[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.19 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk086-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk086-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk086.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.0 = GTGTTAGAGGCTAGCA-1

using 14534 reads

====================================================================================

graph has 4664 edges initially, 96 edges after simplification

total ucounts = 492
nonsolo ucounts = 215[2^71, 3^35, 4^22, 5^14, 6^2, 7^5, 8^4, 9^2, 10^2, 12, 13, 16, 18, 64, 69, 73, 86, 92, 113, 120, 124, 130, 148, 165, 170^2, 178, 228, 230, 232, 234, 236^2, 244, 245, 250, 253, 261, 263, 270^2, 276, 277, 280, 281, 287, 293, 296, 297, 301, 305, 306^2, 309, 310, 316, 318, 321, 322, 327, 331, 341, 347, 360, 378, 393, 644]
surviving nonsolo ucounts = 51[73, 86, 113, 120, 124, 130, 148, 165, 170^2, 178, 228, 230, 232, 234, 236^2, 244, 245, 250, 253, 261, 263, 270^2, 276, 277, 280, 281, 287, 293, 296, 297, 301, 305, 306^2, 309, 310, 316, 318, 321, 322, 327, 331, 341, 347, 360, 378, 393, 644]
ids = [424, 357, 84, 292, 298, 485, 190, 459, 66, 428, ...]

====================================================================================

UMI info for barcode GTGTTAGAGGCTAGCA-1 contig 1 = ACTTTCTGAG...
umi AACTCATTTG = 274 reads: +391 -1 +26 non-validated
umi CAACATTCGT = 312 reads: +418 validated
umi GTGTCACCTT = 82 reads: -312 +2 -1 +103 non-validated
umi TCACACCAGG = 315 reads: +418 validated
umi TGAAACTTCC = 74 reads: +371 -47 non-validated
umi TGCACCTCTC = 162 reads: -302 +116 non-validated

UMI info for barcode GTGTTAGAGGCTAGCA-1 contig 2 = TGGGGAGGAG...
umi AAAAAGGTGC = 281 reads: +385 validated
umi AAATTTTTCA = 253 reads: +385 validated
umi AATCCTACCC = 321 reads: +385 validated
umi ACAAAAGGCT = 241 reads: +385 validated
umi ACGTCGTTAT = 391 reads: +385 validated
umi ACTACTCCTT = 298 reads: +385 validated
umi ACTGGATTAC = 337 reads: +385 validated
umi AGCGGGGTAC = 283 reads: +385 validated
umi CAACCCCCTT = 302 reads: +385 validated
umi CCAATATGTG = 291 reads: +385 validated
umi CGTATGGTTG = 284 reads: +385 validated
umi CGTTCTTCGC = 284 reads: +385 validated
umi CTCTAAGTAT = 233 reads: +385 validated
umi GACACGGAGT = 121 reads: +385 validated
umi GACCTAGTGC = 314 reads: +385 validated
umi GCACCACCCT = 320 reads: +385 validated
umi GCCATCGATA = 360 reads: +385 validated
umi GCGTGTTGGG = 274 reads: +385 validated
umi GGTTCACGAA = 302 reads: +385 validated
umi GTCTTATATG = 236 reads: +385 validated
umi TATGTAACCA = 326 reads: +385 validated
umi TCGCTCATTA = 309 reads: +385 validated
umi TCTTAGGCAT = 261 reads: +385 validated
umi TGGGGAACTC = 646 reads: +385 validated
umi TTACTTGTGC = 180 reads: +55 -1XX +97 -2XX +59 -1XX +8 -1XX +84 -1XX +3 -1XX +31 -1XX +1 -2XX +2 -2XX +1 -3XX +1 -2XX +1 -13XX +4 -1XX +2 -1XX +4 invalidated
umi TTCATGTGGG = 256 reads: +238 -1XX +146 invalidated
umi TTTTACGCAG = 130 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=524]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 89 reads
cdr3 = CAREDIVATEFDYW at 380, score = 9 + 7
umis assigned: [21, 147, 357, 398, 424, 428]
of which 6 are surviving nonsolos
reads assigned: 1203
start codons at 35, 79
confident = true

TIG 2[bases=553]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
385-417 ==> 6-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 26 umis using 1183 reads
cdr3 = CQQSYSTPLF at 359, score = 9 + 7
umis assigned: [1, 11, 32, 45, 69, 74, 80, 96, 148, 178] and 17 others
of which 27 are surviving nonsolos
reads assigned: 7679
start codons at 32, 38, 94, 107, 243, 459
confident = true

REJECT CONTIGS

TIG 1[bases=554]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
17-86 ==> 8898-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
17-86 ==> 8907-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
17-86 ==> 8906-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [29, 35, 36, 66, 84, 146, 151, 181, 209, 270] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3601
start codons at 29, 35, 91, 104, 186, 240, 460
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGAGGATATAGTGGCTACGGAGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCCCTGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1 = GTGTTAGAGGGATACC-1

using 3069 reads

====================================================================================

graph has 2335 edges initially, 38 edges after simplification

total ucounts = 650
nonsolo ucounts = 302[2^131, 3^62, 4^32, 5^20, 6^16, 7^14, 8^10, 9^3, 10, 11^2, 15^3, 77, 165, 166, 207, 228, 268, 277, 279]
surviving nonsolo ucounts = 8[77, 165, 166, 207, 228, 268, 277, 279]
ids = [260, 638, 410, 296, 454, 511, 157, 538]

====================================================================================

UMI info for barcode GTGTTAGAGGGATACC-1 contig 1 = AGGAGTCAGA...
umi ATCATCGCAC = 277 reads: +388 validated
umi CCTTATGACA = 79 reads: +388 validated
umi CTACATTGCG = 210 reads: +388 validated
umi GTTACAGCGT = 231 reads: +388 validated
umi TCCTAAGGTC = 279 reads: +388 validated
umi TTTAAATCAT = 164 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 192 reads
cdr3 = CQQYNSFPWTF at 354, score = 8 + 8
umis assigned: [157, 260, 296, 454, 538, 638]
of which 6 are surviving nonsolos
reads assigned: 1214
start codons at 27, 33, 89, 334, 457
confident = true

REJECT CONTIGS

TIG 1[bases=342]
7-261 ==> 99-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=18)
298-342 ==> 0-44 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
cdr3 = CAKDQGHYDMLTGFYNPQDYW at 250, score = 8 + 7
umis assigned: [410]
of which 1 are surviving nonsolos
reads assigned: 101
start codons at 59, 64, 154, 211, 277
confident = false
VJ delta = 6
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.11 = GTGTTAGCAACGCACC-1

using 115 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 107]
surviving nonsolo ucounts = 1[107]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=450]
4-364 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
365-403 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
403-450 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHANSTNSSITF at 324, score = 4 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 4, 37, 73, 161, 323, 343, 445
confident = false
not full
frameshifted full length transcript of length 450
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.14 = GTGTTAGCAAGTTGTC-1

using 260 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

UMI info for barcode GTGTTAGCAAGTTGTC-1 contig 1 = GCTCTGCTTC...
umi GGATCACGTT = 247 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-384 ==> 0-333 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=11)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-559 ==> 0-117 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSNANNLDGFVF at 375, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 51, 175, 205, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.15 = GTGTTAGCACAAGACG-1

using 309 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[304]
surviving nonsolo ucounts = 1[304]
ids = [2]

====================================================================================

UMI info for barcode GTGTTAGCACAAGACG-1 contig 1 = ATCAGTCCCA...
umi CCAGCCACCG = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.16 = GTGTTAGCACACATGT-1

using 290 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 284]
surviving nonsolo ucounts = 1[284]
ids = [0]

====================================================================================

UMI info for barcode GTGTTAGCACACATGT-1 contig 1 = GGGGAGCTCT...
umi ACCTTTCTCA = 282 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=560]
83-436 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=28)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARENDAFDIW at 425, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 83, 143, 234, 239, 297, 300, 386, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.27 = GTGTTAGCAGATCTGT-1

using 314 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 308]
surviving nonsolo ucounts = 1[308]
ids = [4]

====================================================================================

UMI info for barcode GTGTTAGCAGATCTGT-1 contig 1 = CAGTCCCAAC...
umi GTTAGTCCAC = 282 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=503]
0-21 ==> 10-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
418-503 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPPGPCSF at 348, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 21, 27, 83, 96, 235, 358, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.29 = GTGTTAGCAGCCTGTG-1

using 322 reads

====================================================================================

graph has 104 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[77, 243]
surviving nonsolo ucounts = 2[77, 243]
ids = [3, 1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.32 = GTGTTAGCAGGCAGTA-1

using 309 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 6, 9, 289]
surviving nonsolo ucounts = 1[289]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.34 = GTGTTAGCAGTATCTG-1

using 267 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [3]

====================================================================================

UMI info for barcode GTGTTAGCAGTATCTG-1 contig 1 = CAGTTAGGAC...
umi CGCTGTCCAT = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-22 ==> 30-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
22-370 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGSSPQLTF at 346, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 22, 230, 356, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.37 = GTGTTAGCATATGAGA-1

using 171 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================

UMI info for barcode GTGTTAGCATATGAGA-1 contig 1 = AAATTCAGGT...
umi CCCTTTACTC = 166 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=613]
0-64 ==> 37-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
64-420 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=32)
453-488 ==> 17-52 on |49|IGHJ1|J-REGION| [len=52] (mis=5)
488-613 ==> 0-125 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARAEGSGWFRYLHPW at 409, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 20, 64, 108, 264, 287
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.38 = GTGTTAGCATATGCTG-1

using 443 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[440]
surviving nonsolo ucounts = 1[440]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.43 = GTGTTAGCATGCCCGA-1

using 182 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.52 = GTGTTAGGTAATCGTC-1

using 318 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[15, 302]
surviving nonsolo ucounts = 1[302]
ids = [1]

====================================================================================

UMI info for barcode GTGTTAGGTAATCGTC-1 contig 1 = AGGACCCAGA...
umi CGCTACCTCC = 299 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=535]
17-76 ==> 0-59 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
76-319 ==> 62-305 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=20)
376-399 ==> 16-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQHYGVPPLTF at 338, score = 6 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 17, 222, 348, 441
confident = false
see deletion of 3 bases at pos 59 on |283|IGKV3-20|L-REGION+V-REGION|
>vscore_86.52_69.3%
ATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGACACCACCGGAATTGTGTTGACGCAGTCTCCAGACACCCTGTCTTTGTCTCCAGGGGAAAGAGCCTCCCTCTCTTGTAGGGCCAGTCAGACTATTAGAAATTCCGCCTTAGCCTGGTACCAGCAGATTCCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAACAGGGCCACTGGCATCCCCGACAGATTCGGGGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGACGACTTTGTAATATATTTTTGTCAACATTATGGTGTCCCACCG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.54 = GTGTTAGGTACAGTGG-1

using 223 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 135
nonsolo ucounts = 40[2^20, 3^8, 4^5, 5^2, 6^3, 7, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.57 = GTGTTAGGTAGATTAG-1

using 68 reads

====================================================================================

graph has 74 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^3, 3^2, 4, 5, 7^2, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.59 = GTGTTAGGTATCTGCA-1

using 47 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3^3, 4^2, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.61 = GTGTTAGGTCACACGC-1

using 249 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode GTGTTAGGTCACACGC-1 contig 1 = GAATCAGTCC...
umi ATTACCGGGA = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.66 = GTGTTAGGTGACGGTA-1

using 306 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [1]

====================================================================================

UMI info for barcode GTGTTAGGTGACGGTA-1 contig 1 = ATCCAACAAC...
umi GCATTTCCCT = 287 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=542]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-542 ==> 0-57 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 55, 211, 253, 319, 352, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.68 = GTGTTAGGTGATAAGT-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.75 = GTGTTAGGTTCCCGAG-1

using 312 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[311]
surviving nonsolo ucounts = 1[311]
ids = [1]

====================================================================================

UMI info for barcode GTGTTAGGTTCCCGAG-1 contig 1 = GAGTCAGACC...
umi CCTAACGGCT = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-475 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYWYTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.78 = GTGTTAGGTTCGCTAA-1

using 558 reads

====================================================================================

graph has 220 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 8, 245, 300]
surviving nonsolo ucounts = 2[245, 300]
ids = [0, 2]

====================================================================================

UMI info for barcode GTGTTAGGTTCGCTAA-1 contig 1 = CTCCAAACAG...
umi AAAGGTGTCC = 234 reads: +388 validated

UMI info for barcode GTGTTAGGTTCGCTAA-1 contig 2 = GGGGGACCCA...
umi CATGAAACTA = 274 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
41-393 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-556 ==> 0-127 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CSAWDSSLNVWVF at 362, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 41, 180, 370, 387
confident = false

TIG 2[bases=613]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-613 ==> 0-118 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 59, 257, 262, 279, 323, 356, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.79 = GTGTTAGGTTCTGTTT-1

using 91 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[91]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.86 = GTGTTAGGTTTCGCTC-1

using 313 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[311]
surviving nonsolo ucounts = 1[311]
ids = [0]

====================================================================================

UMI info for barcode GTGTTAGGTTTCGCTC-1 contig 1 = GAAGAGCTGC...
umi ACACATTTAC = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-502 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.87 = GTGTTAGGTTTGTTGG-1

using 141 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 131]
surviving nonsolo ucounts = 1[131]
ids = [3]

====================================================================================

UMI info for barcode GTGTTAGGTTTGTTGG-1 contig 1 = GCTCTGCTTC...
umi GCTTATGTAG = 123 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=544]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-544 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.99 = GTGTTAGTCATAACCG-1

using 376 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 4^2, 9, 10, 341]
surviving nonsolo ucounts = 1[341]
ids = [10]

====================================================================================

UMI info for barcode GTGTTAGTCATAACCG-1 contig 1 = AGCTCTCAGA...
umi TAGTCCTGAC = 339 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=650]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-288 ==> 0-209 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=18)
288-426 ==> 215-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
468-515 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
515-650 ==> 0-135 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CAREGTKVPGSPNRYYYAGMDVW at 415, score = 8 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 79, 132, 137, 235, 350, 376, 472
confident = false
see deletion of 6 bases at pos 209 on |142|IGHV3-48|L-REGION+V-REGION|
>vscore_86.99_83.0%
ATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAATGTGATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCCGGATTCGTCTTTAGTAGATATTCCATGAACTGGGTCCGCCTGGCTCCAGGTAAGGGACTGGAGTGGATTGCTTACATTAGTTCTAGTACCATAGAATACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTTTCTGCACATGAACAGCCTGAGAGACGAGGACACGGCTCTATATTTCTGTGCGAGGGAA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.101 = GTGTTAGTCATATCGG-1

using 631 reads

====================================================================================

graph has 230 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 169, 456]
surviving nonsolo ucounts = 2[169, 456]
ids = [1, 5]

====================================================================================

UMI info for barcode GTGTTAGTCATATCGG-1 contig 1 = GCTCTGCTTC...
umi ATAATCCCTG = 169 reads: +394 validated
umi TTCGGCAAGT = 440 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 112 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 599
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.102 = GTGTTAGTCATGCATG-1

using 299 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 288]
surviving nonsolo ucounts = 1[288]
ids = [5]

====================================================================================

UMI info for barcode GTGTTAGTCATGCATG-1 contig 1 = GTCAGTCTCA...
umi TAACTTGGTA = 262 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-492 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQCYSTPPTFTF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 23, 29, 85, 98, 410, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.105 = GTGTTAGTCCACTGGG-1

using 5161 reads

====================================================================================

graph has 2260 edges initially, 66 edges after simplification

total ucounts = 348
nonsolo ucounts = 145[2^52, 3^36, 4^13, 5^11, 6^9, 7^2, 8, 9, 10, 11, 19, 117, 145, 164, 212, 225, 235, 238, 251^2, 263, 281, 288, 298, 341, 344, 345, 516]
surviving nonsolo ucounts = 16[145, 164, 212, 225, 235, 238, 251^2, 263, 281, 288, 298, 341, 344, 345, 516]
ids = [273, 88, 115, 81, 274, 77, 4, 333, 249, 181, ...]

====================================================================================

UMI info for barcode GTGTTAGTCCACTGGG-1 contig 1 = GAGCTCTGGG...
umi GATGATAGGT = 283 reads: +421 validated
umi TACGTGGGCC = 268 reads: +421 validated
umi TCCTCCCATC = 120 reads: +421 validated

UMI info for barcode GTGTTAGTCCACTGGG-1 contig 2 = GGGGAGGAGT...
umi AACTAGGCAA = 250 reads: +397 validated
umi ATCCCGTTTT = 347 reads: +397 validated
umi CAATGGAACT = 233 reads: +397 validated
umi CACATTGTAT = 227 reads: +397 validated
umi CAGCCCCGCT = 296 reads: +397 validated
umi CAGCCCGGCT = 165 reads: +13 -1XX +383 invalidated
umi CCGGTCAGCG = 216 reads: +397 validated
umi CTGCGTCCTT = 344 reads: +397 validated
umi TCCTCGTCCA = 233 reads: +397 validated
umi TTTACGCAGG = 248 reads: +397 validated
umi TTTCGTCCTC = 350 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=603]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
501-603 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 58 reads
cdr3 = CARGIGGSTVPRFDYW at 422, score = 9 + 7
umis assigned: [181, 249, 273]
of which 3 are surviving nonsolos
reads assigned: 660
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 519, 580
confident = true

TIG 2[bases=564]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 426 reads
cdr3 = CQQYDNLPPGPCSF at 358, score = 9 + 7
umis assigned: [4, 58, 77, 81, 87, 88, 115, 160, 274, 333] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2854
start codons at 31, 37, 93, 106, 245, 368, 470
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGGAATTGGGGGTTCCACAGTCCCTCGCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCGGGGCCGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.106 = GTGTTAGTCCAGAAGG-1

using 58 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[12, 44]
surviving nonsolo ucounts = 1[44]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.109 = GTGTTAGTCCTATGTT-1

using 539 reads

====================================================================================

graph has 601 edges initially, 42 edges after simplification

total ucounts = 284
nonsolo ucounts = 91[2^33, 3^26, 4^13, 5^6, 6^3, 7^3, 8, 10^2, 11^2, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.113 = GTGTTAGTCGGCATCG-1

using 142 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 12, 126]
surviving nonsolo ucounts = 1[126]
ids = [3]

====================================================================================

UMI info for barcode GTGTTAGTCGGCATCG-1 contig 1 = GCTACAACAG...
umi TGGCGGATTC = 115 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=521]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
428-521 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQQYYNAPWTF at 367, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 114
start codons at 28, 97, 350, 383, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.117 = GTGTTAGTCTACCTGC-1

using 204 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 201]
surviving nonsolo ucounts = 1[201]
ids = [1]

====================================================================================

UMI info for barcode GTGTTAGTCTACCTGC-1 contig 1 = AAACCACACC...
umi CACGACATCA = 186 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=584]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
450-484 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-584 ==> 0-100 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 390, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 48, 246, 251, 268, 312, 345, 538
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.119 = GTGTTAGTCTAGAGTC-1

using 170 reads

====================================================================================

graph has 175 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[170]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.120 = GTGTTAGTCTAGCACA-1

using 232 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode GTGTTAGTCTAGCACA-1 contig 1 = AGGAGTCAGA...
umi CGCCATCTCA = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-490 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.134 = GTTAAGCAGAGGTAGA-1

using 276 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [1]

====================================================================================

UMI info for barcode GTTAAGCAGAGGTAGA-1 contig 1 = AGCCTCAGCA...
umi CGTATTTTCT = 253 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=571]
0-31 ==> 29-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
31-390 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=2)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
428-571 ==> 0-143 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQTWGTGTPWVF at 364, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 31, 192, 232, 248, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.141 = GTTAAGCAGCGTAGTG-1

using 82 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 13[2, 3, 4^2, 5^2, 7^4, 8, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.144 = GTTAAGCAGCTGAACG-1

using 621 reads

====================================================================================

graph has 246 edges initially, 34 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 81, 245, 289]
surviving nonsolo ucounts = 3[81, 245, 289]
ids = [0, 5, 6]

====================================================================================

UMI info for barcode GTTAAGCAGCTGAACG-1 contig 1 = AGGAGTCAGT...
umi AATATCGTGT = 78 reads: +55 -1XX +332 invalidated

UMI info for barcode GTTAAGCAGCTGAACG-1 contig 2 = GAGGAGTCAG...
umi TATCTGATGG = 293 reads: +259 -1XX +128 invalidated

UMI info for barcode GTTAAGCAGCTGAACG-1 contig 3 = CCCTAGATCA...
umi GGGAAATCGT = 231 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false

TIG 2[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPRTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 28, 34, 90, 103, 239, 458
confident = false

TIG 3[bases=532]
0-22 ==> 37-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
22-375 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
424-458 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
458-532 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 364, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 22, 220, 225, 242, 286, 319, 512
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.145 = GTTAAGCAGGACTGGT-1

using 25 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.147 = GTTAAGCAGGCCCTCA-1

using 275 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

UMI info for barcode GTTAAGCAGGCCCTCA-1 contig 1 = ACATGGGAAG...
umi CACCAATGCG = 264 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=547]
46-183 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
183-309 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
476-547 ==> 0-71 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 385, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 2, 46, 90, 355
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_86.147_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.151 = GTTAAGCAGTACGCCC-1

using 285 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 273]
surviving nonsolo ucounts = 1[273]
ids = [6]

====================================================================================

UMI info for barcode GTTAAGCAGTACGCCC-1 contig 1 = GGAGTCAGAC...
umi TACCTTCCCT = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
414-476 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 26, 32, 88, 101, 237, 240, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.152 = GTTAAGCAGTCCCACG-1

using 323 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 309]
surviving nonsolo ucounts = 1[309]
ids = [1]

====================================================================================

UMI info for barcode GTTAAGCAGTCCCACG-1 contig 1 = GAGTCAGACT...
umi ATTTCACCTT = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=453]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-453 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 25, 31, 87, 100, 236, 239, 332, 362
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.155 = GTTAAGCAGTCTCCTC-1

using 221 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 5, 210]
surviving nonsolo ucounts = 1[210]
ids = [4]

====================================================================================

UMI info for barcode GTTAAGCAGTCTCCTC-1 contig 1 = GGCAAACAGA...
umi TGCGTCCTCT = 201 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-551 ==> 0-123 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSAWDSSLNVWVF at 361, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 40, 179, 369, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.158 = GTTAAGCAGTGGAGAA-1

using 59 reads

====================================================================================

graph has 85 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^2, 7, 8, 11, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.160 = GTTAAGCAGTGGGCTA-1

using 274 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 268]
surviving nonsolo ucounts = 1[268]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=555]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 33, 241, 367, 461
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.166 = GTTAAGCCAACTGCGC-1

using 693 reads

====================================================================================

graph has 320 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 211, 226, 249]
surviving nonsolo ucounts = 3[211, 226, 249]
ids = [5, 4, 6]

====================================================================================

UMI info for barcode GTTAAGCCAACTGCGC-1 contig 1 = AGCTTCAGCT...
umi TCGTTACCTA = 209 reads: +388 validated
umi TGGGATGTTC = 250 reads: +388 validated

UMI info for barcode GTTAAGCCAACTGCGC-1 contig 2 = GAGAGAGGAG...
umi GTCCAGGTGG = 224 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=602]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-602 ==> 0-167 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 67 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 450
start codons at 47, 201, 351, 376, 381
confident = true

TIG 2[bases=529]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-529 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 73, 224, 229, 376, 454
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.169 = GTTAAGCCAAGCTGGA-1

using 581 reads

====================================================================================

graph has 241 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 274, 300]
surviving nonsolo ucounts = 2[274, 300]
ids = [0, 3]

====================================================================================

UMI info for barcode GTTAAGCCAAGCTGGA-1 contig 1 = TGGGCCTAAG...
umi CCAGTCTGCC = 276 reads: +388 validated
umi GCCCCAGGAT = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 215-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
36-366 ==> 0-330 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=26)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CQVWDGDIYHPDVSF at 351, score = 8 + 7
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 569
start codons at 36, 97, 334, 359, 364, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.175 = GTTAAGCCACATTCGA-1

using 702 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 85, 606]
surviving nonsolo ucounts = 2[85, 606]
ids = [4, 1]

====================================================================================

UMI info for barcode GTTAAGCCACATTCGA-1 contig 1 = GGGACTGATC...
umi CACGTTCGCC = 606 reads: +397 validated
umi GACAGATCCG = 87 reads: +275 -1XX +121 invalidated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 110 reads
cdr3 = CMQALQTPVTF at 372, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 683
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.181 = GTTAAGCCACTGCCAG-1

using 279 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [1]

====================================================================================

UMI info for barcode GTTAAGCCACTGCCAG-1 contig 1 = GCTGGGGTCT...
umi AGCTCTTTTG = 268 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=537]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
432-537 ==> 0-105 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSSTLGVF at 365, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.191 = GTTAAGCCAGTCCTTC-1

using 12 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.192 = GTTAAGCCAGTCTTCC-1

using 1027 reads

====================================================================================

graph has 1542 edges initially, 4 edges after simplification

total ucounts = 504
nonsolo ucounts = 219[2^92, 3^59, 4^34, 5^7, 6^11, 7^8, 8^2, 9^2, 12, 13, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.195 = GTTAAGCCATACTCTT-1

using 597 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[4, 6, 247, 339]
surviving nonsolo ucounts = 2[247, 339]
ids = [3, 2]

====================================================================================

UMI info for barcode GTTAAGCCATACTCTT-1 contig 1 = GATCAGGACT...
umi CCAGCTTTGC = 340 reads: +397 validated
umi CCGGCTTTGC = 247 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-375 ==> 0-345 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=15)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CMQALHLPLTF at 366, score = 9 + 9
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 578
start codons at 30, 63, 99, 150, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.196 = GTTAAGCCATATGAGA-1

using 190 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 185]
surviving nonsolo ucounts = 1[185]
ids = [0]

====================================================================================

UMI info for barcode GTTAAGCCATATGAGA-1 contig 1 = TGAGCGCAGA...
umi AATATGGCCC = 182 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=512]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=12)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
427-512 ==> 0-85 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CATWETSLSAPYVF at 357, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 36, 190, 365, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.197 = GTTAAGCCATCACGAT-1

using 13 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.200 = GTTAAGCCATCGACGC-1

using 15 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.201 = GTTAAGCCATGCCACG-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.213 = GTTAAGCGTCTACCTC-1

using 480 reads

====================================================================================

graph has 185 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 473]
surviving nonsolo ucounts = 1[473]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=324]
0-75 ==> 281-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
75-113 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
113-324 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 43, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 465
start codons at 26, 53, 77, 245
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.215 = GTTAAGCGTCTCTCGT-1

using 566 reads

====================================================================================

graph has 278 edges initially, 26 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[149, 165, 249]
surviving nonsolo ucounts = 3[149, 165, 249]
ids = [5, 3, 1]

