[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.23 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk085-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk085-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk085.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.0 = GTCTTCGAGAAGAAGC-1

using 12415 reads

====================================================================================

graph has 5893 edges initially, 98 edges after simplification

total ucounts = 829
nonsolo ucounts = 606[2^103, 3^87, 4^85, 5^48, 6^41, 7^35, 8^31, 9^37, 10^20, 11^20, 12^20, 13^10, 14^12, 15^5, 16^8, 17, 18^2, 19^3, 20, 26, 73, 74, 112, 114, 141, 176, 184, 185, 195, 202, 217, 226, 230, 242, 249, 252, 256, 261, 264, 270, 273, 274, 277^2, 278, 287^2, 291, 293, 303, 321, 322, 325, 333, 339, 353]
surviving nonsolo ucounts = 36[73, 74, 112, 114, 141, 176, 184, 185, 195, 202, 217, 226, 230, 242, 249, 252, 256, 261, 264, 270, 273, 274, 277^2, 278, 287^2, 291, 293, 303, 321, 322, 325, 333, 339, 353]
ids = [610, 384, 430, 298, 545, 152, 392, 92, 327, 123, ...]

====================================================================================

UMI info for barcode GTCTTCGAGAAGAAGC-1 contig 1 = AGAGCTCTGG...
umi ACGAACAGGT = 184 reads: +385 validated
umi AGACGAAACC = 8 reads: -246 +14 -1XX +11 -1XX +20 -1XX +3 -1XX +1 -1XX +15 -3XX +2 -1X +3 -61 invalidated
umi AGCCATCTCT = 339 reads: +385 validated
umi AGTAGTCCAA = 302 reads: +385 validated
umi AGTATTATTT = 293 reads: +385 validated
umi ATAGATCTTA = 270 reads: +385 validated
umi ATCAGTCTAT = 267 reads: +385 validated
umi CCCTCTTCCT = 196 reads: +385 validated
umi CGGTCTCCTT = 251 reads: +385 validated
umi CGTTCACTAC = 72 reads: +385 validated
umi CTACTATCGT = 187 reads: +385 validated
umi CTGCATCCCA = 291 reads: +385 validated
umi CTGCGGGCGA = 339 reads: +385 validated
umi CTGCTCCTCA = 276 reads: +385 validated
umi CTGTATCCCA = 112 reads: +385 validated
umi GATTTTGGTT = 321 reads: +385 validated
umi GGTATTTTGT = 249 reads: +385 validated
umi GTACCACTCT = 228 reads: +385 validated
umi GTATTTGCTC = 141 reads: +385 validated
umi GTCTATTCAA = 349 reads: +385 validated
umi TACTCACGAT = 77 reads: +385 validated
umi TAGACTCCCT = 278 reads: +385 validated
umi TCGTCAATGT = 274 reads: +385 validated
umi TCTCTTACAT = 241 reads: +385 validated
umi TGACACGGCT = 261 reads: +385 validated
umi TGGATCACTA = 273 reads: +385 validated
umi TTCGGACGGG = 290 reads: +385 validated
umi TTTAACTCTG = 319 reads: +385 validated
umi TTTCATGCCT = 287 reads: +385 validated

UMI info for barcode GTCTTCGAGAAGAAGC-1 contig 2 = GAGTGCTTTC...
umi AGTGTTTCAA = 173 reads: +433 validated
umi ATTGTCATCA = 284 reads: +433 validated
umi CATTGAATAT = 220 reads: +433 validated
umi CCACGGTCCG = 97 reads: +405 -1 +2 -25 non-validated
umi CGACCAACCC = 227 reads: +433 validated
umi CTAATCATCC = 254 reads: +433 validated
umi GGCGCTTTCG = 326 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
391-429 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1035 reads
cdr3 = CQQYGSSPKTF at 368, score = 9 + 8
umis assigned: [92, 123, 131, 146, 148, 162, 173, 327, 376, 384] and 19 others
of which 29 are surviving nonsolos
reads assigned: 6879
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=553]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
451-553 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 171 reads
cdr3 = CARGRILGWYSDYW at 378, score = 9 + 7
umis assigned: [152, 219, 287, 298, 359, 388, 525]
of which 7 are surviving nonsolos
reads assigned: 1555
start codons at 18, 39, 83, 169, 469, 530
confident = true
now this is a cell
paired!

ACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGCCGGATACTAGGGTGGTACTCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTAAGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.6 = GTCTTCGAGACCTAGG-1

using 267 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 258]
surviving nonsolo ucounts = 1[258]
ids = [6]

====================================================================================

UMI info for barcode GTCTTCGAGACCTAGG-1 contig 1 = GAATCAGTCC...
umi TAATACTGTC = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.8 = GTCTTCGAGACTTTCG-1

using 13144 reads

====================================================================================

graph has 5987 edges initially, 94 edges after simplification

total ucounts = 962
nonsolo ucounts = 419[2^165, 3^81, 4^44, 5^33, 6^20, 7^7, 8^8, 9^2, 10^6, 11^2, 12, 15, 16, 18, 19, 22, 23, 28, 37, 76, 115, 124, 132, 139, 152, 156, 162, 169, 170, 180, 208, 217, 221, 223, 228, 230, 240, 254, 261, 264, 273^2, 277, 278, 288, 291^2, 301, 307^2, 313, 315, 325, 341, 350, 351, 355, 368, 374, 385, 879]
surviving nonsolo ucounts = 40[3, 76, 115, 124, 132, 152, 156, 162, 169, 208, 217, 221, 223, 228, 230, 240, 254, 261, 264, 273^2, 277, 278, 288, 291^2, 301, 307^2, 313, 315, 325, 341, 350, 351, 355, 368, 374, 385, 879]
ids = [367, 296, 532, 661, 65, 74, 173, 584, 710, 567, ...]

====================================================================================

UMI info for barcode GTCTTCGAGACTTTCG-1 contig 1 = AGCTCTCAGA...
umi ACAATTCGGA = 123 reads: +355 -1 +56 non-validated
umi ACATTCTTCG = 152 reads: +412 validated
umi AGGACACTCC = 132 reads: +412 validated
umi AGGCATGTAT = 185 reads: +412 validated
umi ATCCGTCAGC = 230 reads: +410 -1 +1 non-validated
umi CCCCTCAGTG = 392 reads: +412 validated
umi CTATGTTCAT = 309 reads: +406 -6 non-validated
umi GCGTAGTGCT = 141 reads: +296 -1 +115 non-validated
umi GTCATTCTGT = 114 reads: +399 -13 non-validated
umi GTGGATTCGG = 223 reads: +412 validated

UMI info for barcode GTCTTCGAGACTTTCG-1 contig 2 = AGGAGTCAGA...
umi AAGGGCCTCT = 308 reads: +382 validated
umi ACCTCTTGCA = 369 reads: +382 validated
umi ACTATGTCCC = 290 reads: +382 validated
umi AGTAAACGCT = 279 reads: +382 validated
umi CACGTTGGCT = 314 reads: +382 validated
umi CCATTCGTGC = 221 reads: +382 validated
umi CCCATAAGGC = 275 reads: +382 validated
umi CGACGGCCTA = 314 reads: +382 validated
umi CGTGCTGCAG = 378 reads: +382 validated
umi CTTAGATTCT = 303 reads: +382 validated
umi GAATTCTACC = 310 reads: +382 validated
umi GACGCGACCG = 117 reads: +382 validated
umi GCACAACTAG = 350 reads: +382 validated
umi GCAGACAACC = 212 reads: +382 validated
umi GTACCGTTCG = 340 reads: +382 validated
umi GTCATCGCGC = 351 reads: +382 validated
umi GTCATTCGGG = 277 reads: +382 validated
umi TCTCAGTCAA = 349 reads: +382 validated
umi TGTTCACGGC = 273 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
440-491 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
491-593 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 112 reads
cdr3 = CARGKVYNWFDPW at 421, score = 9 + 7
umis assigned: [65, 74, 173, 178, 213, 355, 458, 584, 661, 675]
of which 10 are surviving nonsolos
reads assigned: 1966
start codons at 79, 230, 235, 382, 509, 570
confident = true

TIG 2[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 901 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [41, 94, 109, 183, 286, 346, 352, 405, 442, 499] and 9 others
of which 19 are surviving nonsolos
reads assigned: 5562
start codons at 33, 89, 102, 238, 457
confident = true
now this is a cell
paired!

CTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGGGAAGGTCTATAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.9 = GTCTTCGAGAGGTAGA-1

using 6428 reads

====================================================================================

graph has 4031 edges initially, 54 edges after simplification

total ucounts = 861
nonsolo ucounts = 381[2^153, 3^64, 4^51, 5^28, 6^23, 7^19, 8^6, 9^5, 10^3, 11, 12^2, 13^2, 14, 20, 25, 45, 57, 66, 71, 96^2, 102, 109, 142, 165, 190, 198, 208, 209, 213, 219, 230, 239, 255, 605, 1077]
surviving nonsolo ucounts = 22[10, 25, 45, 57, 66, 71, 96^2, 109, 142, 165, 190, 198, 208, 209, 213, 219, 230, 239, 255, 605, 1077]
ids = [354, 218, 122, 691, 273, 842, 336, 426, 778, 552, ...]

====================================================================================

UMI info for barcode GTCTTCGAGAGGTAGA-1 contig 1 = GAGCTCTGGG...
umi CAACACGGCT = 45 reads: +258 -7 +150 non-validated
umi CCTATCGGAT = 66 reads: +384 -28 +3 non-validated
umi GCCCTTATCC = 211 reads: +415 validated
umi TTAACACTCA = 48 reads: -390X +1 -3X +1 -17X +3 invalidated

UMI info for barcode GTCTTCGAGAGGTAGA-1 contig 2 = AGCTGTGGGC...
umi CACATGCGCC = 1097 reads: -343X +1 -7XX +2 -1XX +26 -1XX +3 -1XX invalidated
umi CAGACCATTG = 257 reads: +385 validated
umi CCAATGGCAT = 213 reads: +385 validated
umi CTATACTCCT = 613 reads: +214 -1XX +6 -13XX +1 -1XX +1 -2XX +1 -145X invalidated
umi CTCGCACCAA = 209 reads: +385 validated
umi CTCGTACTCG = 231 reads: +385 validated
umi GGTGTAAGCC = 170 reads: +385 validated
umi TACGATGGGC = 240 reads: +385 validated
umi TGGCGGCCTC = 221 reads: +385 validated
umi TTACCCTGCT = 108 reads: +385 validated
umi TTTCCCCACT = 189 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=677]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=19)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
495-677 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=2)
junction support: 2 umis using 28 reads
cdr3 = CVREGGSWYYFDYW at 422, score = 8 + 6
umis assigned: [122, 273, 479, 770]
of which 4 are surviving nonsolos
reads assigned: 368
start codons at 80, 231, 236, 289, 294, 297, 315, 383
confident = true

TIG 2[bases=636]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=16)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 9 umis using 278 reads
cdr3 = CNSRDSSGNHAVVF at 355, score = 8 + 8
umis assigned: [136, 157, 205, 351, 370, 372, 541, 613, 752, 778] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3452
start codons at 40, 151, 164, 188, 239, 338, 383
confident = true
now this is a cell
paired!

AGAGCCGAGGACACGGCTGTGTATTATTGTGTGAGAGAAGGAGGCAGCTGGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCATTGTCTCCTCAG <==> GCTCAGGCGGAAGATGAGGCTGACTATTACTGTAATTCCCGGGACAGTAGTGGTAATCATGCAGTTGTTTTCGGCGGAGGGACCAAGCTGACCGTTCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.21 = GTCTTCGAGCTGATAA-1

using 122 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[6, 7, 105]
surviving nonsolo ucounts = 1[105]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=482]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-50 ==> 11314-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
36-68 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-482 ==> 12-42 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 100
start codons at 50, 248, 253, 270, 314, 347
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.26 = GTCTTCGAGGATGTAT-1

using 266 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 4, 251]
surviving nonsolo ucounts = 1[251]
ids = [2]

====================================================================================

UMI info for barcode GTCTTCGAGGATGTAT-1 contig 1 = GACTGATCAG...
umi CACACTTCAC = 242 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=492]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-360 ==> 0-326 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=11)
393-431 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
431-492 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMNTLPGGFTF at 370, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.30 = GTCTTCGAGGCTCAGA-1

using 60 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2^3, 3^2, 4^2, 5^4, 6, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.33 = GTCTTCGAGGGCACTA-1

using 251 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2^2, 247]
surviving nonsolo ucounts = 1[247]
ids = [2]

====================================================================================

UMI info for barcode GTCTTCGAGGGCACTA-1 contig 1 = GGAGTCAGAC...
umi TGCTTTCATT = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 26, 32, 101, 237, 240, 333, 366, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.57 = GTCTTCGCACCGAATT-1

using 459 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 453]
surviving nonsolo ucounts = 1[453]
ids = [3]

====================================================================================

UMI info for barcode GTCTTCGCACCGAATT-1 contig 1 = GGAGAAGAGC...
umi CGTTACACAA = 457 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQHATSPFTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 446
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.62 = GTCTTCGCACTTAAGC-1

using 409 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[6, 162, 239]
surviving nonsolo ucounts = 2[162, 239]
ids = [0, 1]

====================================================================================

UMI info for barcode GTCTTCGCACTTAAGC-1 contig 1 = AAAAACCACA...
umi ACTCGCAGGA = 157 reads: +436 validated

UMI info for barcode GTCTTCGCACTTAAGC-1 contig 2 = ATCAGTCCCA...
umi ATCATTGCCG = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=511]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-511 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 50, 248, 253, 270, 314, 347
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.63 = GTCTTCGCAGACACTT-1

using 236 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [0]

====================================================================================

UMI info for barcode GTCTTCGCAGACACTT-1 contig 1 = GGGTCACAAG...
umi TTACTTTTCG = 234 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=633]
0-37 ==> 125-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
37-377 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
394-422 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 34 reads
cdr3 = CFSYGTSGRTF at 361, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 37, 245, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.65 = GTCTTCGCAGATCCAT-1

using 552 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 173, 369]
surviving nonsolo ucounts = 2[173, 369]
ids = [6, 1]

====================================================================================

UMI info for barcode GTCTTCGCAGATCCAT-1 contig 1 = GCTCTGCTTC...
umi GGTGCCCACA = 173 reads: +394 validated

UMI info for barcode GTCTTCGCAGATCCAT-1 contig 2 = ATCACATAAC...
umi CAACAGAGGG = 338 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-656 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

TIG 2[bases=551]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=24)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
494-551 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CAREDDFWSGSYTYYYGMDVW at 400, score = 10 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 58, 209, 256, 355, 451, 512
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.66 = GTCTTCGCAGATCGGA-1

using 386 reads

====================================================================================

graph has 168 edges initially, 24 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 184, 194]
surviving nonsolo ucounts = 2[184, 194]
ids = [2, 3]

====================================================================================

UMI info for barcode GTCTTCGCAGATCGGA-1 contig 1 = ACAAGAGGCA...
umi GGTCACACTG = 196 reads: +394 validated

UMI info for barcode GTCTTCGCAGATCGGA-1 contig 2 = GTGGGCTCAG...
umi AGTCTCTGCA = 183 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=636]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
425-636 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQSYDSSLSGLYVF at 355, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 31, 185, 188, 239, 338, 365, 389, 557
confident = false

TIG 2[bases=631]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-631 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 28 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 35, 96, 183, 230, 234, 333, 386, 552
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.67 = GTCTTCGCAGATCTGT-1

using 103 reads

====================================================================================

graph has 130 edges initially, 4 edges after simplification

total ucounts = 31
nonsolo ucounts = 19[2^6, 3^2, 4^5, 5, 6, 8, 9, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.81 = GTCTTCGCATGGGACA-1

using 182 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 175]
surviving nonsolo ucounts = 1[175]
ids = [3]

====================================================================================

UMI info for barcode GTCTTCGCATGGGACA-1 contig 1 = GGGGGGTCTC...
umi CCAGATCTTT = 173 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=524]
40-390 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
393-431 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
431-524 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSYTSSSTPVVF at 364, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 40, 197, 241, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.84 = GTCTTCGCATTCCTCG-1

using 416 reads

====================================================================================

graph has 118 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[170, 242]
surviving nonsolo ucounts = 2[170, 242]
ids = [1, 5]

====================================================================================

UMI info for barcode GTCTTCGCATTCCTCG-1 contig 1 = AGCTGGGAAG...
umi CAGCTTTCAA = 167 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=539]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=1)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
433-539 ==> 0-106 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CVLYMGSGIWVF at 369, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 30, 45, 54, 57, 82, 349, 352, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.85 = GTCTTCGCATTCGACA-1

using 44 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 4, 30]
surviving nonsolo ucounts = 1[30]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.94 = GTCTTCGGTACGAAAT-1

using 402 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^4, 4, 385]
surviving nonsolo ucounts = 1[385]
ids = [9]

====================================================================================

UMI info for barcode GTCTTCGGTACGAAAT-1 contig 1 = GGGAATCAGT...
umi TGAACGTAGC = 383 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.96 = GTCTTCGGTAGAAAGG-1

using 55 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 44]
surviving nonsolo ucounts = 1[44]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.107 = GTCTTCGGTCATATGC-1

using 18944 reads

====================================================================================

graph has 8024 edges initially, 108 edges after simplification

total ucounts = 1684
nonsolo ucounts = 717[2^318, 3^145, 4^76, 5^43, 6^28, 7^15, 8^7, 9^6, 10^5, 11^2, 13^2, 14^2, 16, 18, 33, 38, 87, 91, 111, 122, 130, 132, 135, 138, 142, 157, 161, 177, 180, 182, 183, 184, 185, 188, 189, 195, 198, 202, 204, 205, 207, 209, 212, 220, 221, 222, 226, 237, 238, 240^2, 245, 246, 247, 257, 261, 274, 275, 279, 285, 291^2, 302^4, 308, 322, 327, 331, 333, 337, 342, 349, 361, 376, 381, 402^2, 691]
surviving nonsolo ucounts = 65[38, 87, 91, 111, 122, 130, 132, 135, 138, 142, 157, 161, 177, 180, 182, 183, 184, 185, 188, 189, 195, 198, 202, 204, 205, 207, 209, 212, 220, 221, 222, 226, 237, 238, 240^2, 245, 246, 247, 257, 261, 274, 275, 279, 285, 291^2, 302^4, 308, 322, 327, 331, 333, 337, 342, 349, 361, 376, 381, 402^2, 691]
ids = [1147, 152, 245, 537, 566, 1218, 1006, 1531, 54, 224, ...]

====================================================================================

UMI info for barcode GTCTTCGGTCATATGC-1 contig 1 = AGCTTCAGCT...
umi AATAGAATTG = 194 reads: +388 validated
umi AATTAAGGAT = 183 reads: +388 validated
umi AGAAGCCCTC = 225 reads: +388 validated
umi AGCACACCAT = 201 reads: +388 validated
umi AGCTAAAGGC = 141 reads: +388 validated
umi ATTAATTGGA = 380 reads: +388 validated
umi CTTGGTATGC = 691 reads: -359X +29 invalidated
umi GCTATATCAG = 131 reads: +388 validated
umi GTCGAAGGGT = 242 reads: +388 validated
umi GTTCAATCCC = 186 reads: +388 validated
umi TAAAATCTGT = 214 reads: +388 validated
umi TAACTTGTCC = 245 reads: +388 validated
umi TACAGTGTAC = 204 reads: +388 validated
umi TATGGTTCTC = 178 reads: +388 validated
umi TGCACAGCAG = 241 reads: +388 validated
umi TGTTGTTTCC = 187 reads: +388 validated
umi TTACCTCCAT = 138 reads: +388 validated
umi TTATACTTGC = 178 reads: -64X +4 -2X +2 -6X +1 -3XX +1 -2XX +1 -6XX +1 -1XX +294 invalidated
umi TTCTTGCTGT = 198 reads: -288 +100 non-validated
umi TTTAATTGGT = 197 reads: +388 validated
umi TTTATCTGCA = 247 reads: +388 validated

UMI info for barcode GTCTTCGGTCATATGC-1 contig 2 = ACATGGGAAA...
umi ATGAGGTATA = 156 reads: +442 validated
umi CCACGTAGTA = 110 reads: +442 validated
umi CCCGCATTCC = 122 reads: +438 -4 non-validated
umi GCCTTCGGTC = 199 reads: +442 validated
umi GTGTATTAAG = 197 reads: +442 validated
umi GTTAACTTAT = 242 reads: +442 validated

UMI info for barcode GTCTTCGGTCATATGC-1 contig 3 = GTCAGAGCCC...
umi AAGGTCCCCT = 138 reads: +379 validated
umi AAGTCTGGTT = 328 reads: +379 validated
umi ACCGCTATCT = 288 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -16X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +277 invalidated
umi ACCTCCTCAT = 411 reads: +18 -1XX +360 invalidated
umi ACGAAATGGA = 82 reads: +379 validated
umi AGATCATTTG = 306 reads: +379 validated
umi AGGGCTCTAG = 91 reads: +368 -1XX +10 invalidated
umi AGGTCACCTC = 287 reads: +379 validated
umi AGTTACGGCC = 197 reads: +379 validated
umi ATATCTATAA = 182 reads: +379 validated
umi ATCATCGCCT = 274 reads: +379 validated
umi ATGGATATAT = 322 reads: +379 validated
umi ATTCATCTCT = 358 reads: +379 validated
umi CAACGACGGT = 287 reads: +379 validated
umi CAGATGTTTC = 304 reads: +379 validated
umi CCCGTGTGTA = 341 reads: +379 validated
umi CCCTGGTTCT = 328 reads: +379 validated
umi CTAAGCTCAG = 302 reads: +5 -1XX +373 invalidated
umi CTTCCGCTTG = 324 reads: +379 validated
umi CTTTCTCTCT = 252 reads: +379 validated
umi GAACGTTCCT = 372 reads: +379 validated
umi GTCGATTCGT = 189 reads: +379 validated
umi TGTCACCAAT = 303 reads: +379 validated
umi TGTGGCCATT = 300 reads: +379 validated
umi TTACAGCGAT = 275 reads: +379 validated
umi TTCACACTTG = 333 reads: +379 validated
umi TTCATCATCT = 186 reads: +379 validated
umi TTCTCGCATG = 219 reads: +379 validated
umi TTTCGAATCT = 224 reads: +379 validated

UMI info for barcode GTCTTCGGTCATATGC-1 contig 4 = AGCTCTGGGA...
umi CACACATAAG = 262 reads: +409 validated
umi CCCACGTTCC = 287 reads: +409 validated
umi CCGCGGCCTC = 239 reads: +409 validated
umi CGAACTTCCT = 403 reads: +409 validated
umi CGCCACCTTG = 354 reads: +409 validated
umi GCTTTTTGGG = 156 reads: +409 validated
umi GTTTTTCGAC = 39 reads: +287 -1 +9 -1 +111 non-validated
umi TATAACGGCC = 131 reads: +409 validated
umi TCTTTGCCAG = 237 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=11)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 20 umis using 628 reads
cdr3 = CVAWDDSLKGPVF at 368, score = 8 + 8
umis assigned: [61, 79, 197, 211, 224, 361, 855, 1006, 1098, 1131] and 11 others
of which 21 are surviving nonsolos
reads assigned: 4737
start codons at 47, 248, 351, 376, 381
confident = true

TIG 2[bases=559]
0-46 ==> 18-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
46-399 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=0)
407-435 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=1)
435-488 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=2)
488-559 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 72 reads
cdr3 = CAREANQHIVVVIAIPDWYFDLW at 388, score = 9 + 7
umis assigned: [338, 537, 566, 989, 1121, 1129]
of which 6 are surviving nonsolos
reads assigned: 1009
start codons at 2, 25, 46, 90
confident = true

TIG 3[bases=562]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1199 reads
cdr3 = CQQRSNWPSF at 368, score = 9 + 7
umis assigned: [54, 57, 135, 143, 152, 208, 245, 251, 269, 299] and 19 others
of which 29 are surviving nonsolos
reads assigned: 7717
start codons at 47, 252, 255, 468
confident = true

TIG 4[bases=560]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=1)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=19)
441-489 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 140 reads
cdr3 = CAGGWHARFDYW at 422, score = 10 + 7
umis assigned: [434, 556, 592, 634, 663, 1021, 1147, 1218, 1419]
of which 9 are surviving nonsolos
reads assigned: 2073
start codons at 80, 236, 383
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.125 = GTCTTCGGTTATCGGT-1

using 97 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[92]
surviving nonsolo ucounts = 1[92]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.136 = GTCTTCGGTTTGACTG-1

using 25 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.142 = GTCTTCGTCAACGCTA-1

using 4436 reads

====================================================================================

graph has 2664 edges initially, 40 edges after simplification

total ucounts = 661
nonsolo ucounts = 278[2^123, 3^55, 4^31, 5^19, 6^12, 7^3, 8^8, 10^4, 12^2, 14^2, 15, 18, 30, 33, 66, 74, 139, 148, 162, 181, 216, 224, 228, 239, 243, 259, 277, 284, 337]
surviving nonsolo ucounts = 17[30, 33, 66, 74, 139, 148, 162, 181, 216, 224, 228, 239, 243, 259, 277, 284, 337]
ids = [476, 577, 484, 214, 277, 228, 235, 446, 596, 256, ...]

