
umi ATAACTGGGT = 385 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=1)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQRSNWPLTF at 368, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 382
start codons at 47, 255, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.812 = TACTCGCAGGACTGGT-1

using 115 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 1[115]
ids = [0]

====================================================================================

UMI info for barcode TACTCGCAGGACTGGT-1 contig 1 = GAGTGCTTTC...
umi GTCTGTACTG = 107 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=509]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-509 ==> 0-40 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 107
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_90.812_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.813 = TACTCGCAGGAGTACC-1

using 1116 reads

====================================================================================

graph has 1536 edges initially, 30 edges after simplification

total ucounts = 442
nonsolo ucounts = 193[2^62, 3^42, 4^36, 5^11, 6^9, 7^8, 8^4, 9^6, 10^2, 11, 12^3, 13^2, 14^2, 15, 16, 17, 23, 30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.815 = TACTCGCAGGCAAAGA-1

using 509 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[201, 305]
surviving nonsolo ucounts = 2[201, 305]
ids = [1, 2]

====================================================================================

UMI info for barcode TACTCGCAGGCAAAGA-1 contig 1 = ACCCAAAAAC...
umi CGCTCGTCCT = 191 reads: +436 validated
umi TACTGTTTCC = 294 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=540]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-540 ==> 0-50 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 36 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 481
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.824 = TACTCGCAGTAACCCT-1

using 413 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^3, 4, 6, 9, 382]
surviving nonsolo ucounts = 1[382]
ids = [10]

====================================================================================

UMI info for barcode TACTCGCAGTAACCCT-1 contig 1 = AGAAGAGCTG...
umi GACTTAGCCT = 343 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-507 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGSSYTF at 358, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 34, 242, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.825 = TACTCGCAGTACACCT-1

using 144 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 11, 128]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.830 = TACTCGCAGTCAAGCG-1

using 324 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 5^2, 308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode TACTCGCAGTCAAGCG-1 contig 1 = AGCTACAACA...
umi CACCTATACG = 298 reads: +282 -5X +113 invalidated

GOOD CONTIGS

TIG 1[bases=503]
0-29 ==> 146-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
29-392 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-503 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYSSPLTF at 368, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 29, 98, 351, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.832 = TACTCGCAGTCGATAA-1

using 311 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 298]
surviving nonsolo ucounts = 1[298]
ids = [3]

====================================================================================

UMI info for barcode TACTCGCAGTCGATAA-1 contig 1 = GAGGAGTCAG...
umi CTTCTTTCCT = 278 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=508]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-508 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 28, 34, 90, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.836 = TACTCGCAGTGGACGT-1

using 317 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[10, 302]
surviving nonsolo ucounts = 1[302]
ids = [6]

====================================================================================

UMI info for barcode TACTCGCAGTGGACGT-1 contig 1 = GGGGATCAGT...
umi TTAATCTATT = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.843 = TACTCGCCAACTGGCC-1

using 1082 reads

====================================================================================

graph has 342 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 298, 780]
surviving nonsolo ucounts = 2[298, 780]
ids = [4, 2]

====================================================================================

UMI info for barcode TACTCGCCAACTGGCC-1 contig 1 = GGGGAGGAAC...
umi TAGTGTGGCT = 780 reads: +382 validated
umi TTGACTCTTT = 299 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 171 reads
cdr3 = CQQYNNWPLTF at 357, score = 9 + 9
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 1063
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.850 = TACTCGCCAATGAAAC-1

using 340 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3^3, 327]
surviving nonsolo ucounts = 1[327]
ids = [2]

====================================================================================

UMI info for barcode TACTCGCCAATGAAAC-1 contig 1 = GGAATCAGTC...
umi CATAAAACTA = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.854 = TACTCGCCACAAGACG-1

using 33 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3^2, 5, 7, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.861 = TACTCGCCACTTCTGC-1

using 343 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[340]
surviving nonsolo ucounts = 1[340]
ids = [1]

====================================================================================