====================================================================================

UMI info for barcode GTTAAGCGTCTCTCGT-1 contig 1 = GAGGAATCAG...
umi GCGCGTTTAG = 165 reads: +110 -1XX +13 -1XX +263 invalidated

UMI info for barcode GTTAAGCGTCTCTCGT-1 contig 2 = GTCAGTCTCA...
umi ACCGCACCGC = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQTYRTPRTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.219 = GTTAAGCGTGACTCAT-1

using 432 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^2, 3, 4, 203, 217]
surviving nonsolo ucounts = 2[203, 217]
ids = [5, 4]

====================================================================================

UMI info for barcode GTTAAGCGTGACTCAT-1 contig 1 = AGCTGTGGGC...
umi CTTATTTATC = 200 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=589]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=3)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
422-589 ==> 0-167 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CNSRDRSDTQWVF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 40, 159, 188, 239, 265, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.221 = GTTAAGCGTGCACTTA-1

using 1121 reads

====================================================================================

graph has 326 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[547, 572]
surviving nonsolo ucounts = 2[547, 572]
ids = [1, 0]

====================================================================================

UMI info for barcode GTTAAGCGTGCACTTA-1 contig 1 = GGGAGGAATC...
umi ACAAATCATC = 581 reads: +388 validated
umi AGCAGGATGG = 545 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 188 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 1113
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.222 = GTTAAGCGTGGTACAG-1

using 109 reads

====================================================================================

graph has 82 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 14[2^2, 4^3, 5, 6^2, 8, 9, 13, 14^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.223 = GTTAAGCGTGTGGCTC-1

using 70 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 10[2, 3, 4^2, 6^2, 8, 9, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.224 = GTTAAGCGTTACGCGC-1

using 678 reads

====================================================================================

graph has 272 edges initially, 12 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[261, 415]
surviving nonsolo ucounts = 2[261, 415]
ids = [1, 0]

====================================================================================

UMI info for barcode GTTAAGCGTTACGCGC-1 contig 1 = GGAGAAGAGC...
umi TAACGTCGGC = 355 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
421-502 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CQQYGSSPGTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 36, 244, 370, 463
confident = false

REJECT CONTIGS

TIG 1[bases=511]
0-76 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
31-391 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-511 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 351, score = 4 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 31, 64, 100, 188, 350, 370, 472
confident = false
not full
frameshifted full length transcript of length 511
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.225 = GTTAAGCGTTAGTGGG-1

using 502 reads

====================================================================================

graph has 680 edges initially, 2 edges after simplification

total ucounts = 271
nonsolo ucounts = 95[2^39, 3^21, 4^16, 5^8, 6^6, 7, 8, 10^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.235 = GTTAAGCTCATACGGT-1

using 333 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 325]
surviving nonsolo ucounts = 1[325]
ids = [4]

====================================================================================

UMI info for barcode GTTAAGCTCATACGGT-1 contig 1 = TGGGGAGGAA...
umi GTCCTAATAC = 325 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 37, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.237 = GTTAAGCTCATGTGGT-1

using 565 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 266, 291]
surviving nonsolo ucounts = 2[266, 291]
ids = [1, 2]

====================================================================================

UMI info for barcode GTTAAGCTCATGTGGT-1 contig 1 = GAATCAGTCC...
umi GTGTGAGAGG = 269 reads: +388 validated
umi TATATACAGT = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 548
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.248 = GTTAAGCTCGCGATCG-1

using 819 reads

====================================================================================

graph has 304 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^3, 3, 4, 250, 256, 299]
surviving nonsolo ucounts = 3[250, 256, 299]
ids = [7, 1, 5]

====================================================================================

UMI info for barcode GTTAAGCTCGCGATCG-1 contig 1 = GGAACTGCTC...
umi GTCGCTGCTG = 299 reads: +382 validated

UMI info for barcode GTTAAGCTCGCGATCG-1 contig 2 = GGGGGCTTTC...
umi AATTTACCCC = 254 reads: +448 validated

UMI info for barcode GTTAAGCTCGCGATCG-1 contig 3 = GGGGTCACAA...
umi TGCCTTCTGC = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWSFTF at 352, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 31, 236, 239, 455
confident = false

TIG 2[bases=559]
18-393 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=33)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
466-559 ==> 0-93 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARSVHFYETVGYFDYW at 384, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 18, 27, 39, 83, 406
confident = false

TIG 3[bases=573]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=3)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-573 ==> 0-147 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CCSYAGSSTLVF at 362, score = 8 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 38, 177, 239, 246, 372, 558
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.250 = GTTAAGCTCGCGTAGC-1

using 58 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 1[56]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.252 = GTTAAGCTCGTATCAG-1

using 396 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 393]
surviving nonsolo ucounts = 1[393]
ids = [2]

====================================================================================

UMI info for barcode GTTAAGCTCGTATCAG-1 contig 1 = GGGATCATCC...
umi TTGAGTATGA = 393 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=556]
0-61 ==> 0-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=2)
61-414 ==> 0-353 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=13)
425-441 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
439-485 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAALPSPMTTVTKGDYW at 403, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 61, 121, 264, 337, 358, 424
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.253 = GTTAAGCTCGTTACGA-1

using 511 reads

====================================================================================

graph has 148 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 6[2, 3, 5, 6, 7, 480]
surviving nonsolo ucounts = 1[480]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.256 = GTTAAGCTCTATCCTA-1

using 13816 reads

====================================================================================

graph has 6775 edges initially, 62 edges after simplification

total ucounts = 1198
nonsolo ucounts = 618[2^218, 3^144, 4^67, 5^52, 6^31, 7^17, 8^18, 9^7, 10^4, 11^3, 13^4, 14, 16, 17, 21, 22, 28, 33, 42, 81^2, 82, 94, 103, 118, 120, 135, 137, 143, 146^2, 153, 180, 185, 191, 205, 216, 223, 251^2, 252, 254, 255, 258, 263, 266, 272, 273, 276, 280, 297, 307, 309, 312, 313, 330, 348, 381, 387^2, 399, 437, 439, 474]
surviving nonsolo ucounts = 43[33, 81^2, 82, 103, 118, 120, 137, 143, 146^2, 153, 185, 191, 205, 216, 223, 251^2, 252, 254, 255, 258, 263, 266, 272, 273, 276, 280, 297, 307, 309, 312, 313, 330, 348, 381, 387^2, 399, 437, 439, 474]
ids = [93, 359, 556, 127, 172, 48, 188, 667, 741, 100, ...]

====================================================================================

UMI info for barcode GTTAAGCTCTATCCTA-1 contig 1 = AGAGCTCTGG...
umi AATAGGCGCC = 116 reads: +385 validated
umi ACCAGCTATT = 32 reads: +82 -1 +217 -3 +56 -26 non-validated
umi ACTTTTTAAA = 396 reads: +385 validated
umi AGCGCATCCG = 102 reads: +385 validated
umi CATCGTCAAT = 79 reads: +385 validated
umi CCACAGCCCA = 250 reads: +385 validated
umi CCGGTCGTCA = 274 reads: +385 validated
umi CCTCACTTCC = 440 reads: +385 validated
umi CGGGCCCTTT = 81 reads: +385 validated
umi CGTTCTACAT = 313 reads: +385 validated
umi CTATACGACT = 252 reads: +385 validated
umi CTCATTCTGG = 256 reads: +385 validated
umi CTCTTCATAG = 248 reads: +385 validated
umi CTGCAGGGGC = 146 reads: +385 validated
umi CTGCTTTGAC = 394 reads: +385 validated
umi GAGTCATACC = 315 reads: +385 validated
umi GCCAATTTAC = 276 reads: +385 validated
umi GCCTAAACAA = 445 reads: +385 validated
umi GCTCTTATAC = 279 reads: +385 validated
umi GTAGCGATGC = 315 reads: +385 validated
umi GTTCCAGTCA = 272 reads: +385 validated
umi GTTCTTCTTA = 308 reads: +385 validated
umi TCCCGGGAAT = 471 reads: +385 validated
umi TCGGTTCGCA = 352 reads: +385 validated
umi TCTATATAAC = 389 reads: +385 validated
umi TGTGCTCTCT = 248 reads: +385 validated
umi TTACGGCCCC = 389 reads: +385 validated

UMI info for barcode GTTAAGCTCTATCCTA-1 contig 2 = GAGCTCTGGG...
umi AATGTTATCG = 157 reads: +424 validated
umi ACCCCAGTTC = 142 reads: +424 validated
umi ACTATATGCT = 85 reads: +181 -2XX +1 -5XX +1 -15XX +1 -50X +1 -5XX +1 -3XX +120 -20 +18 invalidated
umi ACTGCGTACC = 299 reads: +412 -1 +1 -1 +1 -1 +1 -1 +3 -1 +1 non-validated
umi AGGTGCTAGT = 121 reads: +378 -1 +4 -2 +39 non-validated
umi CAATTGACCA = 208 reads: +424 validated
umi CCATGACCGC = 187 reads: +424 validated
umi CGCATGTCTA = 273 reads: +424 validated
umi CTACGCGTCC = 191 reads: +424 validated
umi CTCTGGCCTT = 223 reads: +424 validated
umi CTTCCAGCGC = 322 reads: +424 validated
umi CTTCCGTCTT = 138 reads: +407 -17 non-validated
umi GCAATTTCAC = 128 reads: +395 -1 +28 non-validated
umi GGCGCTGTTG = 253 reads: +424 validated
umi TGCTATCGCC = 249 reads: +424 validated
umi TGTCTACAAG = 209 reads: +409 -15 non-validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 1047 reads
cdr3 = CQQYGSSPLTF at 368, score = 9 + 9
umis assigned: [48, 93, 159, 172, 359, 387, 470, 495, 556, 578] and 17 others
of which 27 are surviving nonsolos
reads assigned: 7331
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=575]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=3)
454-504 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 180 reads
cdr3 = CAAVDSSWIDFGAFDIW at 422, score = 9 + 8
umis assigned: [61, 100, 127, 142, 188, 289, 410, 541, 589, 634] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3122
start codons at 80, 231, 236, 294, 297, 315, 383, 485
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGGCGGTCGACAGCAGCTGGATCGATTTTGGTGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.264 = GTTACAGAGAAACCAT-1

using 334 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6, 8, 316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode GTTACAGAGAAACCAT-1 contig 1 = AGTCTGGGCC...
umi ACTAGCCTAA = 317 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-380 ==> 0-340 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQVWDSSSGHVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 40, 101, 239, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.275 = GTTACAGAGAGACTTA-1

using 10371 reads

====================================================================================

graph has 9647 edges initially, 168 edges after simplification

total ucounts = 1973
nonsolo ucounts = 1447[2^240, 3^189, 4^149, 5^153, 6^126, 7^82, 8^76, 9^87, 10^60, 11^59, 12^48, 13^36, 14^35, 15^29, 16^18, 17^20, 18^6, 19^8, 20^8, 21^5, 22^3, 23^3, 24, 25^2, 26, 27, 41^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.277 = GTTACAGAGATAGCAT-1

using 429 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[6, 421]
surviving nonsolo ucounts = 1[421]
ids = [2]

====================================================================================

UMI info for barcode GTTACAGAGATAGCAT-1 contig 1 = GGAGAAGAGC...
umi TGAGCGCAAT = 428 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=5)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 76 reads
cdr3 = CQQYGSSPCSF at 360, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 419
start codons at 36, 346, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.294 = GTTACAGAGGCAATTA-1

using 826 reads

====================================================================================

graph has 442 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 4, 130, 137, 546]
surviving nonsolo ucounts = 2[137, 546]
ids = [1, 7]

====================================================================================

UMI info for barcode GTTACAGAGGCAATTA-1 contig 1 = GTGGGCTCAG...
umi CTCTGCTCAT = 528 reads: +385 validated

UMI info for barcode GTTACAGAGGCAATTA-1 contig 2 = TAGGACCCAG...
umi AATGACCTAC = 135 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=17)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-548 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 513
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false

TIG 2[bases=536]
18-366 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
361-400 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
400-536 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYGSSRTF at 342, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 134
start codons at 18, 226, 352, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.295 = GTTACAGAGGCCGAAT-1

using 219 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [2]

====================================================================================

UMI info for barcode GTTACAGAGGCCGAAT-1 contig 1 = GCTCTGCCTC...
umi GTGAGATGCT = 210 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=604]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
445-604 ==> 0-159 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQSYDTSLSGSNVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.303 = GTTACAGAGTCTCCTC-1

using 287 reads

====================================================================================

graph has 118 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 22, 262]
surviving nonsolo ucounts = 1[262]
ids = [1]

====================================================================================

UMI info for barcode GTTACAGAGTCTCCTC-1 contig 1 = GGGGGGTCTC...
umi CTTAGGGTGC = 283 reads: +91 -1XX +296 invalidated
umi TACTCCTCAA = 14 reads: -19X +21 -1XX +92 -1XX +2 -1XX +3 -2XX +4 -2XX +2 -1XX +6 -1X +1 -59X +3 -1XX +11 -1XX +4 -1X +1 -1XX +22 -1XX +5 -1XX +14 -1X +8 -1XX +33 -2XX +7 -2XX +2 -6XX +1 -41 invalidated

GOOD CONTIGS

TIG 1[bases=533]
40-401 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=10)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
428-533 ==> 0-105 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYTSSSTLVF at 364, score = 8 + 9
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.305 = GTTACAGAGTGCAAGC-1

using 314 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 307]
surviving nonsolo ucounts = 1[307]
ids = [5]

====================================================================================

UMI info for barcode GTTACAGAGTGCAAGC-1 contig 1 = GGGAGGAATC...
umi TGTCAACTAC = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-479 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 30, 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.306 = GTTACAGAGTGGGATC-1

using 410 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[407]
surviving nonsolo ucounts = 1[407]
ids = [1]

====================================================================================

UMI info for barcode GTTACAGAGTGGGATC-1 contig 1 = GTCAGACCCA...
umi GAAATTACGC = 413 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=13)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQANSVPFTF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 404
start codons at 23, 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.307 = GTTACAGAGTGTACTC-1

using 385 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 375]
surviving nonsolo ucounts = 1[375]
ids = [1]

====================================================================================

UMI info for barcode GTTACAGAGTGTACTC-1 contig 1 = GAATCAGTCC...
umi AGTTGACGGG = 338 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-495 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.311 = GTTACAGCAAATTGCC-1

using 17 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.315 = GTTACAGCAAGTTCTG-1

using 287 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 279]
surviving nonsolo ucounts = 1[279]
ids = [0]

====================================================================================

UMI info for barcode GTTACAGCAAGTTCTG-1 contig 1 = GCTGGGGTCT...
umi ACTTAGTTAC = 278 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-383 ==> 0-342 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
435-554 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CSSYTSRITLGVIF at 365, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.329 = GTTACAGCACTCAGGC-1

using 607 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[603]
surviving nonsolo ucounts = 1[603]
ids = [3]

====================================================================================

UMI info for barcode GTTACAGCACTCAGGC-1 contig 1 = GATCAGGACT...
umi CGTTCACCGC = 606 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 599
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.330 = GTTACAGCAGACAGGT-1

using 219 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [4]

====================================================================================

UMI info for barcode GTTACAGCAGACAGGT-1 contig 1 = AGTGCTTTCT...
umi TATGACCTAT = 202 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=565]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-565 ==> 0-97 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 17, 38, 82, 168, 255, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.337 = GTTACAGCATAGAAAC-1

using 20108 reads

====================================================================================

graph has 7096 edges initially, 94 edges after simplification

total ucounts = 822
nonsolo ucounts = 429[2^134, 3^89, 4^52, 5^33, 6^29, 7^8, 8^8, 9^2, 11^2, 13, 14, 15^3, 16, 17^2, 26, 35, 41, 48, 62, 89, 96, 97, 104, 114, 120, 140, 152, 158, 163, 191, 199, 200, 201, 202, 203, 204, 205, 206, 209, 211, 212, 215, 223^2, 225, 231, 233, 237, 238, 239^2, 247, 261^2, 263^3, 267, 268, 274, 275, 281, 282, 285, 286, 301, 306, 317, 330, 371, 462, 586, 657, 852, 946, 961, 1134, 1161]
surviving nonsolo ucounts = 57[62, 89, 96, 114, 140, 152, 158, 163, 191, 199, 200, 201, 202, 203, 204, 205, 206, 209, 211, 212, 215, 223^2, 225, 231, 233, 237, 238, 239^2, 247, 261^2, 263^3, 267, 268, 274, 275, 281, 282, 285, 286, 301, 306, 317, 330, 371, 462, 586, 657, 852, 946, 961, 1134, 1161]
ids = [112, 350, 616, 250, 615, 56, 325, 667, 87, 638, ...]

====================================================================================

UMI info for barcode GTTACAGCATAGAAAC-1 contig 1 = ATCACATAAC...
umi ACTTTCAGCA = 59 reads: +424 -30 non-validated
umi AGCCTTTCCT = 303 reads: +454 validated
umi CAGCCCCCAC = 331 reads: +454 validated
umi CGACATTACC = 7 reads: -454 non-validated
umi TAGTTTTCCT = 89 reads: -379X +1 -14X +1 -1X +1 -2X +55 invalidated
umi TGAGCGGGCA = 217 reads: +454 validated

UMI info for barcode GTTACAGCATAGAAAC-1 contig 2 = GGGGTCACAA...
umi AATTTATAAC = 217 reads: +188 -2XX +201 invalidated
umi ACACGTCTAT = 286 reads: +391 validated
umi ACACTACCTT = 155 reads: +391 validated
umi ACCTATCGTA = 210 reads: +391 validated
umi ACCTATGGCA = 264 reads: +391 validated
umi ACGGTATTGG = 190 reads: +391 validated
umi ACTCCACGTC = 285 reads: +391 validated
umi ACTGTGGCAT = 202 reads: +391 validated
umi AGAGTATCCT = 225 reads: +391 validated
umi AGCCCCAGTC = 201 reads: +391 validated
umi ATCAGTCAGC = 219 reads: +391 validated
umi CAAGAAACTA = 261 reads: +391 validated
umi CAGGTTTGCC = 111 reads: +4 -1 +1 -2 +2 -3 +1 -1 +376 non-validated
umi CATAAGGTAC = 204 reads: +391 validated
umi CATTGTTAGT = 282 reads: +391 validated
umi CCAATACAAA = 244 reads: +391 validated
umi CCCGTGGTAT = 230 reads: +391 validated
umi CCGTAGTCAT = 220 reads: +198 -2XX +191 invalidated
umi CCGTTCCTAA = 158 reads: +391 validated
umi CTGATTCTTC = 298 reads: +391 validated
umi GCAAGCATTC = 370 reads: +391 validated
umi GCAATCTCAA = 234 reads: +391 validated
umi TAGTGACCTC = 141 reads: +391 validated
umi TATAACGACC = 243 reads: +391 validated
umi TATTATGGAT = 275 reads: +391 validated
umi TCACATTGTT = 195 reads: +391 validated
umi TCCCGTGTCC = 268 reads: +391 validated
umi TCCGCAACTG = 204 reads: +391 validated
umi TCCGGAGCAA = 203 reads: +391 validated
umi TCCTTAAGCA = 159 reads: +391 validated
umi TCGTCTCTTT = 272 reads: +391 validated
umi TCTTTACTCT = 235 reads: +391 validated
umi TGCCTTATCC = 320 reads: +391 validated
umi TGCGATCCAT = 458 reads: +391 validated
umi TGCTTCCCTT = 241 reads: +391 validated
umi TGTATCCCTT = 586 reads: +391 validated
umi TGTGCATCGC = 263 reads: +391 validated
umi TTAATACTGC = 263 reads: +391 validated
umi TTACATGCAT = 240 reads: +391 validated
umi TTACCCTTCT = 268 reads: +391 validated
umi TTATTATTCA = 203 reads: +391 validated
umi TTCATGTGAA = 267 reads: +391 validated
umi TTTCCTTCTC = 285 reads: +391 validated
umi TTTTGTCCCA = 226 reads: +391 validated
umi TTTTTTTCAC = 211 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=583]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=2)
420-441 ==> 0-21 on |21|IGHD3-3|D-REGION| [len=31] (mis=2)
457-512 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 3 umis using 64 reads
cdr3 = CASGGSSNYDFWSGPPPDWYYYGMDVW at 400, score = 9 + 7
umis assigned: [112, 132, 246, 350, 616, 710]
of which 6 are surviving nonsolos
reads assigned: 993
start codons at 58, 209, 256, 355, 469
confident = true

TIG 2[bases=640]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 45 umis using 1707 reads
cdr3 = CCSYAGSSTPYVF at 362, score = 8 + 8
umis assigned: [46, 55, 56, 75, 76, 87, 99, 106, 125, 130] and 35 others
of which 45 are surviving nonsolos
reads assigned: 10888
start codons at 38, 177, 239, 246, 372, 393, 561
confident = true

REJECT CONTIGS

TIG 1[bases=341]
4-46 ==> 3108-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=4)
92-130 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
130-341 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [129, 252, 373, 540, 623, 791]
of which 6 are surviving nonsolos
reads assigned: 5639
start codons at 73
confident = false
did not find CDR3
now this is a cell
paired!

GGCTCCTCCAATTACGATTTTTGGAGTGGCCCACCCCCGGATTGGTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACCCCATATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.359 = GTTACAGGTAGGCTGA-1

using 486 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[215, 269]
surviving nonsolo ucounts = 2[215, 269]
ids = [2, 0]

====================================================================================

UMI info for barcode GTTACAGGTAGGCTGA-1 contig 1 = AGTGACTCCT...
umi CCAGTATCGT = 207 reads: +439 validated

UMI info for barcode GTTACAGGTAGGCTGA-1 contig 2 = GATGCTTTCT...
umi AATATGGCCC = 233 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=508]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=12)
409-459 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
459-508 ==> 0-49 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAHRLSGALVWEYVKDTFDIW at 365, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 20, 64, 243, 246, 326, 335, 402, 440
confident = false

TIG 2[bases=494]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=2)
414-465 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
465-494 ==> 0-29 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAGKSGYSSTISWFDPW at 383, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 1, 17, 26, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.377 = GTTACAGGTGGTCTCG-1

using 344 reads

====================================================================================

graph has 570 edges initially, 6 edges after simplification

total ucounts = 175
nonsolo ucounts = 56[2^23, 3^8, 4^6, 5^8, 6^4, 7, 8^3, 9, 10, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.389 = GTTACAGTCAACGGGA-1

using 296 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode GTTACAGTCAACGGGA-1 contig 1 = GTCAGTCTCA...
umi CTGACGGGGT = 285 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPRFTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 23, 29, 85, 98, 234, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.392 = GTTACAGTCAGCGACC-1

using 956 reads

====================================================================================

graph has 1248 edges initially, 6 edges after simplification

total ucounts = 371
nonsolo ucounts = 157[2^63, 3^32, 4^26, 5^8, 6^7, 7^6, 8^6, 9, 10^3, 11^2, 13, 14, 156]
surviving nonsolo ucounts = 1[156]
ids = [311]

====================================================================================

UMI info for barcode GTTACAGTCAGCGACC-1 contig 1 = AGCTGGGATC...
umi TGCGTAGTTA = 153 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=513]
0-40 ==> 19-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
40-393 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=19)
416-464 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
464-513 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARILSFRDSSGYFDNW at 382, score = 8 + 7
umis assigned: [311]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 40, 214, 238, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.393 = GTTACAGTCAGCTCGG-1

using 1203 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[7, 387, 808]
surviving nonsolo ucounts = 2[387, 808]
ids = [0, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.395 = GTTACAGTCAGGTAAA-1

using 1237 reads

====================================================================================

graph has 1828 edges initially, 14 edges after simplification

total ucounts = 579
nonsolo ucounts = 247[2^97, 3^48, 4^47, 5^25, 6^14, 7^2, 8^3, 9^2, 10^4, 11, 12, 13, 18, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.414 = GTTACAGTCTAGCACA-1

using 304 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[303]
surviving nonsolo ucounts = 1[303]
ids = [0]

====================================================================================

UMI info for barcode GTTACAGTCTAGCACA-1 contig 1 = ACATGGGAAG...
umi ATCTAACAAG = 282 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=481]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
405-455 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
455-481 ==> 0-26 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASQLYLDAFDIW at 385, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 2, 25, 46, 90, 176, 407, 436, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.422 = GTTACAGTCTTTACAC-1

using 2041 reads

====================================================================================

graph has 2844 edges initially, 38 edges after simplification

total ucounts = 937
nonsolo ucounts = 402[2^167, 3^79, 4^63, 5^27, 6^21, 7^15, 8^9, 9^6, 10^5, 11^3, 12^2, 13, 14, 16, 18, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.425 = GTTCATTAGAAGATTC-1

using 234 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.433 = GTTCATTAGATACACA-1

using 303 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 5, 291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

UMI info for barcode GTTCATTAGATACACA-1 contig 1 = GATCAGGACT...
umi CGGGCCCTGT = 293 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=1)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CMQSIQLPITF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 30, 63, 99, 187, 250, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.440 = GTTCATTAGCCAGGAT-1

using 715 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 4, 5, 332, 364]
surviving nonsolo ucounts = 2[332, 364]
ids = [0, 1]

====================================================================================

UMI info for barcode GTTCATTAGCCAGGAT-1 contig 1 = GGACTCCTGT...
umi ACCCTAATCA = 330 reads: +418 validated

UMI info for barcode GTTCATTAGCCAGGAT-1 contig 2 = ATCACATAAC...
umi ACATAATAGA = 335 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=538]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-538 ==> 0-102 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 18, 174, 241, 333, 490
confident = false

TIG 2[bases=565]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
417-445 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=0)
444-494 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
494-565 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARGQVAYCGGDCYSDAFDIW at 400, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 58, 209, 256, 355, 446, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.443 = GTTCATTAGCGATAGC-1

using 328 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[321]
surviving nonsolo ucounts = 1[321]
ids = [6]

====================================================================================

UMI info for barcode GTTCATTAGCGATAGC-1 contig 1 = TGGGAGGAGT...
umi GGCAGGCGCC = 298 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=461]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
416-461 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPSF at 358, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 31, 37, 93, 106, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.447 = GTTCATTAGCTGAACG-1

using 254 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 248]
surviving nonsolo ucounts = 1[248]
ids = [4]

====================================================================================

UMI info for barcode GTTCATTAGCTGAACG-1 contig 1 = GGGGGAGAGG...
umi TTGAACTAGA = 238 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=525]
75-428 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=14)
463-511 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARTVDFWSDLTPGPYYFDYW at 417, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 75, 231, 289, 292, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.451 = GTTCATTAGGACTGGT-1

using 179 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[178]
surviving nonsolo ucounts = 1[178]
ids = [0]

====================================================================================

UMI info for barcode GTTCATTAGGACTGGT-1 contig 1 = GGGGTCACAA...
umi CCGCATGTAA = 174 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=517]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
432-517 ==> 0-85 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 30 reads
cdr3 = CCSEAGGGVPGLLF at 362, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 38, 192
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.453 = GTTCATTAGGCATGGT-1

using 360 reads

====================================================================================

graph has 144 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 158, 191]
surviving nonsolo ucounts = 2[158, 191]
ids = [0, 3]

====================================================================================

UMI info for barcode GTTCATTAGGCATGGT-1 contig 1 = GGAGGAATCA...
umi AACAAACCAG = 150 reads: +388 validated

UMI info for barcode GTTCATTAGGCATGGT-1 contig 2 = GCTCTGCTTC...
umi CGTATACCGT = 176 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-498 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 29, 35, 104, 240, 459
confident = false

TIG 2[bases=499]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-499 ==> 0-57 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.461 = GTTCATTAGTGGCACA-1

using 191 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 185]
surviving nonsolo ucounts = 1[185]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.466 = GTTCATTCAAAGCGGT-1

using 12555 reads

====================================================================================

graph has 5070 edges initially, 92 edges after simplification

total ucounts = 689
nonsolo ucounts = 355[2^114, 3^78, 4^41, 5^28, 6^21, 7^11, 8^7, 9^4, 10, 11^3, 12^2, 13^2, 14, 17, 51, 81, 88, 103, 107, 110, 112^2, 131, 141, 144, 168, 173, 174, 188, 218, 240, 247, 257^2, 270, 271, 279, 285, 288, 289, 292, 315, 318, 335^2, 352, 378, 382, 393, 397, 405, 409, 440, 695, 806]
surviving nonsolo ucounts = 38[81, 88, 103, 110, 112^2, 131, 144, 168, 173, 174, 188, 218, 240, 247, 257^2, 270, 271, 279, 285, 288, 289, 292, 315, 318, 335^2, 352, 378, 382, 393, 397, 405, 409, 440, 695, 806]
ids = [591, 151, 44, 512, 532, 675, 192, 376, 185, 113, ...]

