[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.79 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk087-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk087-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk087.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.0 = TAAGTGCTCGTTACAG-1

using 342 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[9, 328]
surviving nonsolo ucounts = 1[328]
ids = [5]

====================================================================================

UMI info for barcode TAAGTGCTCGTTACAG-1 contig 1 = GGGATTCAGT...
umi GGCCTACACC = 333 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=567]
38-393 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
414-465 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
465-567 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CAKDGGIAAAVFNWFDPW at 380, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 38, 183, 189, 194, 273, 341, 390, 483, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.6 = TAAGTGCTCTGCAAGT-1

using 294 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

UMI info for barcode TAAGTGCTCTGCAAGT-1 contig 1 = ATCAGACCCA...
umi ATTACCATCC = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 4-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=4)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNRYPITF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.9 = TAAGTGCTCTGGCGTG-1

using 419 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 411]
surviving nonsolo ucounts = 1[411]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=375]
19-204 ==> 168-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
201-239 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
239-375 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYNTPITF at 178, score = 10 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 407
start codons at 62, 281
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.16 = TACACGAAGACGCTTT-1

using 238 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode TACACGAAGACGCTTT-1 contig 1 = AGCTTCAGCT...
umi TCCAATACAC = 227 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=527]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=3)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-527 ==> 0-92 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CAAWDDSLNGVVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.17 = TACACGAAGACTAAGT-1

using 1559 reads

====================================================================================

graph has 2092 edges initially, 40 edges after simplification

total ucounts = 612
nonsolo ucounts = 303[2^109, 3^59, 4^42, 5^31, 6^19, 7^15, 8^10, 9^5, 10^3, 11^3, 12^2, 13^2, 17, 19, 39]
surviving nonsolo ucounts = 1[39]
ids = [529]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.19 = TACACGAAGAGCTGCA-1

using 8785 reads

====================================================================================

graph has 3219 edges initially, 62 edges after simplification

total ucounts = 389
nonsolo ucounts = 171[2^41, 3^34, 4^23, 5^8, 6^9, 7^12, 8^4, 10, 12^2, 21, 35, 85, 93, 121^2, 128, 134, 137, 143, 175^2, 181, 197, 208, 212, 215, 217, 218, 219, 227, 228, 229, 251, 260, 269, 271, 272, 300, 301, 302, 310, 321, 328, 346, 350, 447]
surviving nonsolo ucounts = 38[7^2, 12, 35, 85, 93, 121^2, 128, 134, 137, 143, 175^2, 181, 197, 208, 212, 215, 217, 218, 219, 227, 228, 229, 251, 260, 269, 271, 272, 300, 301, 302, 310, 328, 346, 350, 447]
ids = [220, 336, 57, 62, 288, 352, 136, 252, 235, 22, ...]

====================================================================================

UMI info for barcode TACACGAAGAGCTGCA-1 contig 1 = AGTGACTCCT...
umi AATATCTGAG = 130 reads: -430 non-validated
umi AGGCCTTGGG = 11 reads: -7 +169 -84 +13 -1 +5 -1 +8 -1 +4 -1 +1 -1 +20 -114 non-validated
umi ATAAACACGA = 1 reads: -409 +20 -1X invalidated
umi GAACATTAGG = 8 reads: -77 +92 -1 +9 -1 +15 -77 +56 -102 non-validated
umi TGCTCCGGGT = 7 reads: -18 +1 -1X +1 -4X +2 -2 +1 -1 +3 -1 +12 -1 +10 -1X +66 -128 +56 -25 +96 invalidated
umi TTACATAGTA = 92 reads: +430 validated
umi TTGTGAGGAT = 171 reads: +430 validated

UMI info for barcode TACACGAAGAGCTGCA-1 contig 2 = GCTGTGCTGT...
umi AATAAACCGC = 231 reads: +376 validated
umi ATACAATCCT = 274 reads: +376 validated
umi ATATGACTAT = 310 reads: +376 validated
umi ATCGGACTTC = 143 reads: +376 validated
umi CACGATAATG = 211 reads: +376 validated
umi CCAGTATTCT = 49 reads: +40 -3X +246 -87 invalidated
umi CCATTCATAT = 446 reads: +376 validated
umi CCGGTATATT = 220 reads: +376 validated
umi GGAAGGTCGT = 125 reads: +376 validated
umi GTACGCCGGT = 119 reads: +376 validated
umi TACACATCGC = 183 reads: +376 validated
umi TATATGGGAG = 85 reads: +376 validated
umi TATCGGGTAA = 230 reads: +376 validated
umi TCACCGTCTT = 219 reads: +376 validated
umi TCCCGCCTAT = 214 reads: +376 validated
umi TCGTTATCGT = 226 reads: +376 validated
umi TTATGCCCCT = 64 reads: +47 -2X +227 -12 +88 invalidated
umi TTCCCTGTGC = 212 reads: +376 validated
umi TTCGTCGAAA = 252 reads: +376 validated
umi TTGCATATCT = 215 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=632]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=14)
402-450 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
450-632 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 41 reads
cdr3 = CAHTTYMIGDYLHYFDYW at 365, score = 7 + 7
umis assigned: [22, 57, 62, 220, 336, 352, 374]
of which 7 are surviving nonsolos
reads assigned: 416
start codons at 20, 64, 243, 246, 326, 335, 383
confident = true