====================================================================================

UMI info for barcode GTCTTCGTCAACGCTA-1 contig 1 = ACACTTTGTG...
umi AGAGTTATGC = 289 reads: +388 validated
umi CAACCGTCCA = 262 reads: +388 validated
umi CAAGAATACG = 341 reads: +388 validated
umi CCATGAGCAG = 226 reads: +388 validated
umi CCGTAGTTCT = 138 reads: +388 validated
umi GGCTAAAGTA = 242 reads: +388 validated
umi TGCTGAGATC = 221 reads: +388 validated
umi TTAACTCTCT = 231 reads: +388 validated

UMI info for barcode GTCTTCGTCAACGCTA-1 contig 2 = GCCCTCTACT...
umi CACTTGATTC = 76 reads: +372 -46 non-validated
umi CATGCTCATT = 155 reads: +416 -1 +1 non-validated
umi CTCTTCAGTC = 277 reads: +418 validated
umi GGAACTGCCG = 181 reads: +418 validated
umi GGTTTGCCGA = 33 reads: -11 +169 -1XX +35 -52 +9 -1 +140 invalidated
umi GTATTCATGC = 62 reads: +378 -1 +17 -1 +21 non-validated
umi TCTCCCACAA = 32 reads: +350 -68 non-validated
umi TGCCCCACCT = 230 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=562]
0-38 ==> 143-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
38-389 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 304 reads
cdr3 = CQQYNSYSWTF at 365, score = 8 + 8
umis assigned: [100, 192, 194, 256, 277, 460, 596, 613]
of which 8 are surviving nonsolos
reads assigned: 1908
start codons at 38, 44, 100, 113, 345, 468
confident = true

TIG 2[bases=607]
118-471 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
502-536 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
536-607 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 61 reads
cdr3 = CAREEGYGSGSSSQW at 460, score = 9 + 7
umis assigned: [214, 235, 354, 446, 476, 484, 577, 591]
of which 8 are surviving nonsolos
reads assigned: 1031
start codons at 11, 118, 269, 274, 332, 335, 421, 479
confident = true
now this is a cell
paired!

GCTGAGGACACGGCTGTGTATTACTGTGCGAGAGAAGAGGGGTATGGTTCAGGGAGTTCCTCGCAGTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.148 = GTCTTCGTCACTTCAT-1

using 242 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 4, 229]
surviving nonsolo ucounts = 1[229]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=510]
1-357 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
357-395 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
395-510 ==> 0-115 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 325, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 155, 158, 209, 308, 335, 359
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.173 = GTCTTCGTCTACTTAC-1

using 272 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[5, 261]
surviving nonsolo ucounts = 1[261]
ids = [5]

====================================================================================

UMI info for barcode GTCTTCGTCTACTTAC-1 contig 1 = TGGGAGGAAT...
umi TTAAGCCGCA = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-504 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.174 = GTCTTCGTCTCCTATA-1

using 385 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2, 3^2, 4, 7, 82, 280]
surviving nonsolo ucounts = 2[82, 280]
ids = [5, 6]

====================================================================================

UMI info for barcode GTCTTCGTCTCCTATA-1 contig 1 = AGTGCTTTCT...
umi CTCGCGGCGA = 82 reads: +430 validated

UMI info for barcode GTCTTCGTCTCCTATA-1 contig 2 = GGAGTCAGAC...
umi CTTTCGACAA = 266 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=531]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-531 ==> 0-63 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 80
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_85.174_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG

TIG 2[bases=505]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-505 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNSYSAF at 353, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 26, 32, 88, 101, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.185 = GTCTTCGTCTTCTGGC-1

using 20 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.188 = GTCTTCGTCTTTCCTC-1

using 2529 reads

====================================================================================

graph has 2792 edges initially, 54 edges after simplification

total ucounts = 1315
nonsolo ucounts = 534[2^261, 3^122, 4^56, 5^40, 6^24, 7^14, 8^3, 9, 10^3, 11^6, 12^2, 18, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.190 = GTGAAGGAGACGCAAC-1

using 70 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[70]
surviving nonsolo ucounts = 1[70]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=386]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-375 ==> 0-345 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=24)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 30, 63, 187, 250, 349, 369
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.197 = GTGAAGGAGCAGATCG-1

using 201 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 4, 6, 12, 173]
surviving nonsolo ucounts = 1[173]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.200 = GTGAAGGAGCGCCTTG-1

using 269 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3^2, 5, 247]
surviving nonsolo ucounts = 1[247]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=503]
0-77 ==> 5533-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-372 ==> 0-342 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=5)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-503 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHGRKLTF at 350, score = 3 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 30, 63, 91, 99, 187, 349, 369, 459
confident = false
not full
frameshifted full length transcript of length 503
VJ delta = 29
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.205 = GTGAAGGAGGACATTA-1

using 57 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^2, 4, 5, 6, 7, 11, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.208 = GTGAAGGAGGATATAC-1

using 159 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[159]
surviving nonsolo ucounts = 1[159]
ids = [0]

====================================================================================

UMI info for barcode GTGAAGGAGGATATAC-1 contig 1 = AGCTCTGAGA...
umi CGTAAATGGT = 155 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=508]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.213 = GTGAAGGAGGCCCTCA-1

using 958 reads

====================================================================================

graph has 1228 edges initially, 16 edges after simplification

total ucounts = 423
nonsolo ucounts = 185[2^73, 3^33, 4^23, 5^21, 6^16, 7^6, 8^5, 9, 10, 11, 12^2, 13, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.215 = GTGAAGGAGGGATGGG-1

using 12361 reads

====================================================================================

graph has 6093 edges initially, 94 edges after simplification

total ucounts = 927
nonsolo ucounts = 661[2^114, 3^82, 4^85, 5^70, 6^62, 7^41, 8^34, 9^38, 10^18, 11^18, 12^21, 13^11, 14^11, 15^6, 16^5, 17^6, 18, 19^2, 20, 21, 23^2, 24, 32, 77, 95, 99, 108, 153, 200, 205, 217, 230, 240, 242, 266, 271, 281, 295, 296, 303, 305^2, 309, 324, 329, 340, 341, 354, 365^2, 371, 446, 527]
surviving nonsolo ucounts = 30[77, 95, 99, 108, 153, 200, 205, 217, 230, 240, 242, 266, 271, 281, 295, 296, 303, 305^2, 309, 324, 329, 340, 341, 354, 365^2, 371, 446, 527]
ids = [693, 143, 447, 588, 673, 120, 84, 296, 567, 859, ...]

====================================================================================

UMI info for barcode GTGAAGGAGGGATGGG-1 contig 1 = GGAGGAGTCA...
umi ACGACCCGGC = 303 reads: +388 validated
umi ACGATAGCTC = 204 reads: +388 validated
umi AGCCAGCTTC = 199 reads: +388 validated
umi AGGTTATAAC = 96 reads: +388 validated
umi AGTCAAACGA = 349 reads: +388 validated
umi AGTCACGGTA = 309 reads: +388 validated
umi CAAGCTCAAA = 327 reads: +388 validated
umi CCATAACCCG = 448 reads: +388 validated
umi CCGGCTCAGG = 218 reads: +388 validated
umi CGCGCGATTA = 373 reads: +388 validated
umi CGGTAAAGCA = 282 reads: +388 validated
umi CGTGAGCTTA = 306 reads: +388 validated
umi CTACTCATGG = 267 reads: +388 validated
umi CTTGCCTGGG = 100 reads: +388 validated
umi GAAGAAGGTC = 303 reads: +388 validated
umi GCGAGTGGGG = 341 reads: +388 validated
umi GGCGTCAGGG = 527 reads: +388 validated
umi GGCTGTGACC = 229 reads: -336 +52 non-validated
umi GGTGTACGGG = 109 reads: +388 validated
umi TAGGGTTCAG = 153 reads: +388 validated
umi TATTAAGGGC = 78 reads: +388 validated
umi TGGCTTTGGA = 340 reads: +388 validated
umi TGGTTCTTCT = 243 reads: +388 validated
umi TGTCGATCAT = 333 reads: +388 validated
umi TTACTTGCAA = 295 reads: +388 validated
umi TTCACCTTGA = 369 reads: +388 validated
umi TTCACTGTTC = 241 reads: +388 validated
umi TTCCCGGTAT = 368 reads: +388 validated
umi TTCTAACCAT = 265 reads: +388 validated

UMI info for barcode GTGAAGGAGGGATGGG-1 contig 2 = ACTTGGTGAT...
umi CTTTCCTCTA = 304 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=1)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1270 reads
cdr3 = CLQDYNYPWTF at 356, score = 9 + 8
umis assigned: [83, 84, 120, 143, 145, 146, 213, 271, 296, 343] and 19 others
of which 29 are surviving nonsolos
reads assigned: 7855
start codons at 29, 35, 91, 104, 186, 240, 459
confident = true

TIG 2[bases=527]
0-35 ==> 44-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
35-388 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=3)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARTLDGSGSSYFDYW at 377, score = 9 + 7
umis assigned: [456]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 35, 186, 191, 338, 393
confident = true
now this is a cell
paired!

GAGGACACGGCTGTTTATTACTGTGCGAGGACCCTCGATGGTTCGGGGAGTTCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.217 = GTGAAGGAGGTAGCCA-1

using 1445 reads

====================================================================================

graph has 592 edges initially, 14 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2, 3^2, 8^2, 153, 281, 310, 316, 358]
surviving nonsolo ucounts = 5[153, 281, 310, 316, 358]
ids = [4, 3, 10, 2, 7]

====================================================================================

UMI info for barcode GTGAAGGAGGTAGCCA-1 contig 1 = AGAGCTCTGG...
umi CAACGTCCTT = 146 reads: +53 -1XX +91 -1XX +6 -2XX +1 -1XX +143 -1XX +8 -1XX +12 -45X +7 -3XX +4 -1XX +5 -1XX +1 invalidated
umi CTTATTCTGG = 380 reads: +176 -1XX +29 -1XX +4 -1XX +1 -1XX +4 -1XX +1 -1XX +167 invalidated

UMI info for barcode GTGAAGGAGGTAGCCA-1 contig 2 = GGGGAGGAAT...
umi AGCCCAAGCA = 317 reads: +388 validated
umi GCCGTCCGAG = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSQPYTF at 368, score = 9 + 8
umis assigned: [4, 7]
of which 2 are surviving nonsolos
reads assigned: 490
start codons at 44, 252, 378, 474
confident = true

TIG 2[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 101 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2, 10]
of which 2 are surviving nonsolos
reads assigned: 620
start codons at 31, 37, 106, 242, 461
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.219 = GTGAAGGAGGTGCTTT-1

using 302 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================

UMI info for barcode GTGAAGGAGGTGCTTT-1 contig 1 = ACTTTCTGAG...
umi CAAACAGATG = 275 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=14)
423-474 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
474-556 ==> 0-82 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDVGTTPASPSLHEDNYFGPW at 374, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 35, 79, 183, 246, 417, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.221 = GTGAAGGAGTAGCGGT-1

using 27434 reads

====================================================================================

graph has 10904 edges initially, 196 edges after simplification

total ucounts = 1355
nonsolo ucounts = 674[2^211, 3^110, 4^104, 5^64, 6^34, 7^11, 8^16, 9^13, 10^7, 11^5, 12^4, 13^4, 15, 16, 17^2, 22^2, 35, 52, 59, 97, 102, 111, 132, 151^2, 159, 162, 165, 172^2, 180, 190, 191, 194, 198, 201, 202, 207, 215, 218^2, 222, 223^3, 227, 228, 231^2, 232, 233, 235, 241, 242, 247, 248, 251, 253^2, 255^2, 257, 259, 261^2, 262, 265, 266, 268, 278, 280, 284, 287, 289, 290, 294, 296, 298, 301, 305, 311, 314, 318, 327, 336, 338, 342, 349, 356, 365, 371, 380, 385, 416, 430, 747, 748, 793, 926, 930, 935]
surviving nonsolo ucounts = 76[97, 111, 132, 162, 165, 172, 180, 190, 191, 194, 198, 201, 202, 207, 215, 218^2, 222, 223^3, 227, 228, 231^2, 232, 233, 235, 241, 242, 247, 248, 251, 253^2, 255^2, 257, 259, 261^2, 265, 266, 268, 278, 280, 284, 287, 289, 290, 294, 296, 298, 301, 305, 311, 314, 318, 327, 336, 338, 342, 349, 356, 365, 371, 380, 385, 416, 430, 747, 748, 793, 926, 930, 935]
ids = [1, 571, 921, 780, 115, 1305, 1315, 311, 1218, 1065, ...]

====================================================================================

UMI info for barcode GTGAAGGAGTAGCGGT-1 contig 1 = ATCATCCAAC...
umi AAAAATTCCC = 97 reads: +424 validated
umi AATCGTTGAA = 235 reads: +424 validated
umi ACACCTGGAC = 297 reads: +424 validated
umi ACGAATTGGC = 248 reads: +424 validated
umi ATTACTGTCC = 244 reads: +424 validated
umi CCGGCATTTC = 265 reads: +424 validated
umi CCTTTTGCAG = 379 reads: +424 validated
umi CGGCCTTGTG = 249 reads: +424 validated
umi CTCTAATCTT = 283 reads: +424 validated
umi GACTTGTGCG = 272 reads: +424 validated
umi GCAAGACTCT = 163 reads: +421 -2 +1 non-validated
umi GCTTGTCGTC = 378 reads: +424 validated
umi GGAAACCCGA = 365 reads: +424 validated
umi GTAGCAAGGA = 237 reads: +424 validated
umi GTAGGGGACG = 257 reads: +424 validated
umi GTCCTCAACT = 131 reads: +424 validated
umi GTCTGATGCA = 383 reads: +424 validated
umi TAGGATACTA = 247 reads: +424 validated
umi TATGCACCTA = 271 reads: +424 validated
umi TATTGGCCTA = 226 reads: +424 validated
umi TGGACAAAAT = 2 reads: -351X +1 -4X +2 -6XX +1 -2XX +1 -3XX +1 -6XX +3 -1XX +31 -11 invalidated
umi TGGTGACAAT = 190 reads: +422 -1X +1 invalidated
umi TTGGAAATCG = 155 reads: +424 validated
umi TTGTGCGATC = 179 reads: +409 -3 +7 -5 non-validated

UMI info for barcode GTGAAGGAGTAGCGGT-1 contig 2 = GAAGGGCTGG...
umi ACATCGGGCT = 227 reads: +388 validated
umi ATTAATTGTA = 246 reads: +388 validated
umi ATTAGAACAC = 187 reads: +388 validated
umi CATATTTCTT = 225 reads: +388 validated
umi GACCTGGCAG = 199 reads: +388 validated

UMI info for barcode GTGAAGGAGTAGCGGT-1 contig 3 = AGCTCTGGGA...
umi ACATTACGGT = 287 reads: +394 validated
umi AGACCACGTA = 302 reads: +394 validated
umi AGACTGCTGT = 222 reads: +394 validated
umi ATCGGACGCA = 298 reads: +394 validated
umi CGACGGGTGA = 221 reads: +394 validated
umi TAACGTACAC = 264 reads: +394 validated
umi TTAGTTCGTG = 355 reads: +394 validated

UMI info for barcode GTGAAGGAGTAGCGGT-1 contig 4 = GCTCTGCTTC...
umi AACAACAATC = 290 reads: +391 validated
umi AACTACCTGT = 892 reads: -355 +1 -1XX +8 -1XX +5 -1XX +3 -1XX +13 -1XX +1 invalidated
umi ACACCATCAC = 328 reads: +391 validated
umi ACATAGTCTT = 168 reads: +391 validated
umi ACTAGTGTTT = 249 reads: +391 validated
umi AGTGTTCGTT = 278 reads: +391 validated
umi ATACTTAGGC = 367 reads: +391 validated
umi ATCGGGGGTT = 272 reads: +391 validated
umi CACCCGGGCA = 793 reads: -325X +66 invalidated
umi CCCCCTCTGG = 223 reads: +391 validated
umi CCGCTAACAC = 338 reads: +391 validated
umi CCGTGAAGCG = 259 reads: +391 validated
umi CGAGAATTGC = 213 reads: +391 validated
umi CGCGGTTGTT = 112 reads: +391 validated
umi CGGTATATTT = 209 reads: +391 validated
umi CGTTAAAGGA = 292 reads: +391 validated
umi CTATACCTCT = 873 reads: -330X +1 -2XX +1 -1XX +1 -3XX +3 -10XX +2 -2XX +35 invalidated
umi CTCTAAATTG = 319 reads: +391 validated
umi CTCTTACGAC = 233 reads: +391 validated
umi CTTGGTTCTG = 301 reads: +391 validated
umi GTGAGTATTT = 238 reads: +391 validated
umi TCAAAATCTA = 203 reads: +391 validated
umi TCCGCACGCC = 298 reads: +391 validated
umi TCCTGCGTTG = 238 reads: +391 validated
umi TCCTTTAACC = 258 reads: +391 validated
umi TCTTCATACG = 240 reads: +391 validated
umi TGCAACACAT = 256 reads: +391 validated
umi TTGCATGTAC = 237 reads: +391 validated
umi TTTACCAGTT = 752 reads: -346X +1 -4X +1 -1X +2 -3X +1 -1X +1 -2X +2 -1XX +25 invalidated

GOOD CONTIGS

TIG 1[bases=553]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 22 umis using 490 reads
cdr3 = CARVPMVRGVSYYFDYW at 400, score = 9 + 7
umis assigned: [1, 78, 108, 138, 309, 494, 535, 584, 664, 751] and 14 others
of which 23 are surviving nonsolos
reads assigned: 5660
start codons at 58, 214, 256, 322, 355, 415
confident = true

TIG 2[bases=661]
0-62 ==> 24-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
62-415 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
412-450 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
450-661 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 160 reads
cdr3 = CQSYDSSNQVF at 389, score = 6 + 8
umis assigned: [117, 305, 311, 416, 742]
of which 5 are surviving nonsolos
reads assigned: 1072
start codons at 62, 125, 216, 267, 399
confident = true

TIG 3[bases=544]
0-79 ==> 0-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
79-429 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=6)
438-473 ==> 14-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 154 reads
cdr3 = CASVSLYW at 418, score = 9 + 8
umis assigned: [118, 175, 180, 278, 541, 970, 1246]
of which 7 are surviving nonsolos
reads assigned: 1908
start codons at 79, 235, 379, 454
confident = true

TIG 4[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 25 umis using 1042 reads
cdr3 = CQSYDSSLSGSVF at 375, score = 8 + 8
umis assigned: [22, 35, 106, 115, 155, 228, 250, 279, 372, 463] and 19 others
of which 29 are surviving nonsolos
reads assigned: 9586
start codons at 51, 205, 208, 259, 358, 385
confident = true

REJECT CONTIGS

TIG 1[bases=321]
32-189 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
187-250 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
250-321 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [166, 1251]
of which 2 are surviving nonsolos
reads assigned: 897
start codons at 39, 73, 112, 167, 207
confident = false
did not find CDR3

TIG 2[bases=636]
0-51 ==> 5-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
51-402 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=3)
404-425 ==> 49-70 on |316|IGLJ6|J-REGION| [len=70] (mis=0)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=9)
umis assigned: [62, 604, 726, 812, 1016, 1065]
of which 6 are surviving nonsolos
reads assigned: 1544
start codons at 51, 205, 355, 380, 385, 557
confident = false
did not find CDR3

TIG 3[bases=570]
7-95 ==> 5649-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
47-398 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [23, 283, 466, 962, 1308]
of which 4 are surviving nonsolos
reads assigned: 1109
start codons at 47, 53, 109, 122, 258, 476
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.230 = GTGAAGGCAAGAGTCG-1

using 3061 reads

====================================================================================

graph has 1396 edges initially, 76 edges after simplification

total ucounts = 445
nonsolo ucounts = 257[2^78, 3^38, 4^43, 5^25, 6^15, 7^13, 8^9, 9^7, 10^5, 11^4, 12^4, 13^3, 14^2, 15^2, 18, 134, 146, 180, 220, 248, 251, 270, 284]
surviving nonsolo ucounts = 8[134, 146, 180, 220, 248, 251, 270, 284]
ids = [103, 320, 18, 385, 257, 159, 66, 90]