====================================================================================

UMI info for barcode GTTCATTCAAAGCGGT-1 contig 1 = TGAGCGCAGA...
umi ACCTAGTCTG = 257 reads: +388 validated
umi ATCGCCACGC = 321 reads: +388 validated
umi ATCGGCCACG = 280 reads: +388 validated
umi CAAGCAGACC = 89 reads: +388 validated
umi CAAGTCGCAC = 769 reads: -358 +4 -1X +5 -1XX +3 -1XX +1 -1XX +11 -1XX +1 invalidated
umi CAGCCTCGAG = 287 reads: +388 validated
umi CTATTCTTGC = 175 reads: +388 validated
umi CTTACGGGGG = 709 reads: -350X +1 -1XX +22 -1XX +13 invalidated
umi GCGAGTCCTC = 318 reads: +388 validated
umi GCGATCGGGT = 276 reads: +388 validated
umi TATGTCTCAA = 108 reads: +388 validated

UMI info for barcode GTTCATTCAAAGCGGT-1 contig 2 = GGGGAGGAGT...
umi AAATATGGAA = 337 reads: +367 validated
umi AAGACTTACA = 288 reads: +367 validated
umi ACGTAGGCCA = 100 reads: -348 +3 -16XX invalidated
umi CAGCCAGACT = 392 reads: +367 validated
umi CAGTGCCTTG = 167 reads: +367 validated
umi CCCTGTGAGT = 409 reads: +367 validated
umi CCGAGCTCTT = 446 reads: +297 -1XX +69 invalidated
umi CCGGCTGCTC = 352 reads: +367 validated
umi CCTGCTTATA = 384 reads: +367 validated
umi CGCTACCTCT = 274 reads: +367 validated
umi CTTTGGTCGA = 338 reads: +367 validated
umi GATTAATCCA = 239 reads: +367 validated
umi GCCCCCTCAC = 294 reads: +367 validated
umi TAAAACCTCG = 253 reads: +367 validated
umi TAGGCCTGTA = 391 reads: +367 validated
umi TGACGATGCC = 247 reads: +367 validated
umi TTGATTACTC = 376 reads: +367 validated
umi TTGCGTGTCG = 190 reads: +367 validated
umi TTGGATGAGT = 271 reads: +367 validated
umi TTTGGTCGGG = 405 reads: +367 validated

UMI info for barcode GTTCATTCAAAGCGGT-1 contig 3 = TATATGGGGT...
umi CATATACCTA = 132 reads: +430 validated
umi GGTCGCATTG = 3 reads: -412X +1 -1X +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi TCATCGATCG = 13 reads: -253 +1 -1X +1 -11X +1 -3XX +1 -2XX +1 -4XX +1 -2XX +114 -34 invalidated
umi TGATACGTTC = 81 reads: +406 -24 non-validated
umi TTTGAGGCCA = 111 reads: +423 -7 non-validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=6)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 313 reads
cdr3 = CATWDSSLSAGVF at 357, score = 6 + 8
umis assigned: [40, 119, 120, 151, 153, 182, 290, 313, 389, 390] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3532
start codons at 36, 241, 365
confident = true

TIG 2[bases=538]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-206 ==> 0-175 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
206-364 ==> 193-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=7)
370-398 ==> 10-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
402-538 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 939 reads
cdr3 = CPQYDNVPRG at 340, score = 9 + 6
umis assigned: [5, 15, 44, 180, 185, 223, 226, 229, 238, 265] and 10 others
of which 20 are surviving nonsolos
reads assigned: 6054
start codons at 31, 37, 93, 106, 227, 350, 356, 444
confident = true
see deletion of 18 bases at pos 175 on |227|IGKV1-33|L-REGION+V-REGION|

TIG 3[bases=580]
84-439 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=37)
465-514 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
514-580 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CAKDISVAAFSFYYGMDVW at 426, score = 8 + 7
umis assigned: [192, 435, 532, 591, 675]
of which 4 are surviving nonsolos
reads assigned: 336
start codons at 3, 84, 144, 235, 240, 319, 387, 471
confident = true

REJECT CONTIGS

TIG 1[bases=657]
2-56 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
40-72 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
56-80 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
99-186 ==> 43-130 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=18)
99-127 ==> 43-71 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=2)
274-292 ==> 215-233 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
291-376 ==> 241-326 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
408-446 ==> 32-70 on |316|IGLJ6|J-REGION| [len=70] (mis=1)
446-657 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=4)
umis assigned: [113, 216, 376]
of which 3 are surviving nonsolos
reads assigned: 530
start codons at 56, 207, 382, 410
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.470 = GTTCATTCAAGACACG-1

using 20 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.473 = GTTCATTCAAGCGATG-1

using 391 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 379]
surviving nonsolo ucounts = 1[379]
ids = [1]

====================================================================================

UMI info for barcode GTTCATTCAAGCGATG-1 contig 1 = GGAGAAGAGC...
umi AAAACTTCGA = 382 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGSSPYTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 377
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.474 = GTTCATTCAAGCTGTT-1

using 382 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 378]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=441]
4-276 ==> 2164-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
307-339 ==> 14-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
339-441 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [1]
of which 0 are surviving nonsolos
reads assigned: 376
start codons at 31, 37, 78, 357, 418
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.482 = GTTCATTCACGCGAAA-1

using 364 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 154, 199]
surviving nonsolo ucounts = 2[154, 199]
ids = [6, 5]

====================================================================================

UMI info for barcode GTTCATTCACGCGAAA-1 contig 1 = ACCCAAAAAC...
umi CTATAGGTTG = 194 reads: +436 validated
umi CTCTGTAGAG = 155 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=612]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-612 ==> 0-122 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 38 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 344
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.491 = GTTCATTCAGCCAGAA-1

using 570 reads

====================================================================================

graph has 177 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[280, 288]
surviving nonsolo ucounts = 2[280, 288]
ids = [3, 0]

====================================================================================

UMI info for barcode GTTCATTCAGCCAGAA-1 contig 1 = AGGAGTCAGA...
umi AAGTGATCAC = 293 reads: +388 validated
umi TCGACGCACT = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
27-380 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 74 reads
cdr3 = CQQYYSFPWTF at 354, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 565
start codons at 27, 33, 89, 102, 165, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.493 = GTTCATTCAGCTGTTA-1

using 46 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^2, 6, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.501 = GTTCATTCAGTAAGAT-1

using 408 reads

====================================================================================

graph has 186 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 159, 239]
surviving nonsolo ucounts = 2[159, 239]
ids = [2, 3]

====================================================================================

UMI info for barcode GTTCATTCAGTAAGAT-1 contig 1 = GAGGAGTCAG...
umi CGGCGGGCAT = 157 reads: +388 validated

UMI info for barcode GTTCATTCAGTAAGAT-1 contig 2 = GAGCTGCTCA...
umi CGTTGGCCTC = 217 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-502 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQSYSTPWQF at 355, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 28, 34, 90, 103, 239, 458
confident = false

TIG 2[bases=501]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYGSSPVTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 30, 238, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.503 = GTTCATTCATAAGACA-1

using 91 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 5[2^4, 72]
surviving nonsolo ucounts = 1[72]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.504 = GTTCATTCATATGAGA-1

using 313 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 9, 295]
surviving nonsolo ucounts = 1[295]
ids = [3]

====================================================================================

UMI info for barcode GTTCATTCATATGAGA-1 contig 1 = GAGTCAGACC...
umi CGTTCACTGT = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-364 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-483 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYYRSPITF at 352, score = 8 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 25, 31, 87, 100, 236, 257, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.507 = GTTCATTCATCCCACT-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.513 = GTTCATTCATTAGGCT-1

using 89 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[89]
surviving nonsolo ucounts = 1[89]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.516 = GTTCATTGTAATCGTC-1

using 329 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 322]
surviving nonsolo ucounts = 1[322]
ids = [3]

====================================================================================

UMI info for barcode GTTCATTGTAATCGTC-1 contig 1 = GAGGAACTGC...
umi TCTGCCAGTG = 322 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNNWPRTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.517 = GTTCATTGTACCGAGA-1

using 104 reads

====================================================================================

graph has 113 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 16[2^3, 3, 4^3, 5^4, 6, 9, 10, 11, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.522 = GTTCATTGTCACCCAG-1

using 179 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [1]

====================================================================================

UMI info for barcode GTTCATTGTCACCCAG-1 contig 1 = GGCTTTCTGA...
umi AATTCTCCAC = 159 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=525]
15-392 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=53)
414-463 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=6)
463-525 ==> 0-62 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARHYLRGGWPSYFDPW at 381, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 15, 36, 169, 325, 517
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.534 = GTTCATTGTCTCTCTG-1

using 204 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode GTTCATTGTCTCTCTG-1 contig 1 = AGCTTCAGCT...
umi GGCCGCGCAT = 200 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=489]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
400-438 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
438-489 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAAWDDSLNGLVVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.555 = GTTCATTGTTCAGACT-1

using 182 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 173]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.562 = GTTCATTGTTTACTCT-1

using 519 reads

====================================================================================

graph has 178 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[250, 262]
surviving nonsolo ucounts = 2[250, 262]
ids = [8, 0]

====================================================================================

UMI info for barcode GTTCATTGTTTACTCT-1 contig 1 = GAGGAACTGC...
umi AAAATGCTAC = 260 reads: +388 validated

UMI info for barcode GTTCATTGTTTACTCT-1 contig 2 = GAGGAACTGC...
umi TGTCAATGCG = 296 reads: +128 -1XX +38 -1XX +5 -1XX +31 -1XX +176 invalidated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPPGITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 33, 238, 241, 463
confident = false

TIG 2[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.567 = GTTCATTTCACCTCGT-1

using 264 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 257]
surviving nonsolo ucounts = 1[257]
ids = [4]

====================================================================================

UMI info for barcode GTTCATTTCACCTCGT-1 contig 1 = GCTCTGCTTC...
umi GGTCGCGGAA = 262 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=551]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-551 ==> 0-106 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.568 = GTTCATTTCACTCCTG-1

using 324 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 5, 8, 303]
surviving nonsolo ucounts = 1[303]
ids = [6]

====================================================================================

UMI info for barcode GTTCATTTCACTCCTG-1 contig 1 = AGCTTCAGCT...
umi GCGTGCACCG = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-537 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.578 = GTTCATTTCATTGCGA-1

using 364 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 356]
surviving nonsolo ucounts = 1[356]
ids = [2]

====================================================================================

UMI info for barcode GTTCATTTCATTGCGA-1 contig 1 = AGTCCCACTC...
umi ATGCGAAGTA = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.587 = GTTCATTTCCGCATCT-1

using 1853 reads

====================================================================================

graph has 2492 edges initially, 12 edges after simplification

total ucounts = 908
nonsolo ucounts = 393[2^161, 3^97, 4^55, 5^36, 6^18, 7^12, 8^6, 9^2, 10^3, 11, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.589 = GTTCATTTCCGCTGTT-1

using 223 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=383]
8-259 ==> 99-350 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=22)
264-312 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
312-383 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARGAQGFDYW at 248, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 28, 141, 183, 209
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.592 = GTTCATTTCCTGCAGG-1

using 524 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 7, 248, 259]
surviving nonsolo ucounts = 2[248, 259]
ids = [9, 3]

====================================================================================

UMI info for barcode GTTCATTTCCTGCAGG-1 contig 1 = GGCTTTCTGA...
umi CAGGACGACG = 250 reads: +436 validated

UMI info for barcode GTTCATTTCCTGCAGG-1 contig 2 = GGGGTCTCAG...
umi GCGAGAAATA = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=587]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=6)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
451-587 ==> 0-136 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 33 reads
cdr3 = CARAHGDYYTLLDCW at 375, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 15, 36, 80, 166, 366
confident = false

TIG 2[bases=573]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-386 ==> 0-348 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
426-573 ==> 0-147 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSYAGSYSYVF at 362, score = 8 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 38, 177, 195, 239, 246, 249, 345, 372, 390, 558
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.597 = GTTCATTTCGTACCGG-1

using 233 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [5]

====================================================================================

UMI info for barcode GTTCATTTCGTACCGG-1 contig 1 = ATCATCCAAC...
umi TAACGGAAGG = 224 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=501]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=2)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=34)
422-473 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
473-501 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CAGEAVRGNWFDPW at 400, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 58, 256, 265, 322, 355, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.601 = GTTCATTTCTCAACTT-1

using 229 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [4]

====================================================================================

UMI info for barcode GTTCATTTCTCAACTT-1 contig 1 = GGCTGGGGTC...
umi CCGTCCGGAG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
42-370 ==> 0-328 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-501 ==> 0-71 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CTSFTSTSTPVF at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.605 = GTTCATTTCTCTGCTG-1

using 16908 reads

====================================================================================

graph has 6512 edges initially, 156 edges after simplification

total ucounts = 953
nonsolo ucounts = 435[2^156, 3^84, 4^53, 5^29, 6^21, 7^10, 8^7, 9^8, 10^2, 11^2, 12^2, 13, 14, 15, 16^2, 19, 24, 26, 28, 41, 51^3, 61, 101, 112, 113, 122, 138, 147, 172, 182, 191, 196, 203, 205, 217, 220, 227, 228, 229, 234, 276, 277, 292, 294, 302, 316, 318, 319, 321, 329, 341, 345, 347, 363, 368, 369, 375, 391^2, 392, 401, 407, 428, 432, 467, 532, 538, 739, 746]
surviving nonsolo ucounts = 49[15, 19, 51^2, 101, 112, 122, 138, 147, 172, 182, 191, 196, 203, 205, 217, 220, 227, 228, 229, 234, 276, 277, 294, 302, 316, 318, 319, 321, 329, 341, 345, 347, 363, 368, 369, 375, 391^2, 392, 401, 407, 428, 432, 467, 532, 538, 739, 746]
ids = [788, 217, 288, 471, 228, 104, 646, 748, 179, 317, ...]

====================================================================================

UMI info for barcode GTTCATTTCTCTGCTG-1 contig 1 = AGAGCTCTGG...
umi AAATCCAGGC = 401 reads: +373 validated
umi AAATGTGGGT = 340 reads: +373 validated
umi AAGCCACCAG = 374 reads: +373 validated
umi ACGGCTCAGT = 278 reads: +373 validated
umi ACTAGCTCCT = 369 reads: +373 validated
umi AGATTCAGGG = 230 reads: +373 validated
umi AGGCTCCTCA = 276 reads: +373 validated
umi CAATTCGGTT = 429 reads: +373 validated
umi CACGGATTCT = 347 reads: +373 validated
umi CCCGTCGACA = 330 reads: +373 validated
umi CGAAAGATCG = 369 reads: +373 validated
umi CGACTTTAAG = 299 reads: +373 validated
umi CGATCCGTTA = 597 reads: -333 +1 -3XX +1 -1XX +2 -1XX +14 -5XX +4 -1XX +2 -1XX +4 invalidated
umi CGCATATGGT = 343 reads: +373 validated
umi CTGACAAGAG = 367 reads: +373 validated
umi CTGCTCAGGG = 323 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -2XX +1 -13XX +1 -3XX +2 -4XX +1 -1XX +1 -3XX +271 invalidated
umi CTTCCCTCCT = 439 reads: +373 validated
umi GACCCTCTTT = 406 reads: +373 validated
umi GATTCACTAA = 234 reads: +373 validated
umi GGCCTAATGC = 399 reads: +373 validated
umi TAGGTACTAT = 284 reads: +6 -1XX +7 -1XX +37 -1XX +21 -1XX +10 -1XX +29 -1XX +2 -1XX +34 -1XX +3 -6XX +1 -1XX +1 -1X +6 -1XX +1 -1XX +35 -1XX +8 -1XX +7 -1XX +12 -1XX +51 -1XX +2 -1XX +20 -1XX +15 -2XX +1 -1XX +3 -1XX +2 -2X +3 -2XX +6 -5XX +7 -1XX +4 invalidated
umi TATATGAAAC = 465 reads: +373 validated
umi TCCAAGCCGA = 397 reads: +373 validated
umi TGAGACAGTG = 320 reads: +373 validated
umi TGGTCTCTCG = 320 reads: +373 validated
umi TGGTTTTAGC = 547 reads: +307 -1XX +65 invalidated
umi TTCTGCTCTA = 532 reads: -333 +1 -3X +1 -1XX +2 -1XX +14 -5XX +4 -1XX +2 -1XX +4 invalidated

UMI info for barcode GTTCATTTCTCTGCTG-1 contig 2 = ATCATCCAAC...
umi ACTCCGCATC = 225 reads: +445 validated
umi ACTTACTCAC = 113 reads: +392 -53 non-validated
umi ATCAAGGGGT = 219 reads: +445 validated
umi ATCTACTCGT = 24 reads: -407 +1 -4X +3 -1XX +1 -10XX +1 -1XX +1 -3XX +1 -5XX +1 -2XX +3 invalidated
umi ATGCGCCCCG = 146 reads: +445 validated
umi CAACAGGTGT = 1 reads: -445 non-validated
umi CACACCTCGT = 1 reads: -427X +1 -1X +1 -3X +1 -5X +1 -2X +3 invalidated
umi CACAGTCGGT = 179 reads: +445 validated
umi CCACGGGCCC = 51 reads: +357 -47 +41 non-validated
umi CCGTATTGGG = 174 reads: +445 validated
umi CGAGTCTTCC = 1 reads: -412 +1 -3X +1 -10X +1 -5X +1 -8X +3 invalidated
umi CGCGTTGCTC = 82 reads: -412 +1 -3X +3 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi CTTGTATACC = 226 reads: +445 validated
umi GAACGATCCC = 51 reads: +371 -74 non-validated
umi GAGTGTTACA = 207 reads: +445 validated
umi GCTACCTCCA = 207 reads: +445 validated
umi GTGCGCATCT = 19 reads: -412 +1 -3XX +3 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TCACCTTGCG = 118 reads: -412 +1 -4XX +2 -2XX +3 -10XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi TCAGCTGCGG = 201 reads: +445 validated
umi TCATGTGTTT = 139 reads: +416 -29 non-validated
umi TGATGATGCG = 217 reads: +445 validated
umi TTTCACTGCG = 188 reads: +444 -1 non-validated

GOOD CONTIGS

TIG 1[bases=553]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-378 ==> 0-334 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 24 umis using 1380 reads
cdr3 = CQQSGTF at 368, score = 9 + 8
umis assigned: [16, 19, 41, 89, 95, 120, 131, 226, 239, 304] and 17 others
of which 26 are surviving nonsolos
reads assigned: 9838
start codons at 44, 252, 459
confident = true

TIG 2[bases=636]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=13)
440-503 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
503-636 ==> 0-133 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 9 umis using 114 reads
cdr3 = CAREQEGALEWFGASYYYYYMDVW at 400, score = 9 + 7
umis assigned: [97, 104, 158, 167, 179, 217, 228, 229, 288, 317] and 12 others
of which 21 are surviving nonsolos
reads assigned: 2743
start codons at 58, 256, 322, 355, 429, 460
confident = true
now this is a cell
paired!

GCTAGAGAACAAGAGGGCGCGTTAGAATGGTTCGGGGCCTCCTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> TTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTCTGGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.614 = GTTCGGGAGAAACGCC-1

using 121 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 112]
surviving nonsolo ucounts = 1[112]
ids = [2]

====================================================================================

UMI info for barcode GTTCGGGAGAAACGCC-1 contig 1 = GGACTCCTGT...
umi CCACCACCCT = 88 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
18-368 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-524 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CASAAAPGDWFDPW at 363, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 87
start codons at 18, 174, 241, 333, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.623 = GTTCGGGAGCCAGGAT-1

using 283 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 13, 263]
surviving nonsolo ucounts = 1[263]
ids = [4]

====================================================================================

UMI info for barcode GTTCGGGAGCCAGGAT-1 contig 1 = GACTGATCAG...
umi GATTGACGGA = 250 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=469]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-469 ==> 0-38 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTPLTF at 370, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 34, 67, 103, 191, 353, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.625 = GTTCGGGAGCTGCCCA-1

using 14463 reads

====================================================================================

graph has 6152 edges initially, 94 edges after simplification

total ucounts = 541
nonsolo ucounts = 342[2^60, 3^42, 4^35, 5^29, 6^11, 7^17, 8^21, 9^23, 10^12, 11^12, 12^8, 13^12, 14^4, 15, 16^7, 18, 19^2, 20, 21, 24, 77, 130, 161, 172, 184, 188, 224, 230, 241, 247, 260, 275, 281, 286, 289, 292, 300, 304, 306^2, 310, 311, 314, 323, 324, 327, 332, 333, 334, 335, 340^2, 348, 349, 351, 354, 358, 361, 365, 368, 374, 461]
surviving nonsolo ucounts = 41[130, 161, 172, 184, 188, 224, 230, 241, 247, 260, 275, 281, 286, 289, 292, 300, 304, 306^2, 310, 311, 314, 323, 324, 327, 332, 333, 334, 335, 340^2, 348, 349, 351, 354, 358, 361, 365, 368, 374, 461]
ids = [325, 132, 87, 102, 539, 108, 364, 277, 53, 345, ...]

====================================================================================

UMI info for barcode GTTCGGGAGCTGCCCA-1 contig 1 = CTCTCTCAGT...
umi ACAGCGCGTT = 364 reads: +388 validated
umi ACCAACCTTC = 307 reads: +388 validated
umi CAGACTCAGC = 352 reads: +388 validated
umi CCCGCGTCTA = 308 reads: +388 validated
umi CCTAATCGGT = 297 reads: +388 validated
umi CTGCATGATT = 346 reads: +388 validated
umi CTTGCTGCCG = 83 reads: +286 -42 +56 -4 non-validated
umi GCGACCCTGT = 471 reads: -158X +1 -3XX +1 -1XX +2 -1XX +1 -1XX +2 -3XX +214 invalidated
umi TCCAGCATTG = 334 reads: +388 validated
umi TCCGTACGCT = 348 reads: +388 validated
umi TGTTAGTCTG = 367 reads: +388 validated
umi TTATATTACG = 309 reads: +388 validated
umi TTCCCGGCAT = 324 reads: +388 validated

UMI info for barcode GTTCGGGAGCTGCCCA-1 contig 2 = GAGAGAGGAG...
umi ATAAATTTTG = 183 reads: +418 validated
umi ATTACCGGCT = 130 reads: +418 validated
umi ATTCGGTAAA = 286 reads: +418 validated
umi CAGTCGGACC = 303 reads: +418 validated
umi CCAACCAATC = 340 reads: +418 validated
umi CCACAACTGG = 309 reads: +418 validated
umi CGAGCCCGTC = 338 reads: +418 validated
umi CGCCCAACCC = 295 reads: +418 validated
umi CGTCCGTAAG = 210 reads: +418 validated
umi CGTCCTAATG = 309 reads: +418 validated
umi CTGTAGCCCG = 293 reads: +418 validated
umi GAATTCATCT = 312 reads: +418 validated
umi GGTCGGCCAC = 282 reads: +418 validated
umi TAGGTCTATA = 272 reads: +418 validated
umi TTTACTTTCG = 295 reads: +418 validated
umi TTTCTTGTTA = 164 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=2)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 670 reads
cdr3 = CQKYNSALRTF at 348, score = 9 + 8
umis assigned: [46, 52, 170, 210, 224, 313, 325, 370, 466, 470] and 3 others
of which 13 are surviving nonsolos
reads assigned: 4140
start codons at 21, 27, 83, 96, 232, 331, 451
confident = true

TIG 2[bases=562]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=3)
443-491 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
491-562 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 16 umis using 420 reads
cdr3 = CASWGPAQGDGMDVW at 415, score = 9 + 7
umis assigned: [108, 132, 138, 173, 194, 198, 245, 255, 277, 278] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4241
start codons at 73, 229, 376, 448
confident = true

REJECT CONTIGS

TIG 1[bases=516]
5-306 ==> 1626-1927 on rc of segment before IGHD2-8 exon 1 [len=2499] (mis=0)
299-362 ==> 2436-2499 on rc of segment before IGHD2-8 exon 1 [len=2499] (mis=1)
397-445 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
445-516 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [87, 102, 337]
of which 2 are surviving nonsolos
reads assigned: 300
start codons at 342
confident = false
did not find CDR3

TIG 2[bases=576]
4-85 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
38-398 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
401-440 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHARYTLASMCSF at 358, score = 3 + 7
umis assigned: [53, 184, 193, 228, 265, 284, 345, 364, 475, 507]
of which 10 are surviving nonsolos
reads assigned: 2995
start codons at 38, 71, 99, 107, 195, 357, 377, 400, 482
confident = false
not full
frameshifted full length transcript of length 576
VJ delta = 31
not full
now this is a cell
paired!