TIG 2[bases=630]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=10)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 18 umis using 566 reads
cdr3 = CQSGDSSHWVF at 358, score = 8 + 8
umis assigned: [21, 65, 73, 79, 104, 136, 140, 157, 235, 252] and 10 others
of which 20 are surviving nonsolos
reads assigned: 3970
start codons at 43, 104, 173, 191
confident = true

REJECT CONTIGS

TIG 1[bases=593]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
32-56 ==> 204-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
40-173 ==> 0-133 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
173-338 ==> 172-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=9)
344-382 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
382-593 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [9, 38, 177, 294, 323]
of which 5 are surviving nonsolos
reads assigned: 1373
start codons at 40, 159, 299, 315, 344
confident = false
did not find CDR3

TIG 2[bases=544]
2-77 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
26-310 ==> 0-284 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=13)
310-376 ==> 285-351 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=4) [SHIFT!]
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [20, 56, 66, 204, 213, 255, 266]
of which 6 are surviving nonsolos
reads assigned: 1879
start codons at 26, 32, 88, 240, 450
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCCACATACTACTGTGCACACACTACCTACATGATCGGTGACTACCTTCACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAA <==> ATCAGTGGAGTCCAGGCAGAAGACGAGGCTGATTATTACTGTCAATCAGGAGACAGCAGTCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.20 = TACACGAAGAGCTGGT-1

using 240 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 235]
surviving nonsolo ucounts = 1[235]
ids = [0]

====================================================================================

UMI info for barcode TACACGAAGAGCTGGT-1 contig 1 = GAGCTACAAC...
umi AAATAGGCAA = 228 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=492]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
394-433 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
433-492 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYYSTRMYTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 30, 99, 352, 393, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.21 = TACACGAAGAGGTACC-1

using 208 reads

====================================================================================

graph has 104 edges initially, 10 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 200]
surviving nonsolo ucounts = 2[6, 200]
ids = [2, 3]

====================================================================================

UMI info for barcode TACACGAAGAGGTACC-1 contig 1 = GGGCTCTGGG...
umi CGGAGCAGCG = 3 reads: -41 +1 -2X +13 -1X +1 -2X +1 -1X +1 -2X +21 -1X +2 -1X +1 -1X +2 -1X +1 -43 +5 -1X +2 -2X +1 -3X +5 -1X +22 -1XX +5 -1XX +11 -1X +3 -1X +1 -1X +3 -5X +1 -190 invalidated
umi GAAGACGGGC = 202 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=507]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=2)
80-369 ==> 0-289 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=22)
450-486 ==> 13-49 on |52|IGHJ3|J-REGION| [len=49] (mis=1)
486-507 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CVSGPTMEYVW at 422, score = 8 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 199
start codons at 80, 231, 236, 289, 297, 306, 315, 383, 440, 447, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.25 = TACACGAAGATCTGAA-1

using 578 reads

====================================================================================

graph has 624 edges initially, 6 edges after simplification

total ucounts = 191
nonsolo ucounts = 67[2^26, 3^17, 4^8, 5^6, 6^3, 7, 8^4, 11, 221]
surviving nonsolo ucounts = 1[221]
ids = [33]

====================================================================================

UMI info for barcode TACACGAAGATCTGAA-1 contig 1 = AGGAGTCAGA...
umi CATATTAGGG = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [33]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.29 = TACACGAAGCGAAGGG-1

using 249 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 243]
surviving nonsolo ucounts = 1[243]
ids = [3]

====================================================================================

UMI info for barcode TACACGAAGCGAAGGG-1 contig 1 = GCAGGAGTCA...
umi GAAGATCCTT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-489 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYGVPYTF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.34 = TACACGAAGGAGCGTT-1

using 226 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [1]

====================================================================================

UMI info for barcode TACACGAAGGAGCGTT-1 contig 1 = GACTGATCAG...
umi GTGGTATGAG = 216 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=479]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
400-437 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-479 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CMQALQSPRGLTF at 370, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 34, 67, 103, 191, 353, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.41 = TACACGAAGGTGATTA-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.43 = TACACGAAGTACGTAA-1

using 299 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 295]
surviving nonsolo ucounts = 1[295]
ids = [2]

====================================================================================

UMI info for barcode TACACGAAGTACGTAA-1 contig 1 = GCTGGGGTCT...
umi TGAATAAACT = 292 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
432-554 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CSSYTSSSTLWVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.49 = TACACGAAGTGTGGCA-1

using 168 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 30
nonsolo ucounts = 23[2^4, 3^2, 4, 5, 6^4, 7^3, 9^3, 10, 11^2, 12, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.52 = TACACGACAAACGCGA-1

using 133 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[132]
surviving nonsolo ucounts = 1[132]
ids = [1]

====================================================================================