UMI info for barcode TACTCGCCACTTCTGC-1 contig 1 = AATCAGTCCC...
umi CGTATAACTC = 341 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.873 = TACTCGCCATATACCG-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.879 = TACTCGCCATGCTAGT-1

using 1357 reads

====================================================================================

graph has 1944 edges initially, 26 edges after simplification

total ucounts = 593
nonsolo ucounts = 267[2^105, 3^65, 4^27, 5^22, 6^15, 7^8, 8^7, 9^6, 10^2, 11, 12^4, 13, 14^3, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.883 = TACTCGCCATTAGGCT-1

using 203 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6, 7, 186]
surviving nonsolo ucounts = 1[186]
ids = [5]

====================================================================================

UMI info for barcode TACTCGCCATTAGGCT-1 contig 1 = AAAAACCACA...
umi TAGGCATAGC = 166 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=543]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-543 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.898 = TACTCGCGTCGAGATG-1

using 44 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[44]
surviving nonsolo ucounts = 1[44]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.903 = TACTCGCGTGAAAGAG-1

using 321 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 317]
surviving nonsolo ucounts = 1[317]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.905 = TACTCGCGTGATGTCT-1

using 19 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.907 = TACTCGCGTGCCTGTG-1

using 83 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 15[2^5, 3^2, 4, 6^3, 8, 9, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.914 = TACTCGCGTTCCCTTG-1

using 32 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[32]
surviving nonsolo ucounts = 1[32]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.920 = TACTCGCGTTTAAGCC-1

using 957 reads

====================================================================================

graph has 1332 edges initially, 14 edges after simplification

total ucounts = 475
nonsolo ucounts = 179[2^85, 3^28, 4^21, 5^17, 6^10, 7^5, 8^5, 9^3, 10, 12, 16^2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.927 = TACTCGCTCAAGCCTA-1

using 1008 reads

====================================================================================

graph has 1502 edges initially, 12 edges after simplification

total ucounts = 498
nonsolo ucounts = 216[2^98, 3^53, 4^27, 5^12, 6^9, 7^7, 8^4, 9^2, 10^2, 12, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.931 = TACTCGCTCACCATAG-1

using 372 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[365]
surviving nonsolo ucounts = 1[365]
ids = [5]

====================================================================================

UMI info for barcode TACTCGCTCACCATAG-1 contig 1 = GGGGAGTTCA...
umi CTCAACAAGC = 345 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=493]
20-380 ==> 0-360 on |277|IGKV2D-30|L-REGION+V-REGION| [len=360] (mis=5)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-493 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CMQGTLRLTF at 356, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 20, 53, 81, 89, 177, 339, 359, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.938 = TACTCGCTCAGTGTTG-1

using 175 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 168]
surviving nonsolo ucounts = 1[168]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=486]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-486 ==> 12-42 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 54, 252, 257, 274, 318, 351
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.939 = TACTCGCTCAGTTGAC-1

using 570 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 8, 553]
surviving nonsolo ucounts = 1[553]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.940 = TACTCGCTCATAACCG-1

using 1214 reads

====================================================================================

graph has 328 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[9, 405, 795]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.941 = TACTCGCTCATGGTCA-1

using 23 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.953 = TACTCGCTCCGCAGTG-1

using 51071 reads

====================================================================================