====================================================================================

UMI info for barcode GTGAAGGCAAGAGTCG-1 contig 1 = ACTAGAAGTC...
umi AACTATGGTT = 174 reads: +424 validated
umi AGGCCGTTCC = 239 reads: +424 validated
umi ATATATATAC = 245 reads: +399 -1XX +24 invalidated
umi ATGAGCCGGT = 131 reads: +424 validated
umi CCGATGGTTC = 221 reads: +424 validated
umi TAGTGGCAAT = 133 reads: +388 -1 +4 -1 +21 -9 non-validated

UMI info for barcode GTGAAGGCAAGAGTCG-1 contig 2 = GAGGAGTCAG...
umi GCTTTCATGG = 229 reads: +391 validated

UMI info for barcode GTGAAGGCAAGAGTCG-1 contig 3 = GGAGTCAGAC...
umi TGCCCTCACT = 206 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=537]
0-57 ==> 23-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
57-408 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
418-481 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
481-537 ==> 0-56 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 91 reads
cdr3 = CARSRLGNYYYYGMDVW at 399, score = 9 + 7
umis assigned: [18, 66, 90, 103, 159, 320]
of which 6 are surviving nonsolos
reads assigned: 1126
start codons at 57, 208, 213, 266, 271, 274, 292, 360, 438, 499
confident = true

TIG 2[bases=502]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
419-502 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYSTPLYTF at 355, score = 9 + 8
umis assigned: [257]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 28, 34, 90, 103, 239, 461
confident = true

TIG 3[bases=503]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
420-503 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNSYSPTWTF at 353, score = 8 + 8
umis assigned: [385]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 26, 32, 88, 101, 333, 462
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.231 = GTGAAGGCAAGCGTAG-1

using 217 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [0]

====================================================================================

UMI info for barcode GTGAAGGCAAGCGTAG-1 contig 1 = AGTGCTTTCT...
umi TAGATATAGC = 210 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=563]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-563 ==> 0-95 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_85.231_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.233 = GTGAAGGCAAGTCTAC-1

using 164 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 159]
surviving nonsolo ucounts = 1[159]
ids = [3]

====================================================================================

UMI info for barcode GTGAAGGCAAGTCTAC-1 contig 1 = GCTGTGGGTC...
umi TTATAAGATA = 155 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-358 ==> 0-320 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=28)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
429-588 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSADSISPLATRVTF at 353, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 152
start codons at 38, 168, 186, 305
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.234 = GTGAAGGCAATACGCT-1

using 503 reads

====================================================================================

graph has 208 edges initially, 12 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 216, 284]
surviving nonsolo ucounts = 2[216, 284]
ids = [3, 0]

====================================================================================

UMI info for barcode GTGAAGGCAATACGCT-1 contig 1 = GGAGTCAGTC...
umi CCACTTCGAC = 291 reads: +388 validated

UMI info for barcode GTGAAGGCAATACGCT-1 contig 2 = TGGGGGATCA...
umi GGCTTATGAC = 220 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
400-432 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CMQALQTPPTF at 371, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.237 = GTGAAGGCAATGCCAT-1

using 232 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 223]
surviving nonsolo ucounts = 1[223]
ids = [3]

====================================================================================

UMI info for barcode GTGAAGGCAATGCCAT-1 contig 1 = AGTGCTTTCT...
umi CGCCCCCCAC = 221 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=540]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-540 ==> 0-63 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.241 = GTGAAGGCACATTAGC-1

using 204 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[200]
surviving nonsolo ucounts = 1[200]
ids = [0]

====================================================================================

UMI info for barcode GTGAAGGCACATTAGC-1 contig 1 = GGCTTTCTGA...
umi CCTTTTCAAT = 188 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=559]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
403-451 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
451-559 ==> 0-108 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 16 reads
cdr3 = CARAHGDYYTLLDYW at 375, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 15, 36, 80, 166, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.243 = GTGAAGGCACGCATCG-1

using 324 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 315]
surviving nonsolo ucounts = 1[315]
ids = [3]

====================================================================================

UMI info for barcode GTGAAGGCACGCATCG-1 contig 1 = GATCAGGACT...
umi CCGCGTCCTT = 316 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.245 = GTGAAGGCACTATCTT-1

using 193 reads

====================================================================================

graph has 78 edges initially, 16 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[33, 157]
surviving nonsolo ucounts = 2[33, 157]
ids = [2, 0]

====================================================================================

UMI info for barcode GTGAAGGCACTATCTT-1 contig 1 = GCTGGGGTCT...
umi ACCCAAGGTG = 155 reads: +388 validated
umi ATATGGGGTC = 10 reads: -24 +2 -1XX +6 -1XX +4 -2XX +24 -2XX +5 -1XX +5 -2XX +4 -1X +9 -1X +1 -1X +2 -1X +1 -112X +1 -2XX +2 -2XX +15 -1XX +1 -2XX +2 -1XX +1 -1XX +2 -1XX +22 -1XX +1 -1XX +1 -1XX +9 -1XX +5 -1XX +12 -45X +1 -2X +1 -3X +3 -1X +31 invalidated

GOOD CONTIGS

TIG 1[bases=522]
41-394 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=13)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-522 ==> 0-93 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CSSYTTSSTLVF at 365, score = 8 + 9
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 164
start codons at 41, 180, 198, 242, 249, 252
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.247 = GTGAAGGCAGAAGCAC-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.250 = GTGAAGGCAGATCCAT-1

using 658 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[216, 439]
surviving nonsolo ucounts = 2[216, 439]
ids = [1, 0]

====================================================================================

UMI info for barcode GTGAAGGCAGATCCAT-1 contig 1 = GGTCTGCTTC...
umi CGAGTATCTT = 440 reads: +394 validated
umi GTACATTCAT = 217 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
445-656 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 102 reads
cdr3 = CQSYDSSLSGSRVF at 375, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 649
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.258 = GTGAAGGCAGTCAGAG-1

using 326 reads

====================================================================================

graph has 155 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 6, 309]
surviving nonsolo ucounts = 1[309]
ids = [1]

====================================================================================

UMI info for barcode GTGAAGGCAGTCAGAG-1 contig 1 = GAATCAGTCC...
umi CCGTAAGTCG = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.270 = GTGAAGGCATGAGCGA-1

using 208 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 199]
surviving nonsolo ucounts = 1[199]
ids = [1]

====================================================================================

UMI info for barcode GTGAAGGCATGAGCGA-1 contig 1 = TGAGCGCAGA...
umi AGGCGCCTCT = 189 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-537 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.274 = GTGAAGGGTAACGTTC-1

using 12 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.278 = GTGAAGGGTACGCTGC-1

using 417 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 165, 243]
surviving nonsolo ucounts = 2[165, 243]
ids = [1, 3]

====================================================================================

UMI info for barcode GTGAAGGGTACGCTGC-1 contig 1 = ACCCAAAAAC...
umi CTAATGTCTT = 167 reads: +436 validated
umi GCACTTTCTT = 246 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=650]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-650 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 39 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 405
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.280 = GTGAAGGGTAGCGCAA-1

using 162 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 150]
surviving nonsolo ucounts = 1[150]
ids = [4]

====================================================================================

UMI info for barcode GTGAAGGGTAGCGCAA-1 contig 1 = AGTGCTTTCT...
umi CTCGTGTGTC = 148 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=491]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-491 ==> 0-38 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.287 = GTGAAGGGTCAAAGAT-1

using 615 reads

====================================================================================

graph has 238 edges initially, 6 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[242, 372]
surviving nonsolo ucounts = 2[242, 372]
ids = [1, 0]

====================================================================================

UMI info for barcode GTGAAGGGTCAAAGAT-1 contig 1 = GAGGAATCAG...
umi CAAACAGACG = 220 reads: +388 validated

UMI info for barcode GTGAAGGGTCAAAGAT-1 contig 2 = GATCAGGACT...
umi AGTTTTGCCC = 331 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=484]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-484 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=501]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-501 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.293 = GTGAAGGGTCCTGCTT-1

using 392 reads

====================================================================================

graph has 106 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[163, 227]
surviving nonsolo ucounts = 2[163, 227]
ids = [3, 2]

====================================================================================

UMI info for barcode GTGAAGGGTCCTGCTT-1 contig 1 = GAGGAATCAG...
umi TACTACTCTC = 229 reads: +388 validated

UMI info for barcode GTGAAGGGTCCTGCTT-1 contig 2 = GAGGAACTGC...
umi TTATTTAGGC = 166 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=551]
0-33 ==> 64-97 on |291|IGKV3D-20|5'UTR| [len=97] (mis=0)
33-381 ==> 0-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=5)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYGSLPAF at 357, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 162
start codons at 33, 241, 244, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.297 = GTGAAGGGTCTCAACA-1

using 292 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 4^2, 6, 269]
surviving nonsolo ucounts = 1[269]
ids = [9]

====================================================================================

UMI info for barcode GTGAAGGGTCTCAACA-1 contig 1 = AAAAACCACA...
umi TTTTTTTAGC = 257 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=525]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-525 ==> 0-39 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.298 = GTGAAGGGTCTCACCT-1

using 244 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [5]

====================================================================================

UMI info for barcode GTGAAGGGTCTCACCT-1 contig 1 = CTCTCTCAGT...
umi TCTCGTAAAG = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-21 ==> 10-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=2)
371-409 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
409-477 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQKYNSAPFTF at 348, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 21, 27, 83, 96, 232, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.299 = GTGAAGGGTCTGATCA-1

using 7970 reads

====================================================================================

graph has 4042 edges initially, 34 edges after simplification

total ucounts = 603
nonsolo ucounts = 274[2^97, 3^54, 4^36, 5^31, 6^9, 7^6, 8, 9^6, 11^3, 12, 13^3, 15, 16, 67, 86, 116, 133, 135, 149, 176, 194, 205, 207, 239, 269, 294, 302, 316, 333, 338, 348, 350, 351, 393, 395, 398, 445, 474]
surviving nonsolo ucounts = 22[67, 116, 149, 176, 194, 205, 207, 239, 269, 294, 302, 316, 333, 338, 348, 350, 351, 393, 395, 398, 445, 474]
ids = [257, 212, 81, 238, 261, 141, 111, 90, 217, 318, ...]

====================================================================================

UMI info for barcode GTGAAGGGTCTGATCA-1 contig 1 = AGGAGTCAGA...
umi AAAACGGCTG = 472 reads: -89X +296 invalidated
umi AACCATATGG = 452 reads: +385 validated
umi ACTAGTGGAG = 148 reads: +385 validated
umi AGGCTCTTTT = 346 reads: +385 validated
umi ATCGCTTGTC = 208 reads: +385 validated
umi CAGGAGTAGG = 393 reads: +385 validated
umi CCCTTTTCAG = 171 reads: +385 validated
umi CCTTTTTCAG = 66 reads: +381 -1X +3 invalidated
umi CTTCACACGA = 296 reads: +385 validated
umi GAAACAAGCT = 402 reads: +385 validated
umi GTTTTAAGGG = 352 reads: +385 validated
umi TTACTCGCTG = 390 reads: +385 validated

UMI info for barcode GTGAAGGGTCTGATCA-1 contig 2 = AGAGAGGTGC...
umi ACTTTTTCTC = 211 reads: +412 validated
umi AGGGTATCCA = 182 reads: +412 validated
umi CATTCGGCTA = 120 reads: +270 -2X +2 -4X +1 -1X +5 -4X +1 -96X +1 -5X +2 -3XX +5 -1XX +9 invalidated
umi CATTTGTCCC = 347 reads: +412 validated
umi CCAACTTCAA = 234 reads: +412 validated
umi CGCAAAGCGC = 194 reads: +412 validated
umi CTAGCCGCCT = 293 reads: +412 validated
umi TAGATTTATG = 315 reads: +412 validated
umi TGCACCCGGT = 315 reads: +172 -1XX +239 invalidated
umi TGCGCTGGGG = 334 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 599 reads
cdr3 = CQQYYSYPSLTF at 354, score = 9 + 9
umis assigned: [1, 18, 81, 109, 141, 198, 238, 257, 318, 335] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3638
start codons at 33, 89, 102, 238, 460
confident = true

TIG 2[bases=586]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=1)
428-444 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=3)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
484-586 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 8 umis using 208 reads
cdr3 = CARGKTYGDYDYW at 414, score = 9 + 7
umis assigned: [90, 111, 212, 215, 217, 261, 286, 430, 500, 506]
of which 10 are surviving nonsolos
reads assigned: 2489
start codons at 72, 223, 228, 375, 502, 563
confident = true
now this is a cell
paired!

CTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGGGAAGACCTACGGTGACTACGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTTCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.302 = GTGAAGGGTGACGGTA-1

using 205 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2, 3, 4^3, 6^2, 9, 13, 149]
surviving nonsolo ucounts = 1[149]
ids = [9]

====================================================================================

UMI info for barcode GTGAAGGGTGACGGTA-1 contig 1 = GGGAGGAACT...
umi GCCGGGACCA = 135 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
423-478 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNNWPPLYTF at 356, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 35, 84, 104, 240, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.306 = GTGAAGGGTGGAAAGA-1

using 656 reads

====================================================================================

graph has 196 edges initially, 20 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 284, 366]
surviving nonsolo ucounts = 2[284, 366]
ids = [3, 6]

====================================================================================

UMI info for barcode GTGAAGGGTGGAAAGA-1 contig 1 = TGGGGAGGAA...
umi TTTATGGTCA = 374 reads: +147 -1XX +237 invalidated

UMI info for barcode GTGAAGGGTGGAAAGA-1 contig 2 = TGGGGAGGAA...
umi GCCGGTTTGG = 282 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=558]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQFDNWPPLTF at 358, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 358
start codons at 37, 106, 464
confident = false

TIG 2[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNWPWTF at 358, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.308 = GTGAAGGGTGTCAATC-1

using 256 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 251]
surviving nonsolo ucounts = 1[251]
ids = [1]

====================================================================================

UMI info for barcode GTGAAGGGTGTCAATC-1 contig 1 = AGCTTCAGCT...
umi AAGGGTTGCA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-564 ==> 0-129 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.315 = GTGAAGGGTTCTCATT-1

using 256 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 252]
surviving nonsolo ucounts = 1[252]
ids = [2]

====================================================================================

UMI info for barcode GTGAAGGGTTCTCATT-1 contig 1 = GACTGATCAG...
umi TAACTTCAAA = 243 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=525]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
394-431 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
431-525 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQTPLTF at 370, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 34, 67, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.318 = GTGAAGGTCAAGAAGT-1

using 207 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.321 = GTGAAGGTCACCAGGC-1

using 377 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 370]
surviving nonsolo ucounts = 1[370]
ids = [2]

====================================================================================

UMI info for barcode GTGAAGGTCACCAGGC-1 contig 1 = AGCTCTGGGA...
umi ATCAGGGATA = 372 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CTTEGVVVASFDYW at 428, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 80, 236, 303, 360, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.322 = GTGAAGGTCACCGTAA-1

using 355 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 7, 10, 330]
surviving nonsolo ucounts = 1[330]
ids = [3]

====================================================================================

UMI info for barcode GTGAAGGTCACCGTAA-1 contig 1 = GCTGCGGGTA...
umi CCCCTGCGGT = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=586]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=3)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-586 ==> 0-158 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CAAWDDSLSGPVF at 361, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 319
start codons at 40, 191, 248, 251, 344, 369, 374
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.324 = GTGAAGGTCATAGCAC-1

using 326 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 318]
surviving nonsolo ucounts = 1[318]
ids = [4]

====================================================================================

UMI info for barcode GTGAAGGTCATAGCAC-1 contig 1 = GCTCTGCTTC...
umi CGCCCTTCCC = 323 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQSYDSSLSGVVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.330 = GTGAAGGTCCGCAAGC-1

using 276 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode GTGAAGGTCCGCAAGC-1 contig 1 = AGCTCTGAGA...
umi AATGAATCTG = 253 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=516]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=12)
438-469 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=8)
465-515 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 15 reads
cdr3 = CAKTGGGDCDSSGYYCAFDIW at 421, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 79, 230, 235, 382, 496
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.332 = GTGAAGGTCCGCATCT-1

using 381 reads

====================================================================================

graph has 126 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 172, 204]
surviving nonsolo ucounts = 2[172, 204]
ids = [1, 4]

====================================================================================

UMI info for barcode GTGAAGGTCCGCATCT-1 contig 1 = AGGAATCAGA...
umi TAGAGGGCTG = 202 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.333 = GTGAAGGTCCGTTGTC-1

using 336 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 332]
surviving nonsolo ucounts = 1[332]
ids = [2]

====================================================================================

UMI info for barcode GTGAAGGTCCGTTGTC-1 contig 1 = GGAATCAGTC...
umi ATGTGCTCAA = 312 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=513]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-513 ==> 0-99 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.338 = GTGAAGGTCGGAAATA-1

using 53 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 49]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.344 = GTGAAGGTCTCTGAGA-1

using 209 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 6, 193]
surviving nonsolo ucounts = 1[193]
ids = [2]

====================================================================================

UMI info for barcode GTGAAGGTCTCTGAGA-1 contig 1 = GATCAGGACT...
umi GCGTCTGGAT = 182 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=509]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-509 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.352 = GTGAAGGTCTTTCCTC-1

using 333 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 4[3^2, 7, 310]
surviving nonsolo ucounts = 1[310]
ids = [12]

====================================================================================

UMI info for barcode GTGAAGGTCTTTCCTC-1 contig 1 = AGGAGTCAGA...
umi TTCCGCTCCT = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYNSYPWGF at 354, score = 8 + 7
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.356 = GTGCAGCAGAAGGGTA-1

using 896 reads

====================================================================================

graph has 326 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[180, 267, 446]
surviving nonsolo ucounts = 3[180, 267, 446]
ids = [1, 5, 4]

====================================================================================

UMI info for barcode GTGCAGCAGAAGGGTA-1 contig 1 = ACCCAAAAAC...
umi AACTACACCG = 176 reads: +436 validated
umi TATGCGCGCG = 260 reads: +436 validated

UMI info for barcode GTGCAGCAGAAGGGTA-1 contig 2 = GGAATCAGTC...
umi CGCATTGGAT = 448 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-558 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 47 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 427
start codons at 54, 252, 257, 274, 318, 351, 544
confident = true

TIG 2[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 439
start codons at 26, 32, 101, 237, 456
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.361 = GTGCAGCAGACAGACC-1

using 360 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[358]
surviving nonsolo ucounts = 1[358]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCAGACAGACC-1 contig 1 = AGGAGTCAGA...
umi TGCTAGCCGT = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=16)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQDYNFPFTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 27, 33, 89, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.366 = GTGCAGCAGAGTACCG-1

using 395 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[395]
surviving nonsolo ucounts = 1[395]
ids = [0]

====================================================================================

UMI info for barcode GTGCAGCAGAGTACCG-1 contig 1 = GAGGAACTGC...
umi CTATCTGCTC = 349 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
418-504 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYNNWPPFTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.367 = GTGCAGCAGATATGCA-1

using 320 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCAGATATGCA-1 contig 1 = AGACTCAGTC...
umi CTTGCTCAAA = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=18)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQKYNSYALSF at 347, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 20, 26, 82, 95, 231, 234, 327, 366, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.377 = GTGCAGCAGGACAGAA-1

using 102 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 93]
surviving nonsolo ucounts = 1[93]
ids = [2]

====================================================================================

UMI info for barcode GTGCAGCAGGACAGAA-1 contig 1 = GGAACTGCTC...
umi CAATTTGTGG = 83 reads: +383 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=416]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQRSNWPPLTF at 352, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 31, 236, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.391 = GTGCAGCAGTCTCAAC-1

using 231 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 1[222]
surviving nonsolo ucounts = 1[222]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCAGTCTCAAC-1 contig 1 = GCTCTGCTTC...
umi ACACCGGGAC = 205 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
442-564 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSFDRSLSGWVF at 375, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 51, 205, 208, 259, 358
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.392 = GTGCAGCAGTGGGCTA-1

using 83 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 10, 68]
surviving nonsolo ucounts = 1[68]
ids = [2]

====================================================================================

UMI info for barcode GTGCAGCAGTGGGCTA-1 contig 1 = GAGTGCTTTC...
umi TAGTACGGTC = 68 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=529]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-529 ==> 0-60 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 7 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 66
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_85.392_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.393 = GTGCAGCAGTGGGTTG-1

using 153 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [5]

====================================================================================

UMI info for barcode GTGCAGCAGTGGGTTG-1 contig 1 = ACCCAAAAAC...
umi TGGTATTGCT = 138 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=556]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-556 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.400 = GTGCAGCCAAAGCAAT-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.420 = GTGCAGCCACCTGGTG-1

using 20026 reads

====================================================================================

graph has 7075 edges initially, 56 edges after simplification

total ucounts = 761
nonsolo ucounts = 311[2^114, 3^56, 4^21, 5^22, 6^8, 7^9, 8^2, 9^4, 10^2, 11^4, 12, 13, 22, 31, 59, 72, 87, 116, 147, 149, 154, 163, 189, 197, 200, 214, 229, 239, 252^2, 256^2, 259, 260, 264, 265, 266, 273, 277, 280, 282, 284, 285^2, 289, 291, 297^2, 303, 306^2, 308^2, 314, 316, 318, 319, 321, 324, 328, 329, 334, 337, 347, 348, 351, 353, 365, 377, 379, 383, 390, 394^2, 398, 417, 424, 445, 460]
surviving nonsolo ucounts = 61[116, 147, 149, 154, 163, 189, 197, 200, 214, 229, 239, 252, 256^2, 259, 260, 264, 265, 266, 273, 277, 280, 282, 284, 285^2, 289, 291, 297^2, 303, 306^2, 308^2, 314, 316, 318, 319, 321, 324, 328, 329, 334, 337, 347, 348, 351, 353, 365, 377, 379, 383, 390, 394^2, 398, 417, 424, 445, 460]
ids = [337, 727, 162, 717, 153, 252, 85, 285, 0, 581, ...]