UMI info for barcode TACACGACAAACGCGA-1 contig 1 = GGACTCGGGA...
umi CGACCTTCGG = 129 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-21 ==> 15-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
21-374 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
371-409 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
409-560 ==> 0-151 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CGTWDGSLGGVLF at 342, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 128
start codons at 21, 175, 226, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.68 = TACACGACACGAGAGT-1

using 276 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode TACACGACACGAGAGT-1 contig 1 = GCTCTGCTTC...
umi CCAGTTGCAA = 266 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=557]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-557 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.69 = TACACGACACGCGAAA-1

using 336 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[13, 315]
surviving nonsolo ucounts = 1[315]
ids = [6]

====================================================================================

UMI info for barcode TACACGACACGCGAAA-1 contig 1 = GGAGTCAGTC...
umi GCCAAGCTCT = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDDLPITF at 353, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 26, 32, 88, 101, 363, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.71 = TACACGACACGGCGTT-1

using 1422 reads

====================================================================================

graph has 1430 edges initially, 6 edges after simplification

total ucounts = 441
nonsolo ucounts = 144[2^60, 3^29, 4^26, 5^9, 6^9, 7^4, 8, 9, 10, 11, 12^2, 625]
surviving nonsolo ucounts = 1[625]
ids = [415]

====================================================================================

UMI info for barcode TACACGACACGGCGTT-1 contig 1 = AGGAATCAGT...
umi TTGAAAGCTT = 624 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 107 reads
cdr3 = CLQHSSSPWTF at 354, score = 9 + 8
umis assigned: [415]
of which 1 are surviving nonsolos
reads assigned: 612
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.74 = TACACGACACTAGTAC-1

using 122 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[117]
surviving nonsolo ucounts = 1[117]
ids = [1]

====================================================================================

UMI info for barcode TACACGACACTAGTAC-1 contig 1 = GATCAGGACT...
umi ACTGCTGGCA = 111 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=437]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 14 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.75 = TACACGACACTTAAGC-1

using 302 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 8, 288]
surviving nonsolo ucounts = 1[288]
ids = [1]

====================================================================================

UMI info for barcode TACACGACACTTAAGC-1 contig 1 = GCTCTGCTTC...
umi AATGGCTCGA = 284 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=535]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=22)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
442-535 ==> 0-93 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CQSYDSILTGWAF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.77 = TACACGACAGACGCAA-1

using 1817 reads

====================================================================================

graph has 2036 edges initially, 20 edges after simplification

total ucounts = 591
nonsolo ucounts = 261[2^113, 3^56, 4^32, 5^21, 6^6, 7^16, 8^5, 9^3, 10^4, 11, 12^3, 558]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=361]
0-24 ==> 322-346 on rc of segment before IGHJ2 exon 1 [len=346] (mis=0)
84-241 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=1)
240-290 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
290-361 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [569]
of which 0 are surviving nonsolos
reads assigned: 554
start codons at 168, 242, 271
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.81 = TACACGACAGGGCATA-1

using 32 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.82 = TACACGACAGTATCTG-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.90 = TACACGACATGGGAAC-1

using 579 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 255, 320]
surviving nonsolo ucounts = 2[255, 320]
ids = [4, 2]

====================================================================================

UMI info for barcode TACACGACATGGGAAC-1 contig 1 = GAGGAATCAG...
umi TTACCTCTTT = 245 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.91 = TACACGACATGGGACA-1

using 68 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 59]
surviving nonsolo ucounts = 1[59]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=354]
0-330 ==> 18-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
329-354 ==> 0-25 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 52
start codons at 190, 316
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.102 = TACACGAGTAGAAGGA-1

using 322 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 310]
surviving nonsolo ucounts = 1[310]
ids = [7]

====================================================================================

UMI info for barcode TACACGAGTAGAAGGA-1 contig 1 = ACCCAAAAAC...
umi TGGTTCTCTC = 303 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=579]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-579 ==> 0-89 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.103 = TACACGAGTAGAGGAA-1

using 176 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[176]
surviving nonsolo ucounts = 1[176]
ids = [0]

====================================================================================

UMI info for barcode TACACGAGTAGAGGAA-1 contig 1 = GGGGTCTCAG...
umi CTAATCCCTC = 169 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-366 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
426-569 ==> 0-143 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSVAGSYSLVF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 38, 177, 195, 246, 249, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.104 = TACACGAGTAGCTTGT-1

using 240 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode TACACGAGTAGCTTGT-1 contig 1 = GCTCTGCTTC...
umi AATCGTGGTG = 224 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
445-547 ==> 0-102 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGSRVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.115 = TACACGAGTGAGGCTA-1

using 309 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 304]
surviving nonsolo ucounts = 1[304]
ids = [3]

====================================================================================

UMI info for barcode TACACGAGTGAGGCTA-1 contig 1 = GGAGTCAGTC...
umi TATCCTCTGG = 280 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=481]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
417-481 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDNLPSYTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 26, 32, 88, 101, 240, 363, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.118 = TACACGAGTGGAAAGA-1

using 50 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[47]
surviving nonsolo ucounts = 1[47]
ids = [0]

====================================================================================