GCCGAGGACACGGCTGTGTATTACTGTGCGAGTTGGGGGCCCGCCCAGGGGGACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCTCAGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.628 = GTTCGGGAGGACATTA-1

using 530 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 7, 256, 261]
surviving nonsolo ucounts = 2[256, 261]
ids = [0, 5]

====================================================================================

UMI info for barcode GTTCGGGAGGACATTA-1 contig 1 = AGCTTCAGCT...
umi GGATCCCTCT = 263 reads: +388 validated

UMI info for barcode GTTCGGGAGGACATTA-1 contig 2 = AGCTCTGAGA...
umi CTCCCCGAGC = 256 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=609]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-609 ==> 0-106 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.632 = GTTCGGGAGGGTTTCT-1

using 303 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode GTTCGGGAGGGTTTCT-1 contig 1 = GAGGAATCAG...
umi GCTGTACAAA = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-483 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.641 = GTTCGGGAGTGTTAGA-1

using 145 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[142]
surviving nonsolo ucounts = 1[142]
ids = [3]

====================================================================================

UMI info for barcode GTTCGGGAGTGTTAGA-1 contig 1 = ACCCAAAAAC...
umi GTTGATAGCT = 132 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=517]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-517 ==> 0-27 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.647 = GTTCGGGCAAGCGAGT-1

using 512 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[511]
surviving nonsolo ucounts = 1[511]
ids = [1]

====================================================================================

UMI info for barcode GTTCGGGCAAGCGAGT-1 contig 1 = AGGAGTCAGT...
umi TTTCTTACCT = 512 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 503
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.648 = GTTCGGGCAAGGTGTG-1

using 335 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [0]

====================================================================================

UMI info for barcode GTTCGGGCAAGGTGTG-1 contig 1 = GGAGTCAGTC...
umi TCATGCACCA = 336 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSTPSF at 353, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 26, 32, 88, 101, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.655 = GTTCGGGCACACGCTG-1

using 601 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 596]
surviving nonsolo ucounts = 1[596]
ids = [1]

====================================================================================

UMI info for barcode GTTCGGGCACACGCTG-1 contig 1 = GGAGGAATCA...
umi ACGATTTTTA = 595 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 98 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 586
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.657 = GTTCGGGCACAGTCGC-1

using 258 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [0]

====================================================================================

UMI info for barcode GTTCGGGCACAGTCGC-1 contig 1 = GGGGTCACAA...
umi ACCCTGGGAT = 227 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-559 ==> 0-130 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CCSYAGSSTQRVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.658 = GTTCGGGCACGCATCG-1

using 23 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.667 = GTTCGGGCAGCCAGAA-1

using 14 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.681 = GTTCGGGGTAAAGGAG-1

using 69 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[3, 4^2, 7, 8, 10, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.683 = GTTCGGGGTAAGGGCT-1

using 561 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[12, 249, 297]
surviving nonsolo ucounts = 2[249, 297]
ids = [1, 4]

====================================================================================

UMI info for barcode GTTCGGGGTAAGGGCT-1 contig 1 = GGAGGAATCA...
umi CAGAGAAGGC = 224 reads: +388 validated
umi TTCATCAATT = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-498 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 84 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 488
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.684 = GTTCGGGGTAATCGTC-1

using 223 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 218]
surviving nonsolo ucounts = 1[218]
ids = [1]

====================================================================================

UMI info for barcode GTTCGGGGTAATCGTC-1 contig 1 = AGTGCTTTCT...
umi CCCGTTAGTT = 198 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=492]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
junction support: 1 umis using 18 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.685 = GTTCGGGGTAATTGGA-1

using 260 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [2]

====================================================================================

UMI info for barcode GTTCGGGGTAATTGGA-1 contig 1 = GCTCTGCTTC...
umi CAGAGGTGTG = 255 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 52 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 51, 205, 259, 358, 385, 406, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.689 = GTTCGGGGTAGCTAAA-1

using 93 reads

====================================================================================

graph has 94 edges initially, 4 edges after simplification

total ucounts = 29
nonsolo ucounts = 21[2^9, 3^4, 4, 5^2, 6^2, 7^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.694 = GTTCGGGGTCAGAATA-1

using 239 reads

====================================================================================

graph has 76 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 77, 154]
surviving nonsolo ucounts = 2[77, 154]
ids = [6, 3]

====================================================================================

UMI info for barcode GTTCGGGGTCAGAATA-1 contig 1 = GCTCCAAACA...
umi GATATGTCAG = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-550 ==> 0-120 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.700 = GTTCGGGGTCTAGCCG-1

using 393 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[3, 6, 8^2, 15, 351]
surviving nonsolo ucounts = 1[351]
ids = [3]

====================================================================================

UMI info for barcode GTTCGGGGTCTAGCCG-1 contig 1 = AGGAGTCAGA...
umi CTAGATTTGC = 362 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.703 = GTTCGGGGTCTGCCAG-1

using 613 reads

====================================================================================

graph has 264 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 6, 226, 371]
surviving nonsolo ucounts = 2[226, 371]
ids = [2, 1]

====================================================================================

UMI info for barcode GTTCGGGGTCTGCCAG-1 contig 1 = GAGAAGAGCT...
umi ACCCGTTACA = 372 reads: +385 validated

UMI info for barcode GTTCGGGGTCTGCCAG-1 contig 2 = ACCCAAAAAC...
umi CCTCACAGGT = 201 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSLTTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 35, 243, 369, 462
confident = false

TIG 2[bases=544]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-544 ==> 0-54 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.719 = GTTCGGGGTTGGTTTG-1

using 252 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[4^3, 234]
surviving nonsolo ucounts = 1[234]
ids = [8]

====================================================================================

UMI info for barcode GTTCGGGGTTGGTTTG-1 contig 1 = AATACTTTCT...
umi TGATCGAGGG = 233 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=533]
0-38 ==> 26-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
38-391 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=10)
401-462 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=5)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARTMVQSFYYYYMDVW at 380, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 17, 38, 82, 392, 419
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.723 = GTTCGGGGTTTGGCGC-1

using 11158 reads

====================================================================================

graph has 3241 edges initially, 62 edges after simplification

total ucounts = 353
nonsolo ucounts = 136[2^37, 3^18, 4^12, 5^10, 6^10, 7, 8^3, 9, 10^2, 12, 13, 16^2, 17, 19, 25, 109, 118, 124, 129, 130, 151, 166, 168, 177, 181, 191, 200, 208, 224, 225, 228, 232, 241, 253, 257, 269, 275, 280, 287, 297, 318, 394, 397, 432, 579^2, 644, 647, 648, 719]
surviving nonsolo ucounts = 34[25, 109, 118, 124, 129, 130, 151, 166, 168, 181, 191, 200, 208, 224, 225, 228, 232, 253, 257, 269, 275, 280, 287, 297, 318, 394, 397, 432, 579^2, 644, 647, 648, 719]
ids = [215, 329, 347, 43, 205, 341, 59, 343, 146, 201, ...]

====================================================================================

UMI info for barcode GTTCGGGGTTTGGCGC-1 contig 1 = GGGGGGGTCT...
umi ACTTTCCACA = 123 reads: +388 validated
umi AGACCAGCAA = 19 reads: -331X +1 -1XX +1 -4XX +3 -8XX +2 -2XX +11 -1XX +23 invalidated
umi AGACTGCTCG = 18 reads: -338X +3 -8XX +2 -2XX +11 -1XX +23 invalidated
umi AGGAAGCGGT = 152 reads: +388 validated
umi ATAGCGACTG = 202 reads: +388 validated
umi ATCGGCTCAT = 207 reads: +388 validated
umi CAGTATTGGA = 273 reads: +388 validated
umi CCAGCTTCCA = 258 reads: +388 validated
umi CCTGCTTCTC = 276 reads: +388 validated
umi CGATCTGGGA = 170 reads: +388 validated
umi CTCAGGCTTT = 226 reads: +388 validated
umi GCAAGTCCCC = 183 reads: +388 validated
umi GCTACTCTGG = 129 reads: +388 validated
umi TATCTTATTC = 229 reads: +388 validated
umi TCGCACCTGT = 320 reads: +388 validated
umi TCGGTGTGTC = 290 reads: +388 validated
umi TCGTAGCTCT = 229 reads: +388 validated
umi TGGAAGAGGT = 644 reads: -141 +247 non-validated
umi TGTTTGCCCC = 257 reads: +388 validated
umi TTAAGTTCGC = 194 reads: +388 validated
umi TTATTCCAAC = 111 reads: +388 validated
umi TTGGTTAGTG = 130 reads: +388 validated
umi TTTAAGCTTT = 225 reads: +388 validated

UMI info for barcode GTTCGGGGTTTGGCGC-1 contig 2 = GAGCTCTGGG...
umi AGAACTCAAA = 119 reads: -396X +1 -1XX +1 -1XX +1 -1XX +1 -5XX +1 -2XX +1 -9XX +1 -2XX +3 invalidated
umi CAACTCTTTT = 397 reads: -144X +283 invalidated
umi CGGGAATATG = 338 reads: -394X +1 -3XX +1 -1XX +1 -2XX +1 -1XX +1 -3XX +1 -6XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated
umi GGCCTATCTA = 25 reads: +33 -24 +303 -1 +66 non-validated
umi TTTCTGACTG = 119 reads: +427 validated
umi TTTGTTTGTT = 584 reads: -394X +1 -1XX +1 -1XX +1 -1XX +1 -2XX +1 -1XX +1 -3XX +1 -6XX +1 -2XX +1 -2XX +1 -3XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-378 ==> 0-337 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 21 umis using 892 reads
cdr3 = CSSYRPTNTLVF at 365, score = 7 + 9
umis assigned: [43, 48, 50, 59, 72, 79, 106, 113, 136, 146] and 13 others
of which 21 are surviving nonsolos
reads assigned: 4793
start codons at 41, 198, 249, 252
confident = true

TIG 2[bases=667]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=3)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=23)
459-507 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
507-667 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 3 umis using 111 reads
cdr3 = CARDGGFGELLWGYFDYW at 422, score = 9 + 8
umis assigned: [45, 96, 152, 215, 347, 351]
of which 6 are surviving nonsolos
reads assigned: 1568
start codons at 80, 231, 236, 294, 297, 315, 432, 454, 561
confident = true

REJECT CONTIGS

TIG 1[bases=359]
2-87 ==> 5529-5614 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
36-86 ==> 0-50 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
84-188 ==> 256-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
186-223 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
223-359 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [61, 87, 120, 176, 332, 343, 345]
of which 7 are surviving nonsolos
reads assigned: 3373
start codons at 36, 69, 147, 167, 265
confident = false
did not find CDR3
now this is a cell
paired!

ACGGCTGTTTATTATTGTGCGAGAGATGGAGGGTTCGGGGAGTTATTATGGGGCTACTTTGACTACTGGGGCCAGGGAACCCGGGTCAGCGTCTCCTCAG <==> TCTGGGCTCCAGACTGAGGACGAGGCTCATTATTACTGCAGCTCATATAGACCCACCAACACTCTGGTGTTCGGCGTAGGGACCAAGTTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.728 = GTTCGGGTCACTCCTG-1

using 22 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.731 = GTTCGGGTCAGAGCTT-1

using 304 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=532]
2-77 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-379 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-532 ==> 0-113 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 26, 32, 88, 101, 164, 237, 461
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.734 = GTTCGGGTCAGCTCTC-1

using 311 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode GTTCGGGTCAGCTCTC-1 contig 1 = GAGGAACTGC...
umi TACTTCGGTG = 310 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=16)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYNYWPYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 33, 102, 262, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.738 = GTTCGGGTCATCTGCC-1

using 527 reads

====================================================================================

graph has 206 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[12, 134, 378]
surviving nonsolo ucounts = 2[134, 378]
ids = [2, 5]

====================================================================================

UMI info for barcode GTTCGGGTCATCTGCC-1 contig 1 = CATGGACATG...
umi TCCGCACTTG = 381 reads: +385 validated

UMI info for barcode GTTCGGGTCATCTGCC-1 contig 2 = GAGGAACTGC...
umi GTGAACTTTC = 132 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=522]
1-354 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
347-386 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
386-522 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQSYSTPSF at 328, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 1, 7, 63, 76, 212, 428
confident = false

TIG 2[bases=554]
0-33 ==> 64-97 on |291|IGKV3D-20|5'UTR| [len=97] (mis=0)
33-381 ==> 0-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=23)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYESSPATF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 33, 82, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.740 = GTTCGGGTCCAAACAC-1

using 542 reads

====================================================================================

graph has 534 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4, 9, 232, 293]
surviving nonsolo ucounts = 1[232]
ids = [3]

====================================================================================

UMI info for barcode GTTCGGGTCCAAACAC-1 contig 1 = CCACATCCCT...
umi GCCATTGGGC = 228 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=557]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=16)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
457-557 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CARGVARHDPFDFW at 384, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 42, 193, 240, 245, 262, 339, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.746 = GTTCGGGTCCGAACGC-1

using 193 reads

====================================================================================

graph has 288 edges initially, 2 edges after simplification

total ucounts = 108
nonsolo ucounts = 33[2^14, 3^11, 4, 5^3, 6, 8, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.751 = GTTCGGGTCCTCTAGC-1

using 384 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 7^2, 8, 9, 346]
surviving nonsolo ucounts = 1[346]
ids = [2]

====================================================================================

UMI info for barcode GTTCGGGTCCTCTAGC-1 contig 1 = GAGCTACAAC...
umi ATACGCCTTT = 323 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=498]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-498 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYYSTPYTF at 369, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.756 = GTTCGGGTCGCATGGC-1

using 305 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [0]

====================================================================================

UMI info for barcode GTTCGGGTCGCATGGC-1 contig 1 = GAGTCAGTCT...
umi ATCACCATAC = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.758 = GTTCGGGTCGCGGATC-1

using 779 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[244, 529]
surviving nonsolo ucounts = 2[244, 529]
ids = [1, 6]

====================================================================================

UMI info for barcode GTTCGGGTCGCGGATC-1 contig 1 = GATCAGGACT...
umi ACTACCGTTT = 244 reads: +397 validated
umi GCATTCGGCG = 530 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 123 reads
cdr3 = CMQGTHWPYTF at 366, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 767
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.767 = GTTCGGGTCTCTAAGG-1

using 247 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [3]

====================================================================================

UMI info for barcode GTTCGGGTCTCTAAGG-1 contig 1 = AACAACCACA...
umi TTTCAACGGT = 238 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=554]
0-51 ==> 7-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
51-404 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
405-423 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
424-487 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
487-554 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 393, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 51, 202, 249, 348, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.772 = GTTCGGGTCTGCCCTA-1

using 261 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 256]
surviving nonsolo ucounts = 1[256]
ids = [2]

====================================================================================

UMI info for barcode GTTCGGGTCTGCCCTA-1 contig 1 = GGGGGACTCC...
umi CCTGGCCCGG = 231 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=579]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
394-442 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
442-579 ==> 0-137 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CARRRSPWFGALDYW at 366, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 21, 65, 244, 247, 327, 336, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.773 = GTTCGGGTCTGCGTAA-1

using 266 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[26, 238]
surviving nonsolo ucounts = 1[238]
ids = [1]

====================================================================================

UMI info for barcode GTTCGGGTCTGCGTAA-1 contig 1 = ACCCAAAAAC...
umi GCCTCTTGGG = 222 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=588]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-588 ==> 0-98 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.777 = GTTCGGGTCTTCGAGA-1

using 221 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[221]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.788 = GTTCTCGAGCAGGCTA-1

using 389 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 5, 369]
surviving nonsolo ucounts = 1[369]
ids = [5]

====================================================================================

UMI info for barcode GTTCTCGAGCAGGCTA-1 contig 1 = GCATCACCCA...
umi CTGGGCTCTT = 369 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=555]
0-60 ==> 4-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
60-413 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CARSLVSYSSSWIFDYW at 402, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 60, 258, 263, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.802 = GTTCTCGAGGCTCAGA-1

using 1878 reads

====================================================================================

graph has 2367 edges initially, 44 edges after simplification

total ucounts = 964
nonsolo ucounts = 385[2^177, 3^92, 4^41, 5^24, 6^21, 7^10, 8^8, 9^6, 10^2, 11, 12^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.809 = GTTCTCGAGTACGATA-1

using 828 reads

====================================================================================

graph has 306 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 195, 626]
surviving nonsolo ucounts = 2[195, 626]
ids = [1, 6]

====================================================================================

UMI info for barcode GTTCTCGAGTACGATA-1 contig 1 = GAGAGAGGAG...
umi AATCTCGCTT = 195 reads: +424 validated
umi GTGATTTAAC = 633 reads: -279X +145 invalidated

GOOD CONTIGS

TIG 1[bases=679]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-679 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 2 umis using 129 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 814
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.814 = GTTCTCGAGTTACGGG-1

using 246 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 239]
surviving nonsolo ucounts = 1[239]
ids = [1]

====================================================================================

UMI info for barcode GTTCTCGAGTTACGGG-1 contig 1 = GAGTCAGTCT...
umi CCACCTTCAA = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=6)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQSYSPPYTF at 352, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.817 = GTTCTCGCAACGATCT-1

using 146 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 135]
surviving nonsolo ucounts = 1[135]
ids = [4]

====================================================================================

UMI info for barcode GTTCTCGCAACGATCT-1 contig 1 = TGAGAGTCAT...
umi GAATGAAGCT = 130 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=546]
8-379 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
459-546 ==> 0-87 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 368, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 8, 29, 73, 159, 246, 513
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.819 = GTTCTCGCAAGCTGAG-1

using 281 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2^3, 3, 5, 265]
surviving nonsolo ucounts = 1[265]
ids = [4]

====================================================================================

UMI info for barcode GTTCTCGCAAGCTGAG-1 contig 1 = GGGGAGGAAC...
umi GGTCATACGA = 235 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-498 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.822 = GTTCTCGCAATAACGA-1

using 57 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 5, 6, 12, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.831 = GTTCTCGCACGAAACG-1

using 655 reads

====================================================================================

graph has 238 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[163, 488]
surviving nonsolo ucounts = 2[163, 488]
ids = [5, 4]

====================================================================================

UMI info for barcode GTTCTCGCACGAAACG-1 contig 1 = ATCTCCTCCA...
umi TGGAGAGACG = 156 reads: +376 validated

UMI info for barcode GTTCTCGCACGAAACG-1 contig 2 = GGTCTCAACA...
umi TGCTAATCAC = 484 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=578]
0-134 ==> 117-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
134-474 ==> 0-340 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
472-510 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
510-578 ==> 0-68 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQVWDSSSVVF at 449, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 41, 134, 195, 333, 336, 432
confident = false

TIG 2[bases=537]
57-410 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=2)
416-466 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CARSSGDAFDIW at 399, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 477
start codons at 57, 208, 255, 260, 264, 292, 321, 354, 418, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.841 = GTTCTCGCAGCTGTAT-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.842 = GTTCTCGCAGGTGCCT-1

using 846 reads

====================================================================================

graph has 310 edges initially, 24 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[3, 4, 151, 320, 367]
surviving nonsolo ucounts = 3[151, 320, 367]
ids = [5, 2, 1]

====================================================================================

UMI info for barcode GTTCTCGCAGGTGCCT-1 contig 1 = GGAGGAATCA...
umi ATCGTCTAGG = 214 reads: +48 -1XX +12 -2XX +26 -1XX +3 -1XX +14 -1XX +1 -1XX +13 -59X +17 -1XX +1 -1XX +3 -1XX +3 -1XX +3 -1XX +3 -1XX +68 -1XX +6 -1XX +3 -1XX +5 -2XX +2 -1XX +8 -1XX +2 -1 +2 -9X +7 -2XX +5 -2XX +8 -1XX +2 -1XX +5 -1XX +22 invalidated
umi CAGGGACTAT = 334 reads: +22 -1XX +235 -2XX +128 invalidated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=16)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 525
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.850 = GTTCTCGCATCGATGT-1

using 72 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 69]
surviving nonsolo ucounts = 1[69]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=467]
0-305 ==> 10-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
340-378 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
378-467 ==> 0-89 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CTSYAGGSNVVF at 314, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 60
start codons at 198, 297, 324, 339
confident = false
not full
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.851 = GTTCTCGCATCGATTG-1

using 13487 reads

====================================================================================

graph has 5035 edges initially, 55 edges after simplification

total ucounts = 1039
nonsolo ucounts = 445[2^176, 3^104, 4^45, 5^28, 6^15, 7^10, 8^8, 9, 10^2, 11, 12^4, 13, 14, 17, 58, 62, 72, 88, 121, 130, 134, 135, 137, 144, 153, 168, 169, 188, 200, 204, 215, 218^2, 234, 240, 245, 252, 260, 264, 266^2, 271, 273, 274^2, 275, 276, 280, 283, 289, 291, 297, 298, 308, 317, 318, 324, 340, 345, 358, 364, 657]
surviving nonsolo ucounts = 46[72, 88, 121, 130, 134, 135, 137, 144, 153, 168, 169, 188, 200, 204, 215, 218^2, 234, 240, 245, 252, 260, 264, 266^2, 271, 273, 274^2, 275, 276, 280, 283, 289, 291, 297, 298, 308, 317, 318, 324, 340, 345, 358, 364, 657]
ids = [892, 865, 399, 886, 229, 990, 843, 624, 372, 512, ...]

====================================================================================

UMI info for barcode GTTCTCGCATCGATTG-1 contig 1 = AGGAGTCAGA...
umi AACTAACCAC = 348 reads: +388 validated
umi AAGGTGTCGG = 213 reads: +388 validated
umi AATATTCCTA = 279 reads: +388 validated
umi AATTCCTCCT = 149 reads: -353X +3 -1XX +6 -2XX +15 -1XX +7 invalidated
umi ACACTTACCA = 288 reads: +388 validated
umi ACCTCACATA = 296 reads: +388 validated
umi ACGTATTTCG = 264 reads: +388 validated
umi ACGTCACCCT = 214 reads: +388 validated
umi AGCTTCGGTA = 364 reads: +388 validated
umi AGTCTTATCA = 203 reads: +388 validated
umi AGTGGGACTA = 187 reads: +388 validated
umi ATCCTCCTGG = 130 reads: -343 +1 -7X +2 -1XX +34 invalidated
umi CACACGGCCT = 328 reads: +388 validated
umi CACCCAGGCC = 235 reads: +388 validated
umi CAGGAGTACA = 170 reads: +388 validated
umi CCAACCATAG = 270 reads: +388 validated
umi CCAGCGGATG = 152 reads: +388 validated
umi CCCTACCCCG = 278 reads: +388 validated
umi CCGTCAGTGC = 273 reads: +388 validated
umi CCTGTCCACG = 218 reads: +388 validated
umi CGATAGTTAG = 275 reads: +388 validated
umi CGCCCGCATC = 309 reads: +388 validated
umi CGGAGGTTCC = 268 reads: +388 validated
umi CGGCAACGTT = 257 reads: +388 validated
umi CGTGCCGGTT = 201 reads: +388 validated
umi CTACAGTCCT = 317 reads: +388 validated
umi CTGATCTCTG = 302 reads: -353X +3 -1XX +6 -2XX +15 -1XX +7 invalidated
umi CTTAGTCTGC = 270 reads: +388 validated
umi GCAGAAAATG = 144 reads: +388 validated
umi GCCATTACCA = 299 reads: +388 validated
umi GCCATTATTG = 18 reads: -240 +3 -1XX +1 -1XX +8 -1XX +8 -1XX +11 -1XX +23 -2XX +7 -1XX +8 -71 invalidated
umi GGATAGCCAA = 289 reads: +388 validated
umi GGTAAGCACG = 271 reads: +388 validated
umi TACCTTTCCG = 269 reads: +388 validated
umi TCACGGATAC = 136 reads: +388 validated
umi TCATAGCAGA = 254 reads: +388 validated
umi TCCCTATCGG = 282 reads: +388 validated
umi TCCGTGTCGT = 90 reads: +388 validated
umi TCTCCTCGGC = 72 reads: +388 validated
umi TTACCTTACG = 243 reads: +388 validated
umi TTCGTCGCTC = 134 reads: -343 +1 -7X +2 -1X +34 invalidated

UMI info for barcode GTTCTCGCATCGATTG-1 contig 2 = TGGGGAGATC...
umi TCTATGCACA = 125 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 36 umis using 1370 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [21, 42, 45, 55, 75, 100, 112, 113, 165, 179] and 31 others
of which 41 are surviving nonsolos
reads assigned: 9443
start codons at 27, 33, 89, 102, 334, 457
confident = true

TIG 2[bases=519]
23-376 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=16)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
465-519 ==> 0-54 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGGYCTADNCYFLRDYYFDSW at 365, score = 8 + 7
umis assigned: [886]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 23, 108, 221, 226, 243, 258, 287, 320
confident = true

REJECT CONTIGS

TIG 1[bases=351]
4-182 ==> 766-944 on rc of segment before IGHD4-11 exon 1 [len=944] (mis=0)
229-280 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
280-351 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [29]
of which 1 are surviving nonsolos
reads assigned: 651
start codons at 33, 169, 204, 216, 221
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGGCGGCTATTGTACTGCTGATAACTGCTACTTTTTGAGAGACTACTACTTTGACTCTTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCTGACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.857 = GTTCTCGCATGGTTGT-1

using 200 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 8, 182]
surviving nonsolo ucounts = 1[182]
ids = [7]

====================================================================================

UMI info for barcode GTTCTCGCATGGTTGT-1 contig 1 = GCCTGAGAAC...
umi TAGTGTTCTA = 176 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=517]
0-21 ==> 25-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
21-389 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=7)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
424-517 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CVLYLGSFSWVF at 360, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 21, 36, 45, 48, 73, 340, 343
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.860 = GTTCTCGCATTAGCCA-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.863 = GTTCTCGCATTGGCGC-1

using 49 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 8, 27]
surviving nonsolo ucounts = 1[27]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.866 = GTTCTCGGTAAAGGAG-1

using 116 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[2, 8, 96]
surviving nonsolo ucounts = 1[96]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.867 = GTTCTCGGTAAGTGGC-1

using 30 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.874 = GTTCTCGGTATTACCG-1

using 331 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 326]
surviving nonsolo ucounts = 1[326]
ids = [3]

====================================================================================

UMI info for barcode GTTCTCGGTATTACCG-1 contig 1 = GAATCAGTCC...
umi TACCGTACGT = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-503 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.878 = GTTCTCGGTCATACTG-1

using 1028 reads

====================================================================================

graph has 244 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[6, 194, 406, 418]
surviving nonsolo ucounts = 3[194, 406, 418]
ids = [5, 6, 7]

====================================================================================

UMI info for barcode GTTCTCGGTCATACTG-1 contig 1 = TGGGGAGGAA...
umi GCGGTCGCCA = 419 reads: +385 validated

UMI info for barcode GTTCTCGGTCATACTG-1 contig 2 = GGCTGGGGTC...
umi CTTTGCTTCT = 195 reads: +388 validated
umi CTTTTCGGGC = 405 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNNWPPWTF at 358, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 414
start codons at 37, 106, 242, 464
confident = true

