[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.37 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk088-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk088-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk088.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.0 = TACAGTGTCGCCAAAT-1

using 6194 reads

====================================================================================

graph has 3667 edges initially, 60 edges after simplification

total ucounts = 667
nonsolo ucounts = 321[2^123, 3^56, 4^44, 5^28, 6^13, 7^12, 8^9, 9^5, 10^3, 11^3, 12, 13^3, 15, 17, 20, 45, 124, 155, 169, 189, 199, 201, 202, 225, 238^2, 252, 258, 326, 340, 351, 464, 697]
surviving nonsolo ucounts = 18[45, 124, 155, 169, 189, 199, 201, 202, 225, 238^2, 252, 258, 326, 340, 351, 464, 697]
ids = [78, 11, 67, 607, 16, 207, 473, 494, 10, 398, ...]

====================================================================================

UMI info for barcode TACAGTGTCGCCAAAT-1 contig 1 = AGCTTCAGCT...
umi AACATTTTAA = 228 reads: +391 validated
umi ACTCGCCCTC = 151 reads: +391 validated
umi AGAGACGTTT = 45 reads: +391 validated
umi CCAGAGACGC = 193 reads: +391 validated
umi CCTACTGCAT = 259 reads: +391 validated
umi CTTAGCTCCT = 327 reads: +391 validated
umi GCTCTACCAA = 239 reads: +391 validated
umi GTTTTATACG = 199 reads: +391 validated
umi TACGCACCCG = 204 reads: +391 validated
umi TCGGAACTGC = 242 reads: +391 validated
umi TGTATTCCCG = 169 reads: +391 validated

UMI info for barcode TACAGTGTCGCCAAAT-1 contig 2 = GCTTTCTGAG...
umi ACCTTATCCT = 351 reads: +418 validated
umi TCCATTTCCC = 274 reads: +418 validated
umi TGGTCTTCCG = 202 reads: +418 validated
umi TTATTCCCCT = 693 reads: -251X +167 invalidated
umi TTTGAAGCTC = 370 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=648]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
399-437 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
437-648 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 321 reads
cdr3 = CAAWDDSLSGPWVF at 367, score = 7 + 8
umis assigned: [10, 67, 78, 207, 226, 319, 398, 473, 494, 559] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2221
start codons at 46, 200, 350, 375, 380
confident = true

TIG 2[bases=555]
35-380 ==> 0-345 on |742|IGHV4-38-2|L-REGION+V-REGION| [len=345] (mis=1)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-555 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 171 reads
cdr3 = CARDTGAIVGAFDYW at 377, score = 9 + 7
umis assigned: [53, 544, 601, 624, 657]
of which 5 are surviving nonsolos
reads assigned: 1866
start codons at 14, 35, 79, 471, 532
confident = true

REJECT CONTIGS

TIG 1[bases=642]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
13-67 ==> 5937-5991 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
22-88 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=4)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
431-642 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [11, 16]
of which 2 are surviving nonsolos
reads assigned: 306
start codons at 41, 180, 242, 249, 375
confident = false
did not find CDR3
now this is a cell
paired!

GCCGCAGACACGGCCGTGTATTACTGTGCGAGAGATACAGGCGCGATAGTGGGAGCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCCTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.5 = TACAGTGTCGTCTGAA-1

using 43 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[41]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.7 = TACAGTGTCTACTTAC-1

using 411 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[409]
surviving nonsolo ucounts = 1[409]
ids = [2]

====================================================================================