UMI info for barcode TACACGAGTGGAAAGA-1 contig 1 = TCGGGACGTC...
umi GCTTTGCATG = 50 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=455]
16-360 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
366-404 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
404-455 ==> 0-51 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CSSYISSTTLGF at 340, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 47
start codons at 16, 224, 227
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.120 = TACACGAGTGTGCGTC-1

using 71 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[70]
surviving nonsolo ucounts = 1[70]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.133 = TACACGATCAAGATCC-1

using 45 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 9, 27]
surviving nonsolo ucounts = 1[27]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.141 = TACACGATCAGGATCT-1

using 362 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[360]
surviving nonsolo ucounts = 1[360]
ids = [0]

====================================================================================

UMI info for barcode TACACGATCAGGATCT-1 contig 1 = AACAGGCAGG...
umi CAACGCGGTC = 341 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=512]
0-23 ==> 152-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
23-386 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
426-512 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYYSTPPVTF at 362, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 341
start codons at 23, 92, 345, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.143 = TACACGATCATTATCC-1

using 1285 reads

====================================================================================

graph has 1943 edges initially, 18 edges after simplification

total ucounts = 551
nonsolo ucounts = 294[2^117, 3^66, 4^43, 5^28, 6^18, 7^13, 8^4, 9^2, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.148 = TACACGATCCCACTTG-1

using 698 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[282, 415]
surviving nonsolo ucounts = 2[282, 415]
ids = [2, 1]

====================================================================================

UMI info for barcode TACACGATCCCACTTG-1 contig 1 = AGCTGTGGGC...
umi TTTTTACGTG = 275 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=569]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=2)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
425-569 ==> 0-144 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CNSRDSSGNLRGVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 40, 159, 188, 239, 338
confident = false

REJECT CONTIGS

TIG 1[bases=482]
17-358 ==> 12-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=23)
365-411 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
411-482 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CVRNSGLGDYW at 347, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 13, 156, 203, 208, 212, 240, 269, 302
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.151 = TACACGATCCGAAGAG-1

using 178 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 168]
surviving nonsolo ucounts = 1[168]
ids = [1]

====================================================================================

UMI info for barcode TACACGATCCGAAGAG-1 contig 1 = AGAGCTCTGG...
umi CCATGGGAGC = 155 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
426-494 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYGSSRTF at 368, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 44, 252, 378, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.158 = TACACGATCGCCAGCA-1

using 166 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[4, 6, 7, 148]
surviving nonsolo ucounts = 1[148]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.159 = TACACGATCGCCTGTT-1

using 508 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 201, 298]
surviving nonsolo ucounts = 2[201, 298]
ids = [0, 5]

====================================================================================

UMI info for barcode TACACGATCGCCTGTT-1 contig 1 = GACAATCTCC...
umi AAAAGCGCCT = 197 reads: +391 validated

UMI info for barcode TACACGATCGCCTGTT-1 contig 2 = GTCAGACCCA...
umi GCAGTCAGCA = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
13-369 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
385-404 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
404-537 ==> 0-133 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSLSGYVF at 337, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 13, 167, 221, 320, 347, 368
confident = false

TIG 2[bases=497]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=8)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQANSFPLTF at 350, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 23, 29, 85, 98, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.160 = TACACGATCGGAAATA-1

using 143 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 138]
surviving nonsolo ucounts = 1[138]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=389]
1-28 ==> 5973-6000 on segment before IGLV10-54 exon 1 [len=6000] (mis=1)
41-389 ==> 0-348 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=21)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 41, 180, 252, 370
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.161 = TACACGATCGGCGGTT-1

using 16686 reads

====================================================================================

graph has 5145 edges initially, 28 edges after simplification

total ucounts = 674
nonsolo ucounts = 290[2^107, 3^48, 4^35, 5^15, 6^6, 7^4, 8^3, 9^3, 10^2, 11^3, 13^2, 14^2, 16, 18, 19^2, 48, 54^2, 79, 119, 125, 135, 136, 148, 150, 180, 206, 225, 229, 230^2, 238, 251, 252, 253, 254, 263, 265, 266^2, 272, 280, 288, 289, 290, 296, 297^2, 306, 307, 308, 311, 312, 313, 316, 320, 327, 328, 335, 339, 346^2, 355, 358, 365, 383, 389, 391, 400, 618, 697]
surviving nonsolo ucounts = 56[14, 19, 48, 54, 79, 119, 125, 135, 136, 148, 150, 180, 206, 225, 229, 230^2, 238, 251, 252, 253, 254, 263, 265, 266^2, 272, 280, 288, 289, 290, 296, 297^2, 306, 307, 308, 311, 312, 313, 316, 320, 327, 328, 335, 339, 346, 355, 358, 365, 383, 389, 391, 400, 618, 697]
ids = [475, 281, 467, 386, 412, 209, 546, 253, 198, 385, ...]