====================================================================================

UMI info for barcode GTGCAGCCACCTGGTG-1 contig 1 = TGGGGGATCA...
umi AAACGGTCTG = 215 reads: +400 validated
umi AACAGGGTTA = 265 reads: +400 validated
umi ACACTCTTAC = 326 reads: +400 validated
umi ACGATTCGGG = 261 reads: +400 validated
umi ACGCCATGTA = 385 reads: +400 validated
umi AGCTCCCAAC = 436 reads: +400 validated
umi AGTACAACGA = 301 reads: +400 validated
umi ATAAGCATTG = 309 reads: +400 validated
umi ATCAAGCGAT = 383 reads: +400 validated
umi ATCTACCGCT = 258 reads: +400 validated
umi ATCTATCAGC = 156 reads: +400 validated
umi ATGCTCGACC = 149 reads: +400 validated
umi CACAGTGTCG = 397 reads: +400 validated
umi CCCGGTGCAT = 400 reads: +400 validated
umi CCTACTTCCG = 194 reads: +400 validated
umi CGAGTAACGG = 330 reads: +95 -1XX +304 invalidated
umi CGATTCGGCG = 300 reads: +400 validated
umi CGTACTGTTC = 200 reads: +400 validated
umi CTACAAACCC = 275 reads: +400 validated
umi CTCGACCTCC = 311 reads: +400 validated
umi CTGAACCAGC = 319 reads: +400 validated
umi CTGTACCGAC = 317 reads: +400 validated
umi CTTATAGGCA = 308 reads: +400 validated
umi GAGGGTTTAT = 331 reads: +400 validated
umi GCCTAGTCGA = 289 reads: +400 validated
umi GCCTTAGCCG = 322 reads: +400 validated
umi GCTCACTCGG = 353 reads: +400 validated
umi GCTTCTCCAA = 338 reads: +400 validated
umi GGAACTTTCT = 261 reads: +400 validated
umi GGACTGGGTT = 281 reads: +400 validated
umi GGCTGCGATG = 277 reads: +400 validated
umi GGTTGGCCGT = 257 reads: +400 validated
umi GTATATAACC = 298 reads: +400 validated
umi GTCCACGTGG = 379 reads: +400 validated
umi GTGCCTTTTT = 276 reads: +400 validated
umi GTGGGAGCAT = 292 reads: +400 validated
umi GTTCCTTCAA = 382 reads: +400 validated
umi TATACTCATT = 230 reads: +400 validated
umi TCCATGTATC = 290 reads: +400 validated
umi TCCCTTGGGC = 285 reads: +400 validated
umi TCGATTTCCA = 244 reads: +400 validated
umi TCTTATCGAG = 396 reads: +400 validated
umi TGGATTCATA = 256 reads: +400 validated
umi TGGCGCGCCG = 354 reads: +400 validated
umi TGTTCGCTAA = 452 reads: -301X +1 -2XX +96 invalidated
umi TTATGATCAG = 153 reads: +400 validated
umi TTATTTGTCC = 447 reads: +400 validated
umi TTCCTAGGTT = 146 reads: +400 validated
umi TTTACAGCTA = 346 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=571]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=8)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 1966 reads
cdr3 = CMQAVQTPPRTF at 371, score = 9 + 8
umis assigned: [0, 7, 53, 70, 71, 114, 127, 140, 147, 152] and 39 others
of which 49 are surviving nonsolos
reads assigned: 14439
start codons at 35, 68, 104, 192, 354, 374, 477
confident = true

REJECT CONTIGS

TIG 1[bases=570]
0-79 ==> 0-79 on |156|IGHV3-7|5'UTR| [len=79] (mis=0)
0-79 ==> 5921-6000 on rc of segment after IGHV3-7 exon 1 [len=6000] (mis=0)
47-118 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=4)
79-362 ==> 0-283 on |157|IGHV3-7|L-REGION+V-REGION| [len=351] (mis=12)
389-408 ==> 47-66 on segment before IGFBP7-AS1 exon 1 [len=6000] (mis=0)
451-499 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
499-570 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CMRNRLETDCCLDYW at 423, score = 4 + 6
umis assigned: [91, 323, 610]
of which 2 are surviving nonsolos
reads assigned: 753
start codons at 79, 132, 235, 296, 314, 374, 382, 426
confident = false
frameshifted full length stopped transcript of length 570
VJ delta = 4
not full
not full

TIG 2[bases=557]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=1)
20-83 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
31-164 ==> 0-133 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
169-387 ==> 133-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=20) [SHIFT!]
393-421 ==> 10-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQCDILPPE at 363, score = 9 + 6
umis assigned: [33, 75, 85, 164, 223, 269, 274, 337, 639, 709]
of which 10 are surviving nonsolos
reads assigned: 2837
start codons at 31, 37, 93, 346, 463
confident = false
not full
frameshifted full length stopped transcript of length 557
VJ delta = 9
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.422 = GTGCAGCCACGCGAAA-1

using 293 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 87, 200]
surviving nonsolo ucounts = 2[87, 200]
ids = [2, 3]

====================================================================================

UMI info for barcode GTGCAGCCACGCGAAA-1 contig 1 = GGGGTCACAA...
umi ATGGTTAGAG = 79 reads: +385 validated
umi CATATGGGAC = 183 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=584]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-584 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 2 umis using 54 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 257
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.435 = GTGCAGCCAGGAACGT-1

using 988 reads

====================================================================================

graph has 444 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[202, 259, 525]
surviving nonsolo ucounts = 3[202, 259, 525]
ids = [3, 1, 4]

====================================================================================

UMI info for barcode GTGCAGCCAGGAACGT-1 contig 1 = GAGTGCTTTC...
umi GCTGTCCATA = 246 reads: +436 validated

UMI info for barcode GTGCAGCCAGGAACGT-1 contig 2 = TCTCCCTCAC...
umi TTCGCTACTC = 503 reads: +427 validated

UMI info for barcode GTGCAGCCAGGAACGT-1 contig 3 = AGCTTCAGCT...
umi TGCTTTCACC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-554 ==> 0-100 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 18, 39, 83
confident = false

TIG 2[bases=532]
0-55 ==> 4-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
55-408 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
482-532 ==> 0-50 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARGGGFTVVTPSDFDYW at 397, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 492
start codons at 55, 229, 253, 388, 500
confident = false

TIG 3[bases=539]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-539 ==> 0-104 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.437 = GTGCAGCCATAAGACA-1

using 616 reads

====================================================================================

graph has 256 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 118, 195, 299]
surviving nonsolo ucounts = 3[118, 195, 299]
ids = [0, 5, 4]

====================================================================================

UMI info for barcode GTGCAGCCATAAGACA-1 contig 1 = TGGGGAGGAA...
umi TATATCTCCT = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=561]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRNNWPRALTF at 358, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 37, 242, 245, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.439 = GTGCAGCCATCGATTG-1

using 299 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCCATCGATTG-1 contig 1 = GCTCTGCTTC...
umi TTGAACACGA = 295 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
423-442 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-653 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 51, 205, 259, 358, 385, 406, 574
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.445 = GTGCAGCCATTAGGCT-1

using 344 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[342]
surviving nonsolo ucounts = 1[342]
ids = [2]

====================================================================================

UMI info for barcode GTGCAGCCATTAGGCT-1 contig 1 = GATCACATAA...
umi TTTAATACTC = 303 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=567]
59-410 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
483-567 ==> 0-84 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CARLQVDAPLAHGGDYW at 401, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 59, 257, 420, 537
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.447 = GTGCAGCGTAACGTTC-1

using 252 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode GTGCAGCGTAACGTTC-1 contig 1 = AGTGCTTTCT...
umi CCGTGCGTGA = 239 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=556]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-556 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 17, 38, 82, 168, 255, 522
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.469 = GTGCAGCGTGTGACGA-1

using 54 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^4, 4, 5, 7^2, 8, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.474 = GTGCAGCGTTATCCGA-1

using 811 reads

====================================================================================

graph has 336 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 199, 265, 343]
surviving nonsolo ucounts = 2[199, 343]
ids = [3, 4]

====================================================================================

UMI info for barcode GTGCAGCGTTATCCGA-1 contig 1 = CTGGGGGAAG...
umi CGTATTATTA = 131 reads: +6 -1XX +1 -1XX +1 -2XX +14 -1XX +6 -1XX +7 -2XX +23 -1XX +4 -1XX +5 -1XX +7 -1XX +7 -1XX +4 -1X +2 -85X +19 -1XX +1 -2XX +1 -1XX +1 -1XX +1 -3XX +1 -1XX +20 -1XX +29 -1XX +16 -1XX +10 -1XX +21 -1XX +3 -5XX +1 -1XX +1 -2XX +2 -3XX +3 -1XX +4 -1XX +5 -30 +5 -1XX invalidated
umi GTAACAGAGG = 201 reads: +388 validated
umi GTATGCACTA = 345 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=659]
0-60 ==> 54-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
60-413 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=10)
410-448 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
448-659 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CAAWDDSLNGPLF at 381, score = 8 + 8
umis assigned: [1, 3, 4]
of which 2 are surviving nonsolos
reads assigned: 654
start codons at 60, 364, 389, 394, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.478 = GTGCAGCTCAAAGTAG-1

using 299 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 5, 286]
surviving nonsolo ucounts = 1[286]
ids = [3]

====================================================================================

UMI info for barcode GTGCAGCTCAAAGTAG-1 contig 1 = GGAGTCAGAC...
umi CAATGTATTA = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=500]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-500 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.481 = GTGCAGCTCAACGGGA-1

using 1056 reads

====================================================================================

graph has 1457 edges initially, 34 edges after simplification

total ucounts = 486
nonsolo ucounts = 172[2^81, 3^33, 4^20, 5^11, 6^9, 7^6, 8^3, 9, 10, 12^2, 13^2, 15, 61, 80]
surviving nonsolo ucounts = 1[80]
ids = [36]

====================================================================================

UMI info for barcode GTGCAGCTCAACGGGA-1 contig 1 = CGCCATGGAG...
umi ACGACGTACT = 74 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=471]
4-213 ==> 0-209 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=9)
213-351 ==> 215-353 on |116|IGHV3-20|L-REGION+V-REGION| [len=353] (mis=10)
350-413 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
413-471 ==> 0-58 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARVAYYYYGMDVW at 340, score = 9 + 7
umis assigned: [36]
of which 1 are surviving nonsolos
reads assigned: 72
start codons at 4, 155, 160, 215, 233, 301, 370, 467
confident = false
see deletion of 6 bases at pos 209 on |116|IGHV3-20|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.482 = GTGCAGCTCAAGATCC-1

using 426 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 3, 420]
surviving nonsolo ucounts = 1[420]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCTCAAGATCC-1 contig 1 = GAGTCAGTCT...
umi GCATGACATT = 424 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 86 reads
cdr3 = CQQSYSTPSF at 352, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 415
start codons at 25, 31, 87, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.484 = GTGCAGCTCACCAGGC-1

using 351 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 337]
surviving nonsolo ucounts = 1[337]
ids = [6]

====================================================================================

UMI info for barcode GTGCAGCTCACCAGGC-1 contig 1 = GGAGTCAGAC...
umi GCACACGGGT = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 3-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
26-377 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQDYTYPFSF at 353, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 26, 32, 88, 101, 183, 186, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.486 = GTGCAGCTCACGATGT-1

using 658 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 117, 531]
surviving nonsolo ucounts = 2[117, 531]
ids = [7, 3]

====================================================================================

UMI info for barcode GTGCAGCTCACGATGT-1 contig 1 = GGGGATCAGT...
umi CGGTTAGACC = 551 reads: +388 validated
umi TTAAGTCGTC = 114 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 94 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3, 7]
of which 2 are surviving nonsolos
reads assigned: 636
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.490 = GTGCAGCTCATCACCC-1

using 381 reads

====================================================================================

graph has 137 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 372]
surviving nonsolo ucounts = 1[372]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCTCATCACCC-1 contig 1 = ATCACATAAC...
umi AAAAAGAGTA = 374 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=553]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=0)
415-435 ==> 0-20 on |30|IGHD5-24|D-REGION| [len=20] (mis=3)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARDSMEMATIPFFDYW at 400, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 58, 209, 256, 355, 415, 421
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.503 = GTGCAGCTCGCCTGTT-1

using 56 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 1[54]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=348]
7-27 ==> 5730-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
13-346 ==> 0-333 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=20)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 13, 82, 218, 317
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.510 = GTGCAGCTCTCGATGA-1

using 315 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[13, 300]
surviving nonsolo ucounts = 1[300]
ids = [3]

====================================================================================

UMI info for barcode GTGCAGCTCTCGATGA-1 contig 1 = AGCTTCAGCT...
umi TATTACATGA = 287 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=593]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=25)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
432-593 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CSTWDDSLKVVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 47, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.513 = GTGCAGCTCTGCAGTA-1

using 1536 reads

====================================================================================

graph has 1692 edges initially, 14 edges after simplification

total ucounts = 524
nonsolo ucounts = 210[2^108, 3^47, 4^17, 5^12, 6^12, 7^7, 8^2, 11, 14^2, 161, 400]
surviving nonsolo ucounts = 2[161, 400]
ids = [381, 181]

====================================================================================

UMI info for barcode GTGCAGCTCTGCAGTA-1 contig 1 = GGAACTGCTC...
umi CGAGGTCGTC = 396 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=546]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=3)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQQYNNWWTF at 352, score = 9 + 8
umis assigned: [181]
of which 1 are surviving nonsolos
reads assigned: 392
start codons at 31, 100, 236, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.516 = GTGCAGCTCTGTGCAA-1

using 237 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCTCTGTGCAA-1 contig 1 = GATCAGGACT...
umi CCACCTGGTG = 212 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=481]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=8)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-481 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQAVQTPPRTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.517 = GTGCAGCTCTTCCTTC-1

using 261 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode GTGCAGCTCTTCCTTC-1 contig 1 = GGAGTCAGTC...
umi ATGACCATGG = 231 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-472 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYDNLPLTF at 353, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 26, 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.521 = GTGCATAAGACACGAC-1

using 500 reads

====================================================================================

graph has 194 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 8, 194, 290]
surviving nonsolo ucounts = 2[194, 290]
ids = [8, 3]

====================================================================================

UMI info for barcode GTGCATAAGACACGAC-1 contig 1 = GAGATCACAG...
umi CCACACTGCT = 267 reads: +436 validated
umi TTGCTTGCAC = 181 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=521]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-521 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 59 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [3, 8]
of which 2 are surviving nonsolos
reads assigned: 441
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.523 = GTGCATAAGACCGGAT-1

using 669 reads

====================================================================================

graph has 290 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[5^2, 325, 333]
surviving nonsolo ucounts = 2[325, 333]
ids = [1, 3]

====================================================================================

UMI info for barcode GTGCATAAGACCGGAT-1 contig 1 = ATCAGTCCCA...
umi AGCACAGTAT = 329 reads: +388 validated
umi CTCAGATACA = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 109 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 646
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.526 = GTGCATAAGAGTGAGA-1

using 275 reads

====================================================================================

graph has 88 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 46, 224]
surviving nonsolo ucounts = 2[46, 224]
ids = [1, 2]

====================================================================================

UMI info for barcode GTGCATAAGAGTGAGA-1 contig 1 = GAATCAGTCC...
umi CCTCAGACGC = 203 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.528 = GTGCATAAGATATGCA-1

using 305 reads

====================================================================================

graph has 222 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 16[2^3, 3^2, 4^3, 6, 7^2, 8, 9, 11, 13, 218]
surviving nonsolo ucounts = 1[218]
ids = [17]

====================================================================================

UMI info for barcode GTGCATAAGATATGCA-1 contig 1 = GTCAGTCCCA...
umi TCACTTAGTG = 222 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 217
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.531 = GTGCATAAGATCTGCT-1

using 243 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 5, 229]
surviving nonsolo ucounts = 1[229]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.533 = GTGCATAAGATTACCC-1

using 975 reads

====================================================================================

graph has 1443 edges initially, 4 edges after simplification

total ucounts = 445
nonsolo ucounts = 194[2^84, 3^40, 4^24, 5^17, 6^7, 7^7, 8^3, 9^3, 10^2, 11^4, 12, 17, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.535 = GTGCATAAGCACGCCT-1

using 128 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 123]
surviving nonsolo ucounts = 1[123]
ids = [0]

====================================================================================

UMI info for barcode GTGCATAAGCACGCCT-1 contig 1 = AGGAGTCAGT...
umi CCTACGGATT = 99 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=436]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=29)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
415-436 ==> 0-21 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQSQSTPRTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 99
start codons at 27, 33, 189, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.536 = GTGCATAAGCATGGCA-1

using 1958 reads

====================================================================================

graph has 1172 edges initially, 12 edges after simplification

total ucounts = 234
nonsolo ucounts = 73[2^29, 3^16, 4^9, 5^4, 6^2, 8^4, 9, 10, 14, 19, 234, 243, 308, 355, 399]
surviving nonsolo ucounts = 5[234, 243, 308, 355, 399]
ids = [76, 122, 206, 57, 96]

====================================================================================

UMI info for barcode GTGCATAAGCATGGCA-1 contig 1 = GGGAGAGGAG...
umi CCTTCGCTCC = 397 reads: +403 validated

UMI info for barcode GTGCATAAGCATGGCA-1 contig 2 = GGGGTCACAA...
umi ATTTCACGCG = 350 reads: +391 validated
umi CATTATTAAT = 232 reads: +391 validated
umi CTTGTACCCC = 241 reads: +391 validated
umi TCTATTCTGC = 312 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=547]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=4)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
476-547 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARRNYFDYW at 415, score = 9 + 7
umis assigned: [96]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 73, 224, 229, 287, 290, 308, 376
confident = true

TIG 2[bases=640]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 179 reads
cdr3 = CCSYAGSSTFWVF at 362, score = 8 + 8
umis assigned: [57, 76, 122, 206]
of which 4 are surviving nonsolos
reads assigned: 1118
start codons at 38, 177, 239, 246, 372
confident = true
now this is a cell
paired!

ATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAAGGAACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.537 = GTGCATAAGCCACGTC-1

using 19 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 1[18]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.539 = GTGCATAAGCGTCTAT-1

using 322 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^3, 4, 5, 6^2, 294]
surviving nonsolo ucounts = 1[294]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=401]
7-31 ==> 5788-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
26-92 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
45-192 ==> 0-147 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
190-401 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=10)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 45, 322
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.540 = GTGCATAAGCTTATCG-1

using 173 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 163]
surviving nonsolo ucounts = 1[163]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.542 = GTGCATAAGGAACTGC-1

using 53 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 5, 6, 30]
surviving nonsolo ucounts = 1[30]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.543 = GTGCATAAGGACTGGT-1

using 426 reads

====================================================================================

graph has 156 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[4, 205, 210]
surviving nonsolo ucounts = 2[205, 210]
ids = [1, 6]

====================================================================================

UMI info for barcode GTGCATAAGGACTGGT-1 contig 1 = GGAGGAACTG...
umi AATCCGAGTC = 182 reads: +388 validated

UMI info for barcode GTGCATAAGGACTGGT-1 contig 2 = GGGGTCACAA...
umi TAAGAGACCT = 208 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=511]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
384-422 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
422-511 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQRSTWPPRITF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 34, 239, 242, 464
confident = false

TIG 2[bases=553]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-331 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
429-553 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYAGRTTFDVF at 362, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 205
start codons at 38, 174, 177, 192, 195, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.548 = GTGCATAAGGGTGTTG-1

using 209 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 201]
surviving nonsolo ucounts = 1[201]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.553 = GTGCATAAGTCCTCCT-1

using 295 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 7, 282]
surviving nonsolo ucounts = 1[282]
ids = [1]

====================================================================================

UMI info for barcode GTGCATAAGTCCTCCT-1 contig 1 = GAGCTACAAC...
umi GGTTAATCTT = 264 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-516 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYYSTPYTF at 369, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.559 = GTGCATAAGTTAACGA-1

using 398 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 3^2, 4, 7, 18, 358]
surviving nonsolo ucounts = 1[358]
ids = [7]

====================================================================================

UMI info for barcode GTGCATAAGTTAACGA-1 contig 1 = GAGGAATCAG...
umi TCCGTTCGGC = 355 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.563 = GTGCATACAACACGCC-1

using 100 reads

====================================================================================

graph has 149 edges initially, 4 edges after simplification

total ucounts = 19
nonsolo ucounts = 14[2^4, 4^2, 6, 7, 8, 9^2, 10, 11, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.565 = GTGCATACAATGGACG-1

using 254 reads

====================================================================================

graph has 109 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.566 = GTGCATACAATGGATA-1

using 218 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[5, 6, 206]
surviving nonsolo ucounts = 1[206]
ids = [1]

====================================================================================

UMI info for barcode GTGCATACAATGGATA-1 contig 1 = AGAGCTCTGG...
umi CCGCTTTTCT = 189 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=439]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSPYTF at 368, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 44, 252, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.567 = GTGCATACAATGTTGC-1

using 325 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 315]
surviving nonsolo ucounts = 1[315]
ids = [5]

====================================================================================

UMI info for barcode GTGCATACAATGTTGC-1 contig 1 = GGGGAGGAAC...
umi CGACTACCGG = 317 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNWLTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 36, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.568 = GTGCATACACAGACTT-1

using 449 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[447]
surviving nonsolo ucounts = 1[447]
ids = [1]

====================================================================================

UMI info for barcode GTGCATACACAGACTT-1 contig 1 = GAGAAGAGCT...
umi GGTCACAGGA = 453 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-423 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPPWTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 35, 243, 369, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.572 = GTGCATACACCAGATT-1

using 81 reads

====================================================================================

graph has 82 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2, 3, 4^3, 5^2, 6, 7, 9^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.575 = GTGCATACAGAAGCAC-1

using 401 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 4^2, 6, 377]
surviving nonsolo ucounts = 1[377]
ids = [6]

====================================================================================

UMI info for barcode GTGCATACAGAAGCAC-1 contig 1 = ATCAGGACTC...
umi CTTCCACGCT = 380 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=562]
0-29 ==> 1-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
29-389 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
388-426 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CMQALQTPLTF at 365, score = 9 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 29, 62, 98, 186, 348, 368, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.585 = GTGCATACAGGGTTAG-1

using 215 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode GTGCATACAGGGTTAG-1 contig 1 = AGTCTGGGCC...
umi GATAGAGTCT = 201 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=589]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-589 ==> 0-167 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.587 = GTGCATACATATACCG-1

using 588 reads

====================================================================================

graph has 282 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 576]
surviving nonsolo ucounts = 1[576]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=428]
1-178 ==> 160-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=7)
179-217 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
217-428 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CYSRDSSGNPF at 156, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 560
start codons at 40, 139
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.590 = GTGCATACATCATCCC-1

using 392 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 124, 260]
surviving nonsolo ucounts = 1[260]
ids = [3]

====================================================================================