TIG 2[bases=641]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 76 reads
cdr3 = CCSHAGSYIWVF at 366, score = 8 + 7
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 595
start codons at 42, 178, 181, 199, 253, 349, 376
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.885 = GTTCTCGGTCTTCGTC-1

using 790 reads

====================================================================================

graph has 266 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 291, 492]
surviving nonsolo ucounts = 2[291, 492]
ids = [5, 0]

====================================================================================

UMI info for barcode GTTCTCGGTCTTCGTC-1 contig 1 = AAGAACCTGC...
umi ACCCCCTGTT = 492 reads: +376 validated

UMI info for barcode GTTCTCGGTCTTCGTC-1 contig 2 = GGAGGAACTG...
umi GACATCGTGA = 291 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=639]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-392 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
428-639 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CQAWDSSTVVF at 367, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 486
start codons at 52, 57, 113, 200, 346, 350
confident = false

TIG 2[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWPLTF at 355, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 34, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.890 = GTTCTCGGTGGTGTAG-1

using 124 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[116]
surviving nonsolo ucounts = 1[116]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.897 = GTTCTCGGTTCCCTTG-1

using 260 reads

====================================================================================

graph has 89 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode GTTCTCGGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi CCTGACCTCT = 249 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=515]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-515 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.903 = GTTCTCGGTTGTACAC-1

using 499 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[225, 268]
surviving nonsolo ucounts = 2[225, 268]
ids = [0, 3]

====================================================================================

UMI info for barcode GTTCTCGGTTGTACAC-1 contig 1 = TCAGTCCCAC...
umi AGATTACATT = 209 reads: +388 validated

UMI info for barcode GTTCTCGGTTGTACAC-1 contig 2 = AGCTTCAGCT...
umi ATTCCAACAG = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=431]
0-22 ==> 5-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
22-373 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-431 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 22, 28, 97, 233
confident = false

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.914 = GTTCTCGTCAGTTGAC-1

using 335 reads

====================================================================================

graph has 166 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 12[2^4, 3, 4^2, 7, 9, 11, 19, 269]
surviving nonsolo ucounts = 1[269]
ids = [5]

====================================================================================

UMI info for barcode GTTCTCGTCAGTTGAC-1 contig 1 = GGGCTGCTTC...
umi GGCTATCTCT = 257 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=609]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=2)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-609 ==> 0-167 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 54 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 51, 205, 259, 358, 385, 406, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.924 = GTTCTCGTCCCGGATG-1

using 282 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 277]
surviving nonsolo ucounts = 1[277]
ids = [4]

====================================================================================

UMI info for barcode GTTCTCGTCCCGGATG-1 contig 1 = CCAGGGCTGG...
umi TCAAGGAACG = 267 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
46-391 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
431-555 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSSYTSSGVVF at 370, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 46, 203, 247, 254, 257
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.929 = GTTCTCGTCCGTAGTA-1

using 143 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 4, 127]
surviving nonsolo ucounts = 1[127]
ids = [5]

====================================================================================

UMI info for barcode GTTCTCGTCCGTAGTA-1 contig 1 = TCTACAGAAG...
umi CTTCCAGCCC = 123 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=503]
0-34 ==> 270-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
34-387 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
416-464 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
464-503 ==> 0-39 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 376, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 34, 190, 232, 298, 331, 421
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.930 = GTTCTCGTCCTACAGA-1

using 1574 reads

====================================================================================

graph has 802 edges initially, 26 edges after simplification

total ucounts = 203
nonsolo ucounts = 68[2^33, 3^11, 4^10, 5^3, 6^2, 7^2, 9, 12, 14, 128, 148, 470, 478]
surviving nonsolo ucounts = 4[128, 148, 470, 478]
ids = [97, 34, 75, 122]

====================================================================================

REJECT CONTIGS

TIG 1[bases=544]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-31 ==> 5706-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
384-408 ==> 14-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [34, 97]
of which 2 are surviving nonsolos
reads assigned: 266
start codons at 30, 238, 364, 450
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.938 = GTTCTCGTCGCGGATC-1

using 184 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 177]
surviving nonsolo ucounts = 1[177]
ids = [0]

====================================================================================

UMI info for barcode GTTCTCGTCGCGGATC-1 contig 1 = GCTACAACAG...
umi AACCTTCTGT = 162 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=520]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
428-520 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYYSTLWTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.949 = GTTCTCGTCTCTGTCG-1

using 39 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 35]
surviving nonsolo ucounts = 1[35]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.956 = GTTCTCGTCTTGCCGT-1

using 59 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[4, 11, 21, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.969 = GTTTCTAAGATGCCTT-1

using 226 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[224]
surviving nonsolo ucounts = 1[224]
ids = [2]

====================================================================================

UMI info for barcode GTTTCTAAGATGCCTT-1 contig 1 = ACCCAAAAAC...
umi TCGTCACCAT = 222 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=564]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
413-440 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=1)
447-493 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
493-564 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CAREWGYYDILTGYSGGPPDYW at 396, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 54, 205, 252, 257, 274, 289, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.972 = GTTTCTAAGCATCATC-1

using 401 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 10, 384]
surviving nonsolo ucounts = 1[384]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=493]
2-274 ==> 84-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=16)
285-333 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
333-493 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKYPGGFDYW at 263, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 42, 233, 387
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.976 = GTTTCTAAGCGCCTTG-1

using 117 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 109]
surviving nonsolo ucounts = 1[109]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTAAGCGCCTTG-1 contig 1 = GAGGAATCAG...
umi GGTCTGCACT = 93 reads: +388 validated
umi TCTGCACTTT = 1 reads: -343 +11 -1 +6 -1 +2 -1 +4 -1 +2 -1 +3 -1 +6 -1 +4 non-validated

GOOD CONTIGS

TIG 1[bases=497]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-497 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4, 7]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.994 = GTTTCTAAGGTCATCT-1

using 228 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode GTTTCTAAGGTCATCT-1 contig 1 = CTTGGGATTC...
umi CTAGACTAGC = 204 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=499]
0-57 ==> 23-80 on |107|IGHV3-13|5'UTR| [len=80] (mis=0)
57-407 ==> 0-350 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=2)
426-472 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
472-499 ==> 0-27 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARAPTVEGGGMDVW at 396, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 57, 213, 331, 357, 429, 490
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.998 = GTTTCTAAGTACGACG-1

using 1060 reads

====================================================================================

graph has 454 edges initially, 26 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2^4, 3^2, 4^2, 5, 18, 294, 309, 410]
surviving nonsolo ucounts = 3[294, 309, 410]
ids = [2, 0, 8]

====================================================================================

UMI info for barcode GTTTCTAAGTACGACG-1 contig 1 = AGGAGTCAGA...
umi AACCAACCGC = 306 reads: +388 validated
umi AATTAGTCAC = 220 reads: +54 -1XX +6 -1XX +7 -1XX +16 -1XX +3 -1XX +59 -1XX +2 -1XX +3 -2XX +3 -1XX +13 -1XX +8 -19 +6 -1XX +6 -1XX +10 -1XX +7 -1XX +26 -1XX +68 -1XX +2 -1XX +12 -1XX +2 -2X +20 -1XX +6 -1XX +1 -1XX +5 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 512
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false

REJECT CONTIGS

TIG 1[bases=362]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-326 ==> 0-293 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 33, 337
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1001 = GTTTCTAAGTATCTCG-1

using 470 reads

====================================================================================

graph has 150 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 10[2, 3, 4^2, 6^2, 7, 12, 210, 215]
surviving nonsolo ucounts = 2[210, 215]
ids = [8, 3]

====================================================================================

UMI info for barcode GTTTCTAAGTATCTCG-1 contig 1 = GAGCTACAAC...
umi CACTTTCTTT = 202 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=492]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=14)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
430-492 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 30, 99, 352, 472
confident = false

REJECT CONTIGS

TIG 1[bases=507]
23-215 ==> 0-192 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=8)
216-376 ==> 192-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=14) [SHIFT!]
374-412 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
412-507 ==> 0-95 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CSSWDSSLSAWVF at 345, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 23, 162, 235, 353
confident = false
not full
frameshifted full length stopped transcript of length 507
VJ delta = 20
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1002 = GTTTCTAAGTATGACA-1

using 326 reads

====================================================================================

graph has 146 edges initially, 10 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 4, 5, 306]
surviving nonsolo ucounts = 2[5, 306]
ids = [5, 7]

====================================================================================

UMI info for barcode GTTTCTAAGTATGACA-1 contig 1 = ATCAGTCCCA...
umi CTCATGTAGA = 2 reads: -160 +5 -3X +1 -2 +1 -1X +6 -1 +1 -1X +5 -1 +5 -1 +8 -1X +3 -1X +3 -1X +1 -1X +1 -1XX +8 -1X +8 -2X +20 -1X +2 -3X +9 -119 invalidated
umi CTTTCCTACT = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-482 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 257
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1006 = GTTTCTAAGTCCATAC-1

using 9468 reads

====================================================================================

graph has 3591 edges initially, 42 edges after simplification

total ucounts = 444
nonsolo ucounts = 216[2^64, 3^39, 4^22, 5^25, 6^9, 7^5, 8^4, 9^2, 10^3, 12, 13, 14, 19, 63, 79, 81, 86, 95, 111, 113, 116, 127, 141, 152, 158, 162, 166, 169, 198, 204, 217, 225, 228, 240, 241, 244, 250, 259, 269, 280, 283, 287, 295, 296^2, 302, 306, 321, 344, 345, 347, 459]
surviving nonsolo ucounts = 38[63, 79, 81, 86, 95, 113, 116, 127, 141, 152, 158, 162, 166, 169, 198, 204, 217, 225, 228, 240, 241, 244, 250, 259, 269, 280, 283, 287, 295, 296^2, 302, 306, 321, 344, 345, 347, 459]
ids = [71, 129, 199, 10, 122, 442, 330, 20, 185, 435, ...]

====================================================================================

UMI info for barcode GTTTCTAAGTCCATAC-1 contig 1 = GGGATCAGGA...
umi AATTACTTCA = 256 reads: +400 validated
umi ACTGAAAGCA = 228 reads: +400 validated
umi AGAATGCAGT = 170 reads: +400 validated
umi AGCCGTTAAG = 64 reads: +388 -12 non-validated
umi ATACTTATCC = 293 reads: +400 validated
umi CACACTCAGG = 79 reads: +400 validated
umi CATCACACTA = 292 reads: +400 validated
umi CATTCCTGGG = 262 reads: +400 validated
umi CGCGTGTTTA = 345 reads: +400 validated
umi CGGATAAGAC = 286 reads: +400 validated
umi CGTGGGCGGT = 83 reads: +400 validated
umi CTGTGTAACC = 277 reads: +400 validated
umi CTTCCTAGAT = 269 reads: +400 validated
umi GATGCTCTGC = 249 reads: +400 validated
umi GCTATCTCAG = 205 reads: +400 validated
umi GTTCGTCTAC = 169 reads: +400 validated
umi TAATACTAGC = 301 reads: +400 validated
umi TGAATCATCT = 305 reads: +400 validated
umi TTATGGGATA = 242 reads: +400 validated
umi TTGCCTCGCT = 463 reads: +400 validated
umi TTGCTCCTCA = 160 reads: +400 validated
umi TTTCATGGCT = 152 reads: +400 validated

UMI info for barcode GTTTCTAAGTCCATAC-1 contig 2 = AGCTCTGGGA...
umi AACCCTTCAC = 76 reads: +424 validated
umi AAGCATCCTT = 127 reads: +422 -2 non-validated
umi CAACATGGTT = 95 reads: +424 validated
umi CTAACTTTGC = 323 reads: +424 validated
umi CTACTATCCA = 293 reads: +424 validated
umi CTGACCGGAG = 195 reads: +424 validated
umi GATTCGACTA = 241 reads: +424 validated
umi GTTAACCTCG = 283 reads: +422 -1 +1 non-validated
umi TATAACGGAA = 105 reads: +424 validated
umi TTGGCTGCGT = 192 reads: +424 validated
umi TTTCGTGGGG = 160 reads: +409 -15 non-validated
umi TTTTTACGGT = 115 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=568]
32-397 ==> 0-365 on |734|IGKV2D-40|L-REGION+V-REGION| [len=365] (mis=2)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 733 reads
cdr3 = CMQRIEFPFTF at 371, score = 9 + 8
umis assigned: [30, 58, 63, 71, 92, 129, 149, 152, 187, 191] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5071
start codons at 32, 65, 101, 189, 192, 354, 374, 474
confident = true

TIG 2[bases=575]
0-80 ==> 0-80 on |143|IGHV3-49|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |144|IGHV3-49|L-REGION+V-REGION| [len=359] (mis=1)
441-468 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
467-504 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 173 reads
cdr3 = CTRDRITMVRGVMYW at 428, score = 8 + 7
umis assigned: [10, 20, 122, 203, 206, 222, 254, 307, 330, 428] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2171
start codons at 80, 133, 231, 236, 303, 360, 389, 449, 464
confident = true
now this is a cell
paired!

ACCGAGGACACAGCCGTGTATTACTGTACTAGAGATCGAATTACTATGGTTCGGGGAGTTATGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGGGTGGAGGCTGAGGATGTTGGAGTTTATTACTGCATGCAACGTATAGAGTTTCCCTTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1011 = GTTTCTAAGTGAAGTT-1

using 589 reads

====================================================================================

graph has 222 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[6, 575]
surviving nonsolo ucounts = 1[575]
ids = [3]

====================================================================================

UMI info for barcode GTTTCTAAGTGAAGTT-1 contig 1 = GGGAGTCAGT...
umi GACCTTCCGC = 574 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQQSYSTRALTF at 354, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 568
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1015 = GTTTCTAAGTGGAGTC-1

using 213 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 208]
surviving nonsolo ucounts = 1[208]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTAAGTGGAGTC-1 contig 1 = GAGTCAGACT...
umi TCGTCACCCT = 196 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-494 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1020 = GTTTCTACAAAGCAAT-1

using 41 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[3, 4^3, 6, 7, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1023 = GTTTCTACAACGATCT-1

using 311 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^2, 4^3, 11, 280]
surviving nonsolo ucounts = 1[280]
ids = [3]

====================================================================================

UMI info for barcode GTTTCTACAACGATCT-1 contig 1 = GGAACTGCTC...
umi CTTCGGTACA = 280 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQCKSWPFTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 31, 80, 100, 360, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1024 = GTTTCTACAACTGCTA-1

using 395 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 7, 11, 372]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GTTTCTACAACTGCTA-1 contig 1 = GGATCACTCA...
umi ATTCACGGAA = 375 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=537]
60-413 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=22)
420-466 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
466-537 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CVRNSGLGDYW at 402, score = 8 + 7
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 370
start codons at 60, 211, 258, 263, 267, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1044 = GTTTCTACACGACTCG-1

using 277 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode GTTTCTACACGACTCG-1 contig 1 = CTCAGAGAGG...
umi ACATATCTGT = 273 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=534]
0-75 ==> 4-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
75-428 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=38)
459-505 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
505-534 ==> 0-29 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARESYVGLYSSTSYPDYW at 417, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 75, 224, 231, 310, 352, 378, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1045 = GTTTCTACACGGCGTT-1

using 541 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 5, 6, 9, 211, 301]
surviving nonsolo ucounts = 2[211, 301]
ids = [5, 10]

====================================================================================

UMI info for barcode GTTTCTACACGGCGTT-1 contig 1 = GGAGTCAGTC...
umi GTTACAGGGA = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-475 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQTYSTLVTF at 353, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 237, 456
confident = false

REJECT CONTIGS

TIG 1[bases=474]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-368 ==> 0-351 on |184|IGHV4-34|L-REGION+V-REGION| [len=369] (mis=6)
401-449 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
449-474 ==> 0-25 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
cdr3 = CDRRGHGYYCARAHGDYYTLLDFW at 346, score = 4 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 17, 38, 82, 168
confident = false
frameshifted full length transcript of length 474
VJ delta = 37
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1047 = GTTTCTACACGTCAGC-1

using 241 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 4, 225]
surviving nonsolo ucounts = 1[225]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTACACGTCAGC-1 contig 1 = AGCTTCAGCT...
umi CTCTTTGGAG = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-563 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1053 = GTTTCTACAGCCACCA-1

using 350 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 343]
surviving nonsolo ucounts = 1[343]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTACAGCCACCA-1 contig 1 = GGACTGATCA...
umi TTACCTTTCA = 346 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=17)
397-435 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CMQGRQTPQFTF at 371, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1060 = GTTTCTACAGGGAGAG-1

using 242 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode GTTTCTACAGGGAGAG-1 contig 1 = CTCTGCTTCA...
umi ATATCCCCGG = 223 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=595]
0-50 ==> 1-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
50-406 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=20)
403-441 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
441-595 ==> 0-154 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CQCYDNSLTGWGF at 374, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 50, 204, 357, 384, 520
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1064 = GTTTCTACATAACCTG-1

using 19195 reads

====================================================================================

graph has 15380 edges initially, 224 edges after simplification

total ucounts = 3484
nonsolo ucounts = 1935[2^612, 3^363, 4^279, 5^169, 6^138, 7^73, 8^62, 9^55, 10^33, 11^32, 12^21, 13^13, 14^20, 15^3, 16^10, 17^6, 18^4, 19^3, 20^2, 21, 23, 26, 29, 43, 46, 70, 119, 120, 124, 133, 172, 186, 203, 211, 226, 234, 263, 279, 283^2, 286, 303, 304, 308, 316, 332, 336, 350, 365, 376, 380, 409^2, 469, 512, 633]
surviving nonsolo ucounts = 33[2, 23, 26, 43, 46, 70, 124, 133, 186, 203, 211, 226, 234, 263, 279, 283^2, 286, 303, 304, 308, 316, 332, 336, 350, 365, 376, 380, 409^2, 469, 512, 633]
ids = [3442, 211, 2841, 2230, 256, 1716, 623, 3255, 845, 2954, ...]

====================================================================================

UMI info for barcode GTTTCTACATAACCTG-1 contig 1 = AGAGCTCTGG...
umi ACAAATAACC = 209 reads: +388 validated
umi ACAGTTTCTG = 290 reads: +388 validated
umi ACCCATGGTT = 336 reads: +388 validated
umi ACCCGTCCTT = 348 reads: +388 validated
umi AGCATTTGGC = 416 reads: +388 validated
umi ATACGGGACC = 515 reads: +49 -5XX +2 -4XX +1 -5XX +1 -1XX +2 -250XX +1 -2XX +2 -2XX +1 -2XX +1 -14XX +43 invalidated
umi CAGGATGTAG = 380 reads: +388 validated
umi CATAAACCTG = 409 reads: +388 validated
umi CATGCTTAAC = 256 reads: +388 validated
umi CCCAGGCCAT = 283 reads: +388 validated
umi CCTCTCACGT = 633 reads: +49 -5XX +2 -4XX +1 -5XX +1 -1XX +1 -251 +1 -2X +2 -2XX +1 -2XX +1 -14XX +43 invalidated
umi CTTAAGATAT = 308 reads: +388 validated
umi CTTCATCCTT = 226 reads: +388 validated
umi GACCACTTAA = 317 reads: +388 validated
umi GACCTATTAT = 381 reads: +388 validated
umi GCAGTCTCGT = 275 reads: +388 validated
umi GCCCGTTCGC = 304 reads: +388 validated
umi TAACACGGCC = 306 reads: +388 validated
umi TCCGTATGGC = 366 reads: +388 validated
umi TCTAGTATCC = 204 reads: +388 validated
umi TGGAATAGGG = 472 reads: +388 validated
umi TGTACAGCTA = 288 reads: +388 validated
umi TTAGCACCCG = 339 reads: +388 validated

UMI info for barcode GTTTCTACATAACCTG-1 contig 2 = GGAGTCTCCC...
umi ACAGCATGGA = 24 reads: -11 +146 -1 +8 -1 +17 -1 +186 -49 +7 non-validated
umi ACCATCGTCA = 45 reads: +255 -1 +3 -1 +2 -1 +7 -1 +156 non-validated
umi ATCAACCGTA = 119 reads: +427 validated
umi CAAATAGGCG = 190 reads: +427 validated
umi CTCTGTGCTA = 73 reads: +427 validated
umi GCTTTGCATC = 42 reads: +427 validated
umi TATTTTTTCT = 1 reads: -427 non-validated
umi TCCATACAAT = 26 reads: +409 -18 non-validated
umi TGCCGACTCC = 232 reads: +427 validated
umi TTACGCCTCT = 133 reads: +427 validated
umi TTTCTTGGAT = 2 reads: -427 non-validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
394-432 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 21 umis using 896 reads
cdr3 = CHHYGVSPGWTF at 368, score = 9 + 8
umis assigned: [184, 217, 260, 268, 479, 582, 997, 1020, 1082, 1200] and 13 others
of which 23 are surviving nonsolos
reads assigned: 7706
start codons at 44, 252, 378, 474
confident = true

TIG 2[bases=668]
0-59 ==> 0-59 on |200|IGHV5-51|5'UTR| [len=59] (mis=2)
59-397 ==> 0-338 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=22)
434-486 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=6)
486-668 ==> 0-182 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 6 umis using 91 reads
cdr3 = CVITVRHTTSLTQFLQHW at 401, score = 8 + 7
umis assigned: [211, 256, 623, 845, 1716, 2230, 2752, 2841, 3098, 3255] and 1 others
of which 10 are surviving nonsolos
reads assigned: 869
start codons at 59, 233, 276, 392
confident = true
now this is a cell
paired!

ACCGCCATGTACTATTGTGTCATTACTGTGCGACACACGACGTCGTTAACTCAATTCCTCCAACACTGGGGCCAGGGCTCCCTGGTCACCGTCTCCTCAG <==> AGCAGACTCGAGCCTGAAGACTTTGCACTGTATTACTGTCATCATTATGGTGTCTCACCAGGGTGGACGTTCGGCCAAGGGTCCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1076 = GTTTCTACATCTCGCT-1

using 10811 reads

====================================================================================

graph has 6420 edges initially, 122 edges after simplification

total ucounts = 1005
nonsolo ucounts = 739[2^111, 3^92, 4^93, 5^89, 6^53, 7^50, 8^44, 9^34, 10^32, 11^22, 12^30, 13^11, 14^11, 15^13, 16^5, 17^7, 18^5, 19^4, 20^2, 21^5, 25, 26^2, 85, 109, 154, 166, 182, 186, 201, 228, 239^2, 242, 250, 264, 282, 293, 294, 318, 341, 342, 351, 358, 379, 400]
surviving nonsolo ucounts = 23[26, 85, 109, 166, 182, 186, 201, 228, 239^2, 242, 250, 264, 282, 293, 294, 318, 341, 342, 351, 358, 379, 400]
ids = [638, 862, 727, 155, 684, 992, 938, 411, 145, 299, ...]

====================================================================================

UMI info for barcode GTTTCTACATCTCGCT-1 contig 1 = AGAGCTCTGG...
umi ATATAACCAG = 241 reads: +385 validated
umi ATCCTCATGG = 166 reads: +385 validated
umi ATCTAGATAT = 320 reads: +385 validated
umi CATCGGCTAC = 267 reads: +385 validated
umi CATGCTGCTC = 360 reads: +385 validated
umi CCCGCACGTC = 226 reads: +385 validated
umi CTCGATGGCT = 229 reads: +385 validated
umi CTCGGGGTCT = 336 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +339 invalidated
umi CTGTCGAATC = 291 reads: +385 validated
umi GGATTACTCT = 248 reads: +385 validated
umi GGCGTCCAGG = 298 reads: +385 validated
umi GTAGTCCGGA = 401 reads: +385 validated
umi GTTATCGCCG = 182 reads: +385 validated
umi TACCTGCTCT = 113 reads: +385 validated
umi TCCTCGGTGG = 346 reads: +385 validated
umi TGCGTCGTTG = 85 reads: +385 validated
umi TGTCGTAGTA = 345 reads: +385 validated
umi TTCGGCTGCT = 205 reads: +385 validated
umi TTGAGCCGTA = 245 reads: +385 validated

UMI info for barcode GTTTCTACATCTCGCT-1 contig 2 = GGCTTTCTGA...
umi AATTCCCCGT = 215 reads: -363X +1 -3XX +1 -5XX +1 -10XX +2 -1XX +4 -1XX +41 invalidated
umi CACCGAGTGT = 350 reads: +433 validated
umi GTACCTTCAC = 22 reads: -433 non-validated
umi TTTTAATTCG = 185 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 682 reads
cdr3 = CQQYGSSPKTF at 368, score = 9 + 8
umis assigned: [145, 155, 164, 266, 268, 299, 411, 416, 435, 576] and 9 others
of which 19 are surviving nonsolos
reads assigned: 4828
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=519]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
448-519 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 39 reads
cdr3 = CARGRILGWYSDYW at 375, score = 9 + 7
umis assigned: [43, 240, 638, 992]
of which 4 are surviving nonsolos
reads assigned: 762
start codons at 15, 36, 80, 166
confident = true
now this is a cell
paired!

ACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGCCGGATACTAGGGTGGTACTCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTAAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1077 = GTTTCTACATGCTAGT-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1078 = GTTTCTACATGGTTGT-1

using 82 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^2, 3^4, 4, 5, 7^2, 37]
surviving nonsolo ucounts = 1[37]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=305]
0-305 ==> 0-305 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=5)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 25
start codons at 0, 44, 223, 226
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1081 = GTTTCTACATTACCTT-1

using 6008 reads

====================================================================================

graph has 6071 edges initially, 100 edges after simplification

total ucounts = 1092
nonsolo ucounts = 807[2^131, 3^94, 4^85, 5^74, 6^68, 7^70, 8^47, 9^40, 10^29, 11^38, 12^24, 13^24, 14^25, 15^23, 16^10, 17^10, 18^4, 19^3, 20^3, 22, 23, 24, 32, 212]
surviving nonsolo ucounts = 1[212]
ids = [186]

====================================================================================

UMI info for barcode GTTTCTACATTACCTT-1 contig 1 = ACCCAAAAAC...
umi ATCAAGCTCA = 203 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=595]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-595 ==> 0-105 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [186]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 54, 252, 257, 274, 318, 351, 508, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1089 = GTTTCTAGTAATTGGA-1

using 1362 reads

====================================================================================

graph has 1942 edges initially, 16 edges after simplification

total ucounts = 543
nonsolo ucounts = 274[2^92, 3^60, 4^43, 5^24, 6^21, 7^15, 8^5, 9^4, 10, 11^4, 13^2, 14^2, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1100 = GTTTCTAGTCAACTGT-1

using 324 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 314]
surviving nonsolo ucounts = 1[314]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTAGTCAACTGT-1 contig 1 = GAAGAGCTGC...
umi CTACGCTGGG = 284 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=503]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-503 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYGSSPWTF at 357, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 33, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1113 = GTTTCTAGTCTGGAGA-1

using 58 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 3, 11, 39]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1117 = GTTTCTAGTGAGCGAT-1

using 266 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 261]
surviving nonsolo ucounts = 1[261]
ids = [3]

====================================================================================

UMI info for barcode GTTTCTAGTGAGCGAT-1 contig 1 = TGGGGTCTCA...
umi GATACTTCGT = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-39 ==> 124-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
39-393 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
427-478 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSSHAGSTRVLF at 363, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 39, 196, 247, 346, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1122 = GTTTCTAGTGCATCTA-1

using 225 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 216]
surviving nonsolo ucounts = 1[216]
ids = [0]

====================================================================================

UMI info for barcode GTTTCTAGTGCATCTA-1 contig 1 = ACCCAAAAAC...
umi AAATTGACTG = 207 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-531 ==> 0-41 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1128 = GTTTCTAGTGTCTGAT-1

using 252 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode GTTTCTAGTGTCTGAT-1 contig 1 = GCTGGGGTCT...
umi AAAGGGTGTG = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-558 ==> 0-129 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 41, 198, 242, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1141 = GTTTCTAGTTCCTCCA-1

using 491 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 3, 6, 7, 216, 253]
surviving nonsolo ucounts = 2[216, 253]
ids = [9, 8]

====================================================================================

UMI info for barcode GTTTCTAGTTCCTCCA-1 contig 1 = ATCACATAAC...
umi TTCACGACGG = 258 reads: +448 validated
umi TTCGCATCGG = 214 reads: +361 -1X +86 invalidated

GOOD CONTIGS

TIG 1[bases=546]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
443-506 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
506-546 ==> 0-40 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CARGGWGTGTTGLEKGYYYYAMDVW at 400, score = 9 + 7
umis assigned: [8, 9]
of which 2 are surviving nonsolos
reads assigned: 459
start codons at 58, 118, 209, 256, 293, 355, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1153 = GTTTCTATCACCACCT-1

using 268 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 10, 249]
surviving nonsolo ucounts = 1[249]
ids = [4]

====================================================================================

UMI info for barcode GTTTCTATCACCACCT-1 contig 1 = GGGACTCCTG...
umi TACACTAATC = 239 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=593]
19-377 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
452-593 ==> 0-141 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 364, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 19, 63, 242, 245, 248, 334, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1161 = GTTTCTATCAGGATCT-1

using 8133 reads

====================================================================================

graph has 3906 edges initially, 36 edges after simplification

total ucounts = 661
nonsolo ucounts = 352[2^118, 3^77, 4^46, 5^32, 6^21, 7^12, 8^5, 9^6, 10^5, 12^2, 15, 18, 20, 25, 27, 30, 32, 145, 203, 253, 258, 265, 277, 282, 294, 306, 308, 311, 313, 318, 342, 345, 358^2, 361, 366, 369, 436]
surviving nonsolo ucounts = 21[145, 203, 253, 258, 265, 277, 282, 294, 306, 308, 311, 313, 318, 342, 345, 358^2, 361, 366, 369, 436]
ids = [502, 467, 23, 512, 71, 406, 601, 612, 641, 471, ...]

====================================================================================

UMI info for barcode GTTTCTATCAGGATCT-1 contig 1 = AGAGCTCTGG...
umi AAGATCGCGG = 253 reads: +385 validated
umi ACGTCTATGT = 268 reads: +385 validated
umi CGGCACGCAG = 442 reads: -6XX +1 -2XX +1 -164X +1 -3XX +2 -6XX +1 -2XX +196 invalidated
umi CTTTGCTCTT = 360 reads: +385 validated
umi GATAGCGCGC = 318 reads: +385 validated
umi GTACAGCGCG = 280 reads: +385 validated
umi GTACATGGCT = 368 reads: +385 validated
umi GTGCTTGTCG = 358 reads: +385 validated
umi GTGTGTATTC = 313 reads: +385 validated
umi TACCGTAGCA = 203 reads: +385 validated
umi TACTAACTCT = 310 reads: +385 validated
umi TATATATACA = 337 reads: +385 validated
umi TATATCTCCT = 366 reads: +385 validated
umi TCAGACGCCA = 147 reads: +385 validated
umi TTATTTTTTG = 289 reads: +385 validated
umi TTCAGGCAGC = 361 reads: +385 validated
umi TTCATGCGCT = 294 reads: +385 validated
umi TTGGAACATC = 319 reads: +385 validated
umi TTTACATATT = 306 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 945 reads
cdr3 = CQQYNNWPPWTF at 365, score = 9 + 8
umis assigned: [23, 71, 267, 339, 350, 406, 407, 437, 441, 467] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5789
start codons at 44, 113, 249, 471
confident = true

REJECT CONTIGS

TIG 1[bases=559]
0-80 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-239 ==> 0-209 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=0)
240-391 ==> 209-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1) [SHIFT!]
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [54, 512]
of which 2 are surviving nonsolos
reads assigned: 597
start codons at 30, 63, 99, 150, 187, 251, 350, 370, 377, 465
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1187 = GTTTCTATCGTAGGTT-1

using 214 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 200]
surviving nonsolo ucounts = 1[200]
ids = [2]

====================================================================================

UMI info for barcode GTTTCTATCGTAGGTT-1 contig 1 = ACTAGAAGTC...
umi ATTAACCATT = 200 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=543]
0-57 ==> 23-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
57-408 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=3)
413-429 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=0)
424-472 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
472-543 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CATKHDYGDYGDYW at 399, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 57, 208, 213, 266, 271, 274, 292, 360, 412
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1194 = GTTTCTATCTCCAGGG-1

using 24 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1211 = TAAACCGAGAACTGTA-1

using 920 reads

====================================================================================

graph has 344 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 307, 605]
surviving nonsolo ucounts = 2[307, 605]
ids = [2, 4]

====================================================================================

UMI info for barcode TAAACCGAGAACTGTA-1 contig 1 = GGGGCAGGAG...
umi CGATCGGGGG = 311 reads: +388 validated
umi GTGATAATGT = 610 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 134 reads
cdr3 = CQQSYSTPVTF at 359, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 903
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1213 = TAAACCGAGAATGTTG-1

using 234 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 228]
surviving nonsolo ucounts = 1[228]
ids = [3]

====================================================================================

UMI info for barcode TAAACCGAGAATGTTG-1 contig 1 = GGGAATCAGT...
umi CCAATTGCAG = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1217 = TAAACCGAGAGAGCTC-1

using 250 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 246]
surviving nonsolo ucounts = 1[246]
ids = [3]

====================================================================================

UMI info for barcode TAAACCGAGAGAGCTC-1 contig 1 = GCTGGGGTCT...
umi GACTTGTCCT = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=570]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=2)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-570 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1225 = TAAACCGAGGAATCGC-1

using 107 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 100]
surviving nonsolo ucounts = 1[100]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=463]
0-353 ==> 7-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
352-390 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
390-463 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTRETF at 329, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 91
start codons at 26, 62, 150, 312, 332, 432
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1229 = TAAACCGAGGCGTACA-1

using 662 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[36, 626]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1230 = TAAACCGAGGCTAGGT-1

using 281 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^4, 3, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode TAAACCGAGGCTAGGT-1 contig 1 = GGGGTCTCAG...
umi CTTCGGCTAG = 268 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=510]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-399 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-510 ==> 0-78 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTSSSTPLYVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 38, 195, 239, 246, 396
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1238 = TAAACCGAGTCGTACT-1

using 254 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 247]
surviving nonsolo ucounts = 1[247]
ids = [3]

====================================================================================

UMI info for barcode TAAACCGAGTCGTACT-1 contig 1 = ACCCAAAAAC...
umi TCGTTGCCTT = 247 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-556 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1253 = TAAACCGCAAGTAATG-1

using 729 reads

====================================================================================

graph has 326 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^2, 6, 353, 357]
surviving nonsolo ucounts = 2[353, 357]
ids = [0, 6]

====================================================================================

UMI info for barcode TAAACCGCAAGTAATG-1 contig 1 = AGTCAGTCTC...
umi AACCCATACT = 357 reads: +388 validated

UMI info for barcode TAAACCGCAAGTAATG-1 contig 2 = AGAGCTGCTC...
umi CTACCGCCGG = 357 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 23-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false

TIG 2[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGNSPRTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 31, 260, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1268 = TAAACCGCACTTCTGC-1

using 225 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 223]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode TAAACCGCACTTCTGC-1 contig 1 = GGGGAGCATC...
umi GCCACCTTCT = 224 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=516]
65-418 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=21)
440-480 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
480-516 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARGKDDSGRSDYW at 407, score = 9 + 6
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 216
start codons at 65, 268, 272, 300, 329, 362, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1277 = TAAACCGCATCCCACT-1

using 343 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 334]
surviving nonsolo ucounts = 1[334]
ids = [4]

====================================================================================

UMI info for barcode TAAACCGCATCCCACT-1 contig 1 = GTCAGACTCA...
umi TGCGCTCATT = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-469 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1284 = TAAACCGCATGGTCTA-1

using 171 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 166]
surviving nonsolo ucounts = 1[166]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=434]
0-340 ==> 11-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
339-377 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
377-434 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQDNGYPWTF at 316, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 51, 64, 296, 329, 419
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1289 = TAAACCGGTAAACACA-1

using 228 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 221]
surviving nonsolo ucounts = 1[221]
ids = [2]

====================================================================================

UMI info for barcode TAAACCGGTAAACACA-1 contig 1 = ACTTTCTGAG...
umi CATGTCCAGT = 218 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=515]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=13)
405-456 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
456-515 ==> 0-59 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAGRTGVGLGTGWFDPW at 374, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 35, 79, 242
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1294 = TAAACCGGTAGGCTGA-1

using 289 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 286]
surviving nonsolo ucounts = 1[286]
ids = [0]

====================================================================================

UMI info for barcode TAAACCGGTAGGCTGA-1 contig 1 = GGAGCCCCAG...
umi ATATATCATT = 271 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=521]
0-68 ==> 168-236 on |168|IGHV3-74|5'UTR| [len=236] (mis=0)
68-419 ==> 0-351 on |169|IGHV3-74|L-REGION+V-REGION| [len=351] (mis=4)
447-510 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CAVLNYGSGSYEGYYYYYGMDVW at 410, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 68, 224, 285, 371, 426, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1296 = TAAACCGGTATATCCG-1

using 306 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [0]

====================================================================================

UMI info for barcode TAAACCGGTATATCCG-1 contig 1 = GGAGTCAGTC...
umi ATGACTATAG = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1300 = TAAACCGGTCGCCATG-1

using 166 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[163]
surviving nonsolo ucounts = 1[163]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1301 = TAAACCGGTCGTTGTA-1

using 509 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[10, 494]
surviving nonsolo ucounts = 1[494]
ids = [6]

====================================================================================

UMI info for barcode TAAACCGGTCGTTGTA-1 contig 1 = GAGTCAGTCC...
umi TAAGTTCGCT = 495 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYDNLPITF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 487
start codons at 25, 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1305 = TAAACCGGTGAACCTT-1

using 321 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 313]
surviving nonsolo ucounts = 1[313]
ids = [0]

====================================================================================

UMI info for barcode TAAACCGGTGAACCTT-1 contig 1 = GGAGGAACTG...
umi AAATCTACAG = 290 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=476]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-476 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQRSNWPPTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1306 = TAAACCGGTGCGAAAC-1

using 288 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 4, 6, 267]
surviving nonsolo ucounts = 1[267]
ids = [2]

====================================================================================

UMI info for barcode TAAACCGGTGCGAAAC-1 contig 1 = AGCTTCAGCT...
umi CTGTATAGCA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-535 ==> 0-100 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1308 = TAAACCGGTGTGAAAT-1

using 314 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 308]
surviving nonsolo ucounts = 1[308]
ids = [4]

====================================================================================

UMI info for barcode TAAACCGGTGTGAAAT-1 contig 1 = GGAGAAGAGC...
umi GATGCTTATA = 307 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQHATSPFTF at 360, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1314 = TAAACCGGTTGTCGCG-1

using 186 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[4, 5, 6, 8, 161]
surviving nonsolo ucounts = 1[161]
ids = [4]

====================================================================================

UMI info for barcode TAAACCGGTTGTCGCG-1 contig 1 = TCAGGAGGCA...
umi GGAGAAAGTC = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-32 ==> 9-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
32-384 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
420-553 ==> 0-133 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CSSYTSSSTRVF at 356, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 32, 189, 233, 240
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1317 = TAAACCGTCACATGCA-1

using 235 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=441]
0-348 ==> 5-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
346-383 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
383-441 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYTTLLTF at 322, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 1, 57, 70, 206, 425
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1325 = TAAACCGTCCAACCAA-1

using 7940 reads

====================================================================================

graph has 4006 edges initially, 20 edges after simplification

total ucounts = 673
nonsolo ucounts = 286[2^94, 3^60, 4^46, 5^28, 6^7, 7^11, 8, 9^2, 10, 12^2, 13^2, 17, 18, 20, 50, 83, 107, 110, 134, 149, 173, 190, 198, 200, 201, 210^2, 228, 231, 239, 250, 258, 262, 273, 274, 287, 290, 292, 301, 304, 332, 336, 429]
surviving nonsolo ucounts = 28[50, 83, 107, 110, 134, 149, 173, 190, 198, 201, 210^2, 228, 231, 239, 250, 258, 262, 273, 274, 287, 290, 292, 301, 304, 332, 336, 429]
ids = [69, 335, 512, 433, 521, 211, 611, 442, 199, 48, ...]

====================================================================================

UMI info for barcode TAAACCGTCCAACCAA-1 contig 1 = GATCAGGACT...
umi AAGCTACTGT = 284 reads: +397 validated
umi AATTGTCCAA = 201 reads: +397 validated
umi ACTCGACCAT = 257 reads: +397 validated
umi ACTTTACACA = 335 reads: +397 validated
umi ATGTCTTTCA = 274 reads: +397 validated
umi CACGTGGGGA = 200 reads: +397 validated
umi CCACGAGGCG = 292 reads: +397 validated
umi CGCACCGCTA = 299 reads: +397 validated
umi CTGACTGCAT = 426 reads: -78 +1 -4XX +314 invalidated
umi GATCGTACGG = 255 reads: +397 validated
umi GTACGGGATC = 331 reads: +397 validated
umi GTTAACACCT = 263 reads: +397 validated
umi TGGGTCTACA = 304 reads: +397 validated
umi TTATCTTTAG = 234 reads: +397 validated

UMI info for barcode TAAACCGTCCAACCAA-1 contig 2 = GGAGAGGAGC...
umi AAATGTGCTT = 215 reads: +427 validated
umi ACGACATTTC = 49 reads: -1 +330 -22 +12 -1 +14 -1 +28 -18 non-validated
umi CACTAGGAAA = 219 reads: +427 validated
umi CAGACTCCGT = 153 reads: +415 -12 non-validated
umi CGCACCCACT = 210 reads: +417 -10 non-validated
umi CTAGCATGCG = 72 reads: -402 +4 -3 +1 -1 +11 -1 +4 non-validated
umi GGAGGGGAGG = 109 reads: +380 -5 +42 non-validated
umi GGGAAGCGTG = 182 reads: +427 validated
umi TAGCACTCAT = 110 reads: +427 validated
umi TATCTCTACA = 136 reads: +427 validated
umi TCCCCCATGC = 275 reads: +420 -7 non-validated
umi TGCCGGGCGC = 276 reads: +427 validated
umi TGTAGTAAGC = 175 reads: +427 validated
umi TGTGTGCGCG = 235 reads: +415 -2 +3 -1 +6 non-validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 524 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [31, 48, 81, 89, 159, 199, 238, 300, 362, 393] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3897
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true

TIG 2[bases=571]
0-73 ==> 163-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=0)
73-426 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=2)
428-451 ==> 0-23 on |28|IGHD5-12|D-REGION| [len=23] (mis=1)
454-500 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 107 reads
cdr3 = CARTRGYSGYDYGRMDYW at 415, score = 9 + 7
umis assigned: [11, 69, 200, 211, 299, 335, 433, 442, 512, 521] and 4 others
of which 14 are surviving nonsolos
reads assigned: 2366
start codons at 73, 229, 290, 376, 449, 457
confident = true
now this is a cell
paired!

ACGGCTGTGTATTACTGTGCAAGAACACGTGGATATAGTGGCTACGATTATGGTCGCATGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACCCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1326 = TAAACCGTCCACGCAG-1

using 556 reads

====================================================================================

graph has 284 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3, 4, 171, 178, 197]
surviving nonsolo ucounts = 3[171, 178, 197]
ids = [0, 5, 1]

====================================================================================

UMI info for barcode TAAACCGTCCACGCAG-1 contig 1 = AGCTCTGAGA...
umi ACATAACTCA = 170 reads: +395 -3 +26 non-validated
umi ACGCCGTCTC = 194 reads: +424 validated
umi TCAGAAATGT = 4 reads: -50 +2 -1 +3 -1 +4 -1 +8 -1 +4 -1 +7 -1 +3 -1X +4 -2X +11 -73 +25 -1XX +1 -1XX +1 -3XX +3 -11XX +1 -3XX +1 -1XX +1 -2XX +1 -190XX invalidated

UMI info for barcode TAAACCGTCCACGCAG-1 contig 2 = AGCTTCAGCT...
umi TCCTCACCTA = 175 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=609]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-609 ==> 0-106 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0, 1, 4]
of which 2 are surviving nonsolos
reads assigned: 363
start codons at 79, 230, 235, 382, 460
confident = false

TIG 2[bases=594]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-594 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1331 = TAAACCGTCCTAGGGC-1

using 284 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 4^2, 5, 261]
surviving nonsolo ucounts = 1[261]
ids = [6]

====================================================================================

UMI info for barcode TAAACCGTCCTAGGGC-1 contig 1 = GAATCAGTCC...
umi GCTCCGCAGT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-481 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1333 = TAAACCGTCGAGGTAG-1

using 4614 reads

====================================================================================

graph has 2574 edges initially, 38 edges after simplification

total ucounts = 464
nonsolo ucounts = 204[2^66, 3^44, 4^25, 5^11, 6^11, 7^16, 8^4, 9^7, 10, 11^2, 12, 14, 16, 67, 74, 102, 128, 132, 174, 176, 197, 203, 212, 272, 311, 741, 799]
surviving nonsolo ucounts = 14[16, 67, 74, 102, 132, 174, 176, 197, 203, 212, 272, 311, 741, 799]
ids = [63, 432, 238, 216, 241, 419, 145, 219, 102, 4, ...]

====================================================================================

UMI info for barcode TAAACCGTCGAGGTAG-1 contig 1 = GAAACAGAGC...
umi AGACTTAAAC = 15 reads: +299 -89 non-validated
umi ATAACTTTAC = 740 reads: -261X +127 invalidated
umi CATCCACGGC = 176 reads: +388 validated
umi TTTCAACAGC = 276 reads: +388 validated

UMI info for barcode TAAACCGTCGAGGTAG-1 contig 2 = CAGCTCTGGG...
umi AAATACTTCC = 223 reads: +169 -1XX +236 invalidated
umi ATCTTACTCT = 212 reads: +404 -2 non-validated
umi CCTGGACGGG = 311 reads: -256 +150 non-validated
umi CTTCGTGGTT = 98 reads: +406 validated
umi CTTGTTGTCA = 195 reads: +403 -1 +2 non-validated
umi GAGCATACTA = 71 reads: +369 -1 +10 -1 +16 -9 non-validated
umi GAGGCCCGCA = 138 reads: +406 validated
umi TTAAGTGGCT = 177 reads: +406 validated
umi TTCATATATA = 67 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=637]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=16)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 172 reads
cdr3 = CSAWDSSLNVWVF at 359, score = 7 + 8
umis assigned: [63, 87, 145, 455]
of which 4 are surviving nonsolos
reads assigned: 1192
start codons at 38, 177, 367, 384
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=24)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 99 reads
cdr3 = CVKEEDAFDIW at 422, score = 8 + 8
umis assigned: [4, 102, 170, 216, 219, 238, 241, 419, 432]
of which 9 are surviving nonsolos
reads assigned: 1447
start codons at 80, 231, 236, 297, 383, 467
confident = true
now this is a cell
paired!

AACAGCCTGAGAGTTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGACGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGTAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1339 = TAAACCGTCGTAGGTT-1

using 275 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[272]
surviving nonsolo ucounts = 1[272]
ids = [3]

====================================================================================

UMI info for barcode TAAACCGTCGTAGGTT-1 contig 1 = AGTGCTCTCT...
umi GGTTTAAGGG = 271 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGAARSGTVTLDYW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 17, 38, 82, 168, 273
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1344 = TAAACCGTCTCGTTTA-1

using 235 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 226]
surviving nonsolo ucounts = 1[226]
ids = [0]

====================================================================================

UMI info for barcode TAAACCGTCTCGTTTA-1 contig 1 = AGCTTCAGCT...
umi AAACTGTGCT = 227 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=2)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
431-544 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDSLSGVF at 367, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1345 = TAAACCGTCTGCGGCA-1

using 348 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [0]

====================================================================================

UMI info for barcode TAAACCGTCTGCGGCA-1 contig 1 = GGAGGAACTG...
umi CAAACGTAGC = 345 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYYNWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 34, 89, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1350 = TAAACCGTCTTGCAAG-1

using 259 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [2]

====================================================================================

UMI info for barcode TAAACCGTCTTGCAAG-1 contig 1 = GGGAATCAGT...
umi TGTACTGGAT = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1352 = TAAGAGAAGACGACGT-1

using 9 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1353 = TAAGAGAAGACTACAA-1

using 377 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 362]
surviving nonsolo ucounts = 1[362]
ids = [4]

====================================================================================

UMI info for barcode TAAGAGAAGACTACAA-1 contig 1 = ATCAGTCCCA...
umi CCATATGTCA = 364 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1355 = TAAGAGAAGAGCAATT-1

using 20 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1358 = TAAGAGAAGATCCTGT-1

using 7396 reads

====================================================================================

graph has 4249 edges initially, 48 edges after simplification

total ucounts = 643
nonsolo ucounts = 320[2^118, 3^55, 4^46, 5^25, 6^18, 7^14, 8^8, 9^6, 10^4, 11^2, 12^2, 14, 90, 175, 190, 193, 241, 261, 275, 278, 284, 287, 289, 292, 298, 299, 313, 324, 327, 332, 345, 357, 489]
surviving nonsolo ucounts = 20[175, 190, 193, 241, 261, 275, 278, 284, 287, 289, 292, 298, 299, 313, 324, 327, 332, 345, 357, 489]
ids = [319, 115, 21, 467, 617, 346, 433, 34, 145, 60, ...]

====================================================================================

UMI info for barcode TAAGAGAAGATCCTGT-1 contig 1 = CCACATCCCT...
umi AATATAACTT = 170 reads: +418 validated
umi CTCAATTGGC = 295 reads: +418 validated
umi CTCTTCACGC = 173 reads: +418 validated
umi TATGCACGCT = 245 reads: +418 validated
umi TCGTCAATGA = 319 reads: +418 validated
umi TTCGGTGGAA = 329 reads: +418 validated
umi TTGGCTTCCG = 232 reads: +418 validated
umi TTTCACCTCC = 325 reads: +418 validated

UMI info for barcode TAAGAGAAGATCCTGT-1 contig 2 = GGAGAAGAGC...
umi AATTGATAGT = 282 reads: +385 validated
umi ACGCCTCGTT = 292 reads: +385 validated
umi ATGCTGTAAG = 190 reads: +385 validated
umi ATTTTAGGCC = 284 reads: +385 validated
umi CAAAGGCAAT = 298 reads: +385 validated
umi CCATCAACCC = 301 reads: +385 validated
umi CCATTCAGTA = 345 reads: +385 validated
umi GACACTATCT = 278 reads: +385 validated
umi TAAACGGCGT = 276 reads: +385 validated
umi TAAACTCGTA = 340 reads: +385 validated
umi TCCCACGCTC = 293 reads: +385 validated
umi TTTACGCCTC = 399 reads: -351X +1 -4XX +1 -3XX +2 -11XX +1 -3XX +2 -1XX +1 -4XX invalidated

GOOD CONTIGS

TIG 1[bases=531]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-395 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=27)
424-460 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=2)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 182 reads
cdr3 = CAILFYSSSSPIDSW at 384, score = 9 + 7
umis assigned: [21, 303, 319, 467, 520, 600, 617, 631]
of which 8 are surviving nonsolos
reads assigned: 2041
start codons at 42, 240, 245, 262, 339
confident = true

TIG 2[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 469 reads
cdr3 = CQQSDASPRTF at 360, score = 9 + 7
umis assigned: [34, 60, 115, 145, 153, 227, 228, 346, 433, 434] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3514
start codons at 36, 244, 373, 463
confident = true
now this is a cell
paired!

TCTGAAGACACGGCTGTCTATTACTGTGCGATTCTATTCTATAGCAGCTCGTCACCAATTGACTCCTGGGGCCAAGGAACCCTAGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAATCTGATGCCTCACCTCGGACTTTCGGCCCTGGGACCAAAGTGGATTTCAAGC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1361 = TAAGAGAAGCCGATTT-1

using 265 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[261]
surviving nonsolo ucounts = 1[261]
ids = [4]

====================================================================================

UMI info for barcode TAAGAGAAGCCGATTT-1 contig 1 = GGAGTCAGTC...
umi TTATGGATAC = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-370 ==> 0-344 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYRETWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1364 = TAAGAGAAGCGTGTCC-1

using 352 reads

====================================================================================

graph has 526 edges initially, 4 edges after simplification

total ucounts = 182
nonsolo ucounts = 71[2^35, 3^14, 4^9, 5^6, 7^2, 8^2, 9, 10, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1367 = TAAGAGAAGGATTCGG-1

using 246 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode TAAGAGAAGGATTCGG-1 contig 1 = GAGAAGAGCT...
umi AACTTGACCT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
423-509 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPRVTF at 359, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1368 = TAAGAGAAGGGTTTCT-1

using 840 reads

====================================================================================

graph has 350 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[229, 278, 328]
surviving nonsolo ucounts = 3[229, 278, 328]
ids = [7, 1, 6]

====================================================================================

UMI info for barcode TAAGAGAAGGGTTTCT-1 contig 1 = GGAGGAATCA...
umi AGATGACTGA = 277 reads: +388 validated
umi TATGGCCGAT = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 109 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [1, 6]
of which 2 are surviving nonsolos
reads assigned: 599
start codons at 29, 35, 104, 240, 459
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1371 = TAAGAGAAGTAGGCCA-1

using 12001 reads

====================================================================================

graph has 4373 edges initially, 34 edges after simplification

total ucounts = 606
nonsolo ucounts = 263[2^102, 3^40, 4^31, 5^22, 6^15, 7^5, 8^2, 9^2, 10^2, 11, 12, 15, 16, 19, 27, 60, 75^2, 82, 88, 117, 185^2, 233, 248^2, 261, 276, 280, 284, 289, 292, 295, 307, 312, 313, 331, 354, 367, 373^2, 378, 393, 395, 399, 424^2, 427, 432, 494, 752]
surviving nonsolo ucounts = 35[60, 75, 82, 88, 117, 185^2, 233, 248^2, 261, 276, 280, 284, 289, 292, 295, 307, 312, 313, 331, 354, 367, 373^2, 378, 393, 395, 399, 424^2, 427, 432, 494, 752]
ids = [50, 122, 601, 349, 596, 37, 359, 490, 295, 365, ...]