====================================================================================

UMI info for barcode TACACGATCGGCGGTT-1 contig 1 = GGGAGAGGAG...
umi CCTCGGGCTG = 136 reads: +412 validated
umi CGCTGAGGAA = 19 reads: +218 -1 +86 -1 +1 -1X +5 -1 +98 invalidated
umi CTTATGCGCA = 149 reads: +412 validated
umi GATGTCCTCG = 230 reads: +412 validated
umi GCATCGTCAT = 52 reads: +298 -2 +99 -1X +12 invalidated
umi GGACGGCGTT = 81 reads: +412 validated
umi GGTCATCAAA = 206 reads: +412 validated
umi GTTCGCAAGC = 48 reads: +355 -1 +56 non-validated
umi TAAAAGGGTG = 14 reads: -43 +242 -127 non-validated
umi TCCCTTCGCC = 128 reads: +412 validated

UMI info for barcode TACACGATCGGCGGTT-1 contig 2 = GGGAGAGCCC...
umi AACGATGAAT = 337 reads: +379 validated
umi AACGCACTCA = 394 reads: +379 validated
umi ACAACAGGCT = 264 reads: +379 validated
umi ACCACCACCT = 618 reads: +379 validated
umi AGTATACCTT = 263 reads: +379 validated
umi ATAATGGCGA = 356 reads: +379 validated
umi ATCAGGTCAG = 305 reads: +379 validated
umi ATTATCGGCC = 291 reads: +379 validated
umi ATTGTGTGGG = 399 reads: +379 validated
umi CATTGCCCGT = 319 reads: +379 validated
umi CCAATTATGG = 297 reads: +379 validated
umi CCGAGATCAT = 392 reads: +379 validated
umi CCGCCCCGGG = 298 reads: +379 validated
umi CGGCACACTT = 290 reads: +379 validated
umi CGTTAACGGT = 181 reads: +379 validated
umi CGTTAGGTAC = 312 reads: +379 validated
umi CTAATCCTTT = 325 reads: +379 validated
umi CTACTATGCA = 267 reads: +379 validated
umi CTAGACCTTC = 255 reads: +379 validated
umi CTCTTATGGT = 337 reads: +379 validated
umi CTGAGCCGCA = 291 reads: +379 validated
umi CTGTCTATAG = 344 reads: +379 validated
umi GACAAAGGGA = 232 reads: +379 validated
umi GCATATTGTC = 148 reads: +379 validated
umi GCATGGTCCT = 314 reads: +379 validated
umi GGGACCGGCA = 266 reads: +379 validated
umi GGGAGTCCCG = 238 reads: +379 validated
umi GGTTGTCGCA = 324 reads: +379 validated
umi GTGCATTGCT = 252 reads: +379 validated
umi GTGGCATCCG = 288 reads: +64 -1XX +1 -2XX +311 invalidated
umi GTGGCGTAGG = 386 reads: +379 validated
umi GTTATCGGTG = 302 reads: +379 validated
umi TATATGCTGT = 366 reads: +379 validated
umi TCATTTGCAC = 299 reads: +379 validated
umi TCCACTTGGG = 695 reads: -179X +200 invalidated
umi TCGTACGCAA = 325 reads: +379 validated
umi TGAGGACTGC = 311 reads: +379 validated
umi TGCGGCGCAC = 279 reads: +379 validated
umi TGGCATCTGT = 252 reads: +379 validated
umi TTACGTTCTG = 310 reads: +379 validated
umi TTGAAACCTT = 260 reads: +315 -1XX +1 -3XX +3 -2XX +1 -8XX +1 -44X invalidated
umi TTGGCTTCTT = 357 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=624]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=31)
449-485 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-624 ==> 0-139 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 7 umis using 83 reads
cdr3 = CASDWHSNRHALDW at 412, score = 9 + 8
umis assigned: [253, 281, 334, 380, 386, 412, 432, 467, 475, 546]
of which 10 are surviving nonsolos
reads assigned: 1043
start codons at 73, 229, 280, 373
confident = true

TIG 2[bases=562]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=13)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 41 umis using 2109 reads
cdr3 = CQQSSNWLTF at 368, score = 9 + 9
umis assigned: [18, 19, 51, 63, 117, 123, 132, 151, 156, 211] and 32 others
of which 42 are surviving nonsolos
reads assigned: 13153
start codons at 47, 252, 468
confident = true

REJECT CONTIGS

TIG 1[bases=591]
1-32 ==> 5969-6000 on segment before IGLV7-35 exon 1 [len=6000] (mis=0)
32-54 ==> 0-22 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=1)
35-58 ==> 0-23 on segment before IGLV5-48 exon 2 [len=168] (mis=0)
46-63 ==> 5889-5906 on segment after IGSF21 exon 4 [len=6000] (mis=0)
66-254 ==> 22-210 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=14)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
430-591 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CLLHHSRAWVF at 369, score = 4 + 8
umis assigned: [58, 198, 209, 452, 454]
of which 4 are surviving nonsolos
reads assigned: 735
start codons at 32, 65, 110, 165, 189, 255
confident = false
see insertion of TCCTTCTCCCCA at pos 22 on |388|IGLV7-46|L-REGION+V-REGION|
not full
frameshifted full length stopped transcript of length 591
VJ delta = 4
not full
now this is a cell
paired!