graph has 21410 edges initially, 226 edges after simplification

total ucounts = 3273
nonsolo ucounts = 1350[2^538, 3^254, 4^140, 5^94, 6^57, 7^27, 8^32, 9^11, 10^14, 11^10, 12^7, 13^4, 14^3, 15^5, 16, 17, 19^3, 20, 21, 22, 25, 36, 37, 40, 41, 49, 52, 53, 65, 69, 74, 80, 86, 87, 96^2, 113, 114, 117, 121, 129, 133, 134, 135, 141, 144, 147, 156, 158, 167, 173, 179^2, 183, 187, 200, 207, 213, 217, 220, 226, 228, 235, 236, 239, 242, 243, 247, 250, 253, 259^2, 274, 278, 283^2, 291, 292, 295, 299, 304, 305^2, 313^2, 314, 316, 320, 321, 324, 326^3, 327, 328, 331^2, 335, 336^2, 337^2, 339, 341, 343, 349, 352, 353, 354, 356, 357, 358, 360^4, 362, 363^2, 365^2, 368, 369^3, 371, 377^2, 381^2, 385, 387, 390, 392^2, 394, 396, 397, 398, 403, 404, 405^2, 408^2, 409, 411^3, 423, 428, 443, 447, 476^2, 506, 507, 549, 569, 570, 656, 701, 738, 749, 764, 829]
surviving nonsolo ucounts = 135[2^4, 3, 37, 41, 49, 52, 80, 87, 113, 121, 129, 134, 144, 147, 156, 158, 167, 173, 179^2, 187, 200, 207, 213, 217, 220, 226, 228, 235, 236, 239, 242, 243, 247, 250, 253, 259^2, 274, 278, 283^2, 291, 292, 295, 299, 304, 305^2, 313^2, 314, 316, 320, 321, 324, 326^3, 327, 328, 331^2, 335, 336^2, 337^2, 339, 341, 343, 349, 352, 353, 354, 356, 357, 358, 360^4, 362, 363^2, 365^2, 368, 369^3, 371, 377^2, 381^2, 385, 387, 390, 392^2, 394, 396, 397, 398, 403, 404, 405^2, 408^2, 409, 411^3, 423, 428, 443, 447, 476^2, 506, 507, 549, 569, 570, 656, 701, 738, 749, 764, 829]
ids = [1407, 2464, 2473, 3189, 308, 2835, 1753, 2531, 565, 1371, ...]

====================================================================================