UMI info for barcode GTGCATACATCATCCC-1 contig 1 = AAGAGGCAGC...
umi CGGACTGCAC = 258 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=576]
0-29 ==> 22-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
29-385 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
420-576 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSYDTSLSGSVF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 29, 183, 186, 237, 336, 363
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.591 = GTGCATACATCCGTGG-1

using 470 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 221, 244]
surviving nonsolo ucounts = 2[221, 244]
ids = [2, 5]

====================================================================================

UMI info for barcode GTGCATACATCCGTGG-1 contig 1 = GCTGGGGTCT...
umi CTCATCCCGG = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-356 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-553 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CTSYAGGSNVVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 41, 249, 348, 375, 390
confident = false

REJECT CONTIGS

TIG 1[bases=525]
8-356 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
351-389 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
389-525 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 8, 216, 342, 431
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.597 = GTGCATAGTAAACACA-1

using 593 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[10, 254, 325]
surviving nonsolo ucounts = 2[254, 325]
ids = [4, 2]

====================================================================================

UMI info for barcode GTGCATAGTAAACACA-1 contig 1 = GAGCATCACC...
umi TCTCAATCTC = 255 reads: +424 validated

UMI info for barcode GTGCATAGTAAACACA-1 contig 2 = GGAGGAACTG...
umi TATTACAGAT = 336 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=557]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
432-486 ==> 7-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARAPAALEHYYYMDVW at 404, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 62, 218, 260, 265, 297, 326, 359, 443
confident = false

TIG 2[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQRSNWPFTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 34, 239, 242, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.598 = GTGCATAGTAAATGTG-1

using 501 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[500]
surviving nonsolo ucounts = 1[500]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.610 = GTGCATAGTCCAGTGC-1

using 335 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [3]

====================================================================================

UMI info for barcode GTGCATAGTCCAGTGC-1 contig 1 = GGGGTCACAA...
umi GCTTCCACAA = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=580]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-580 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CCSYAGSSIVLF at 362, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.611 = GTGCATAGTCCGAACC-1

using 269 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 264]
surviving nonsolo ucounts = 1[264]
ids = [1]

====================================================================================

UMI info for barcode GTGCATAGTCCGAACC-1 contig 1 = GGGGAGGAAT...
umi AGTTAACCGA = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.619 = GTGCATAGTGTGCCTG-1

using 228 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=5)
390-414 ==> 14-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQSIQLSK at 366, score = 8 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 30, 63, 99, 187, 250, 349, 369, 456
confident = false
not full
frameshifted full length transcript of length 550
VJ delta = 21
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.624 = GTGCATAGTTCCCTTG-1

using 85 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 14[2^2, 3, 4^2, 5^2, 6^2, 8^2, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.626 = GTGCATAGTTGATTGC-1

using 286 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [2]

====================================================================================

UMI info for barcode GTGCATAGTTGATTGC-1 contig 1 = GAGGAGTCAG...
umi TTATTGTTCC = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQSYTTLLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.629 = GTGCATAGTTTGCATG-1

using 115 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 5, 100]
surviving nonsolo ucounts = 1[100]
ids = [0]

====================================================================================

UMI info for barcode GTGCATAGTTTGCATG-1 contig 1 = GCAGAGCTCT...
umi CACAGGTTGG = 90 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=552]
24-386 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=8)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
421-552 ==> 0-131 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CETWDSNTQVF at 360, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 90
start codons at 24, 188, 228, 343
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.631 = GTGCATATCAATAAGG-1

using 235 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 9, 219]
surviving nonsolo ucounts = 1[219]
ids = [0]

====================================================================================

UMI info for barcode GTGCATATCAATAAGG-1 contig 1 = GCTCTGCTTC...
umi AGCTCTTCTA = 203 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=506]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
442-506 ==> 0-64 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLSAYVF at 375, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 201
start codons at 51, 205, 208, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.633 = GTGCATATCAGCGATT-1

using 35 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 32]
surviving nonsolo ucounts = 1[32]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=357]
0-300 ==> 51-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
299-337 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
337-357 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDSFSWTF at 276, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 28
start codons at 11, 24, 160, 163, 256, 286
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.634 = GTGCATATCAGCTCTC-1

using 308 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 5, 295]
surviving nonsolo ucounts = 1[295]
ids = [3]

====================================================================================

UMI info for barcode GTGCATATCAGCTCTC-1 contig 1 = GAAGTCTCTC...
umi GCACTCCTCT = 273 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=506]
0-26 ==> 5-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=0)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-506 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQKYNSAPPWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 237, 336, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.635 = GTGCATATCAGGTAAA-1

using 342 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[340]
surviving nonsolo ucounts = 1[340]
ids = [2]

====================================================================================

UMI info for barcode GTGCATATCAGGTAAA-1 contig 1 = GGAGTCAGTC...
umi TTTAAGGAAT = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.640 = GTGCATATCATTGCGA-1

using 505 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^4, 217, 276]
surviving nonsolo ucounts = 2[217, 276]
ids = [9, 4]

====================================================================================

UMI info for barcode GTGCATATCATTGCGA-1 contig 1 = GCAGGAGTCA...
umi GAGTGTGTGC = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-29 ==> 152-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
29-380 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-494 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYDSFSWTF at 356, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 29, 35, 91, 104, 240, 243, 336, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.643 = GTGCATATCCAGAGGA-1

using 15357 reads

====================================================================================

graph has 7010 edges initially, 76 edges after simplification

total ucounts = 1108
nonsolo ucounts = 548[2^199, 3^109, 4^68, 5^49, 6^26, 7^18, 8^8, 9^4, 10^2, 11, 12^7, 13^2, 14^2, 15^2, 18, 19, 21, 29, 34, 48, 49, 57, 68, 95, 99, 101, 159, 177, 193, 196, 202, 209^2, 234, 236, 241, 246, 247, 253, 264, 265, 272^2, 278, 279, 284^2, 288, 289, 292, 295, 296, 302^2, 303, 308, 319, 333, 335, 336, 341, 342, 682, 881, 1092]
surviving nonsolo ucounts = 44[29, 49, 68, 95, 99, 101, 159, 177, 193, 196, 202, 209^2, 234, 236, 241, 246, 247, 253, 264, 265, 272^2, 278, 279, 284^2, 288, 289, 292, 295, 296, 302^2, 303, 319, 333, 335, 336, 341, 342, 682, 881, 1092]
ids = [354, 50, 663, 719, 88, 1082, 308, 172, 497, 340, ...]

====================================================================================

UMI info for barcode GTGCATATCCAGAGGA-1 contig 1 = CTGGGCCTCA...
umi ACTTTAAGGA = 293 reads: +379 validated
umi AGCTCGTGGT = 339 reads: +379 validated
umi ATACCCTTTT = 273 reads: +379 validated
umi ATTATATCTG = 1086 reads: -331X +1 -10XX +1 -1XX +3 -1XX +31 invalidated
umi CAAACCACTA = 297 reads: +379 validated
umi CAGATCCCGG = 334 reads: +379 validated
umi CCCAAACCTT = 303 reads: +379 validated
umi CCCCGACTAT = 284 reads: +379 validated
umi CCTCATTGGC = 249 reads: +379 validated
umi CCTCGGACGC = 283 reads: +379 validated
umi CGGAATTCTT = 684 reads: -344 +3 -1XX +31 invalidated
umi CGGCGGACAG = 208 reads: +379 validated
umi CTCATCCCAC = 265 reads: +379 validated
umi CTGCCGACCG = 265 reads: +379 validated
umi CTGCGGCAAC = 285 reads: +379 validated
umi CTGTGGATTG = 205 reads: +379 validated
umi CTTATCGGCA = 306 reads: +379 validated
umi CTTCTATAGG = 290 reads: +379 validated
umi GACTTTTCTT = 882 reads: -339X +1 -2XX +1 -1XX +3 -1XX +31 invalidated
umi GATCCCTGCC = 10 reads: -10X +1 -2XX +1 -3XX +1 -1XX +1 -2XX +2 -5XX +1 -1XX +2 -3XX +1 -7XX +27 -308 invalidated
umi GCAACTTCTC = 284 reads: +379 validated
umi GTTGCATCCT = 341 reads: +379 validated
umi TAGCGAGAGG = 237 reads: +379 validated
umi TAGTTATAGT = 97 reads: +379 validated
umi TCACGTCGTC = 39 reads: -314 +1 -1X +1 -6X +1 -5XX +4 -3XX +1 -1XX +3 -4XX +2 -1XX +31 invalidated
umi TGCACGGTCG = 279 reads: +379 validated
umi TGCCTTGTCC = 318 reads: +379 validated
umi TGTTAGGGAT = 248 reads: +379 validated
umi TTATCGCGCC = 296 reads: +379 validated
umi TTGGATTTAT = 336 reads: +379 validated
umi TTGTCTTCCA = 207 reads: +379 validated
umi TTTGTACTTC = 271 reads: +379 validated

UMI info for barcode GTGCATATCCAGAGGA-1 contig 2 = GGGAGAGGAG...
umi AGAGCCCGAT = 47 reads: +357 -5 +61 -4 non-validated
umi ATCATCCTTA = 98 reads: +427 validated
umi CAGTGCTATC = 239 reads: +427 validated
umi CGTATGCTAT = 195 reads: +426 -1 non-validated
umi CGTTGGGGGG = 29 reads: -132 +295 non-validated
umi GATCTTGTCG = 192 reads: +427 validated
umi TAATCCCCAC = 69 reads: +30 -2X +1 -5XX +2 -2XX +385 invalidated
umi TGTTTTCATC = 233 reads: +427 validated
umi TTTGAAATAG = 100 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=627]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=4)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 27 umis using 1215 reads
cdr3 = CQAWDSSTALVF at 352, score = 6 + 9
umis assigned: [47, 58, 74, 112, 130, 170, 234, 242, 274, 279] and 22 others
of which 31 are surviving nonsolos
reads assigned: 9957
start codons at 37, 42, 98, 185, 331, 335
confident = true

TIG 2[bases=682]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=2)
437-500 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=6)
500-682 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 104 reads
cdr3 = CARVSYTFLGHYYYYMDVW at 412, score = 9 + 6
umis assigned: [50, 88, 181, 340, 354, 497, 663, 970, 1082]
of which 9 are surviving nonsolos
reads assigned: 1185
start codons at 73, 229, 373, 457
confident = true
now this is a cell
paired!

GCCGTCTATTACTGTGCGAGAGTAAGCTACACCTTCCTGGGCCACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCATCGTCTCCTCAG <==> AGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCATTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.644 = GTGCATATCCAGTAGT-1

using 367 reads

====================================================================================

graph has 172 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[85, 278]
surviving nonsolo ucounts = 2[85, 278]
ids = [2, 5]

====================================================================================

UMI info for barcode GTGCATATCCAGTAGT-1 contig 1 = GGAGGAACTG...
umi TTCAATTACT = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
384-422 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
422-506 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNNWPPRETF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 34, 103, 239, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.649 = GTGCATATCCGCGTTT-1

using 316 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[311]
surviving nonsolo ucounts = 1[311]
ids = [2]

====================================================================================

UMI info for barcode GTGCATATCCGCGTTT-1 contig 1 = GAGAAGAGCT...
umi TAAAACACAG = 313 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-372 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDRSWTF at 359, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 35, 369, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.650 = GTGCATATCCGTTGTC-1

using 261 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 253]
surviving nonsolo ucounts = 1[253]
ids = [2]

====================================================================================

UMI info for barcode GTGCATATCCGTTGTC-1 contig 1 = TCTGCTTCAG...
umi AGCGCGCCGA = 247 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=569]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-569 ==> 0-126 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 49, 203, 206, 257, 356, 383, 407
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.651 = GTGCATATCCTTGGTC-1

using 873 reads

====================================================================================

graph has 1270 edges initially, 10 edges after simplification

total ucounts = 420
nonsolo ucounts = 198[2^88, 3^44, 4^31, 5^19, 6^4, 7^4, 8^3, 9^4, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.654 = GTGCATATCGGAAACG-1

using 190 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 184]
surviving nonsolo ucounts = 1[184]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.663 = GTGCATATCTGCAGTA-1

using 15778 reads

====================================================================================

graph has 6614 edges initially, 56 edges after simplification

total ucounts = 697
nonsolo ucounts = 329[2^106, 3^64, 4^28, 5^30, 6^24, 7^12, 8^4, 9^2, 10, 11, 13, 16^3, 19, 23, 31, 50, 126, 134, 147, 152, 180, 183, 216, 220, 221, 223, 232, 241, 247, 255^2, 267, 268^2, 271, 272, 274, 277^2, 278, 279, 283, 290, 291, 292, 294, 297, 298, 310, 312, 317, 319, 328, 331, 346, 365, 368, 377^2, 395, 414, 424, 444, 447, 578]
surviving nonsolo ucounts = 50[50, 126, 134, 147, 152, 180, 183, 216, 220, 221, 223, 232, 241, 247, 255^2, 267, 268^2, 271, 272, 274, 277^2, 278, 279, 283, 290, 291, 292, 294, 297, 298, 310, 312, 317, 319, 328, 331, 346, 365, 368, 377^2, 395, 414, 424, 444, 447, 578]
ids = [83, 643, 691, 548, 185, 581, 584, 240, 624, 291, ...]

====================================================================================

UMI info for barcode GTGCATATCTGCAGTA-1 contig 1 = GTATGGGGAG...
umi AAACTATCTC = 222 reads: +388 validated
umi AGGTGCCAAC = 464 reads: +56 -1XX +1 -1XX +4 -5XX +4 -20XX +1 -3XX +2 -12XX +278 invalidated
umi ATAAGAGGAC = 299 reads: +388 validated
umi CCACTTCTCT = 215 reads: +388 validated
umi CCCGTTCGCT = 304 reads: +388 validated
umi CGCGTTGCCT = 262 reads: +388 validated
umi CGTATCCAAG = 287 reads: +388 validated
umi CTATTAGTTG = 280 reads: +388 validated
umi GACCACACAG = 271 reads: +388 validated
umi GCGACATTGC = 443 reads: +388 validated
umi GCTCCCGGCT = 328 reads: +388 validated
umi GGGTCACATC = 251 reads: +388 validated
umi GGTTCATTAC = 327 reads: +388 validated
umi TAGAAATTGG = 298 reads: +388 validated
umi TCCGTCGCCC = 180 reads: +388 validated
umi TGTACCAACT = 360 reads: +388 validated
umi TTCGTCCCTC = 268 reads: +388 validated
umi TTTTGCATAC = 265 reads: +388 validated

UMI info for barcode GTGCATATCTGCAGTA-1 contig 2 = ATCATCCAAC...
umi AATGGTTTAA = 274 reads: +424 validated
umi ACAAAAGTCG = 279 reads: +424 validated
umi ACTCGTGGGA = 46 reads: +273 -23 +73 -2 +53 non-validated
umi CAATAGTCCC = 157 reads: +424 validated
umi CCGGCCCGCC = 301 reads: +424 validated
umi CTAAGGGCGC = 454 reads: -358X +1 -6XX +1 -6XX +1 -11XX +40 invalidated
umi CTCATTAATG = 283 reads: +424 validated
umi CTTCATGTAA = 238 reads: +424 validated
umi GATAATGCGC = 236 reads: +419 -5 non-validated
umi GTCCGCAAGC = 364 reads: +424 validated
umi GTGCCTCCAG = 310 reads: +424 validated
umi TAGATAACCT = 375 reads: +424 validated
umi TAGGGCCCCA = 292 reads: +424 validated
umi TCATCGCTCA = 363 reads: +424 validated
umi TCGCTCCCGC = 228 reads: +424 validated
umi TGCTGTTAGT = 196 reads: +424 validated
umi TTAAAGTGCG = 123 reads: +424 validated
umi TTTTCCCGGA = 375 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=559]
35-388 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 18 umis using 832 reads
cdr3 = CQQSYSTPPTF at 362, score = 9 + 8
umis assigned: [6, 114, 124, 240, 259, 312, 327, 345, 384, 417] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5235
start codons at 2, 35, 41, 97, 110, 246, 465
confident = true

TIG 2[bases=553]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=12)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 343 reads
cdr3 = CARATIAAAGQRSFDYW at 400, score = 9 + 7
umis assigned: [46, 48, 83, 185, 274, 336, 349, 364, 397, 480] and 8 others
of which 18 are surviving nonsolos
reads assigned: 4807
start codons at 58, 214, 256, 322, 355
confident = true

REJECT CONTIGS

TIG 1[bases=565]
0-81 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=6)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [194, 208, 298]
of which 3 are surviving nonsolos
reads assigned: 873
start codons at 34, 67, 95, 103, 191, 353, 373, 471
confident = false
did not find CDR3

TIG 2[bases=635]
3-47 ==> 5926-5970 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
41-386 ==> 0-345 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [47, 291, 333, 374, 426, 448, 498, 520, 548, 584] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2833
start codons at 42, 198, 242, 249, 252, 348, 373
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCTAGGGCAACTATAGCAGCAGCTGGTCAGAGGTCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTCCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCCCACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.666 = GTGCATATCTTGAGAC-1

using 904 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[899]
surviving nonsolo ucounts = 1[899]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.669 = GTGCGGTAGAACTGTA-1

using 916 reads

====================================================================================

graph has 444 edges initially, 30 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2^5, 4, 265, 625]
surviving nonsolo ucounts = 2[265, 625]
ids = [2, 15]

====================================================================================

UMI info for barcode GTGCGGTAGAACTGTA-1 contig 1 = GAGTCAGACC...
umi ATTACCTCGG = 267 reads: +385 validated

UMI info for barcode GTGCGGTAGAACTGTA-1 contig 2 = GGGAGTCAGT...
umi TCGACCGCTT = 629 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-366 ==> 0-341 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CHQYNRGWTF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 25, 31, 100, 332, 452
confident = false

TIG 2[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=14)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 103 reads
cdr3 = CQQTYSTPLTF at 354, score = 9 + 9
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 616
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.676 = GTGCGGTAGATAGCAT-1

using 749 reads

====================================================================================

graph has 238 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 13[2^3, 3^3, 4, 5, 6, 8^2, 9, 689]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.679 = GTGCGGTAGCAGCGTA-1

using 432 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 4, 150, 270]
surviving nonsolo ucounts = 2[150, 270]
ids = [3, 4]

====================================================================================

UMI info for barcode GTGCGGTAGCAGCGTA-1 contig 1 = GAAGAGCTGC...
umi CCTCCATGCC = 270 reads: +388 validated

UMI info for barcode GTGCGGTAGCAGCGTA-1 contig 2 = AGCCTGGGCC...
umi CCAACTCTGG = 133 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 33, 82, 241, 340, 381, 463
confident = false

TIG 2[bases=543]
0-40 ==> 12-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
40-386 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
419-543 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQAWDSSTAVVF at 355, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 40, 45, 101, 188, 334, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.682 = GTGCGGTAGCTAAACA-1

using 318 reads

====================================================================================

graph has 180 edges initially, 8 edges after simplification

total ucounts = 16
nonsolo ucounts = 8[2^4, 4, 7, 53, 238]
surviving nonsolo ucounts = 3[7, 53, 238]
ids = [6, 7, 3]

====================================================================================

UMI info for barcode GTGCGGTAGCTAAACA-1 contig 1 = AGCTTCAGCT...
umi ACCTCGTACC = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-555 ==> 0-120 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.685 = GTGCGGTAGCTCCCAG-1

using 408 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[3, 4, 6^2, 11, 371]
surviving nonsolo ucounts = 1[371]
ids = [11]

====================================================================================

UMI info for barcode GTGCGGTAGCTCCCAG-1 contig 1 = AGTCAGACTC...
umi TCTATAGCTT = 373 reads: +385 validated
umi TTCCGGACCC = 4 reads: -362 +8 -1X +8 -1X +5 invalidated

GOOD CONTIGS

TIG 1[bases=545]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=24)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=6)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CHQYNSYSSF at 351, score = 8 + 6
umis assigned: [11, 12]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 24, 30, 86, 99, 235, 238, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.689 = GTGCGGTAGGACTGGT-1

using 165 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode GTGCGGTAGGACTGGT-1 contig 1 = TCACAAGAGG...
umi CACTACAATC = 156 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=536]
0-34 ==> 128-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
34-374 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
428-536 ==> 0-108 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 24 reads
cdr3 = CCSEAGGGVPGLLF at 358, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 34, 188
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.690 = GTGCGGTAGGCCGAAT-1

using 239 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 5^2, 220]
surviving nonsolo ucounts = 1[220]
ids = [2]

====================================================================================

UMI info for barcode GTGCGGTAGGCCGAAT-1 contig 1 = GCTCTGCTTC...
umi CACTCACGAG = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=589]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-589 ==> 0-144 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.691 = GTGCGGTAGGCTCAGA-1

using 305 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 10[2^4, 3^2, 4^3, 270]
surviving nonsolo ucounts = 1[270]
ids = [10]

====================================================================================

UMI info for barcode GTGCGGTAGGCTCAGA-1 contig 1 = GAGTCAGACT...
umi CTATCGCTTA = 269 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.705 = GTGCGGTCAAAGCGGT-1

using 670 reads

====================================================================================

graph has 436 edges initially, 14 edges after simplification

total ucounts = 145
nonsolo ucounts = 80[2^21, 3^18, 4^8, 5^8, 6^6, 7^8, 8^3, 9^2, 10, 11, 13, 14, 15, 240]
surviving nonsolo ucounts = 1[240]
ids = [24]

====================================================================================

UMI info for barcode GTGCGGTCAAAGCGGT-1 contig 1 = GAGGAACTGC...
umi ATAGTGCCCT = 207 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=468]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQRSNWRCSF at 354, score = 9 + 7
umis assigned: [24]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.706 = GTGCGGTCAAATTGCC-1

using 201 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2^3, 186]
surviving nonsolo ucounts = 1[186]
ids = [3]

====================================================================================

UMI info for barcode GTGCGGTCAAATTGCC-1 contig 1 = TCCAAACAGA...
umi CAGTCAGCGG = 165 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-551 ==> 0-123 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CSAWDSSLNVWVF at 361, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 40, 179, 369, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.707 = GTGCGGTCAACGATCT-1

using 255 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[3^2, 4, 236]
surviving nonsolo ucounts = 1[236]
ids = [4]

====================================================================================

UMI info for barcode GTGCGGTCAACGATCT-1 contig 1 = TGAGAGAGGA...
umi GGTTTACGCG = 239 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=575]
0-74 ==> 5-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
74-427 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=3)
453-504 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
504-575 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CAKRPYRWYQLLRTWFDPW at 416, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 74, 225, 230, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.720 = GTGCGGTCACGACTCG-1

using 386 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 11[2^3, 3, 4^2, 5, 7, 11, 19, 322]
surviving nonsolo ucounts = 1[322]
ids = [5]