AGAGCCGAGGACACGGCCGTATATTACTGTGCGAGTGATTGGCACAGTAACAGGCACGCACTAGACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCACCAGCCTAGAGCCTGAAGACTTCGCAGTTTATTACTGTCAGCAGAGTAGCAACTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.167 = TACACGATCTCGTTTA-1

using 25 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.185 = TACAGTGAGACTGGGT-1

using 366 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 4, 353]
surviving nonsolo ucounts = 2[4, 353]
ids = [6, 7]

====================================================================================

UMI info for barcode TACAGTGAGACTGGGT-1 contig 1 = AGAAGTCTCT...
umi TTCCCCCCTG = 4 reads: -132 +83 -8 +7 -1 +27 -1 +20 -33 +56 -20 non-validated
umi TTCCCCCTGT = 334 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 4-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQKYNSAPYTF at 354, score = 9 + 8
umis assigned: [6, 7]
of which 2 are surviving nonsolos
reads assigned: 333
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.187 = TACAGTGAGAGACTAT-1

using 451 reads

====================================================================================

graph has 260 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 7, 203, 233]
surviving nonsolo ucounts = 2[203, 233]
ids = [1, 0]

====================================================================================

UMI info for barcode TACAGTGAGAGACTAT-1 contig 1 = ACAAGAGGCA...
umi AACTCTGGGT = 227 reads: +385 validated

UMI info for barcode TACAGTGAGAGACTAT-1 contig 2 = GACAAGAGGC...
umi AATTCCCTAC = 213 reads: +17 -2XX +17 -1X +3 -1XX +4 -2XX +27 -1XX +316 invalidated

GOOD CONTIGS

TIG 1[bases=581]
0-32 ==> 130-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
32-372 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
389-417 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
417-581 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CFSYGTSGRTF at 356, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 32, 240, 366
confident = false

TIG 2[bases=425]
33-355 ==> 0-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CCSFTVNTRSYVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 33, 190, 234, 244, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.190 = TACAGTGAGAGGGATA-1

using 1402 reads

====================================================================================

graph has 785 edges initially, 25 edges after simplification

total ucounts = 439
nonsolo ucounts = 182[2^87, 3^42, 4^19, 5^13, 6^7, 7^5, 8^2, 9, 10^2, 11, 13, 36, 522]
surviving nonsolo ucounts = 2[36, 522]
ids = [277, 335]

====================================================================================

UMI info for barcode TACAGTGAGAGGGATA-1 contig 1 = GGGGTCACAA...
umi GGCTTTCAGG = 35 reads: +391 validated
umi TCAAGATTCA = 504 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=563]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-331 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
429-563 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 75 reads
cdr3 = CSSYAGRTTFDVF at 362, score = 7 + 8
umis assigned: [277, 335]
of which 2 are surviving nonsolos
reads assigned: 531
start codons at 38, 174, 177, 192, 195, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.197 = TACAGTGAGCGTAATA-1

using 51 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[51]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.209 = TACAGTGAGTCCGGTC-1

using 463 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[463]
surviving nonsolo ucounts = 1[463]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.214 = TACAGTGAGTTCGCAT-1

using 295 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 286]
surviving nonsolo ucounts = 1[286]
ids = [5]

====================================================================================

UMI info for barcode TACAGTGAGTTCGCAT-1 contig 1 = GAGTCAGTCC...
umi GAAACTGCAG = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDDLPITF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 25, 31, 87, 100, 362, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.216 = TACAGTGCAAAGGCGT-1

using 311 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGCAAAGGCGT-1 contig 1 = TGGGGGCTGT...
umi AAATGGGGTG = 298 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=512]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=4)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=10)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
422-512 ==> 0-90 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQSADRSGTYVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 43, 104, 173, 191, 251, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.217 = TACAGTGCAACACCTA-1

using 206 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[201]
surviving nonsolo ucounts = 1[201]
ids = [5]

====================================================================================

UMI info for barcode TACAGTGCAACACCTA-1 contig 1 = AGACTCAGTC...
umi CCTAATTGGC = 187 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=459]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-459 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNSYPLTF at 347, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 20, 26, 82, 95, 231, 234, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.218 = TACAGTGCAACTGCTA-1

using 434 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^3, 4, 5, 7, 20, 34, 351]
surviving nonsolo ucounts = 2[34, 351]
ids = [9, 3]

====================================================================================

UMI info for barcode TACAGTGCAACTGCTA-1 contig 1 = GGAGTCAGTC...
umi CACTGCTAGC = 349 reads: +388 validated
umi GATGGAACAC = 10 reads: -248 +2 -1 +6 -1X +2 -1 +2 -1XX +11 -1XX +2 -1XX +3 -1XX +20 -1XX +8 -1XX +4 -4X +4 -2X +1 -20 +4 -2X +2 -1X +7 -2X +8 -1X +5 -1X +7 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [3, 9]
of which 2 are surviving nonsolos
reads assigned: 356
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.221 = TACAGTGCAAGTAGTA-1

using 19660 reads

====================================================================================