UMI info for barcode TACTCGCTCCGCAGTG-1 contig 1 = AGAGCTCTGG...
umi AAAAGCCTGG = 165 reads: +183 -1XX +201 invalidated
umi AACCCGGCCA = 361 reads: +385 validated
umi AACTCTGGCG = 302 reads: +385 validated
umi AACTGTTTAG = 370 reads: +385 validated
umi AAGAATTTCC = 245 reads: +385 validated
umi AAGATTGACT = 286 reads: +385 validated
umi AAGCAGTTCT = 831 reads: +385 validated
umi AAGGTGTCCT = 392 reads: +385 validated
umi AATGTCAGTA = 746 reads: +385 validated
umi ACAAACGTAC = 313 reads: +385 validated
umi ACAACTCTTT = 314 reads: +385 validated
umi ACACACATCA = 415 reads: +385 validated
umi ACATACCCTG = 389 reads: +385 validated
umi ACATGATGCC = 255 reads: +385 validated
umi ACCAGCACTA = 356 reads: +385 validated
umi ACCGTCTAGG = 413 reads: +385 validated
umi ACCTTCGTTC = 333 reads: +385 validated
umi ACCTTGACAA = 427 reads: +385 validated
umi ACGCAATCCC = 126 reads: +385 validated
umi ACGCTTCTCT = 357 reads: +385 validated
umi ACGTGGCTAC = 4 reads: -354 +14 -5XX +7 -1XX +4 invalidated
umi ACTACTTACC = 360 reads: +385 validated
umi ACTAGATCCT = 318 reads: +385 validated
umi ACTTCCCTCC = 338 reads: +385 validated
umi AGCAAACTTT = 339 reads: +385 validated
umi AGCACCAACT = 374 reads: +385 validated
umi AGCGAATATC = 416 reads: +385 validated
umi ATACAACCGA = 206 reads: +385 validated
umi ATATCACGGC = 353 reads: +385 validated
umi ATCCTTTCAC = 261 reads: +385 validated
umi ATTTCACGTT = 392 reads: +385 validated
umi CAAAGTCCGC = 182 reads: +385 validated
umi CAACGCAGCC = 510 reads: +385 validated
umi CAACGGTTCG = 326 reads: +385 validated
umi CACAAACACT = 339 reads: +385 validated
umi CACTAATCTA = 692 reads: -122X +263 invalidated
umi CACTACACGT = 376 reads: +385 validated
umi CATTGCCGTC = 306 reads: +385 validated
umi CCACCTCCGG = 377 reads: +385 validated
umi CCATAGTTAC = 393 reads: +385 validated
umi CCTGAAGAGT = 324 reads: -17X +1 -2X +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +339 invalidated
umi CCTTAGCCAG = 409 reads: +385 validated
umi CGGATATACT = 247 reads: +385 validated
umi CGTACGTGCT = 339 reads: +385 validated
umi CGTTCTTGAA = 363 reads: +385 validated
umi CTAAATGGGT = 395 reads: +385 validated
umi CTATGTCGGG = 234 reads: +385 validated
umi CTCGAGTCAT = 261 reads: +385 validated
umi CTCTAGGCCT = 360 reads: +385 validated
umi CTGGCAGCCT = 408 reads: +385 validated
umi CTTAGCTCTT = 352 reads: +385 validated
umi CTTATTTTTC = 374 reads: +385 validated
umi CTTCAAGTCT = 366 reads: +385 validated
umi CTTGAACGAT = 228 reads: +385 validated
umi CTTTGCTAGA = 360 reads: +385 validated
umi GAATGCTACT = 407 reads: +385 validated
umi GACACTCCTG = 739 reads: +385 validated
umi GAGGAGTTGC = 482 reads: +385 validated
umi GAGGATTGGA = 479 reads: +385 validated
umi GATCGACCTC = 389 reads: +385 validated
umi GATTAACGTA = 391 reads: +385 validated
umi GCACTTACTG = 363 reads: -32X +1 -2X +1 -1XX +1 -5XX +2 -1XX +339 invalidated
umi GCAGTGGGTC = 559 reads: -248X +137 invalidated
umi GCCCAGCTCT = 391 reads: +385 validated
umi GCCGGCCTGT = 315 reads: +385 validated
umi GCGCGTCTCC = 661 reads: +385 validated
umi GCTCGATGGG = 292 reads: +385 validated
umi GCTGACTCGG = 172 reads: +385 validated
umi GGAACTCGGT = 295 reads: +385 validated
umi GGCAATGCTA = 431 reads: +385 validated
umi GGCGTCGTCG = 135 reads: +385 validated
umi GGGATAAGGC = 407 reads: +385 validated
umi GGTCTGGGAC = 563 reads: -246X +1 -6XX +132 invalidated
umi GTATTTAGCT = 314 reads: +385 validated
umi GTCTGATCGC = 359 reads: +385 validated
umi GTGTAAGTAG = 296 reads: +385 validated
umi GTTCAAATCA = 451 reads: +385 validated
umi GTTGGCACCC = 373 reads: +385 validated
umi TACATCGGAC = 410 reads: +385 validated
umi TACGGTACAG = 403 reads: +385 validated
umi TACTTGCCTT = 321 reads: +385 validated
umi TATCCCAACT = 367 reads: +385 validated
umi TCATTAGTTC = 441 reads: +385 validated
umi TCCAACGATT = 244 reads: +385 validated
umi TCCAAGTAGC = 353 reads: +385 validated
umi TCGCAAGCCG = 375 reads: +385 validated
umi TGATAGTGCA = 417 reads: +60 -1XX +324 invalidated
umi TGGATATTAG = 150 reads: +8 -1 +376 non-validated
umi TGGCCGTATC = 328 reads: +385 validated
umi TTAATCGAAT = 288 reads: +385 validated
umi TTAATTCGAT = 358 reads: +385 validated
umi TTACTACCGC = 372 reads: +385 validated
umi TTAGGGCTGC = 329 reads: +385 validated
umi TTATTTACAC = 403 reads: +385 validated
umi TTCACTATAT = 364 reads: +385 validated
umi TTCAGCAGCT = 330 reads: +385 validated
umi TTCTGATAAG = 338 reads: +385 validated
umi TTGTCACAAA = 360 reads: +385 validated
umi TTTCTCATGA = 341 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 98 umis using 5383 reads
cdr3 = CQQYGSSLTTF at 368, score = 9 + 8
umis assigned: [5, 75, 97, 103, 112, 122, 125, 143, 187, 224] and 89 others
of which 99 are surviving nonsolos
reads assigned: 35122
start codons at 44, 252, 378, 471
confident = true