====================================================================================

UMI info for barcode GTGCGGTCACGACTCG-1 contig 1 = GAGAAGAGCT...
umi CCGCTGCCGA = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=8)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYGRSPYTF at 359, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 35, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.722 = GTGCGGTCACTTCGAA-1

using 483 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[3^2, 5, 7, 459]
surviving nonsolo ucounts = 1[459]
ids = [4]

====================================================================================

UMI info for barcode GTGCGGTCACTTCGAA-1 contig 1 = ATACTTTCTG...
umi TCCACGCGCA = 353 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=487]
0-37 ==> 35-72 on |181|IGHV4-31|5'UTR| [len=72] (mis=0)
37-393 ==> 0-356 on |182|IGHV4-31|L-REGION+V-REGION| [len=356] (mis=4)
428-479 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 25 reads
cdr3 = CVRAENRAWLRSRSDPGWFDPW at 382, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 37, 81
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.725 = GTGCGGTCAGACACTT-1

using 73 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^3, 3^2, 4, 5, 6, 20, 21]
surviving nonsolo ucounts = 7[2^2, 3, 4, 5, 20, 21]
ids = [7, 13, 1, 9, 3, 5, 14]

====================================================================================

REJECT CONTIGS

TIG 1[bases=405]
0-312 ==> 28-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
329-357 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
357-405 ==> 0-48 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CFSYGTSGRTF at 296, score = 8 + 8
umis assigned: [1, 3, 5, 7, 9, 12, 13, 14]
of which 7 are surviving nonsolos
reads assigned: 49
start codons at 180, 306
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.730 = GTGCGGTCAGCTGTGC-1

using 341 reads

====================================================================================

graph has 180 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 5[2^2, 5, 159, 163]
surviving nonsolo ucounts = 2[159, 163]
ids = [10, 8]

====================================================================================

UMI info for barcode GTGCGGTCAGCTGTGC-1 contig 1 = GCTCTGAGAG...
umi GTCGGTCTGT = 157 reads: +424 validated
umi GTTTAAATCC = 151 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=550]
0-78 ==> 1-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
78-431 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
455-502 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
502-550 ==> 0-48 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CARDRAATARLGGMDVW at 420, score = 9 + 7
umis assigned: [8, 10]
of which 2 are surviving nonsolos
reads assigned: 303
start codons at 78, 229, 234, 381, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.732 = GTGCGGTCAGGCGATA-1

using 114 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[114]
surviving nonsolo ucounts = 1[114]
ids = [0]

====================================================================================

UMI info for barcode GTGCGGTCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi GTAGCAATGG = 97 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=547]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-547 ==> 0-134 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.736 = GTGCGGTCATATGAGA-1

using 179 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 8[2, 3^4, 4, 8, 141]
surviving nonsolo ucounts = 1[141]
ids = [14]

====================================================================================

UMI info for barcode GTGCGGTCATATGAGA-1 contig 1 = TGAGCGCAGA...
umi TCCTTTTACC = 134 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=521]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-521 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.741 = GTGCGGTCATCTCGCT-1

using 6970 reads

====================================================================================

graph has 5203 edges initially, 120 edges after simplification

total ucounts = 1288
nonsolo ucounts = 664[2^248, 3^136, 4^78, 5^61, 6^39, 7^28, 8^17, 9^4, 10^7, 11^11, 12^2, 13^8, 14^3, 15, 16^2, 19, 23, 25, 31, 65, 69, 70, 121, 171, 185, 202, 237, 254, 258, 260, 283, 489, 523, 529]
surviving nonsolo ucounts = 15[31, 65, 70, 121, 171, 185, 202, 237, 254, 258, 260, 283, 489, 523, 529]
ids = [628, 846, 1081, 879, 927, 942, 1203, 517, 327, 191, ...]

====================================================================================

UMI info for barcode GTGCGGTCATCTCGCT-1 contig 1 = GAGCTACAAC...
umi AACAGGAGGG = 411 reads: -369X +2 -1XX +7 -2XX +8 -1XX +10 -1XX +2 invalidated
umi AGTCTCACGT = 262 reads: +403 validated
umi CAGACAACCG = 253 reads: +403 validated
umi GAGTGTTCAC = 30 reads: -403 non-validated
umi GGTTAAGCCT = 533 reads: +403 validated
umi GTGGCATTCC = 64 reads: +388 -5 +1 -2 +7 non-validated
umi TACTTTGCTG = 168 reads: -381X +8 -1XX +10 -1XX +2 invalidated
umi TAGGCCGGAC = 184 reads: +403 validated
umi TCTTAGTCAA = 69 reads: +403 validated
umi TTCCTGTCGG = 206 reads: +403 validated

UMI info for barcode GTGCGGTCATCTCGCT-1 contig 2 = CAGCTCTGGG...
umi AACTTGGACA = 262 reads: +436 validated
umi ATTTGAGCCC = 287 reads: +436 validated
umi CTATTTGCTC = 238 reads: +436 validated
umi GTTTGACTGC = 125 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=569]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-375 ==> 0-345 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=21)
395-433 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 191 reads
cdr3 = CQWYRTNSPVTF at 369, score = 9 + 8
umis assigned: [19, 191, 327, 628, 796, 846, 927, 942, 1081, 1203]
of which 10 are surviving nonsolos
reads assigned: 2131
start codons at 30, 99, 352, 475
confident = true

TIG 2[bases=587]
80-433 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=72)
470-516 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
516-587 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 53 reads
cdr3 = CAKEGGEEFHDGAPYAPIDWW at 422, score = 9 + 7
umis assigned: [31, 292, 517, 879]
of which 4 are surviving nonsolos
reads assigned: 887
start codons at 80, 231, 236, 287, 294, 297, 315, 383, 450, 453
confident = true
now this is a cell
paired!

TATTACTGTGCAAAAGAGGGGGGGGAAGAGTTCCATGATGGCGCTCCGTACGCCCCCATTGACTGGTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AACAACCTGCAGCCTGAAGATGTGGCAGTTTATTACTGTCAGTGGTATCGTACTAATTCTCCGGTCACTTTCGGCCCTGGGACCAAAGTGGAAATCAGAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.744 = GTGCGGTCATGCATGT-1

using 1856 reads

====================================================================================

graph has 2039 edges initially, 66 edges after simplification

total ucounts = 743
nonsolo ucounts = 378[2^134, 3^81, 4^54, 5^39, 6^23, 7^10, 8^11, 9^8, 10^6, 11^6, 12^4, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.751 = GTGCGGTGTAAATGAC-1

using 361 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3^2, 4, 341]
surviving nonsolo ucounts = 1[341]
ids = [7]

====================================================================================

UMI info for barcode GTGCGGTGTAAATGAC-1 contig 1 = TGGGGGCTTT...
umi CCTCCCATCA = 340 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=529]
19-396 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=11)
421-458 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARQTLHLGESLYW at 385, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 19, 28, 40, 84
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.757 = GTGCGGTGTAGAAGGA-1

using 117 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 4[3, 4, 6, 90]
surviving nonsolo ucounts = 1[90]
ids = [0]

====================================================================================

UMI info for barcode GTGCGGTGTAGAAGGA-1 contig 1 = CATGGCCAGC...
umi ACGTCGCTCG = 82 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=425]
1-354 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
351-389 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
389-425 ==> 0-36 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CASWDDSLRGRVF at 322, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 1, 155, 305, 330, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.761 = GTGCGGTGTCACACGC-1

using 176 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 6, 7, 152]
surviving nonsolo ucounts = 1[152]
ids = [9]

====================================================================================

UMI info for barcode GTGCGGTGTCACACGC-1 contig 1 = GGAGTGCTTT...
umi GCTATACTTC = 128 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=546]
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
422-470 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
470-546 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 379, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 19, 40, 84, 170, 257, 524
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.765 = GTGCGGTGTCATGCAT-1

using 259 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 249]
surviving nonsolo ucounts = 1[249]
ids = [5]

====================================================================================

UMI info for barcode GTGCGGTGTCATGCAT-1 contig 1 = AGCTTCAGCT...
umi CGCTACGTTG = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=578]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-578 ==> 0-143 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAAWDDSLNAVVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.774 = GTGCGGTGTCTCACCT-1

using 1109 reads

====================================================================================

graph has 362 edges initially, 4 edges after simplification

total ucounts = 16
nonsolo ucounts = 10[2^5, 3, 243, 279, 282, 286]
surviving nonsolo ucounts = 4[243, 279, 282, 286]
ids = [13, 15, 2, 7]

====================================================================================

UMI info for barcode GTGCGGTGTCTCACCT-1 contig 1 = GGGGGTCTCA...
umi AGGCACTTAC = 283 reads: +388 validated
umi GTAGACAATA = 287 reads: +388 validated
umi TCTGTTAGCA = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=638]
39-400 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
427-638 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 143 reads
cdr3 = CSSYTSSSTLVF at 363, score = 8 + 9
umis assigned: [2, 7, 13]
of which 3 are surviving nonsolos
reads assigned: 800
start codons at 39, 196, 240, 247, 250, 559
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.778 = GTGCGGTGTCTGGTCG-1

using 282 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 4, 7, 261]
surviving nonsolo ucounts = 1[261]
ids = [4]

====================================================================================

UMI info for barcode GTGCGGTGTCTGGTCG-1 contig 1 = GGCTGGGGTC...
umi CCGCAAAGCA = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=641]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CCSYAGRYSWVF at 366, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 42, 181, 199, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.783 = GTGCGGTGTGCAACGA-1

using 80 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3, 4, 8, 56]
surviving nonsolo ucounts = 1[56]
ids = [10]

====================================================================================

UMI info for barcode GTGCGGTGTGCAACGA-1 contig 1 = GAGGAATCAG...
umi TTTCTTGGAG = 48 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=426]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 8 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 48
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.788 = GTGCGGTGTTAAAGTG-1

using 186 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^4, 3^2, 169]
surviving nonsolo ucounts = 1[169]
ids = [9]

====================================================================================

UMI info for barcode GTGCGGTGTTAAAGTG-1 contig 1 = CTGGGCCTCA...
umi TCGACTGCTT = 171 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=633]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-383 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=2)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQAWDSSTAPIWVF at 352, score = 6 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 37, 42, 98, 185, 331, 335, 554
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.790 = GTGCGGTGTTCAGGCC-1

using 326 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[4, 314]
surviving nonsolo ucounts = 1[314]
ids = [6]

====================================================================================

UMI info for barcode GTGCGGTGTTCAGGCC-1 contig 1 = GAGGAACTGC...
umi GTTAGCCCGT = 319 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNKWPITF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.793 = GTGCGGTGTTTGACTG-1

using 1515 reads

====================================================================================

graph has 1440 edges initially, 82 edges after simplification

total ucounts = 799
nonsolo ucounts = 328[2^143, 3^88, 4^50, 5^21, 6^13, 7^3, 8^5, 9^3, 10, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.808 = GTGCGGTTCCACGAAT-1

using 398 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 12[2^6, 3^3, 5, 6, 355]
surviving nonsolo ucounts = 1[355]
ids = [22]

====================================================================================

UMI info for barcode GTGCGGTTCCACGAAT-1 contig 1 = ATCAGTCCCA...
umi TTTTGGCTGT = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [22]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.811 = GTGCGGTTCCAGTATG-1

using 221 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 9[2^4, 3^2, 4, 6, 188]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GTGCGGTTCCAGTATG-1 contig 1 = GGGAGGGTCC...
umi GCTGTTACTG = 179 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=611]
61-409 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
488-611 ==> 0-123 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 19 reads
cdr3 = CARDLLWFGETRAFDIW at 406, score = 9 + 8
umis assigned: [10]
of which 0 are surviving nonsolos
reads assigned: 177
start codons at 17, 61, 105, 423, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.815 = GTGCGGTTCCGCATCT-1

using 260 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 11[2^6, 3^2, 4^2, 227]
surviving nonsolo ucounts = 1[227]
ids = [4]

====================================================================================

UMI info for barcode GTGCGGTTCCGCATCT-1 contig 1 = TCTCTTCAGC...
umi CACCCCGATA = 216 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=603]
0-84 ==> 31-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
84-424 ==> 0-340 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=0)
425-463 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
463-603 ==> 0-140 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQVWDSSTGGVF at 399, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 84, 145, 232, 382, 595
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.817 = GTGCGGTTCCGTACAA-1

using 346 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 4, 327]
surviving nonsolo ucounts = 1[327]
ids = [2]

====================================================================================

UMI info for barcode GTGCGGTTCCGTACAA-1 contig 1 = GAATCAGTCC...
umi ATAAATTCTG = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.825 = GTGCGGTTCGAGAACG-1

using 634 reads

====================================================================================

graph has 304 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 4[2, 3, 274, 342]
surviving nonsolo ucounts = 2[274, 342]
ids = [16, 1]

====================================================================================

UMI info for barcode GTGCGGTTCGAGAACG-1 contig 1 = AGCTGTGGGC...
umi TGCAGGTCTA = 283 reads: +379 validated

UMI info for barcode GTGCGGTTCGAGAACG-1 contig 2 = GGAAATCAGT...
umi AACTTCAATC = 338 reads: +388 validated
umi CCCCAGGCTT = 2 reads: -260 +23 -1 +3 -1X +20 -1X +7 -72 invalidated

GOOD CONTIGS

TIG 1[bases=630]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=14)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CHSRDSRGPWVF at 355, score = 8 + 8
umis assigned: [16]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 40, 159, 239, 338
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1, 8]
of which 1 are surviving nonsolos
reads assigned: 333
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.828 = GTGCGGTTCGCCAGCA-1

using 252 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3^3, 5, 230]
surviving nonsolo ucounts = 1[230]
ids = [9]

====================================================================================

UMI info for barcode GTGCGGTTCGCCAGCA-1 contig 1 = AGCTCTGAGA...
umi TCAGCGCGTG = 218 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=619]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-619 ==> 0-116 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.830 = GTGCGGTTCGCGTTTC-1

using 3630 reads

====================================================================================

graph has 3387 edges initially, 131 edges after simplification

total ucounts = 1732
nonsolo ucounts = 831[2^366, 3^205, 4^105, 5^85, 6^34, 7^14, 8^6, 9^4, 10, 11^4, 12^2, 14^3, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.838 = GTGCGGTTCTCCAACC-1

using 243 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[3, 4, 227]
surviving nonsolo ucounts = 2[4, 227]
ids = [7, 5]

====================================================================================

UMI info for barcode GTGCGGTTCTCCAACC-1 contig 1 = AGAGCTCTGG...
umi GGGTACGCCC = 225 reads: +385 validated
umi TACCGTGACG = 4 reads: -163 +5 -1 +15 -1 +3 -1 +3 -1 +3 -1 +23 -1X +12 -1X +7 -1X +30 -1XX +9 -1 +10 -1X +1 -1 +1 -2X +1 -1X +12 -72 invalidated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYGSSPNTF at 368, score = 9 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 228
start codons at 44, 252, 378, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.840 = GTGCGGTTCTGGAGCC-1

using 232 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[232]
surviving nonsolo ucounts = 1[232]
ids = [0]

====================================================================================

UMI info for barcode GTGCGGTTCTGGAGCC-1 contig 1 = GGCTGGGGTC...
umi CTTCGTCAAA = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-579 ==> 0-149 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 42, 250, 253, 562
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.862 = GTGCTTCAGCCACGTC-1

using 3953 reads

====================================================================================

graph has 2689 edges initially, 54 edges after simplification

total ucounts = 711
nonsolo ucounts = 293[2^122, 3^66, 4^38, 5^22, 6^10, 7^7, 8^4, 9^3, 10^5, 12^3, 13^2, 17, 20, 40, 70, 123, 204, 289, 300, 334, 477, 677]
surviving nonsolo ucounts = 9[5, 70, 123, 204, 289, 300, 334, 477, 677]
ids = [480, 285, 210, 79, 648, 239, 503, 561, 281]

====================================================================================

UMI info for barcode GTGCTTCAGCCACGTC-1 contig 1 = AAGAACCTGC...
umi ACCTGTTCCT = 194 reads: +373 validated
umi CACCGGCCTA = 125 reads: +373 validated
umi CCTGCCACTC = 689 reads: -176 +197 non-validated
umi TGTATCACGG = 291 reads: +373 validated

UMI info for barcode GTGCTTCAGCCACGTC-1 contig 2 = GGGGAGTGAT...
umi CATTATGGAT = 298 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=636]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-385 ==> 0-333 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=12)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 269 reads
cdr3 = CQAWDSGTVF at 367, score = 6 + 8
umis assigned: [79, 210, 281, 648]
of which 4 are surviving nonsolos
reads assigned: 1272
start codons at 52, 57, 113, 200, 346, 350
confident = true

TIG 2[bases=567]
35-390 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=42)
415-465 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
465-567 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CAKDTGSGSGTAFYGMDVW at 377, score = 8 + 7
umis assigned: [239]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 35, 95, 186, 191, 422, 483, 544
confident = true

REJECT CONTIGS

TIG 1[bases=359]
4-213 ==> 146-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=30)
238-288 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
288-359 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CAKDTGSGSGTAFYGMDVW at 200, score = 8 + 7
umis assigned: [561]
of which 1 are surviving nonsolos
reads assigned: 471
start codons at 9, 14, 245
confident = false
VJ delta = 25
not full
not full

TIG 2[bases=556]
0-76 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
31-391 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=16)
390-420 ==> 7-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [285, 480, 503]
of which 3 are surviving nonsolos
reads assigned: 403
start codons at 31, 64, 100, 188, 350, 370, 462
confident = false
did not find CDR3
now this is a cell
paired!

GCCCTTTATTACTGTGCGAAAGATACAGGATCTGGTTCAGGGACAGCATTCTACGGCATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCGG <==> ACCATCAGCGACACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCGGCACGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.866 = GTGCTTCAGCTATGCT-1

using 171 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 168]
surviving nonsolo ucounts = 1[168]
ids = [2]

====================================================================================

UMI info for barcode GTGCTTCAGCTATGCT-1 contig 1 = GGGGGTCTCA...
umi TTGCTCCGCA = 168 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=589]
39-393 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
430-589 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTLVVF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.881 = GTGCTTCAGGTGTTAA-1

using 315 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [7]

====================================================================================

UMI info for barcode GTGCTTCAGGTGTTAA-1 contig 1 = GAGGAACTGC...
umi TTTCAAGCTG = 307 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=18)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYYNWPPYTF at 354, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 33, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.882 = GTGCTTCAGTAAGTAC-1

using 100 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 8, 87]
surviving nonsolo ucounts = 1[87]
ids = [3]

====================================================================================

UMI info for barcode GTGCTTCAGTAAGTAC-1 contig 1 = CCCCAGAGCA...
umi CCTTATGTTA = 83 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=472]
0-22 ==> 20-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
22-375 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=21)
391-440 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=7)
440-472 ==> 0-32 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CASSIGRYSYGFDHW at 364, score = 9 + 6
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 22, 173, 220, 225, 319, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.884 = GTGCTTCAGTCCAGGA-1

using 329 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[329]
surviving nonsolo ucounts = 1[329]
ids = [0]

====================================================================================

UMI info for barcode GTGCTTCAGTCCAGGA-1 contig 1 = GGATGCTTTC...
umi AATTACTATC = 328 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=549]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=12)
415-478 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
478-549 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CVSRLRYGSGNYFYYYYMDVW at 384, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 2, 18, 27, 39, 83, 345, 403, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.886 = GTGCTTCAGTCGTACT-1

using 580 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 571]
surviving nonsolo ucounts = 1[571]
ids = [0]

====================================================================================

UMI info for barcode GTGCTTCAGTCGTACT-1 contig 1 = GAAGAGCTGC...
umi AGATAGAATT = 523 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=516]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-516 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 517
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.891 = GTGCTTCAGTGGGTTG-1

using 376 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[374]
surviving nonsolo ucounts = 1[374]
ids = [1]

====================================================================================

UMI info for barcode GTGCTTCAGTGGGTTG-1 contig 1 = GGGAGGAACT...
umi CAATACTCCA = 376 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYNHWPCSF at 356, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.893 = GTGCTTCAGTGGTAGC-1

using 279 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 270]
surviving nonsolo ucounts = 1[270]
ids = [0]

====================================================================================

UMI info for barcode GTGCTTCAGTGGTAGC-1 contig 1 = GAGGAACTGC...
umi AAAGTCTTTG = 248 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=496]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-496 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.900 = GTGCTTCCAACGATGG-1

using 926 reads

====================================================================================

graph has 658 edges initially, 4 edges after simplification

total ucounts = 122
nonsolo ucounts = 32[2^17, 3^4, 4^5, 8^2, 10, 134, 222, 388]
surviving nonsolo ucounts = 2[222, 388]
ids = [23, 0]

====================================================================================

UMI info for barcode GTGCTTCCAACGATGG-1 contig 1 = GAAGAGCTGC...
umi ATGTAATCGC = 200 reads: +385 validated

UMI info for barcode GTGCTTCCAACGATGG-1 contig 2 = GGGAGAGGAG...
umi AAAACAGCGA = 329 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=493]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYGSSRGTF at 357, score = 9 + 8
umis assigned: [23]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 33, 241, 367, 460
confident = false

TIG 2[bases=518]
0-73 ==> 6-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
73-423 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=6)
434-454 ==> 7-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=0)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
junction support: 1 umis using 20 reads
cdr3 = CARSPRGGYFDWLLAYFDYW at 412, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 73, 229, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.910 = GTGCTTCCAAGCTGAG-1

using 10997 reads

====================================================================================

graph has 3597 edges initially, 52 edges after simplification

total ucounts = 342
nonsolo ucounts = 155[2^48, 3^24, 4^15, 5^13, 6^6, 7^3, 9, 11, 12^3, 14, 19, 21, 28, 31, 41, 54, 95, 98, 113^2, 124, 127, 142, 172, 189^3, 213, 219, 229, 230, 233^2, 239, 240, 241, 266, 278, 281, 282, 285, 286, 287, 320, 342, 346, 480, 810, 845, 1459]
surviving nonsolo ucounts = 36[41, 54, 95, 98, 113^2, 124, 127, 142, 172, 189^3, 213, 219, 229, 230, 233^2, 239, 240, 241, 266, 278, 281, 282, 285, 286, 287, 320, 342, 346, 480, 810, 845, 1459]
ids = [102, 163, 329, 113, 45, 57, 282, 123, 81, 6, ...]