UMI info for barcode TACAGTGTCTACTTAC-1 contig 1 = GGAGTCAGTC...
umi TTAGGGTCGT = 406 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=24)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYDDLPITF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 26, 32, 88, 101, 363, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.9 = TACAGTGTCTCGCTTG-1

using 313 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode TACAGTGTCTCGCTTG-1 contig 1 = GCTGGGGTCT...
umi CTACCTTTTG = 302 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=560]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-393 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
432-560 ==> 0-128 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CSSYTSSSTPYVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 41, 198, 242, 249, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.12 = TACAGTGTCTGCAAGT-1

using 251 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode TACAGTGTCTGCAAGT-1 contig 1 = GTGGGCTCAG...
umi TCACGTGGTT = 242 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=571]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=1)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
417-571 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CYSTDSSGNHGVF at 350, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 35, 96, 165, 183, 234, 296, 333, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.13 = TACAGTGTCTGCGGCA-1

using 152 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[152]
surviving nonsolo ucounts = 1[152]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGTCTGCGGCA-1 contig 1 = GGCTGGGGTC...
umi GCCTCTTCCT = 145 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-370 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
430-584 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CSSVAGSYSLVF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 42, 181, 199, 250, 253, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.17 = TACCTATAGAATGTTG-1

using 204 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[5, 193]
surviving nonsolo ucounts = 1[193]
ids = [7]

====================================================================================

UMI info for barcode TACCTATAGAATGTTG-1 contig 1 = AGTCTCAGTC...
umi GTTATTCCAT = 174 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-20 ==> 27-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
20-359 ==> 0-339 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
408-501 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQESKTFTRTF at 347, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.22 = TACCTATAGAGGGATA-1

using 229 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode TACCTATAGAGGGATA-1 contig 1 = GCTGGGGTCA...
umi CTCATGTCTT = 215 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=479]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
417-479 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CCSYAAVF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 41, 180, 242, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.39 = TACCTATAGGAGTAGA-1

using 322 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 8, 305]
surviving nonsolo ucounts = 1[305]
ids = [5]

====================================================================================

UMI info for barcode TACCTATAGGAGTAGA-1 contig 1 = GAGTCAGACC...
umi GCATGGGTTT = 310 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 22-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
31-376 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
385-413 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYYSYPRTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.43 = TACCTATAGGCCCTCA-1

using 8085 reads

====================================================================================

graph has 4323 edges initially, 52 edges after simplification

total ucounts = 861
nonsolo ucounts = 404[2^159, 3^90, 4^46, 5^27, 6^27, 7^15, 8^7, 9^5, 10^4, 11^2, 12, 16, 24, 87, 175, 206, 233, 238, 245, 255, 256, 266, 270, 271, 282, 293, 303, 306, 307, 310, 888, 1047]
surviving nonsolo ucounts = 19[87, 175, 206, 233, 238, 245, 255, 256, 266, 270, 271, 282, 293, 303, 306, 307, 310, 888, 1047]
ids = [650, 802, 717, 360, 146, 31, 113, 39, 796, 97, ...]

====================================================================================

UMI info for barcode TACCTATAGGCCCTCA-1 contig 1 = CTGGGCCTCA...
umi AACTATACAA = 271 reads: +376 validated
umi AATCTAACAG = 245 reads: +376 validated
umi ACAATTATCA = 254 reads: +376 validated
umi AGACCCTCCT = 270 reads: +376 validated
umi AGTAGTGCTT = 260 reads: +376 validated
umi ATATGAGAAC = 237 reads: +376 validated
umi ATCCTTTTGC = 850 reads: -327 +1 -10XX +1 -2XX +3 -1XX +17 -1XX +13 invalidated
umi CCACATGCAA = 308 reads: +376 validated
umi CCCAGCAGTG = 1056 reads: -327 +1 -10XX +1 -2XX +3 -1XX +17 -1XX +13 invalidated
umi CGCATTCCAG = 231 reads: +376 validated
umi CGTGCCACAG = 292 reads: +376 validated
umi CTTTATGGGG = 276 reads: +376 validated
umi TCCCCGGTCC = 307 reads: +376 validated
umi TCCTCGATAG = 302 reads: +376 validated
umi TCTTTACCCT = 208 reads: +376 validated
umi TTCATCCTCT = 265 reads: +376 validated
umi TTCCATGTTG = 173 reads: +376 validated