REJECT CONTIGS

TIG 1[bases=305]
0-84 ==> 268-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=0)
82-133 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
133-305 ==> 0-172 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
umis assigned: [2531, 2835]
of which 2 are surviving nonsolos
reads assigned: 33
start codons at 77, 257, 295
confident = false
did not find CDR3

TIG 2[bases=585]
3-30 ==> 5570-5597 on segment before IGLV3-29 exon 1 [len=6000] (mis=0)
55-87 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
82-422 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
418-456 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
456-585 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [412, 447, 471, 680, 872, 2652, 2736, 3075]
of which 8 are surviving nonsolos
reads assigned: 344
start codons at 82, 87, 143, 230, 376, 380
confident = false
did not find CDR3

TIG 3[bases=358]
38-195 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
193-256 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
256-358 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [52, 261, 651, 1371, 1650, 1698, 2187]
of which 7 are surviving nonsolos
reads assigned: 831
start codons at 45, 79, 118, 173, 213, 274, 335
confident = false
did not find CDR3

TIG 4[bases=682]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
0-79 ==> 7407-7486 on rc of segment before IGHV1-24 exon 2 [len=7486] (mis=0)
43-90 ==> 3154-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=6)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=17)
454-500 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=7)
500-682 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CAKKVENRQLVPNDYWGQGILVAVSSASTKGPSVFPLAPSSKSTSGGTAALGCLVKDYFPEPVTVSWNSGALTS at 421, score = 8 + 5
umis assigned: [565, 625, 669, 674, 762, 1753, 1782, 1874, 2214, 2620] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2440
start codons at 79, 230, 235, 382, 458
confident = false
full length transcript of length 682
VJ delta = 180
delta too large
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.954 = TACTCGCTCCGCGCAA-1

using 308 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 298]
surviving nonsolo ucounts = 1[298]
ids = [5]

====================================================================================

UMI info for barcode TACTCGCTCCGCGCAA-1 contig 1 = AGGAGTCAGT...
umi TCCATAGGGG = 299 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQSYSTPSF at 354, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 27, 33, 89, 102, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.960 = TACTCGCTCGAGCCCA-1

using 243 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [5]

====================================================================================

UMI info for barcode TACTCGCTCGAGCCCA-1 contig 1 = GGCTGGGGTC...
umi TTCATCGGAC = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=597]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-391 ==> 0-349 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=22)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
430-597 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYADSYRLLF at 366, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.981 = TACTCGCTCTGGTTCC-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.991 = TACTTACAGAAGAAGC-1

using 444 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 5, 6, 12, 415]
surviving nonsolo ucounts = 1[415]
ids = [7]

====================================================================================

UMI info for barcode TACTTACAGAAGAAGC-1 contig 1 = GAGGAATCAG...
umi TATCTCAGTT = 415 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 408
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.992 = TACTTACAGAAGGCCT-1

using 44 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 9[2^6, 3, 4, 6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.997 = TACTTACAGAGTCGGT-1

using 243 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [1]

====================================================================================

UMI info for barcode TACTTACAGAGTCGGT-1 contig 1 = GGAGTCAGAC...
umi CTCTTGTGTC = 225 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=497]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CHQYNSYSTF at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 26, 32, 88, 101, 237, 240, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1007 = TACTTACAGCGAAGGG-1

using 1256 reads

====================================================================================

graph has 1556 edges initially, 12 edges after simplification

total ucounts = 467
nonsolo ucounts = 209[2^86, 3^43, 4^28, 5^16, 6^11, 7^10, 8^3, 9^5, 10, 11^2, 12, 14^2, 228]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1015 = TACTTACAGCTGATAA-1

using 782 reads

====================================================================================

graph has 274 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 12[2^2, 3, 4^4, 6, 7, 10, 29, 702]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1018 = TACTTACAGGATCGCA-1

using 303 reads

====================================================================================

graph has 151 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[5, 8, 9, 275]
surviving nonsolo ucounts = 1[275]
ids = [8]

====================================================================================