====================================================================================

UMI info for barcode GTGCTTCCAAGCTGAG-1 contig 1 = CTGGGCCTCA...
umi AAATACTTCA = 190 reads: +376 validated
umi AAGAACGCGG = 171 reads: +376 validated
umi AAGCGCATGC = 226 reads: +376 validated
umi AAGCTAACAG = 284 reads: +376 validated
umi AATGCTACTT = 1479 reads: -327 +1 -10XX +1 -2XX +3 -1XX +31 invalidated
umi ACGCCTGCCG = 243 reads: +376 validated
umi ACTCACCCCT = 112 reads: +376 validated
umi AGTATTCGAT = 112 reads: +376 validated
umi ATGCAGGCAT = 216 reads: +376 validated
umi CAATATACTT = 146 reads: +376 validated
umi CCAACATTAG = 256 reads: +376 validated
umi CCAGACACCG = 39 reads: +257 -9 +4 -1 +1 -1 +1 -1 +2 -2 +1 -5X +1 -1 +1 -1 +1 -1 +85 invalidated
umi CGGAGAGAAC = 128 reads: +376 validated
umi GAATCCTAAT = 325 reads: +376 validated
umi GAATCGGTTG = 341 reads: -2XX +374 invalidated
umi GAGAGTAGCT = 56 reads: -19 +357 non-validated
umi GCTGCGCTTG = 481 reads: +376 validated
umi GGGGGGGCTA = 823 reads: -329X +1 -8XX +1 -2XX +3 -1XX +31 invalidated
umi GTGTGGATCA = 193 reads: +376 validated
umi TAGCTTTGTG = 233 reads: +376 validated
umi TCGTTTGGAC = 124 reads: +376 validated
umi TCTTTCGTTC = 286 reads: +376 validated
umi TGATAAACCG = 243 reads: +376 validated
umi TGCAATGCAT = 230 reads: +376 validated
umi TGCGACTAAC = 232 reads: +376 validated
umi TGGTTTATTG = 237 reads: +376 validated
umi TGTAAGACGC = 219 reads: +376 validated
umi TTATTACGCT = 852 reads: -338X +1 -2XX +3 -1XX +31 invalidated
umi TTGTGAGTTG = 91 reads: +376 validated
umi TTTCATTTCC = 276 reads: +376 validated

UMI info for barcode GTGCTTCCAAGCTGAG-1 contig 2 = AGCTCTGGGA...
umi CAGATGGATG = 288 reads: +421 validated
umi CATACGAATA = 287 reads: +421 validated
umi CGAGAGTCTA = 99 reads: +418 -2 +1 non-validated
umi GCCAGAGCGG = 280 reads: +421 validated
umi TCTTATCACA = 348 reads: +421 validated
umi TTTCTCTGCC = 191 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 26 umis using 895 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [1, 6, 9, 10, 20, 40, 45, 57, 72, 81] and 20 others
of which 30 are surviving nonsolos
reads assigned: 8660
start codons at 37, 42, 98, 185, 331, 335
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |107|IGHV3-13|5'UTR| [len=80] (mis=0)
80-430 ==> 0-350 on |108|IGHV3-13|L-REGION+V-REGION| [len=350] (mis=3)
428-449 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=2)
451-501 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 108 reads
cdr3 = CARGNSSSWYDSAFDIW at 419, score = 9 + 8
umis assigned: [90, 92, 113, 175, 287, 334]
of which 6 are surviving nonsolos
reads assigned: 1467
start codons at 80, 236, 354, 380, 447, 482
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCAAGGGGGAATAGCAGCAGCTGGTATGATTCGGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.912 = GTGCTTCCAAGTCTGT-1

using 7 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[7]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.916 = GTGCTTCCAATGGTCT-1

using 49 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^3, 4, 5^2, 7, 9^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.921 = GTGCTTCCACATGGGA-1

using 182 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 177]
surviving nonsolo ucounts = 1[177]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.925 = GTGCTTCCACCTGGTG-1

using 356 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 11, 14, 321]
surviving nonsolo ucounts = 1[321]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-26 ==> 6796-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
15-78 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 26, 32, 88, 101, 240, 363, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.926 = GTGCTTCCACGAGGTA-1

using 264 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^3, 257]
surviving nonsolo ucounts = 1[257]
ids = [3]

====================================================================================

UMI info for barcode GTGCTTCCACGAGGTA-1 contig 1 = AGGAGTCAGA...
umi GGGGGTTGAA = 238 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-475 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYNTYIWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 27, 33, 102, 240, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.928 = GTGCTTCCACGCTTTC-1

using 177 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 167]
surviving nonsolo ucounts = 1[167]
ids = [3]

====================================================================================

UMI info for barcode GTGCTTCCACGCTTTC-1 contig 1 = CTCAGGAGGC...
umi AGGCCATAAT = 160 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=548]
33-387 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=2)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-548 ==> 0-124 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CSSYTSSSTSRVF at 357, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 157
start codons at 33, 234, 241
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.940 = GTGCTTCCAGGACCCT-1

using 164 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[160]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.941 = GTGCTTCCAGGACGTA-1

using 1275 reads

====================================================================================

graph has 474 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[312, 347, 612]
surviving nonsolo ucounts = 3[312, 347, 612]
ids = [0, 6, 1]

====================================================================================

UMI info for barcode GTGCTTCCAGGACGTA-1 contig 1 = GAGGGTCCTG...
umi TCCCTGCCTT = 317 reads: +424 validated

UMI info for barcode GTGCTTCCAGGACGTA-1 contig 2 = CTGGGCCTCA...
umi ATTAACTTGC = 287 reads: +376 validated

UMI info for barcode GTGCTTCCAGGACGTA-1 contig 3 = GGAGTCAGAC...
umi CCTATGCGCC = 621 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=20)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
483-599 ==> 0-116 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAKYYGSGNWPLFDSW at 404, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 314
start codons at 15, 59, 103, 326, 417, 537
confident = false

TIG 2[bases=545]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-545 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 37, 42, 98, 185, 331, 335
confident = false

TIG 3[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 85 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 606
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.950 = GTGCTTCCATCACGAT-1

using 358 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[358]
surviving nonsolo ucounts = 1[358]
ids = [0]

====================================================================================

UMI info for barcode GTGCTTCCATCACGAT-1 contig 1 = GATCAGGACT...
umi GTTTACAGCT = 336 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=517]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
427-517 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CMQALQTPCSF at 366, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.952 = GTGCTTCCATCCGGGT-1

using 6465 reads

====================================================================================

graph has 3290 edges initially, 82 edges after simplification

total ucounts = 656
nonsolo ucounts = 297[2^117, 3^66, 4^41, 5^16, 6^14, 7^13, 8^4, 9^4, 10^2, 13^2, 14^2, 16, 143, 163, 168, 188, 229, 238, 270, 285, 301, 319, 339, 381, 444, 677, 951]
surviving nonsolo ucounts = 15[143, 163, 168, 188, 229, 238, 270, 285, 301, 319, 339, 381, 444, 677, 951]
ids = [56, 132, 581, 477, 21, 597, 648, 644, 130, 653, ...]

====================================================================================

UMI info for barcode GTGCTTCCATCCGGGT-1 contig 1 = AGCTTCAGCT...
umi AACTTTATGT = 231 reads: +391 validated
umi TTTCCTCATA = 276 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=649]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
438-649 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 2 umis using 65 reads
cdr3 = CAAWDDSLNGRYVF at 368, score = 8 + 8
umis assigned: [21, 648]
of which 2 are surviving nonsolos
reads assigned: 492
start codons at 47, 351, 376, 381, 393, 402
confident = true

REJECT CONTIGS

TIG 1[bases=536]
1-95 ==> 5906-6000 on rc of segment after IGHV3-20 exon 1 [len=6000] (mis=2)
95-450 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=26)
490-536 ==> 13-59 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
cdr3 = CAKDIPSPQYCGGDCALSYGMDVW at 437, score = 9 + 7
umis assigned: [56, 132]
of which 2 are surviving nonsolos
reads assigned: 287
start codons at 95, 240, 246, 251, 330, 398, 497
confident = false
VJ delta = 25
not full
not full

TIG 2[bases=655]
3-57 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
41-73 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
57-73 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
57-81 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
57-82 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
100-179 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
100-128 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
270-377 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
273-376 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
353-378 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
406-444 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
444-655 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [157, 477, 558, 581]
of which 4 are surviving nonsolos
reads assigned: 1735
start codons at 57, 208, 258, 383
confident = false
did not find CDR3

TIG 3[bases=553]
7-88 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [130, 336, 407, 597, 644, 653]
of which 6 are surviving nonsolos
reads assigned: 1834
start codons at 31, 37, 93, 106, 242, 459
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.960 = GTGCTTCGTAAACGCG-1

using 104 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 4, 5, 86]
surviving nonsolo ucounts = 2[2, 86]
ids = [6, 8]

====================================================================================

UMI info for barcode GTGCTTCGTAAACGCG-1 contig 1 = GTCAGACTCA...
umi TAAGGGCGAA = 1 reads: -388 non-validated
umi TGTTGGCTGC = 86 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CQQYNSYALSF at 350, score = 8 + 7
umis assigned: [6, 8]
of which 2 are surviving nonsolos
reads assigned: 87
start codons at 23, 29, 85, 98, 234, 237, 330, 369, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.961 = GTGCTTCGTAAAGTCA-1

using 899 reads

====================================================================================

graph has 1223 edges initially, 18 edges after simplification

total ucounts = 396
nonsolo ucounts = 187[2^67, 3^47, 4^26, 5^18, 6^14, 7^6, 8, 9, 10^2, 11^2, 12^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.968 = GTGCTTCGTATAAACG-1

using 4801 reads

====================================================================================

graph has 3031 edges initially, 52 edges after simplification

total ucounts = 684
nonsolo ucounts = 361[2^132, 3^74, 4^42, 5^33, 6^20, 7^14, 8^7, 9^5, 10^7, 11, 13, 14^2, 15, 17, 19^2, 20, 39, 40, 63, 64, 126, 146, 159, 163, 169, 183^2, 195, 222, 231^2, 271, 287, 356]
surviving nonsolo ucounts = 18[19, 20, 39, 40, 64, 126, 146, 163, 169, 183^2, 195, 222, 231^2, 271, 287, 356]
ids = [44, 361, 103, 384, 52, 78, 428, 147, 333, 144, ...]

====================================================================================

UMI info for barcode GTGCTTCGTATAAACG-1 contig 1 = AGCTGTGGGC...
umi ACATTCAATC = 65 reads: +332 -1 +13 -19 +20 non-validated
umi ATCTCTTGGA = 180 reads: +385 validated
umi ATGATCTTTT = 164 reads: +385 validated
umi CAACATGCCT = 184 reads: +385 validated
umi CGATTCCCCT = 196 reads: +385 validated
umi GACTATGGGT = 227 reads: +385 validated

UMI info for barcode GTGCTTCGTATAAACG-1 contig 2 = GGGAGAGGAG...
umi ACACTTCCCA = 17 reads: +28 -53 +174 -13 +116 -1 +3 -2 +6 -1 +1 -1 +4 -24 non-validated
umi ACTATTGTTA = 109 reads: +427 validated
umi AGGAGACTTG = 36 reads: +351 -76 non-validated
umi CGCATGGTTG = 35 reads: +8 -1XX +2 -1XX +9 -6X +2 -2X +1 -1X +3 -1X +6 -1XX +13 -1XX +1 -1XX +27 -1XX +4 -1XX +8 -1XX +41 -3XX +1 -3XX +4 -1XX +15 -1XX +2 -1XX +2 -37X +1 -3XX +2 -1XX +1 -2XX +3 -2XX +1 -1XX +1 -2XX +6 -1XX +5 -1XX +32 -2XX +8 -1XX +1 -1XX +20 -1XX +20 -2XX +13 -1XX +5 -3XX +1 -13XX +1 -7X +2 -1X +1 -1X +1 -3X +1 -4X +24 -11 invalidated
umi CTGGTAGGCC = 16 reads: +24 -3 +78 -5 +78 -9 +166 -1 +4 -1 +2 -1 +5 -50 non-validated
umi GCTATCGGCT = 137 reads: +410 -17 non-validated

UMI info for barcode GTGCTTCGTATAAACG-1 contig 3 = CTGGGCCTCA...
umi AACATTCTTC = 346 reads: +376 validated
umi ATTTGTTTCT = 222 reads: +376 validated
umi CACACATCGG = 233 reads: +376 validated
umi CTAGGCCCTG = 164 reads: +376 validated
umi CTGTACTCGG = 70 reads: -13X +1 -17XX +2 -3XX +1 -8XX +331 invalidated
umi GAAGCGAATA = 39 reads: -1 +375 non-validated
umi TACTGTATGG = 281 reads: +376 validated
umi TTCTATCCGC = 275 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=636]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 149 reads
cdr3 = CNSRDSSGNHLRVF at 355, score = 8 + 8
umis assigned: [52, 144, 147, 181, 296, 390]
of which 6 are surviving nonsolos
reads assigned: 1001
start codons at 40, 159, 188, 239, 338
confident = true

TIG 2[bases=507]
0-74 ==> 6-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
74-429 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=26)
436-455 ==> 0-19 on |26|IGHD4-23|D-REGION| [len=19] (mis=2)
464-501 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CAKDIAGHYGGNTAWEYW at 416, score = 9 + 7
umis assigned: [44, 78, 103, 298, 361, 428]
of which 5 are surviving nonsolos
reads assigned: 342
start codons at 74, 219, 225, 230, 309, 377
confident = true

TIG 3[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 289 reads
cdr3 = CQAWDSSTVVF at 352, score = 6 + 8
umis assigned: [8, 176, 191, 333, 363, 384, 529, 660]
of which 7 are surviving nonsolos
reads assigned: 1615
start codons at 37, 42, 98, 185, 331, 335
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.973 = GTGCTTCGTCAAAGAT-1

using 240 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [0]

====================================================================================

UMI info for barcode GTGCTTCGTCAAAGAT-1 contig 1 = ATCACACAAC...
umi TCGGTGGGCT = 236 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=588]
0-57 ==> 3-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
57-410 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
418-466 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
466-588 ==> 0-122 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CVTDLATTVDYW at 399, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 57, 213, 255, 277, 292, 321, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.986 = GTGCTTCGTTATCGGT-1

using 274 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode GTGCTTCGTTATCGGT-1 contig 1 = CGAGCCCAGC...
umi CGGTGCCGGT = 271 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=553]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 67, 218, 223, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1006 = GTGCTTCTCATGTGGT-1

using 22 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1012 = GTGCTTCTCCCTAACC-1

using 458 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 8, 158, 285]
surviving nonsolo ucounts = 3[8, 158, 285]
ids = [7, 1, 5]

====================================================================================

UMI info for barcode GTGCTTCTCCCTAACC-1 contig 1 = TGGGGAGGAA...
umi CACACATCCC = 160 reads: +388 validated
umi CCTGTTCAGC = 285 reads: +388 validated
umi GTAGCTCGTC = 7 reads: -29 +56 -140 +102 -61 non-validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 65 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [1, 5, 7]
of which 3 are surviving nonsolos
reads assigned: 443
start codons at 32, 38, 107, 243, 462
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1013 = GTGCTTCTCCGAACGC-1

using 64 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 8, 48]
surviving nonsolo ucounts = 1[48]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1030 = GTGCTTCTCGTAGGAG-1

using 544 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 242, 297]
surviving nonsolo ucounts = 2[242, 297]
ids = [4, 1]

====================================================================================

UMI info for barcode GTGCTTCTCGTAGGAG-1 contig 1 = GTCAGTCCCA...
umi CGGCTAATGG = 296 reads: +388 validated
umi TCCAGTCAAG = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 86 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 531
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1038 = GTGCTTCTCTCCAACC-1

using 170 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 5, 154]
surviving nonsolo ucounts = 1[154]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
0-73 ==> 7-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
0-73 ==> 7073-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-73 ==> 7067-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
42-109 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
73-237 ==> 0-164 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=7)
237-348 ==> 240-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=9) [SHIFT!]
353-403 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
403-474 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CVKEEDAFDIW at 339, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 151
start codons at 73, 224, 229, 300, 355, 384
confident = false
frameshifted full length stopped transcript of length 474
VJ delta = 84
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1045 = GTGCTTCTCTCTTGAT-1

using 11073 reads

====================================================================================

graph has 5026 edges initially, 74 edges after simplification

total ucounts = 907
nonsolo ucounts = 436[2^171, 3^86, 4^67, 5^32, 6^13, 7^6, 8^6, 9^2, 10^3, 11^2, 12, 15^2, 16, 20, 26, 49, 53, 70, 90, 97, 106, 113, 120, 128, 145, 162, 174, 177, 181, 186, 189, 200, 202, 223, 230, 231, 245, 248^2, 251, 253, 257, 260, 265, 268, 269, 270, 272, 288, 290, 296, 297, 312, 323, 337, 338, 519]
surviving nonsolo ucounts = 42[49, 53, 70, 90, 97, 106, 113, 120, 128, 145, 162, 174, 177, 181, 186, 189, 200, 202, 223, 230, 231, 245, 248^2, 251, 253, 257, 260, 265, 268, 269, 270, 272, 288, 290, 296, 297, 312, 323, 337, 338, 519]
ids = [568, 71, 167, 145, 730, 442, 876, 854, 434, 32, ...]

====================================================================================

UMI info for barcode GTGCTTCTCTCTTGAT-1 contig 1 = ACTTTCTGAG...
umi ACCCGTACGC = 52 reads: +27 -1 +351 -39 non-validated
umi ATACTTTGGG = 92 reads: +418 validated
umi ATCATTAACA = 208 reads: +418 validated
umi ATCGCAACCT = 61 reads: +418 validated
umi ATTAGTTAAC = 173 reads: +418 validated
umi CGACGCCTTA = 243 reads: +418 validated
umi GGTTACCCGG = 45 reads: +364 -54 non-validated
umi GTAGCCTCCT = 176 reads: +418 validated
umi TACTGCAGTC = 171 reads: +418 validated
umi TCGGAACCTC = 99 reads: +416 -1 +1 non-validated
umi TCTCTTATGC = 208 reads: +418 validated
umi TTATTGGCCC = 240 reads: +418 validated
umi TTCCTAATCT = 120 reads: +418 validated
umi TTGGTGTTTC = 111 reads: +403 -1 +14 non-validated

UMI info for barcode GTGCTTCTCTCTTGAT-1 contig 2 = GAGGAGTCAG...
umi AAATAGTATA = 327 reads: +388 validated
umi AAGTGGGGCC = 275 reads: +388 validated
umi AATCCGTTAC = 223 reads: +388 validated
umi ACTTTGCCCT = 249 reads: +388 validated
umi ATCAGTTCCT = 294 reads: +388 validated
umi ATTTCAAAAC = 288 reads: +388 validated
umi ATTTCATGCC = 206 reads: +388 validated
umi CTGTCCGTCT = 129 reads: +388 validated
umi GCCATGTCCT = 229 reads: +388 validated
umi GCTACTCCTT = 339 reads: +388 validated
umi TAGAACCTTC = 187 reads: +388 validated
umi TCCATATCGC = 267 reads: +388 validated

UMI info for barcode GTGCTTCTCTCTTGAT-1 contig 3 = GAGCTACAAC...
umi AAGTATAACT = 260 reads: +403 validated
umi AAGTGTCCTC = 146 reads: +403 validated
umi CAATAACACC = 518 reads: -310 +2 -2XX +89 invalidated
umi CAGCTCCTCG = 264 reads: +403 validated
umi CGTATGGTAG = 327 reads: +403 validated
umi CTCAGTCCCT = 308 reads: +403 validated
umi CTGACCCCTA = 263 reads: +403 validated
umi CTGGACCTGC = 248 reads: +403 validated
umi CTTAGCCCTC = 160 reads: +385 -1 +17 non-validated
umi CTTAGGTGTC = 108 reads: +403 validated
umi GAGTGCTCTC = 288 reads: +403 validated
umi GGGCTTGGCA = 184 reads: +403 validated
umi GTGTCACCCT = 143 reads: +403 validated
umi TACCGAGCTA = 252 reads: +403 validated
umi TCGGAACGGT = 251 reads: +403 validated
umi TGTTTGGACA = 298 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=524]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=2)
399-453 ==> 9-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 176 reads
cdr3 = CARTATHAHYYGMDVW at 374, score = 9 + 7
umis assigned: [71, 145, 156, 167, 196, 349, 568, 583, 657, 730] and 4 others
of which 14 are surviving nonsolos
reads assigned: 1980
start codons at 35, 79, 410
confident = true

TIG 2[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 475 reads
cdr3 = CQQSYSTPLTF at 355, score = 9 + 9
umis assigned: [7, 31, 37, 105, 152, 213, 214, 434, 502, 523] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2983
start codons at 28, 34, 90, 103, 239, 458
confident = true

TIG 3[bases=569]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 354 reads
cdr3 = CQQYYSTPSITF at 369, score = 9 + 8
umis assigned: [30, 32, 230, 266, 378, 402, 422, 428, 441, 442] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3950
start codons at 30, 99, 352, 475
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1051 = GTGCTTCTCTGTCCGT-1

using 316 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2^2, 306]
surviving nonsolo ucounts = 1[306]
ids = [7]

====================================================================================

UMI info for barcode GTGCTTCTCTGTCCGT-1 contig 1 = AGTCCCAACC...
umi GTCTATTTGT = 286 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=470]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
405-470 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDNLPTF at 347, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 20, 26, 82, 95, 234, 357, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1053 = GTGCTTCTCTTAGAGC-1

using 504 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 500]
surviving nonsolo ucounts = 1[500]
ids = [2]

====================================================================================

UMI info for barcode GTGCTTCTCTTAGAGC-1 contig 1 = GTCAGTCTCA...
umi CCGGTACACT = 502 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 85 reads
cdr3 = CQQSYSTPRNF at 350, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 493
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1054 = GTGCTTCTCTTAGCCC-1

using 296 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 288]
surviving nonsolo ucounts = 1[288]
ids = [4]

====================================================================================

UMI info for barcode GTGCTTCTCTTAGCCC-1 contig 1 = GAAGAGCTGC...
umi CTTCCCTATT = 289 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYGSSPGTF at 357, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1057 = GTGCTTCTCTTGAGAC-1

using 856 reads

====================================================================================

graph has 782 edges initially, 16 edges after simplification

total ucounts = 300
nonsolo ucounts = 97[2^40, 3^22, 4^14, 5^10, 6^4, 7^3, 8, 9, 14, 325]
surviving nonsolo ucounts = 1[325]
ids = [284]

====================================================================================

UMI info for barcode GTGCTTCTCTTGAGAC-1 contig 1 = GGGGAGGAGT...
umi TTGAACCGGG = 292 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-489 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYTTLLTF at 358, score = 9 + 9
umis assigned: [284]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 31, 37, 93, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1062 = GTGGGTCAGAAACGAG-1

using 728 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 719]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1077 = GTGGGTCAGATATGGT-1

using 10354 reads

====================================================================================

graph has 5265 edges initially, 68 edges after simplification

total ucounts = 1179
nonsolo ucounts = 500[2^227, 3^101, 4^56, 5^37, 6^19, 7^9, 8^5, 9, 10^2, 11^2, 12, 13^2, 14, 15, 34, 37, 83, 92, 145, 154, 160, 174, 176, 179, 180, 182, 191, 211^2, 228^2, 230, 235, 239, 243, 250, 251, 261, 268, 272, 276, 279, 291, 299, 309, 318, 354, 355, 381, 396]
surviving nonsolo ucounts = 35[3, 83, 92, 145, 154, 160, 174, 176, 179, 180, 182, 191, 211^2, 228^2, 230, 235, 239, 243, 250, 251, 261, 268, 272, 276, 279, 291, 299, 309, 318, 354, 355, 381, 396]
ids = [988, 1021, 970, 955, 1170, 482, 167, 639, 990, 314, ...]