graph has 8536 edges initially, 132 edges after simplification

total ucounts = 1005
nonsolo ucounts = 534[2^178, 3^85, 4^68, 5^52, 6^31, 7^19, 8^12, 9^5, 10^5, 11^2, 12^3, 13^3, 14, 17, 18, 20, 25, 52, 85, 110, 111, 117, 118, 123, 126, 160, 172, 175, 176, 178, 185, 198^2, 202, 203, 207^3, 220, 225, 229^2, 235, 238^2, 239, 243, 246, 248, 249, 252, 254, 259, 261^2, 263, 264, 265, 268^2, 269, 270, 272, 279, 281, 285, 286, 295, 296, 299, 302, 313, 314, 322, 326, 328, 336, 340, 397, 406, 553, 601, 1211]
surviving nonsolo ucounts = 64[85, 110, 111, 117, 118, 126, 160, 172, 175, 176, 178, 185, 198^2, 202, 203, 207^3, 220, 225, 229^2, 235, 238^2, 239, 243, 246, 248, 249, 252, 254, 259, 261^2, 263, 264, 265, 268^2, 269, 270, 272, 279, 281, 285, 286, 295, 296, 299, 302, 313, 314, 322, 326, 328, 336, 340, 397, 406, 553, 601, 1211]
ids = [358, 872, 483, 167, 675, 708, 528, 888, 111, 745, ...]

====================================================================================

UMI info for barcode TACAGTGCAAGTAGTA-1 contig 1 = TGGGGACCCA...
umi AAATCTTGTG = 203 reads: +393 -1 +30 non-validated
umi AACGACATGT = 263 reads: +424 validated
umi ATAAAGCGCA = 261 reads: +418 -2 +4 non-validated
umi CAATGGCCAG = 413 reads: +424 validated
umi CACAATGGGC = 245 reads: +424 validated
umi CACTCACAGG = 269 reads: +424 validated
umi CACTTTTCGC = 325 reads: -144X +280 invalidated
umi CAGCCGGGCG = 282 reads: +424 validated
umi CATGAGGGGC = 173 reads: +418 -1 +5 non-validated
umi CCTAAAAGGC = 84 reads: +412 -12 non-validated
umi CCTGTATACA = 310 reads: +400 -1 +5 -1 +4 -1 +6 -1 +5 non-validated
umi CGACATTGCA = 251 reads: +424 validated
umi GAGCAGTTAA = 269 reads: +424 validated
umi GAGCATTCGT = 160 reads: +409 -1 +14 non-validated
umi GAGTCAAGTG = 247 reads: +404 -1 +4 -1 +2 -2 +2 -1 +1 -1 +5 non-validated
umi GCTGATGTAG = 325 reads: +423 -1 non-validated
umi GGCATACCCT = 263 reads: +409 -1 +1 -1 +12 non-validated
umi TACGGATATA = 229 reads: +424 validated
umi TCAATGCTCC = 238 reads: +424 validated
umi TCCCCAGGCT = 209 reads: +424 validated
umi TCGGTGGCGC = 202 reads: +424 validated
umi TCTTTAGGAA = 221 reads: +424 validated
umi TGCTTTTAAC = 111 reads: +424 validated
umi TGCTTTTTGG = 200 reads: +418 -1 +3 -2 non-validated
umi TGGACATGGC = 279 reads: +424 validated
umi TGGTCTGCAT = 342 reads: +424 validated
umi TGTGACTGGC = 237 reads: +424 validated
umi TTCTGGCGGT = 204 reads: +421 -1 +2 non-validated

UMI info for barcode TACAGTGCAAGTAGTA-1 contig 2 = TGGGAAAACA...
umi ACATCTTTGG = 292 reads: +391 validated
umi ATGTATTCCT = 392 reads: +391 validated
umi GCGCTGATCT = 322 reads: +391 validated
umi TAGTTTCCGC = 300 reads: +391 validated
umi TGGTTATCTC = 167 reads: +391 validated
umi TTGATCGGTG = 305 reads: +391 validated

UMI info for barcode TACAGTGCAAGTAGTA-1 contig 3 = GGGGGCTGGG...
umi ACTGGATAAA = 174 reads: +388 validated
umi AGTCCTCCAG = 185 reads: +388 validated
umi ATCATCGCAT = 115 reads: +388 validated
umi ATTTCTTCGG = 198 reads: +388 validated
umi CATATGGCGA = 292 reads: +388 validated
umi CCCTATACAC = 226 reads: +388 validated
umi CCGCTGTCAG = 1220 reads: -311X +77 invalidated
umi CGCGATGCCA = 208 reads: +388 validated
umi CGTGAATCGG = 239 reads: +388 validated
umi CTCGCTTTCC = 272 reads: +335 -3X +50 invalidated
umi GTGTAGGAGG = 116 reads: +388 validated
umi GTTTATGCCT = 272 reads: +388 validated
umi TACAATTGGG = 126 reads: +388 validated
umi TATCGAGGCA = 178 reads: +388 validated
umi TCACCTTTAA = 245 reads: +388 validated
umi TCCACTCGAA = 228 reads: +388 validated
umi TCTGCCGTTA = 261 reads: +388 validated
umi TGCACCGTAT = 270 reads: +388 validated
umi TTCAACCCGT = 252 reads: +388 validated
umi TTTCAATGCC = 266 reads: +388 validated
umi TTTCATTTGA = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=9)
413-431 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 24 umis using 444 reads
cdr3 = CARVWYSSSSGRYFDYW at 401, score = 8 + 7
umis assigned: [13, 23, 156, 226, 230, 249, 256, 260, 282, 358] and 18 others
of which 28 are surviving nonsolos
reads assigned: 6703
start codons at 59, 210, 257, 262, 279, 294, 323, 356
confident = true