UMI info for barcode TACTTACAGGATCGCA-1 contig 1 = CTGGGCCTCA...
umi TGTACTACCT = 267 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=567]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-567 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQAWDSSTAVF at 352, score = 6 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1026 = TACTTACAGTACGCGA-1

using 267 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1030 = TACTTACAGTCCAGGA-1

using 184 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 7, 171]
surviving nonsolo ucounts = 1[171]
ids = [3]

====================================================================================

UMI info for barcode TACTTACAGTCCAGGA-1 contig 1 = AGTGCTTTCT...
umi TCCATAGGCT = 170 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=585]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-585 ==> 0-108 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1039 = TACTTACCAAAGTCAA-1

using 185 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 177]
surviving nonsolo ucounts = 1[177]
ids = [1]

====================================================================================

UMI info for barcode TACTTACCAAAGTCAA-1 contig 1 = GGGGGACTCC...
umi ATCATTCCTG = 172 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=530]
21-371 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
402-454 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
454-530 ==> 0-76 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 366, score = 8 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 21, 65, 244, 327
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1041 = TACTTACCAACTGGCC-1

using 297 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode TACTTACCAACTGGCC-1 contig 1 = TGGGGGCTTT...
umi GCCTTCGCTA = 293 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=565]
40-177 ==> 0-137 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=24)
177-303 ==> 140-266 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=29)
424-470 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
470-565 ==> 0-95 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 379, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 40, 84, 349
confident = false
see deletion of 3 bases at pos 137 on |192|IGHV4-4|L-REGION+V-REGION|
>vscore_90.1041_77.4%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGAGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1046 = TACTTACCAATGGACG-1

using 1768 reads

====================================================================================

graph has 670 edges initially, 6 edges after simplification

total ucounts = 18
nonsolo ucounts = 13[2^2, 4, 5, 6^2, 8, 11, 64, 188, 203, 226, 1038]
surviving nonsolo ucounts = 5[64, 188, 203, 226, 1038]
ids = [9, 13, 3, 14, 0]

====================================================================================

UMI info for barcode TACTTACCAATGGACG-1 contig 1 = AGCTCTGAGA...
umi ACTAAACATG = 201 reads: +424 validated
umi TAGCTTTGTT = 186 reads: +424 validated
umi TGATGTTAAA = 224 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=541]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-541 ==> 0-38 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 3 umis using 60 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3, 13, 14]
of which 3 are surviving nonsolos
reads assigned: 598
start codons at 79, 230, 235, 382, 460
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1048 = TACTTACCACACGCTG-1

using 278 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode TACTTACCACACGCTG-1 contig 1 = GAAGAGCTGC...
umi ACCAAGCTAT = 277 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQLYGTSLFTF at 357, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1055 = TACTTACCACGGATAG-1

using 225 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [1]

====================================================================================

UMI info for barcode TACTTACCACGGATAG-1 contig 1 = GTCAGTCCCA...
umi AGCTCATTCG = 219 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1068 = TACTTACCATACTACG-1

using 717 reads

====================================================================================

graph has 286 edges initially, 12 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 353, 355]
surviving nonsolo ucounts = 2[353, 355]
ids = [5, 0]

====================================================================================

UMI info for barcode TACTTACCATACTACG-1 contig 1 = GAGTCAGTCT...
umi GGTACCTTCG = 361 reads: +388 validated

UMI info for barcode TACTTACCATACTACG-1 contig 2 = GATCAGGACT...
umi AGTCATTGCA = 360 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQSYSTPRTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 25, 31, 87, 100, 236, 455
confident = false

TIG 2[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CMQALQTPRFTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 90.1073 = TACTTACCATGGAATA-1

using 263 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 258]
surviving nonsolo ucounts = 1[258]
ids = [1]

====================================================================================

UMI info for barcode TACTTACCATGGAATA-1 contig 1 = AGTCAGACCC...
umi CCCTTCTCGC = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-30 ==> 23-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
30-375 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
384-412 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSYPRTF at 351, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 24, 30, 86, 99, 235, 454
confident = false
NOT paired!
sorting bam, mem = 0.14
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk090-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk090-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

63.838 seconds used processing barcodes, peak mem = 0.31