UMI info for barcode TACCTATAGGCCCTCA-1 contig 2 = GAGCATCACC...
umi CCCAGTCCTT = 242 reads: +436 validated
umi TCACTGCCCA = 86 reads: +361 -1X +74 invalidated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=15)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 15 umis using 685 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [16, 31, 39, 97, 113, 146, 164, 271, 278, 360] and 7 others
of which 17 are surviving nonsolos
reads assigned: 5686
start codons at 37, 42, 98, 185, 236, 331, 335
confident = true

TIG 2[bases=519]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=16)
442-498 ==> 7-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
498-519 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 33 reads
cdr3 = CARDRAETSSVGFYYYGVDVW at 404, score = 8 + 7
umis assigned: [280, 650]
of which 2 are surviving nonsolos
reads assigned: 326
start codons at 62, 260, 265, 344, 359
confident = true
now this is a cell
paired!

TATTATTGTGCGAGAGATCGGGCGGAGACCAGCTCGGTGGGTTTCTACTACTACGGTGTGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAAGGTGACTATTACTGTCAGGCGTGGGACAGTAGCACTGTGGTATTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.44 = TACCTATAGGCTAGGT-1

using 384 reads

====================================================================================

graph has 265 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[9, 161, 208]
surviving nonsolo ucounts = 2[161, 208]
ids = [8, 7]

====================================================================================

UMI info for barcode TACCTATAGGCTAGGT-1 contig 1 = GGAGTCAGTC...
umi TTTTCATTGC = 138 reads: +388 validated

UMI info for barcode TACCTATAGGCTAGGT-1 contig 2 = AGCTCTGAGA...
umi TCATATCGGG = 211 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=478]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false

TIG 2[bases=571]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=18)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAKGSAASRPYYFDYW at 421, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 79, 230, 235, 293, 296, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.45 = TACCTATAGGGAAACA-1

using 302 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode TACCTATAGGGAAACA-1 contig 1 = AGGAACTGCT...
umi TTAGGTCATC = 276 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-32 ==> 65-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-502 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNNWPPITF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 32, 101, 237, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.51 = TACCTATAGTTTCCTT-1

using 46 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 9[2^3, 3^2, 4^2, 9, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.53 = TACCTATCAAATCCGT-1

using 526 reads

====================================================================================

graph has 218 edges initially, 18 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 192, 325]
surviving nonsolo ucounts = 2[192, 325]
ids = [3, 6]

====================================================================================

UMI info for barcode TACCTATCAAATCCGT-1 contig 1 = GGAGGAGTCA...
umi GCTTTCGCTA = 55 reads: +61 -1XX +5 -1XX +21 -2XX +2 -1XX +14 -1XX +1 -1XX +7 -2XX +3 -1 +1 -195 +2 -1X +3 -1XX +2 -1XX +1 -1XX +3 -2XX +2 -1XX +7 -2XX +1 -1XX +1 -1XX +20 -1XX +7 -1XX +6 invalidated
umi TATGCAATCA = 304 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=2)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
417-491 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQDYSYPLTF at 356, score = 9 + 9
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 348
start codons at 29, 35, 91, 104, 186, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.62 = TACCTATCACACTGCG-1

using 62 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[62]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.66 = TACCTATCACCATCCT-1

using 25 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[4, 6, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.69 = TACCTATCACCCTATC-1

using 398 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[9, 108, 277]
surviving nonsolo ucounts = 2[108, 277]
ids = [4, 5]

====================================================================================

UMI info for barcode TACCTATCACCCTATC-1 contig 1 = ATCACCCAAA...
umi TATAAAGGCG = 271 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=516]
0-57 ==> 2-59 on |62|IGHV1-18|5'UTR| [len=59] (mis=0)
57-335 ==> 0-278 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=28)
430-478 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=7)
478-516 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARAGSSSWSAELDSW at 399, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 57, 208, 260, 292, 321
confident = false