====================================================================================

UMI info for barcode TAAGAGAAGTAGGCCA-1 contig 1 = GGAGAAGAGC...
umi AAGATCGTAG = 320 reads: -17X +1 -2XX +1 -2XX +4 -4XX +1 -2XX +2 -1XX +1 -2XX +1 -2XX +2 -1XX +339 invalidated
umi AAGGGACGTC = 185 reads: +385 validated
umi AATCTACCTT = 428 reads: +385 validated
umi ACCTGACTAA = 279 reads: +385 validated
umi AGTTATCGGA = 75 reads: +385 validated
umi ATACCTCGCT = 262 reads: +385 validated
umi ATCTTGGGAC = 380 reads: +385 validated
umi ATGTCACCCC = 366 reads: +385 validated
umi ATTAGGCTCG = 402 reads: +385 validated
umi ATTATTTACC = 393 reads: +385 validated
umi CACCCTCCCG = 287 reads: +385 validated
umi CACTCTCCTT = 437 reads: +385 validated
umi CATTATCTCT = 370 reads: +385 validated
umi CCCGAAAATG = 437 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -15XX +2 -3XX +2 -4XX +1 -1XX +1 -3XX +283 invalidated
umi CGGTCCCCCT = 249 reads: +385 validated
umi CGGTGGGTAG = 294 reads: +385 validated
umi CTCGATGAGG = 314 reads: +385 validated
umi CTTCTGTCGC = 302 reads: +385 validated
umi CTTTTACCAG = 87 reads: +385 validated
umi GACACTTACA = 182 reads: +385 validated
umi GACTAAAGTT = 254 reads: +385 validated
umi GATGCTCTAA = 288 reads: +385 validated
umi GCCCGCGACC = 401 reads: +385 validated
umi GGCTAACTTT = 375 reads: +385 validated
umi GTATGCGGGT = 509 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -4XX +1 -10X +2 -3XX +2 -4XX +1 -1XX +1 -3XX +283 invalidated
umi TAGATCATGG = 306 reads: +385 validated
umi TATGTCACCA = 236 reads: +385 validated
umi TCACCCATTC = 276 reads: +385 validated
umi TCGCTTCCCC = 750 reads: -229X +156 invalidated
umi TGCCCATGTA = 323 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -4XX +1 -10X +2 -3XX +2 -4XX +1 -1XX +1 -3XX +283 invalidated
umi TGCTCACCAT = 431 reads: +385 validated
umi TTCGATCAGG = 353 reads: +385 validated
umi TTTAGGTACC = 116 reads: +385 validated
umi TTTGCAGGGG = 43 reads: -193X +1 -15X +2 -2XX +2 -1XX +1 -4XX +3 -2XX +43 -1 +72 -43 invalidated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=20)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 32 umis using 1792 reads
cdr3 = CHQYRTSPLTF at 360, score = 9 + 8
umis assigned: [32, 37, 47, 75, 122, 132, 152, 161, 166, 168] and 24 others
of which 34 are surviving nonsolos
reads assigned: 10502
start codons at 36, 178, 244, 463
confident = true

REJECT CONTIGS

TIG 1[bases=400]
0-328 ==> 25-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=16)
344-393 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
cdr3 = CARDFWGVYYGMDVW at 317, score = 9 + 6
umis assigned: [50]
of which 1 are surviving nonsolos
reads assigned: 57
start codons at 173, 178, 195, 350
confident = false
VJ delta = 23
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1378 = TAAGAGACAAACCCAT-1

using 7563 reads

====================================================================================

graph has 3125 edges initially, 46 edges after simplification

total ucounts = 376
nonsolo ucounts = 156[2^53, 3^20, 4^24, 5^11, 6^8, 7^4, 8, 9^4, 10^3, 11, 14, 16, 22, 30, 67, 129, 134, 159, 224, 232, 239, 243, 245, 251, 261, 268, 281, 285, 286, 301, 304, 334, 346, 385, 517, 524, 768]
surviving nonsolo ucounts = 22[30, 134, 159, 224, 232, 239, 243, 245, 251, 261, 268, 281, 285, 286, 301, 304, 334, 346, 385, 517, 524, 768]
ids = [258, 362, 110, 303, 58, 77, 132, 60, 175, 70, ...]

====================================================================================

UMI info for barcode TAAGAGACAAACCCAT-1 contig 1 = ACATGGGAAA...
umi ACTTGTCGCC = 287 reads: +421 validated
umi CCTCTTTCTT = 204 reads: +421 validated
umi GCTTCTCCAG = 349 reads: +421 validated
umi TCGCTAAGCC = 228 reads: +421 validated

UMI info for barcode TAAGAGACAAACCCAT-1 contig 2 = GGGGGGGGTC...
umi CAAGATTAGG = 260 reads: +203 -2XX +186 invalidated
umi CACTAGGGAT = 263 reads: +391 validated
umi CAGGCCCTTG = 236 reads: +391 validated
umi CCAGAATCGT = 281 reads: +203 -3XX +185 invalidated
umi CCCCGGGGTC = 159 reads: +391 validated
umi CTCCCTACCA = 304 reads: +391 validated
umi CTCTCACCTT = 252 reads: +391 validated
umi CTTCCTTCAT = 311 reads: +391 validated
umi TCAGGTACAC = 283 reads: +391 validated
umi TCCCCGGGTT = 284 reads: +391 validated
umi TGATGTGCCT = 525 reads: +391 validated
umi TTTCCGTTGT = 135 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=538]
0-46 ==> 55-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
46-402 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=23)
416-467 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
467-538 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 106 reads
cdr3 = CARGIMGATLWFDSW at 391, score = 9 + 7
umis assigned: [43, 132, 238, 303]
of which 4 are surviving nonsolos
reads assigned: 1044
start codons at 2, 46, 90, 263, 406
confident = true

TIG 2[bases=644]
42-369 ==> 0-327 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
433-644 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 548 reads
cdr3 = CGSSTISSALVVF at 366, score = 7 + 8
umis assigned: [60, 70, 77, 103, 110, 172, 175, 193, 292, 297] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3218
start codons at 42, 199, 250, 253
confident = true

REJECT CONTIGS

TIG 1[bases=633]
0-95 ==> 80-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
95-439 ==> 0-344 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=16)
458-497 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
497-633 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [58, 112, 143, 151, 218, 258]
of which 6 are surviving nonsolos
reads assigned: 2230
start codons at 95, 164, 417, 539
confident = false
did not find CDR3
now this is a cell
paired!

GCTGCGGACACGGCCTTGTATTACTGTGCGAGAGGTATAATGGGAGCTACTCTCTGGTTCGACTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCGGGCTGAGGACGAGGCTGATTATTACTGCGGCTCGTCTACAATCAGCAGCGCTCTCGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1381 = TAAGAGACAAGCCGCT-1

using 8706 reads

====================================================================================

graph has 6934 edges initially, 128 edges after simplification

total ucounts = 1296
nonsolo ucounts = 990[2^151, 3^124, 4^104, 5^99, 6^77, 7^80, 8^59, 9^58, 10^44, 11^34, 12^36, 13^26, 14^31, 15^24, 16^11, 17^9, 18^4, 19^5, 20, 21^4, 23^2, 24, 25, 34, 269, 324, 328, 771]
surviving nonsolo ucounts = 4[269, 324, 328, 771]
ids = [399, 293, 812, 877]

====================================================================================

UMI info for barcode TAAGAGACAAGCCGCT-1 contig 1 = GGGCAGGAGT...
umi ATGTAAGGGT = 326 reads: +394 validated
umi CATGGATCTT = 269 reads: +394 validated
umi GTAACGTTTT = 333 reads: +394 validated
umi GTTAATAGCT = 762 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=561]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=1)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 289 reads
cdr3 = CQQYDNLPPLFTF at 358, score = 9 + 8
umis assigned: [293, 399, 812, 877]
of which 4 are surviving nonsolos
reads assigned: 1665
start codons at 31, 37, 93, 106, 245, 368, 467
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1382 = TAAGAGACAAGCCGTC-1

using 51 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2, 3, 4, 5, 6, 7, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1388 = TAAGAGACACAGGTTT-1

using 354 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 345]
surviving nonsolo ucounts = 1[345]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1389 = TAAGAGACACCAGTTA-1

using 289 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================

UMI info for barcode TAAGAGACACCAGTTA-1 contig 1 = GGGGGGGTCT...
umi CTCACGACGC = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=4)
41-402 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-564 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CSSYTSSSTLVF at 365, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 41, 198, 242, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1390 = TAAGAGACACCGAATT-1

using 340 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3^2, 5, 10, 313]
surviving nonsolo ucounts = 1[313]
ids = [9]

====================================================================================

UMI info for barcode TAAGAGACACCGAATT-1 contig 1 = GAAGAGCTGC...
umi TCTTTTCTTT = 317 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSLTF at 357, score = 9 + 9
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 33, 241, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1394 = TAAGAGACACTATCTT-1

using 444 reads

====================================================================================

graph has 196 edges initially, 18 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 150, 279]
surviving nonsolo ucounts = 2[150, 279]
ids = [8, 0]

====================================================================================

UMI info for barcode TAAGAGACACTATCTT-1 contig 1 = GAAGCTTTCT...
umi ACTTTGAAGC = 277 reads: +388 validated
umi TCGTCTCACT = 44 reads: -6 +3 -1XX +3 -2XX +2 -2XX +7 -1XX +6 -1XX +4 -2XX +24 -3XX +4 -1XX +5 -2XX +4 -1XX +7 -1XX +1 -1XX +1 -1XX +2 -1XX +1 -116X +2 -1XX +14 -1XX +2 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +5 -1XX +11 -43 +1 -2XX +1 -3XX +1 -3XX +33 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=589]
57-418 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
445-589 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CSSYTSSSTLVF at 381, score = 8 + 9
umis assigned: [0, 8]
of which 2 are surviving nonsolos
reads assigned: 312
start codons at 57, 214, 258, 265, 268, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1396 = TAAGAGACAGACACTT-1

using 381 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[381]
surviving nonsolo ucounts = 1[381]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1405 = TAAGAGACAGGATTGG-1

using 97 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[96]
surviving nonsolo ucounts = 1[96]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=376]
0-336 ==> 11-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
336-374 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
cdr3 = CYSTDNSGRHSGMF at 304, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 83
start codons at 50, 137, 184, 188, 287, 340
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1407 = TAAGAGACAGTTCATG-1

using 159 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 145]
surviving nonsolo ucounts = 1[145]
ids = [3]

====================================================================================

UMI info for barcode TAAGAGACAGTTCATG-1 contig 1 = GGGGTCTCAG...
umi CGTTTATTAC = 140 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=7)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
429-549 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYAGRNNPVVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 38, 195, 239, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1424 = TAAGAGAGTAGTAGTA-1

using 573 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[267, 303]
surviving nonsolo ucounts = 2[267, 303]
ids = [2, 3]

====================================================================================

UMI info for barcode TAAGAGAGTAGTAGTA-1 contig 1 = AAGAGGCAGC...
umi GGTGCATCCA = 251 reads: +382 validated
umi GGTGCATCCT = 279 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 132-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
30-370 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
374-412 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
412-566 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 2 umis using 119 reads
cdr3 = CCSYAGAKLF at 354, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 526
start codons at 30, 238, 288, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1426 = TAAGAGAGTCAAACTC-1

using 438 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 130, 305]
surviving nonsolo ucounts = 2[130, 305]
ids = [0, 1]

====================================================================================

UMI info for barcode TAAGAGAGTCAAACTC-1 contig 1 = AGCTTCAGCT...
umi ATCCATGCCC = 302 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-554 ==> 0-119 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1428 = TAAGAGAGTCAGCTAT-1

using 235 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [1]

====================================================================================

UMI info for barcode TAAGAGAGTCAGCTAT-1 contig 1 = GGGAATCAGT...
umi CCCCCACTCT = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 354, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1429 = TAAGAGAGTCATGCCG-1

using 207 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[7, 195]
surviving nonsolo ucounts = 1[195]
ids = [1]

====================================================================================

UMI info for barcode TAAGAGAGTCATGCCG-1 contig 1 = GAAGAGCCCC...
umi ATCCATTGTT = 197 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=560]
0-70 ==> 50-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
70-423 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=22)
453-500 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
500-560 ==> 0-60 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDLRFRDLVFGGGMDVW at 412, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 70, 226, 347, 373, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1431 = TAAGAGAGTCCCTACT-1

using 252 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode TAAGAGAGTCCCTACT-1 contig 1 = GGGGTCACAA...
umi CCCGTTAGCT = 247 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CCSYAGSSTSFYVF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 38, 177, 239, 246, 372, 396, 564
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1433 = TAAGAGAGTCCGTGAC-1

using 808 reads

====================================================================================

graph has 256 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[805]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=335]
46-203 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
201-264 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
264-335 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 796
start codons at 53, 87, 126, 181, 221
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1436 = TAAGAGAGTCTAGAGG-1

using 121 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[4, 111]
surviving nonsolo ucounts = 1[111]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1437 = TAAGAGAGTGAGGGTT-1

using 1031 reads

====================================================================================

graph has 352 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[245, 375, 408]
surviving nonsolo ucounts = 3[245, 375, 408]
ids = [3, 5, 2]

====================================================================================

UMI info for barcode TAAGAGAGTGAGGGTT-1 contig 1 = GAGGAATCAG...
umi GATTACTCTA = 412 reads: -61 +327 non-validated
umi GTATGCGCAC = 249 reads: +388 validated
umi GTTTACACTT = 381 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 183 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2, 3, 5]
of which 3 are surviving nonsolos
reads assigned: 1018
start codons at 28, 34, 103, 239, 458
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1439 = TAAGAGAGTGCATCTA-1

using 231 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 226]
surviving nonsolo ucounts = 1[226]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1446 = TAAGAGAGTTCCACAA-1

using 663 reads

====================================================================================

graph has 316 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3^2, 4, 294, 357]
surviving nonsolo ucounts = 2[294, 357]
ids = [2, 5]

====================================================================================

UMI info for barcode TAAGAGAGTTCCACAA-1 contig 1 = ACTTTCTGAG...
umi AGGGCTCCTC = 290 reads: +415 validated

UMI info for barcode TAAGAGAGTTCCACAA-1 contig 2 = CGAGCCCAGC...
umi GCTTGTCGAC = 321 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=571]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-571 ==> 0-121 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 35, 79, 159, 229, 431
confident = false

TIG 2[bases=507]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
442-485 ==> 9-52 on |50|IGHJ2|J-REGION| [len=52] (mis=0)
485-507 ==> 0-22 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAREGRGYSGFFDLW at 409, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1453 = TAAGAGATCAACGGGA-1

using 542 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 539]
surviving nonsolo ucounts = 1[539]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=445]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-27 ==> 5973-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-27 ==> 5269-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-27 ==> 782-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-27 ==> 9983-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-27 ==> 786-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
12-84 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
12-84 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
12-84 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
27-324 ==> 0-297 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=7)
327-445 ==> 18-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 533
start codons at 27, 33, 89, 102, 238, 241, 351
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1456 = TAAGAGATCACAGTAC-1

using 1430 reads

====================================================================================

graph has 1636 edges initially, 14 edges after simplification

total ucounts = 492
nonsolo ucounts = 215[2^88, 3^39, 4^30, 5^17, 6^18, 7^6, 8^6, 9^3, 10^3, 13, 15, 16, 29, 327]
surviving nonsolo ucounts = 1[327]
ids = [62]

====================================================================================

UMI info for barcode TAAGAGATCACAGTAC-1 contig 1 = GTCAGTCTCA...
umi ACTACGCCTA = 303 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=507]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-507 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQCYSTPPTFTF at 350, score = 9 + 7
umis assigned: [62]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 23, 29, 85, 98, 410, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1465 = TAAGAGATCCACGAAT-1

using 392 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 380]
surviving nonsolo ucounts = 1[380]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=505]
0-268 ==> 85-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=18)
297-345 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
345-505 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGDRRAAAFYYHYMDVW at 257, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 71, 113, 179, 212, 302, 399
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1473 = TAAGAGATCCTCCTAG-1

using 25 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1475 = TAAGAGATCGAGAACG-1

using 393 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[391]
surviving nonsolo ucounts = 1[391]
ids = [0]

====================================================================================

UMI info for barcode TAAGAGATCGAGAACG-1 contig 1 = GTCAGTCCCA...
umi ATGAACGGGG = 390 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1478 = TAAGAGATCGTAGGAG-1

using 254 reads

====================================================================================

graph has 83 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 243]
surviving nonsolo ucounts = 1[243]
ids = [2]

====================================================================================

UMI info for barcode TAAGAGATCGTAGGAG-1 contig 1 = GCTCTGCTTC...
umi CGCGGGGTCT = 237 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=580]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-580 ==> 0-135 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1481 = TAAGAGATCTAACTTC-1

using 905 reads

====================================================================================

graph has 410 edges initially, 10 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3, 4, 206, 280, 409]
surviving nonsolo ucounts = 3[206, 280, 409]
ids = [2, 1, 5]

====================================================================================

UMI info for barcode TAAGAGATCTAACTTC-1 contig 1 = GAAGAGCTGC...
umi GTTGATCGCT = 409 reads: +385 validated

UMI info for barcode TAAGAGATCTAACTTC-1 contig 2 = AGCTTCAGCT...
umi CCGCGCCACT = 262 reads: -1X +84 -1XX +302 invalidated
umi CGCTGTTCCT = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYGSSPWTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 402
start codons at 33, 241, 367, 460
confident = true

TIG 2[bases=600]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-600 ==> 0-165 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 458
start codons at 47, 201, 351, 376, 381
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1493 = TAAGCGTAGAATGTGT-1

using 60 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 6, 51]
surviving nonsolo ucounts = 1[51]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1494 = TAAGCGTAGAATGTTG-1

using 284 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 6, 10, 265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-25 ==> 6797-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
14-77 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 25, 31, 87, 100, 239, 362, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1507 = TAAGCGTAGCGATATA-1

using 219 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 13, 201]
surviving nonsolo ucounts = 1[201]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=500]
1-59 ==> 4685-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=42)
457-500 ==> 0-43 on |53|IGHJ3|J-REGION| [len=50] (mis=7)
cdr3 = CTREVRSSYVWGTHIRAEHCFDIW at 404, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 15, 59, 103, 326, 488
confident = false
VJ delta = 2
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1509 = TAAGCGTAGCGTGTCC-1

using 455 reads

====================================================================================

graph has 152 edges initially, 12 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[159, 295]
surviving nonsolo ucounts = 2[159, 295]
ids = [2, 0]

====================================================================================

UMI info for barcode TAAGCGTAGCGTGTCC-1 contig 1 = GAGTCAGTCT...
umi AACTCAGTGG = 264 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-502 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 25, 31, 87, 100, 236, 455
confident = false

REJECT CONTIGS

TIG 1[bases=460]
0-334 ==> 26-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
333-371 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
371-460 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPLTF at 310, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 7, 43, 131, 293, 313, 413
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1510 = TAAGCGTAGCTAAGAT-1

using 862 reads

====================================================================================

graph has 302 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[256, 283, 320]
surviving nonsolo ucounts = 2[256, 320]
ids = [2, 4]

====================================================================================

UMI info for barcode TAAGCGTAGCTAAGAT-1 contig 1 = GATCAGGACT...
umi CGATTGCGGT = 257 reads: +400 validated
umi CGTAGCGCGA = 69 reads: -217 +5 -1XX +1 -1XX +1 -2XX +2 -1XX +1 -3XX +3 -1XX +1 -3XX +2 -2XX +4 -1XX +20 -1XX +2 -1XX +2 -1XX +5 -1XX +2 -1XX +2 -1XX +2 -1XX +1 -2XX +7 -54 +1 -1XX +1 -2XX +1 -2XX +2 -1XX +7 -2XX +7 -2XX +5 -1XX +7 invalidated
umi CTACCTCGGA = 318 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 87 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [2, 3, 4]
of which 2 are surviving nonsolos
reads assigned: 635
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1511 = TAAGCGTAGCTAGTTC-1

using 397 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[2, 3, 70, 312]
surviving nonsolo ucounts = 1[312]
ids = [11]

====================================================================================

UMI info for barcode TAAGCGTAGCTAGTTC-1 contig 1 = AGCTTCAGCT...
umi TTGGCATTTG = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-536 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CAAWDDSLNGVVF at 368, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1515 = TAAGCGTAGGCAGTCA-1

using 312 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^2, 3^2, 5, 6, 13, 274]
surviving nonsolo ucounts = 1[274]
ids = [7]

====================================================================================

UMI info for barcode TAAGCGTAGGCAGTCA-1 contig 1 = GTCAGTCTCA...
umi GTTGATACAT = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-510 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPLTF at 350, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1525 = TAAGCGTAGTACGTAA-1

using 348 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[347]
surviving nonsolo ucounts = 1[347]
ids = [0]

====================================================================================

UMI info for barcode TAAGCGTAGTACGTAA-1 contig 1 = AGGAGTCAGT...
umi CAGACACCGA = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYSSPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1526 = TAAGCGTAGTATGACA-1

using 27 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1532 = TAAGCGTCAAATCCGT-1

using 214 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [1]

====================================================================================

UMI info for barcode TAAGCGTCAAATCCGT-1 contig 1 = AGTGCTTTCT...
umi CCGACTCCAC = 208 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=548]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
397-428 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=4)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
477-548 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARGSGMGYCSGGSCYLNWFDPW at 377, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 17, 38, 82, 168, 395
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1539 = TAAGCGTCAATGGACG-1

using 223 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 219]
surviving nonsolo ucounts = 1[219]
ids = [3]

====================================================================================

UMI info for barcode TAAGCGTCAATGGACG-1 contig 1 = GCTCTGCTTC...
umi TTTGATGTCG = 208 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-584 ==> 0-142 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1540 = TAAGCGTCACAACGTT-1

using 839 reads

====================================================================================

graph has 292 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 827]
surviving nonsolo ucounts = 1[827]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1547 = TAAGCGTCAGACGCCT-1

using 112 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1551 = TAAGCGTCAGCGTCCA-1

using 199 reads

====================================================================================

graph has 82 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[68, 131]
surviving nonsolo ucounts = 2[68, 131]
ids = [1, 0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=384]
0-347 ==> 4-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=22)
347-384 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
cdr3 = CQQFDSVPLTF at 323, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 110
start codons at 2, 58, 71, 207, 210
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1553 = TAAGCGTCAGCTCCGA-1

using 197 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[196]
surviving nonsolo ucounts = 1[196]
ids = [0]

====================================================================================

UMI info for barcode TAAGCGTCAGCTCCGA-1 contig 1 = GAGGAATCAG...
umi ATAACCGATC = 185 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=464]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-464 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1555 = TAAGCGTCAGGCTCAC-1

using 219 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 215]
surviving nonsolo ucounts = 1[215]
ids = [1]

====================================================================================

UMI info for barcode TAAGCGTCAGGCTCAC-1 contig 1 = GGAGTCAGAC...
umi ACTAAGGTAT = 192 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=489]
0-32 ==> 21-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
32-377 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-489 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYSYTWTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1557 = TAAGCGTCAGTACACT-1

using 206 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [1]

====================================================================================

UMI info for barcode TAAGCGTCAGTACACT-1 contig 1 = GAAACAGAGC...
umi TGTCTTAAGC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=567]
38-390 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
426-567 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CSAWDSSLNVWVF at 359, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 38, 177, 367, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1558 = TAAGCGTCAGTCACTA-1

using 145 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[145]
surviving nonsolo ucounts = 1[145]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1565 = TAAGCGTCATGTCGAT-1

using 116 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[116]
surviving nonsolo ucounts = 1[116]
ids = [0]

====================================================================================

UMI info for barcode TAAGCGTCATGTCGAT-1 contig 1 = GTCAGACCCA...
umi TCAAGTGGCC = 111 reads: +373 validated

GOOD CONTIGS

TIG 1[bases=474]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-357 ==> 0-334 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
358-396 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
396-474 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CQRVTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 23, 29, 85, 98, 330, 438
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1569 = TAAGCGTGTAAACACA-1

using 328 reads

====================================================================================

graph has 119 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 323]
surviving nonsolo ucounts = 1[323]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=530]
0-71 ==> 5669-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
5-77 ==> 8895-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
5-77 ==> 8904-8976 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
5-77 ==> 8903-8975 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
20-359 ==> 0-339 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
356-394 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
394-530 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 20, 26, 82, 231, 436
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1571 = TAAGCGTGTAAGGATT-1

using 625 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 615]
surviving nonsolo ucounts = 1[615]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1578 = TAAGCGTGTATATGGA-1

using 167 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1579 = TAAGCGTGTATCTGCA-1

using 210 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4^2, 196]
surviving nonsolo ucounts = 1[196]
ids = [4]

====================================================================================

UMI info for barcode TAAGCGTGTATCTGCA-1 contig 1 = AGCTGTGGGC...
umi GAAATGGCCT = 193 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=521]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
388-419 ==> 7-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-521 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CNSRDSSGNHPF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1596 = TAAGCGTGTGCACTTA-1

using 237 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[235]
surviving nonsolo ucounts = 1[235]
ids = [0]

====================================================================================

UMI info for barcode TAAGCGTGTGCACTTA-1 contig 1 = ATACTTTCTG...
umi CCTTAGCGCT = 225 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=501]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
402-452 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
452-501 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARDFPGNYFTFDIW at 376, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 37, 81, 161, 231, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1597 = TAAGCGTGTGCTCTTC-1

using 798 reads

====================================================================================

graph has 276 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 789]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1598 = TAAGCGTGTGGTAACG-1

using 17299 reads

====================================================================================

graph has 5334 edges initially, 72 edges after simplification

total ucounts = 596
nonsolo ucounts = 261[2^85, 3^42, 4^25, 5^21, 6^6, 7^4, 8^4, 9^3, 10^3, 11, 13^3, 15, 22, 34, 56, 76, 97, 111, 114, 146, 149, 151, 164, 188, 210, 211, 213, 214, 217, 225, 240^2, 245, 247, 255, 257, 258^2, 262^2, 271, 272, 278, 286^2, 290, 291^3, 292, 296, 298, 300, 301, 304, 305, 306^2, 309, 311, 314, 323, 324, 327, 328, 333, 334, 340, 347, 357, 362, 364, 379, 389, 417]
surviving nonsolo ucounts = 53[56, 188, 210, 211, 213, 214, 217, 225, 240^2, 245, 247, 255, 257, 258^2, 262^2, 271, 272, 278, 286^2, 290, 291^3, 292, 296, 298, 300, 301, 304, 305, 306^2, 309, 311, 314, 323, 324, 327, 328, 333, 334, 340, 347, 357, 362, 364, 379, 389, 417]
ids = [440, 595, 562, 357, 121, 27, 587, 358, 110, 247, ...]