TIG 2[bases=644]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=2)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 339 reads
cdr3 = CSALDSSLSAHWVF at 363, score = 8 + 8
umis assigned: [68, 192, 584, 734, 888, 961]
of which 6 are surviving nonsolos
reads assigned: 1751
start codons at 42
confident = true

TIG 3[bases=644]
45-398 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 20 umis using 669 reads
cdr3 = CSSYTNSSTLVF at 369, score = 8 + 8
umis assigned: [111, 148, 167, 203, 275, 333, 346, 401, 420, 454] and 11 others
of which 21 are surviving nonsolos
reads assigned: 5496
start codons at 45, 202, 246, 253, 256, 420
confident = true

REJECT CONTIGS

TIG 1[bases=570]
5-80 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
397-434 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSTNSGLTF at 355, score = 4 + 9
umis assigned: [598, 749, 770, 793]
of which 4 are surviving nonsolos
reads assigned: 1148
start codons at 35, 68, 104, 192, 354, 374, 476
confident = false
not full
frameshifted full length transcript of length 570
VJ delta = 29
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.225 = TACAGTGCAATTCCTT-1

using 340 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 327]
surviving nonsolo ucounts = 1[327]
ids = [4]

====================================================================================

UMI info for barcode TACAGTGCAATTCCTT-1 contig 1 = GAGGAACTGC...
umi GCGATTATAT = 329 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.227 = TACAGTGCACAGGCCT-1

using 227 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGCACAGGCCT-1 contig 1 = AGCTTCAGCT...
umi CGACTTTCTC = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=24)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
434-563 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CATWDDSLSAQVF at 367, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 46, 200, 260, 350, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.233 = TACAGTGCACGACTCG-1

using 215 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 6, 202]
surviving nonsolo ucounts = 1[202]
ids = [3]

====================================================================================

UMI info for barcode TACAGTGCACGACTCG-1 contig 1 = AGGAGTCAGA...
umi GGAGTTGCTA = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=21)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-500 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYYTFSHTF at 354, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 27, 33, 89, 102, 185, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.234 = TACAGTGCACGCGAAA-1

using 449 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 48, 396]
surviving nonsolo ucounts = 2[48, 396]
ids = [1, 3]

====================================================================================

UMI info for barcode TACAGTGCACGCGAAA-1 contig 1 = GGGGAGGAAC...
umi GATATGCGAT = 395 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 36, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.235 = TACAGTGCACTGTTAG-1

using 344 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[7, 331]
surviving nonsolo ucounts = 1[331]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=390]
0-263 ==> 87-350 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=32)
271-319 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
319-390 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARGARADFDYW at 252, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 69, 213
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.246 = TACAGTGCAGGCGATA-1

using 169 reads

====================================================================================

graph has 89 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[169]
surviving nonsolo ucounts = 1[169]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGCAGGCGATA-1 contig 1 = GGGCCTCAGG...
umi TTAATACGGA = 160 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=472]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-472 ==> 0-61 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.251 = TACAGTGCAGTTCCCT-1

using 240 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[237]
surviving nonsolo ucounts = 1[237]
ids = [2]

====================================================================================

UMI info for barcode TACAGTGCAGTTCCCT-1 contig 1 = TGGGGGAATC...
umi TCTAACCTAT = 207 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=502]
22-380 ==> 0-358 on |99|IGHV2-70|L-REGION+V-REGION| [len=358] (mis=3)
378-405 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=5)
398-461 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
461-502 ==> 0-41 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARSPYDILTGHYYYYGMDVW at 367, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 22, 178, 245, 248, 328, 337, 418, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.259 = TACAGTGGTAAGTGGC-1

using 500 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 496]
surviving nonsolo ucounts = 1[496]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGGTAAGTGGC-1 contig 1 = GGGGGACTCC...
umi GAATGAACCC = 502 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=510]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=4)
391-439 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
439-510 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAHYGSGSLRFDYW at 366, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 495
start codons at 21, 65, 244, 247, 327, 336, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.270 = TACAGTGGTATGGTTC-1

using 619 reads

====================================================================================

graph has 172 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 253, 358]
surviving nonsolo ucounts = 2[253, 358]
ids = [5, 2]

====================================================================================

UMI info for barcode TACAGTGGTATGGTTC-1 contig 1 = GAATCAGTCC...
umi ATATCTTCAG = 65 reads: -339X +2 -3XX +1 -1XX +1 -2XX +1 -1XX +8 -1XX +25 -1XX +2 invalidated
umi GTGTATAGTG = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2, 5]
of which 2 are surviving nonsolos
reads assigned: 309
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 87.273 = TACAGTGGTCAGTGGA-1

using 173 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[173]
surviving nonsolo ucounts = 1[173]
ids = [0]

====================================================================================

UMI info for barcode TACAGTGGTCAGTGGA-1 contig 1 = GGGAGGAATC...
umi ACTATGGTTA = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-486 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!
sorting bam, mem = 0.07
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk087-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk087-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

13.900 seconds used processing barcodes, peak mem = 0.23