REJECT CONTIGS

TIG 1[bases=576]
1-25 ==> 5976-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=0)
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=2)
395-415 ==> 18-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
415-576 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 38, 390
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.75 = TACCTATCACTGTTAG-1

using 223 reads

====================================================================================

graph has 218 edges initially, 10 edges after simplification

total ucounts = 101
nonsolo ucounts = 45[2^20, 3^9, 4^9, 5, 6, 7, 9, 10^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.79 = TACCTATCAGCCACCA-1

using 126 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 116]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.84 = TACCTATCAGGATTGG-1

using 878 reads

====================================================================================

graph has 296 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[7, 14, 221, 303, 329]
surviving nonsolo ucounts = 5[7, 14, 221, 303, 329]
ids = [8, 6, 5, 7, 1]

====================================================================================

UMI info for barcode TACCTATCAGGATTGG-1 contig 1 = ACCCAAAAAC...
umi GAATCGGATA = 214 reads: +436 validated
umi GGCTTAAGTG = 304 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=536]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-536 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 506
start codons at 54, 252, 257, 274, 318, 351
confident = true

REJECT CONTIGS

TIG 1[bases=519]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
10-42 ==> 5623-5655 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
37-375 ==> 0-338 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
376-414 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
414-519 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 37, 42, 98, 185, 331, 335
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.85 = TACCTATCAGGGCATA-1

using 415 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 401]
surviving nonsolo ucounts = 1[401]
ids = [0]

====================================================================================

UMI info for barcode TACCTATCAGGGCATA-1 contig 1 = GACTGATCAG...
umi AAGGGTCACT = 387 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=530]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
431-530 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 54 reads
cdr3 = CMQALQTPHTF at 370, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.101 = TACCTATCATGGTCTA-1

using 2247 reads

====================================================================================

graph has 2960 edges initially, 42 edges after simplification

total ucounts = 783
nonsolo ucounts = 411[2^136, 3^108, 4^63, 5^38, 6^22, 7^19, 8^7, 9^6, 10^3, 11^2, 12, 13^2, 14, 15, 45, 298]
surviving nonsolo ucounts = 1[298]
ids = [677]

====================================================================================

UMI info for barcode TACCTATCATGGTCTA-1 contig 1 = GATCAGGACT...
umi TGCGTGCTCT = 290 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=493]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-493 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [677]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.104 = TACCTATCATTTGCTT-1

using 288 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 276]
surviving nonsolo ucounts = 1[276]
ids = [3]

====================================================================================

UMI info for barcode TACCTATCATTTGCTT-1 contig 1 = GGGGGAGTCA...
umi CCTATCGGCC = 271 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=460]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
420-460 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQSYSTPQITF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 29, 35, 91, 104, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.106 = TACCTATGTAAGTTCC-1

using 238 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 233]
surviving nonsolo ucounts = 1[233]
ids = [2]

====================================================================================

UMI info for barcode TACCTATGTAAGTTCC-1 contig 1 = ATCAGTCCCA...
umi CAGTTCTTCA = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-476 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.107 = TACCTATGTACAAGTA-1

using 730 reads

====================================================================================

graph has 916 edges initially, 16 edges after simplification

total ucounts = 311
nonsolo ucounts = 144[2^54, 3^30, 4^26, 5^7, 6^9, 7^8, 8^3, 11^3, 12^2, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 88.109 = TACCTATGTACGCTGC-1

using 278 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 6, 263]
surviving nonsolo ucounts = 1[263]
ids = [7]

====================================================================================

UMI info for barcode TACCTATGTACGCTGC-1 contig 1 = TCAGACTCAG...
umi TTGTAAGTAC = 253 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=473]
0-22 ==> 159-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
22-373 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-473 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNSYSRYTF at 349, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 22, 28, 84, 97, 233, 236, 329, 455
confident = false
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk088-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk088-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

4.773 seconds used processing barcodes, peak mem = 0.23