====================================================================================

UMI info for barcode TAAGCGTGTGGTAACG-1 contig 1 = AGCCCTGGGA...
umi ACCTCGCGCA = 271 reads: +421 validated
umi GCGTGCCCCT = 216 reads: +421 validated
umi TAAGCCCGTA = 55 reads: -5 +1 -1 +4 -1 +3 -1 +370 -1X +27 -7 invalidated

UMI info for barcode TAAGCGTGTGGTAACG-1 contig 2 = GGGGAGGAGT...
umi AAATACCGGG = 303 reads: +391 validated
umi AAATAGTCGG = 321 reads: +391 validated
umi AACAACTCTC = 266 reads: +391 validated
umi AAGAGCTATC = 294 reads: +391 validated
umi AAGTGGGTCC = 285 reads: +391 validated
umi AATCATCAGT = 296 reads: +391 validated
umi AATGCAACTT = 218 reads: +391 validated
umi ACGTCAGCAG = 354 reads: +391 validated
umi ACTGAGGTAT = 383 reads: +391 validated
umi ATCACCGATC = 315 reads: +391 validated
umi ATCCCAGGTA = 292 reads: +391 validated
umi ATCCTACGAC = 242 reads: +391 validated
umi ATCGCAGTTT = 334 reads: +391 validated
umi ATGATTGATA = 393 reads: +391 validated
umi ATGGACCCTT = 214 reads: +391 validated
umi ATGTGTGCGC = 298 reads: +391 validated
umi CACACTTTGC = 340 reads: +391 validated
umi CAGTTCCCCG = 255 reads: +391 validated
umi CCATGATACA = 309 reads: +391 validated
umi CGCATGGGAC = 299 reads: +391 validated
umi CGGCTAACCG = 238 reads: +391 validated
umi CGTAGGAGCT = 360 reads: +391 validated
umi CGTCAGTGAG = 278 reads: +391 validated
umi CGTTGTAAGC = 278 reads: +391 validated
umi CTAATGATGC = 328 reads: +391 validated
umi CTATTCCAAG = 306 reads: +391 validated
umi CTCATTGCCC = 335 reads: +391 validated
umi CTCGCTGATC = 305 reads: +391 validated
umi CTGGGTAAGC = 291 reads: +391 validated
umi GACAGGCCGC = 305 reads: +391 validated
umi GAGCTTCCGA = 318 reads: +391 validated
umi GCCTTGCATG = 291 reads: +391 validated
umi GCGTCGGGTT = 214 reads: +391 validated
umi GCTCCATAGT = 333 reads: +293 -1XX +97 invalidated
umi GGCAAAGCAC = 264 reads: +391 validated
umi GTAGAGAGGC = 241 reads: +391 validated
umi GTTATCCTTC = 308 reads: +391 validated
umi TAAGATATTG = 257 reads: +391 validated
umi TAATGGTTGG = 254 reads: +391 validated
umi TACTCACACG = 419 reads: +391 validated
umi TATAGTCAAG = 363 reads: +391 validated
umi TATGTTTTCG = 288 reads: +391 validated
umi TATTAACCGA = 262 reads: +391 validated
umi TGATAACTCT = 249 reads: +391 validated
umi TGTAGTACCA = 258 reads: +391 validated
umi TTAGAATTCC = 290 reads: +391 validated
umi TTCACTTTCG = 211 reads: +391 validated
umi TTTGGATTGC = 220 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=552]
0-60 ==> 19-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
60-413 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
435-481 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 45 reads
cdr3 = CAKDWGPYGATGSDYW at 402, score = 9 + 7
umis assigned: [45, 358, 440]
of which 3 are surviving nonsolos
reads assigned: 528
start codons at 60, 211, 216, 363
confident = true

TIG 2[bases=558]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 2201 reads
cdr3 = CQQYDNLPPVTF at 358, score = 9 + 8
umis assigned: [5, 6, 8, 13, 21, 25, 27, 55, 62, 104] and 38 others
of which 48 are surviving nonsolos
reads assigned: 13861
start codons at 31, 37, 93, 106, 245, 368, 464
confident = true

REJECT CONTIGS

TIG 1[bases=540]
0-46 ==> 33-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
0-46 ==> 5954-6000 on rc of segment after IGHV3-21 exon 1 [len=6000] (mis=0)
14-85 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=9)
46-399 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=3)
418-469 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
469-540 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CELIGDYVLSNWFDPW at 390, score = 3 + 7
umis assigned: [489, 595]
of which 2 are surviving nonsolos
reads assigned: 530
start codons at 46, 202, 349
confident = false
frameshifted full length stopped transcript of length 540
VJ delta = 9
not full
not full
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAAGATTGGGGCCCTTACGGTGCCACCGGATCAGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCGGTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1609 = TAAGCGTGTTGTCTTT-1

using 238 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode TAAGCGTGTTGTCTTT-1 contig 1 = TGGGGAGTCA...
umi TTGAGCGATT = 220 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=484]
35-283 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-484 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLHYDNRRRTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 35, 91, 104, 243, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1616 = TAAGCGTTCAGTTGAC-1

using 214 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 202]
surviving nonsolo ucounts = 1[202]
ids = [2]

====================================================================================

UMI info for barcode TAAGCGTTCAGTTGAC-1 contig 1 = AAAACCACAC...
umi GCACACACCA = 188 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=516]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-516 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 49, 247, 252, 269, 313, 346
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1621 = TAAGCGTTCCCATTTA-1

using 209 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[208]
surviving nonsolo ucounts = 1[208]
ids = [1]

====================================================================================

UMI info for barcode TAAGCGTTCCCATTTA-1 contig 1 = GAGCTCTGGG...
umi CTTCACTCTG = 208 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=14)
468-516 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
516-542 ==> 0-26 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARESFAYCSADCHKYYFDYW at 422, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 80, 236, 287, 297, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1622 = TAAGCGTTCCGTTGTC-1

using 306 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[5, 300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode TAAGCGTTCCGTTGTC-1 contig 1 = ATCAGTCCCA...
umi GCACACTCCC = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1627 = TAAGCGTTCGAGAGCA-1

using 1063 reads

====================================================================================

graph has 1080 edges initially, 36 edges after simplification

total ucounts = 300
nonsolo ucounts = 108[2^41, 3^30, 4^11, 5^11, 6, 7^3, 8, 9, 10, 11^4, 12, 24, 209, 257]
surviving nonsolo ucounts = 3[24, 209, 257]
ids = [173, 215, 144]

====================================================================================

UMI info for barcode TAAGCGTTCGAGAGCA-1 contig 1 = GCTGGGGTCT...
umi CAACGTCGTG = 2 reads: -44 +3 -1X +8 -1X +21 -2X +3 -1X +5 -1X +10 -291 invalidated
umi GTTAGTCTGG = 213 reads: +391 validated

UMI info for barcode TAAGCGTTCGAGAGCA-1 contig 2 = GTGGGTCCAG...
umi CTCACGTGTC = 259 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=643]
0-41 ==> 1-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
41-399 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=5)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
432-643 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 27 reads
cdr3 = CCSYAGSYTLYVF at 365, score = 8 + 8
umis assigned: [72, 215]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 41, 180, 198, 242, 249, 252, 348, 375, 396
confident = false

TIG 2[bases=628]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
417-628 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 36 reads
cdr3 = CQSADSSGTYWVF at 350, score = 8 + 8
umis assigned: [144]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 35, 96, 165, 183
confident = false

REJECT CONTIGS

TIG 1[bases=332]
5-294 ==> 62-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=23)
291-328 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
cdr3 = CHQYNSYSTF at 270, score = 8 + 7
umis assigned: [173]
of which 1 are surviving nonsolos
reads assigned: 22
start codons at 5, 18, 154, 157, 250
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1630 = TAAGCGTTCGGCGCAT-1

using 832 reads

====================================================================================

graph has 1314 edges initially, 4 edges after simplification

total ucounts = 523
nonsolo ucounts = 115[2^53, 3^25, 4^8, 5^13, 6^4, 7^3, 8^2, 9^2, 11^2, 12, 15, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1632 = TAAGCGTTCGTACCGG-1

using 215 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=546]
2-72 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
24-133 ==> 0-109 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1)
133-373 ==> 111-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17) [SHIFT!]
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 349, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 24, 30, 99, 233, 452
confident = false
not full
frameshifted full length stopped transcript of length 546
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1638 = TAAGCGTTCTGATACG-1

using 14301 reads

====================================================================================

graph has 4595 edges initially, 44 edges after simplification

total ucounts = 372
nonsolo ucounts = 182[2^42, 3^33, 4^19, 5^10, 6^11, 7^4, 8^3, 14, 28, 44, 89, 94, 98, 100, 123, 134, 136, 139, 140, 146, 157, 167, 172, 183, 184, 194, 198, 200, 201, 206, 211, 213, 214, 219, 220, 225, 226, 227, 233, 241^2, 255, 256^2, 258, 267, 275^2, 278, 279^2, 283, 287, 288, 289, 306, 307, 310^2, 312, 331, 349, 364, 375, 378, 413, 487]
surviving nonsolo ucounts = 55[89, 94, 98, 100, 123, 134, 136, 140, 146, 157, 167, 172, 183, 184, 194, 198, 200, 201, 206, 211, 213, 214, 219, 220, 225, 226, 227, 233, 241^2, 255, 256^2, 258, 267, 275^2, 278, 279^2, 283, 288, 289, 306, 307, 310^2, 312, 331, 349, 364, 375, 378, 413, 487]
ids = [308, 194, 8, 158, 205, 313, 66, 98, 1, 160, ...]

====================================================================================

UMI info for barcode TAAGCGTTCTGATACG-1 contig 1 = TGGGGGCTGT...
umi AAATATTCTC = 144 reads: +382 validated
umi ACCATGTGTG = 236 reads: +382 validated
umi AGGCCGTATG = 238 reads: +382 validated
umi CACCGGCACT = 242 reads: +382 validated
umi CATTTTAGGC = 308 reads: +382 validated
umi CCACCATATC = 198 reads: +382 validated
umi CCCCACAGTT = 278 reads: +382 validated
umi CGCTACATGC = 366 reads: +382 validated
umi CTGTAGTCTA = 290 reads: +382 validated
umi CTGTGCCCTC = 199 reads: +382 validated
umi GAGCCTGGAG = 256 reads: +382 validated
umi GAGTCTCACG = 120 reads: +382 validated
umi GATGAATCAA = 183 reads: +382 validated
umi GCATGACTTT = 274 reads: +382 validated
umi GCTACTATGT = 219 reads: +382 validated
umi GCTGAGGACA = 267 reads: +382 validated
umi GGACCGAGAG = 199 reads: +382 validated
umi GGAGTTCACA = 194 reads: +382 validated
umi GGGAAAACAT = 229 reads: +382 validated
umi TATCCATCGA = 208 reads: +382 validated
umi TCCGATCTTG = 140 reads: +382 validated
umi TTCACGTTTG = 221 reads: +382 validated
umi TTCAGCCTAT = 223 reads: +382 validated

UMI info for barcode TAAGCGTTCTGATACG-1 contig 2 = TGGGGGACTC...
umi AACCCATCAG = 218 reads: +433 validated
umi AAGCAATGCT = 97 reads: +433 validated
umi ACAATATGGG = 378 reads: +433 validated
umi AGCGGTTGGC = 213 reads: +433 validated
umi AGTTCGCCAG = 251 reads: +426 -7 non-validated
umi AGTTTCGCAC = 344 reads: +433 validated
umi ATCACTTGGC = 303 reads: +433 validated
umi ATTTACGCTC = 131 reads: +433 validated
umi CAACCTTAGT = 204 reads: +433 validated
umi CATGACCCTT = 143 reads: +433 validated
umi CCACGTGGGA = 172 reads: +433 validated
umi CGCTCTAGGA = 270 reads: +433 validated
umi CGTCGTTGCT = 103 reads: +433 validated
umi CGTGTCCATA = 159 reads: +433 validated
umi GACATTTGGT = 93 reads: +411 -1 +2 -1 +7 -1 +3 -7 non-validated
umi GACTGCATGG = 486 reads: +433 validated
umi GCTGACAGGT = 308 reads: +433 validated
umi GTATTACAGG = 333 reads: +433 validated
umi TCAATATAAT = 222 reads: +433 validated
umi TCCATAGAGG = 89 reads: +391 -1 +1 -14 +26 non-validated
umi TCTCTCCGCA = 287 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=636]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=4)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 23 umis using 848 reads
cdr3 = CQSADSSGTSVVF at 358, score = 8 + 8
umis assigned: [1, 30, 45, 84, 101, 107, 121, 151, 184, 185] and 13 others
of which 23 are surviving nonsolos
reads assigned: 5164
start codons at 43, 104, 173, 191
confident = true

TIG 2[bases=526]
22-380 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=0)
384-408 ==> 7-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=3)
404-455 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 17 umis using 477 reads
cdr3 = CARIRSVVVVAATIWFDPW at 367, score = 7 + 7
umis assigned: [3, 8, 22, 42, 49, 51, 59, 69, 75, 98] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4736
start codons at 22, 170, 178, 245, 328, 337
confident = true

REJECT CONTIGS

TIG 1[bases=567]
4-80 ==> 3258-3334 on rc of segment before IGKV2-24 exon 2 [len=3774] (mis=7)
4-80 ==> 3255-3331 on segment before IGKV2D-23 exon 1 [len=3772] (mis=7)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=0)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [12, 39, 66, 80, 87, 112, 123, 135, 174, 324] and 1 others
of which 10 are surviving nonsolos
reads assigned: 2578
start codons at 30, 63, 99, 187, 349, 369, 473
confident = false
did not find CDR3
now this is a cell
paired!

GCCACATATTACTGTGCACGGATACGAAGTGTAGTGGTGGTAGCTGCTACGATCTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTCCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1640 = TAAGCGTTCTTAGAGC-1

using 464 reads

====================================================================================

graph has 268 edges initially, 4 edges after simplification

total ucounts = 42
nonsolo ucounts = 24[2^4, 3, 4^3, 5^3, 6^5, 7^4, 8^2, 9, 325]
surviving nonsolo ucounts = 1[325]
ids = [29]

====================================================================================

UMI info for barcode TAAGCGTTCTTAGAGC-1 contig 1 = GAGATCACAG...
umi GCACCGATCC = 312 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=577]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-577 ==> 0-122 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [29]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1642 = TAAGCGTTCTTCAACT-1

using 636 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[72, 262, 299]
surviving nonsolo ucounts = 3[72, 262, 299]
ids = [1, 2, 0]

====================================================================================

UMI info for barcode TAAGCGTTCTTCAACT-1 contig 1 = GATCAGGACT...
umi AGTTAGCCCT = 296 reads: +400 validated
umi CACCTCGATT = 64 reads: -400 non-validated
umi CATTCAATCA = 261 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 72 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0, 1, 2]
of which 3 are surviving nonsolos
reads assigned: 616
start codons at 30, 63, 99, 187, 349, 369, 472
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1643 = TAAGCGTTCTTCGAGA-1

using 232 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[229]
surviving nonsolo ucounts = 1[229]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=561]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-297 ==> 0-250 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=9)
297-398 ==> 252-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=6) [SHIFT!]
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
433-561 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 47, 201, 349, 374, 379
confident = false
not full
frameshifted full length stopped transcript of length 561
VJ delta = 24
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1647 = TAAGTGCAGAACTCGG-1

using 247 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [3]

====================================================================================

UMI info for barcode TAAGTGCAGAACTCGG-1 contig 1 = GAATCAGTCC...
umi GCTGACTTCG = 210 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=442]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-442 ==> 0-29 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 25, 31, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1651 = TAAGTGCAGACAGGCT-1

using 867 reads

====================================================================================

graph has 550 edges initially, 10 edges after simplification

total ucounts = 370
nonsolo ucounts = 89[2^52, 3^16, 4^6, 6^5, 7, 8^2, 9, 10^2, 11, 17, 18, 282]
surviving nonsolo ucounts = 1[282]
ids = [299]

====================================================================================

UMI info for barcode TAAGTGCAGACAGGCT-1 contig 1 = GAGGAGTCAG...
umi TCCCAGTCCT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
416-490 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSLPPTF at 355, score = 7 + 8
umis assigned: [299]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 28, 34, 90, 103, 338, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1654 = TAAGTGCAGATCCTGT-1

using 220 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 43
nonsolo ucounts = 8[2, 3^4, 5, 6, 160]
surviving nonsolo ucounts = 1[160]
ids = [16]

====================================================================================

UMI info for barcode TAAGTGCAGATCCTGT-1 contig 1 = GCTTTCTGAG...
umi CCGCCAGTGC = 151 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=480]
14-385 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
junction support: 1 umis using 13 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 374, score = 9 + 7
umis assigned: [16]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 14, 35, 79, 165, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1658 = TAAGTGCAGCATGGCA-1

using 19 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1670 = TAAGTGCAGTCCAGGA-1

using 210 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 204]
surviving nonsolo ucounts = 1[204]
ids = [4]

====================================================================================

UMI info for barcode TAAGTGCAGTCCAGGA-1 contig 1 = CACAAGAGGC...
umi GCCTTTGTGT = 196 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=543]
0-33 ==> 129-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
33-373 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-543 ==> 0-119 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CCSYAGSSTFGVF at 357, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 33, 172, 234, 241, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1678 = TAAGTGCCAAGAAAGG-1

using 267 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [2]

====================================================================================

UMI info for barcode TAAGTGCCAAGAAAGG-1 contig 1 = TGAGCGCAGA...
umi AGATATAGGG = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=541]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-541 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1682 = TAAGTGCCAATGTTGC-1

using 18070 reads

====================================================================================

graph has 6225 edges initially, 84 edges after simplification

total ucounts = 604
nonsolo ucounts = 291[2^92, 3^50, 4^40, 5^16, 6^8, 7^9, 8^6, 9^2, 10^3, 11, 12^4, 19, 32, 34, 51, 54, 62, 65, 75, 85, 92, 104, 114, 145, 148, 154, 183, 203, 226^2, 235, 240, 247, 251, 256, 267, 270, 283, 284, 285, 299^2, 301, 310, 311, 316, 318, 319, 321, 323, 324, 327, 331, 341, 345, 348^3, 353, 354, 364, 376^2, 379, 391, 403, 417, 531, 557, 766, 1131]
surviving nonsolo ucounts = 54[34, 51, 54, 65, 85, 92, 104, 114, 145, 148, 183, 203, 226^2, 235, 240, 247, 256, 267, 270, 283, 284, 285, 299^2, 301, 310, 311, 316, 318, 319, 321, 323, 324, 327, 331, 341, 345, 348^3, 353, 354, 364, 376^2, 379, 391, 403, 417, 531, 557, 766, 1131]
ids = [575, 596, 332, 429, 541, 84, 475, 341, 175, 414, ...]

====================================================================================

UMI info for barcode TAAGTGCCAATGTTGC-1 contig 1 = GGAGAAGAGC...
umi AACTTACTCT = 298 reads: +385 validated
umi AACTTCCCGG = 313 reads: +385 validated
umi AAGGAAACAC = 368 reads: +385 validated
umi AATTTAAATA = 285 reads: +385 validated
umi AATTTTCATG = 357 reads: +385 validated
umi ACGCAATGCC = 93 reads: +385 validated
umi AGAATAGGGC = 226 reads: +385 validated
umi AGCCCACCGT = 418 reads: +385 validated
umi AGCTTCATCC = 28 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +52 -287 invalidated
umi ATCAAGGCCT = 258 reads: +385 validated
umi ATCGCCTCAG = 321 reads: +385 validated
umi ATTACTTCGC = 347 reads: +385 validated
umi ATTCAGTCCC = 147 reads: +385 validated
umi ATTCTAATCC = 312 reads: +385 validated
umi ATTTTCTTTC = 331 reads: +385 validated
umi CACACCAGTG = 557 reads: +385 validated
umi CAGTTGTATC = 282 reads: +385 validated
umi CATCTCCAAG = 356 reads: +385 validated
umi CCAAGGAGCA = 324 reads: +385 validated
umi CGACTCGGAT = 286 reads: +385 validated
umi CGCATAGGGT = 325 reads: +385 validated
umi CGGCGATTCG = 268 reads: +385 validated
umi CGGTCTTTCG = 325 reads: +385 validated
umi CTAAATTAGT = 206 reads: +385 validated
umi CTCACTACAT = 372 reads: +385 validated
umi GACGTTACCT = 377 reads: +385 validated
umi GATACACCAA = 404 reads: +385 validated
umi GCCTCTGAAA = 332 reads: +385 validated
umi GCTGCGCGTG = 9 reads: -345X +1 -5X +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi GGATGCCGGT = 553 reads: +123 -1XX +261 invalidated
umi TACTACTTTG = 303 reads: +385 validated
umi TATTCGTGTT = 396 reads: +385 validated
umi TCACCGCGAT = 346 reads: +385 validated
umi TCCTATACAG = 379 reads: +385 validated
umi TGTTTCCAGT = 294 reads: +385 validated

UMI info for barcode TAAGTGCCAATGTTGC-1 contig 2 = TGGGGAGCTC...
umi ATTAAGCTGC = 219 reads: +444 -1 non-validated
umi CACTACATCA = 317 reads: +445 validated
umi CCAGAGCCCG = 234 reads: +445 validated
umi GACGGGCTCT = 111 reads: +376 -2 +11 -1 +5 -1 +20 -29 non-validated
umi GTATAATCGT = 149 reads: +445 validated
umi GTTCGATATG = 341 reads: +437 -1 +2 -1 +2 -1 +1 non-validated
umi GTTGCTAACC = 61 reads: +261 -1X +2 -1X +180 invalidated
umi TACATCCACT = 344 reads: +445 validated
umi TATCGCACGC = 98 reads: -405 +3 -2X +9 -1X +2 -1X +3 -2XX +17 invalidated
umi TGGACTGTAA = 87 reads: +421 -24 non-validated
umi TGTTCAGTAG = 346 reads: +445 validated
umi TGTTTTAGGT = 180 reads: +445 validated
umi TTCACGCCCA = 33 reads: +360 -85 non-validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 33 umis using 1651 reads
cdr3 = CQQYGSSPLTF at 360, score = 9 + 9
umis assigned: [29, 30, 33, 48, 51, 84, 110, 117, 123, 157] and 25 others
of which 34 are surviving nonsolos
reads assigned: 10607
start codons at 36, 244, 370, 463
confident = true

TIG 2[bases=600]
84-437 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
441-462 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=0)
466-529 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
529-600 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 110 reads
cdr3 = CARDTGYSSSWYRVGYYYYGMDVW at 426, score = 9 + 7
umis assigned: [172, 205, 231, 341, 414, 428, 429, 444, 475, 541] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2478
start codons at 84, 235, 240, 298, 301, 387, 486
confident = true

REJECT CONTIGS

TIG 1[bases=460]
0-343 ==> 9-352 on rc of segment before IGHJ4 exon 1 [len=352] (mis=0)
341-392 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=0)
392-460 ==> 0-68 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
umis assigned: [362, 596]
of which 2 are surviving nonsolos
reads assigned: 57
start codons at 114, 162, 234, 336
confident = false
did not find CDR3

TIG 2[bases=304]
0-155 ==> 5845-6000 on rc of segment after IGHD1-1 exon 1 [len=6000] (mis=0)
183-233 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
233-304 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [332, 527]
of which 2 are surviving nonsolos
reads assigned: 803
start codons at 69, 214
confident = false
did not find CDR3
now this is a cell
paired!

GCGAGAGATACCGGGTATAGCAGCAGCTGGTACAGAGTGGGCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1694 = TAAGTGCCAGCCTATA-1

using 317 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 4, 304]
surviving nonsolo ucounts = 1[304]
ids = [2]

====================================================================================

UMI info for barcode TAAGTGCCAGCCTATA-1 contig 1 = GGGGAGGAAT...
umi CTCCGATGCT = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1701 = TAAGTGCCAGTGGGAT-1

using 278 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 4, 8, 259]
surviving nonsolo ucounts = 1[259]
ids = [3]

====================================================================================

UMI info for barcode TAAGTGCCAGTGGGAT-1 contig 1 = ATCAGTCCCA...
umi CCACTATCGC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1708 = TAAGTGCCATGACATC-1

using 48 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 7[2, 3^2, 5^2, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1710 = TAAGTGCCATGGATGG-1

using 278 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[6, 9, 261]
surviving nonsolo ucounts = 1[261]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1715 = TAAGTGCGTAGCGATG-1

using 816 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[812]
surviving nonsolo ucounts = 1[812]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1726 = TAAGTGCGTCTCTCTG-1

using 28 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1727 = TAAGTGCGTGACAAAT-1

using 374 reads

====================================================================================

graph has 524 edges initially, 12 edges after simplification

total ucounts = 188
nonsolo ucounts = 63[2^27, 3^14, 4^6, 5, 6^5, 7^2, 8^3, 10, 11^2, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1731 = TAAGTGCGTGTAATGA-1

using 610 reads

====================================================================================

graph has 266 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2^3, 3, 7, 218, 374]
surviving nonsolo ucounts = 2[218, 374]
ids = [5, 8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1735 = TAAGTGCGTTGCTCCT-1

using 412 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[412]
surviving nonsolo ucounts = 1[412]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=512]
11-339 ==> 23-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
338-376 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
376-512 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPWTF at 315, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 407
start codons at 50, 63, 199, 418
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1745 = TAAGTGCTCATGCTCC-1

using 189 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5^2, 178]
surviving nonsolo ucounts = 1[178]
ids = [1]

====================================================================================

UMI info for barcode TAAGTGCTCATGCTCC-1 contig 1 = AAACCACACC...
umi TCGCCAATCC = 167 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=515]
0-48 ==> 11-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
48-401 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
450-484 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
484-515 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 390, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 48, 246, 251, 268, 312, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1746 = TAAGTGCTCATGTGGT-1

using 122 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 118]
surviving nonsolo ucounts = 1[118]
ids = [2]

====================================================================================

UMI info for barcode TAAGTGCTCATGTGGT-1 contig 1 = GAGAGAGGAG...
umi GGACGCTCGT = 118 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=564]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-564 ==> 0-67 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 86.1752 = TAAGTGCTCCTCTAGC-1

using 31 reads

====================================================================================

graph has 31 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk086-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk086-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

79.883 seconds used processing barcodes, peak mem = 0.23