====================================================================================

UMI info for barcode GTGGGTCAGATATGGT-1 contig 1 = GAGCTACAAC...
umi AACGGCATGG = 250 reads: +400 validated
umi AGGGCGGTAG = 205 reads: +400 validated
umi AGTTTGGCAC = 277 reads: +400 validated
umi AGTTTTCCGT = 177 reads: +400 validated
umi ATTCACCCTT = 225 reads: -372 +28 non-validated
umi CACATTTTGG = 214 reads: -363X +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi CATAACCTAC = 11 reads: -343X +1 -3X +1 -1X +1 -12X +11 -1 +26 invalidated
umi CCATGCCACC = 229 reads: +400 validated
umi CGAGGTCGTC = 148 reads: -397 +3 non-validated
umi CGCCATTATA = 244 reads: +400 validated
umi CTACAATGGA = 291 reads: -330X +3 -1X +1 -2X +1 -5XX +1 -3XX +1 -1XX +1 -12XX +38 invalidated
umi CTTATGCGCT = 235 reads: +400 validated
umi GAAGCTTCTT = 173 reads: +400 validated
umi GAGACATCGC = 162 reads: -359 +1 -2XX +2 -2XX +2 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi GATTAACGAC = 297 reads: -332X +1 -1XX +1 -2X +1 -5XX +1 -3XX +1 -1XX +1 -12XX +38 invalidated
umi GCCCTGACCA = 294 reads: +400 validated
umi GCCTTTGATT = 396 reads: -271 +1 -1X +127 invalidated
umi GCTTAGTCGA = 262 reads: +400 validated
umi GTGCACTTAT = 250 reads: -366X +2 -1X +6 -2XX +15 -1XX +7 invalidated
umi GTTTGCCGCA = 191 reads: +400 validated
umi TCAAGTGCGG = 232 reads: +400 validated
umi TCAGCCACAT = 180 reads: +400 validated
umi TCCAGACTAA = 146 reads: +400 validated
umi TCCGTATACC = 91 reads: -362X +1 -3X +2 -1X +6 -2X +15 -1X +7 invalidated
umi TCGGTTTCAG = 186 reads: +396 -1X +3 invalidated
umi TGAACAAGGT = 42 reads: +317 -1 +2 -1 +8 -71 non-validated
umi TTCCCGATGA = 252 reads: +400 validated
umi TTCTACAACG = 229 reads: -378 +14 -1XX +7 invalidated
umi TTCTTGCCTG = 356 reads: -112 +288 non-validated
umi TTGATTGTAG = 269 reads: +400 validated
umi TTTGACAGGG = 157 reads: +400 validated

UMI info for barcode GTGGGTCAGATATGGT-1 contig 2 = ACATGGGAAG...
umi CATACGTCTC = 280 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 601 reads
cdr3 = CQQYYSTPWTF at 369, score = 9 + 8
umis assigned: [31, 153, 166, 167, 228, 271, 314, 374, 482, 495] and 21 others
of which 31 are surviving nonsolos
reads assigned: 6567
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=556]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARGRGSGWQGLAMSPSYYFDYW at 385, score = 9 + 7
umis assigned: [319]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 2, 25, 46, 90, 176, 424
confident = true
now this is a cell
paired!

TGTGCGAGAGGCCGGGGCAGTGGCTGGCAAGGTTTAGCCATGTCACCTTCGTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1081 = GTGGGTCAGATGCCTT-1

using 247 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 242]
surviving nonsolo ucounts = 1[242]
ids = [3]

====================================================================================

UMI info for barcode GTGGGTCAGATGCCTT-1 contig 1 = GCTCTGCTTC...
umi CAATCCACAA = 2 reads: -89 +1 -1X +2 -2 +1 -3 +1 -1 +1 -1 +2 -1 +4 -1 +1 -1 +3 -3X +9 -1 +7 -5X +4 -249 invalidated
umi CTTTCCACAA = 215 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=506]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-506 ==> 0-61 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1094 = GTGGGTCAGGACGAAA-1

using 914 reads

====================================================================================

graph has 1160 edges initially, 36 edges after simplification

total ucounts = 454
nonsolo ucounts = 174[2^73, 3^42, 4^22, 5^17, 6^5, 7^4, 8^3, 9^2, 10, 11, 12, 15, 19, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1107 = GTGGGTCAGTATTGGA-1

using 438 reads

====================================================================================

graph has 222 edges initially, 24 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3^2, 212, 216]
surviving nonsolo ucounts = 2[212, 216]
ids = [2, 7]

====================================================================================

UMI info for barcode GTGGGTCAGTATTGGA-1 contig 1 = TCTGCTTCAG...
umi GCGCTTGGTG = 2 reads: -10 +3 -2X +10 -2X +6 -1X +4 -2X +24 -130X +7 -1X +1 -1X +2 -1X +4 -2X +1 -1X +2 -2X +2 -1X +20 -1X +2 -1X +4 -144 invalidated
umi TGTCCTGTGA = 212 reads: +394 validated

UMI info for barcode GTGGGTCAGTATTGGA-1 contig 2 = ACAAGAGGCA...
umi CGGGGTGCTC = 212 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=654]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
443-654 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=4)
junction support: 1 umis using 22 reads
cdr3 = CQSYDSSLSGLYVF at 373, score = 7 + 8
umis assigned: [4, 7]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 49, 203, 206, 257, 356, 383, 407
confident = false

TIG 2[bases=637]
0-32 ==> 130-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
32-372 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=5)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CCSYAGSRTPNWVF at 356, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 32, 171, 233, 240, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1112 = GTGGGTCAGTTAGGTA-1

using 109 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1120 = GTGGGTCCAAGGCTCC-1

using 268 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 261]
surviving nonsolo ucounts = 1[261]
ids = [3]

====================================================================================

UMI info for barcode GTGGGTCCAAGGCTCC-1 contig 1 = AGAGCCCTGG...
umi CCCGCCGCAG = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQRSNWPPGLTF at 365, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 44, 249, 252, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1126 = GTGGGTCCAAGTTAAG-1

using 8027 reads

====================================================================================

graph has 3844 edges initially, 70 edges after simplification

total ucounts = 616
nonsolo ucounts = 263[2^104, 3^52, 4^28, 5^14, 6^11, 7^3, 8^5, 9^2, 10^2, 12, 13, 16, 23, 25, 29, 76, 88, 90, 92, 111, 114, 130, 134, 145, 165, 166, 170, 174^2, 176, 178, 184, 185, 186, 191, 197, 198, 201^2, 202, 214^3, 215^2, 217, 258, 261, 305, 370, 434]
surviving nonsolo ucounts = 37[29, 76, 88, 90, 92, 111, 114, 130, 134, 145, 165, 166, 170, 174^2, 176, 178, 184, 185, 186, 191, 197, 198, 201^2, 202, 214^3, 215^2, 217, 258, 261, 305, 370, 434]
ids = [289, 467, 169, 516, 558, 489, 564, 597, 277, 150, ...]

====================================================================================

UMI info for barcode GTGGGTCCAAGTTAAG-1 contig 1 = GGCTGGGGTC...
umi ACCTCAATTT = 178 reads: +388 validated
umi ACCTTTGTCC = 213 reads: +388 validated
umi ACTTCACGGG = 21 reads: -7 +10 -1XX +7 -1XX +21 -1XX +8 -1XX +18 -160XX +1 -2XX +2 -1XX +12 -1XX +5 -1XX +5 -1XX +2 -1XX +31 -1XX +4 -1XX +2 -1XX +1 -78XX invalidated
umi AGGAATCTTC = 176 reads: +388 validated
umi CCACTCTATT = 447 reads: +388 validated
umi CCAGTGTCTT = 165 reads: +388 validated
umi CCCCAGGTCT = 176 reads: +388 validated
umi CCTCCAGCGG = 216 reads: +388 validated
umi CTCCGGGACT = 133 reads: +388 validated
umi GCCTATTTCG = 219 reads: +388 validated
umi GCTCTACTCG = 186 reads: +388 validated
umi GGACCTTCAT = 191 reads: +388 validated
umi TCAATATGGG = 75 reads: +388 validated
umi TCCCATGTTG = 215 reads: +388 validated
umi TCCCCAGGAT = 114 reads: +388 validated
umi TGGACCGCCA = 261 reads: +388 validated
umi TTAACCGCCT = 176 reads: +388 validated
umi TTTGGACGGA = 216 reads: +388 validated

UMI info for barcode GTGGGTCCAAGTTAAG-1 contig 2 = AGCTCTCAGA...
umi CATGCTGTCT = 199 reads: +412 validated
umi CCCCATTCAC = 211 reads: +412 validated
umi CCCCTATCCT = 187 reads: +412 validated
umi CCCTCGCTGT = 187 reads: +412 validated
umi CCGAGAGGCC = 382 reads: +15 -3XX +3 -1XX +3 -6XX +2 -2XX +2 -1XX +1 -130X +1 -1XX +1 -3XX +1 -4XX +1 -1XX +1 -1XX +228 invalidated
umi CTGCCACGCG = 263 reads: +412 validated
umi CTTAAGACCT = 30 reads: +214 -1 +3 -2 +1 -1 +2 -1 +9 -4 +12 -1 +13 -47 +7 -1 +4 -1 +58 -1 +14 -1 +1 -1 +1 -1 +5 -1 +3 -1 non-validated
umi CTTCCATCTG = 202 reads: +412 validated
umi GACCTTATGC = 198 reads: +412 validated
umi TCCCTACACT = 195 reads: +412 validated
umi TGAACCATTA = 204 reads: +412 validated
umi TTGGCTGGAC = 133 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=641]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-394 ==> 0-352 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=6)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 17 umis using 496 reads
cdr3 = CCSYAGTYTWVF at 366, score = 8 + 8
umis assigned: [37, 43, 57, 70, 153, 157, 175, 210, 277, 345] and 8 others
of which 18 are surviving nonsolos
reads assigned: 3312
start codons at 42, 181, 199, 243, 250, 349, 376
confident = true

TIG 2[bases=651]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=9)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
491-651 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 12 umis using 302 reads
cdr3 = CARGPNWYHFDYW at 421, score = 9 + 7
umis assigned: [139, 176, 177, 186, 195, 284, 289, 292, 317, 491] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2335
start codons at 79, 230, 235, 262, 273, 382, 545
confident = true

REJECT CONTIGS

TIG 1[bases=746]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-79 ==> 0-43 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
82-191 ==> 0-109 on segment before IGLV1-51 exon 2 [len=109] (mis=2)
188-498 ==> 43-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=9) [SHIFT!]
497-535 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
535-746 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [1, 150, 169, 325, 516, 558, 564]
of which 7 are surviving nonsolos
reads assigned: 850
start codons at 36, 350, 474
confident = false
did not find CDR3
now this is a cell
paired!

CTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGGCCCGAACTGGTACCATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCACCTACACTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1137 = GTGGGTCCACCCAGTG-1

using 202 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 199]
surviving nonsolo ucounts = 1[199]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1141 = GTGGGTCCACTGAAGG-1

using 323 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 317]
surviving nonsolo ucounts = 1[317]
ids = [0]

====================================================================================

UMI info for barcode GTGGGTCCACTGAAGG-1 contig 1 = GATCAGGACT...
umi CAGACCCTAT = 269 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=519]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-519 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1151 = GTGGGTCCAGCGATCC-1

using 82 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 18[2^8, 3^2, 4^2, 5^3, 9, 12^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1165 = GTGGGTCCATGTTCCC-1

using 402 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[400]
surviving nonsolo ucounts = 1[400]
ids = [0]

====================================================================================

UMI info for barcode GTGGGTCCATGTTCCC-1 contig 1 = AGGAATCAGA...
umi TCGAATTAGG = 398 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 395
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1166 = GTGGGTCCATTCGACA-1

using 569 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[254, 313]
surviving nonsolo ucounts = 2[254, 313]
ids = [1, 2]

====================================================================================

UMI info for barcode GTGGGTCCATTCGACA-1 contig 1 = AGCTTCAGCT...
umi CACCCTCGCG = 220 reads: +388 validated

UMI info for barcode GTGGGTCCATTCGACA-1 contig 2 = CCTGGGTCAG...
umi CTGTGCATGC = 314 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=527]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-527 ==> 0-93 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 46, 200, 350, 375, 380
confident = false

TIG 2[bases=573]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
399-437 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYGSSPRTF at 376, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 52, 260, 386, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1177 = GTGGGTCGTCACCCAG-1

using 454 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[452]
surviving nonsolo ucounts = 1[452]
ids = [2]

====================================================================================

UMI info for barcode GTGGGTCGTCACCCAG-1 contig 1 = AGGAGTCAGA...
umi TACTGAGTCG = 449 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=12)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 444
start codons at 27, 33, 89, 102, 241, 259, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1179 = GTGGGTCGTCATATGC-1

using 493 reads

====================================================================================

graph has 164 edges initially, 34 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[89, 139, 262]
surviving nonsolo ucounts = 3[89, 139, 262]
ids = [3, 1, 2]

====================================================================================

UMI info for barcode GTGGGTCGTCATATGC-1 contig 1 = GAAGAGCTGC...
umi GTATTATATT = 257 reads: +388 validated

UMI info for barcode GTGGGTCGTCATATGC-1 contig 2 = AGGAGTCAGA...
umi TAGTCCTTAG = 90 reads: +263 -1XX +121 invalidated

UMI info for barcode GTGGGTCGTCATATGC-1 contig 3 = GGAGTCAGAC...
umi CTAGAGTGGC = 138 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYGSSPPITF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 33, 241, 367, 463
confident = false

TIG 2[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=24)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CHQYNSYSTF at 354, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 86
start codons at 27, 33, 89, 102, 238, 241, 334, 454
confident = false

TIG 3[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-370 ==> 0-344 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CQQYNRGWTF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 26, 32, 88, 101, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1191 = GTGGGTCGTTAGGGTG-1

using 202 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 196]
surviving nonsolo ucounts = 1[196]
ids = [1]

====================================================================================

UMI info for barcode GTGGGTCGTTAGGGTG-1 contig 1 = GAGGAATCAG...
umi CCAATCGAGA = 156 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=475]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-475 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 156
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1197 = GTGGGTCGTTGATTCG-1

using 206 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode GTGGGTCGTTGATTCG-1 contig 1 = ACCCAAAAAC...
umi TTCGCCCAAC = 172 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=521]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-521 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1206 = GTGGGTCTCACCCGAG-1

using 286 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 283]
surviving nonsolo ucounts = 1[283]
ids = [1]

====================================================================================

UMI info for barcode GTGGGTCTCACCCGAG-1 contig 1 = AGGAGTCAGA...
umi TTGAATTAAC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1207 = GTGGGTCTCACCGGGT-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1208 = GTGGGTCTCAGAGGTG-1

using 396 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2, 3, 4^3, 375]
surviving nonsolo ucounts = 1[375]
ids = [9]

====================================================================================

REJECT CONTIGS

TIG 1[bases=489]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=2)
30-50 ==> 1493-1513 on rc of segment before IGLV10-54 exon 1 [len=5448] (mis=0)
34-231 ==> 0-197 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=5)
240-278 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
278-489 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 34
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1211 = GTGGGTCTCAGTTTGG-1

using 389 reads

====================================================================================

graph has 124 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 22, 175, 188]
surviving nonsolo ucounts = 3[22, 175, 188]
ids = [3, 4, 5]

====================================================================================

UMI info for barcode GTGGGTCTCAGTTTGG-1 contig 1 = GGGGGGGTCT...
umi GTATCTTCGA = 155 reads: +388 validated

UMI info for barcode GTGGGTCTCAGTTTGG-1 contig 2 = CGAGCCCAGC...
umi CGGTCTTCGT = 20 reads: +236 -1 +1 -2 +3 -1 +13 -1 +62 -1 +43 -60 non-validated
umi TCTTGTTGTG = 174 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=541]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-370 ==> 0-329 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=17)
391-429 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
429-541 ==> 0-112 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSFTSTYRNLF at 365, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 41, 249, 252, 271
confident = false

TIG 2[bases=496]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=33)
449-491 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
junction support: 1 umis using 12 reads
cdr3 = CARVLNYFHLIYGLDAW at 409, score = 9 + 7
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 192
start codons at 67, 218, 223, 261, 281, 284, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1212 = GTGGGTCTCATCTGTT-1

using 571 reads

====================================================================================

graph has 742 edges initially, 4 edges after simplification

total ucounts = 250
nonsolo ucounts = 97[2^45, 3^25, 4^8, 5^6, 6^6, 7^3, 8, 9, 14, 102]
surviving nonsolo ucounts = 1[102]
ids = [177]

====================================================================================

UMI info for barcode GTGGGTCTCATCTGTT-1 contig 1 = AGCACAACGC...
umi GCTAATTGCT = 84 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=477]
16-369 ==> 0-353 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=1)
372-393 ==> 0-21 on |32|IGHD6-13|D-REGION| [len=21] (mis=2)
408-446 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
446-477 ==> 0-31 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARVCCIAAAGTSHQLSYW at 358, score = 9 + 7
umis assigned: [177]
of which 1 are surviving nonsolos
reads assigned: 82
start codons at 16, 167, 172, 214, 219, 236, 313, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1215 = GTGGGTCTCCACGAAT-1

using 611 reads

====================================================================================

graph has 286 edges initially, 12 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[56, 244, 305]
surviving nonsolo ucounts = 3[56, 244, 305]
ids = [6, 8, 2]

====================================================================================

UMI info for barcode GTGGGTCTCCACGAAT-1 contig 1 = AGGAGTCAGA...
umi CCCTGGATCA = 306 reads: +388 validated
umi TACCCCACCA = 58 reads: -11 +377 non-validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 45 reads
cdr3 = CQQYNSYPRTF at 354, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 359
start codons at 27, 33, 89, 102, 334, 457
confident = true

REJECT CONTIGS

TIG 1[bases=450]
0-261 ==> 74-335 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=16)
276-314 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
314-450 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 253, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 1, 356
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1233 = GTGGGTCTCGCCATAA-1

using 829 reads

====================================================================================

graph has 1117 edges initially, 20 edges after simplification

total ucounts = 481
nonsolo ucounts = 171[2^81, 3^42, 4^30, 5^7, 6^5, 7^3, 8^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1236 = GTGGGTCTCGGTGTTA-1

using 227 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 218]
surviving nonsolo ucounts = 1[218]
ids = [4]

====================================================================================

UMI info for barcode GTGGGTCTCGGTGTTA-1 contig 1 = GTCAGACTCA...
umi GGCGGAGGTA = 177 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=11)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYDSFSWTF at 350, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 23, 29, 85, 98, 234, 237, 330, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1253 = GTGGGTCTCTGTTTGT-1

using 139 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[139]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1256 = GTGGGTCTCTTTAGTC-1

using 414 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[412]
surviving nonsolo ucounts = 1[412]
ids = [1]

====================================================================================

UMI info for barcode GTGGGTCTCTTTAGTC-1 contig 1 = GGGACTGATC...
umi ACAACGTTTT = 409 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=572]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=2)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTPLFTF at 372, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 406
start codons at 36, 69, 105, 193, 355, 375, 478
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1265 = GTGTGCGAGCCTATGT-1

using 78 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[5, 67]
surviving nonsolo ucounts = 1[67]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=426]
0-368 ==> 3-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=14)
385-426 ==> 0-41 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
cdr3 = CARAHGDYYTLLDFW at 357, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 18, 62, 148, 348
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1283 = GTGTGCGAGGTTCCTA-1

using 120 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 4, 108]
surviving nonsolo ucounts = 1[108]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1288 = GTGTGCGAGTGATCGG-1

using 629 reads

====================================================================================

graph has 888 edges initially, 12 edges after simplification

total ucounts = 309
nonsolo ucounts = 115[2^53, 3^20, 4^16, 5^6, 6^6, 7^4, 8^4, 9, 10, 12, 13, 15, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1289 = GTGTGCGAGTGCCAGA-1

using 289 reads

====================================================================================

graph has 430 edges initially, 2 edges after simplification

total ucounts = 134
nonsolo ucounts = 57[2^25, 3^11, 4^8, 5^2, 6^4, 7^2, 8, 10^3, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1293 = GTGTGCGAGTGGGATC-1

using 234 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [0]

====================================================================================

UMI info for barcode GTGTGCGAGTGGGATC-1 contig 1 = GGGGAGTCAG...
umi AGTCAACCCC = 231 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=543]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
369-407 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQSYSTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 28, 34, 90, 103, 188, 239, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1295 = GTGTGCGAGTTGCAGG-1

using 2378 reads

====================================================================================

graph has 1460 edges initially, 42 edges after simplification

total ucounts = 1085
nonsolo ucounts = 553[2^303, 3^132, 4^62, 5^29, 6^8, 7^8, 8^4, 9^3, 10, 11, 13, 253]
surviving nonsolo ucounts = 1[253]
ids = [76]

====================================================================================

UMI info for barcode GTGTGCGAGTTGCAGG-1 contig 1 = GGAGGAGTCA...
umi AATTTTGCCA = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQDYTYPFSF at 356, score = 9 + 7
umis assigned: [76]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 29, 35, 91, 104, 186, 189, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1300 = GTGTGCGCAACAACCT-1

using 392 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[392]
surviving nonsolo ucounts = 1[392]
ids = [0]

====================================================================================

UMI info for barcode GTGTGCGCAACAACCT-1 contig 1 = GGGGAGGAAC...
umi ACATTGTCTG = 394 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 387
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1319 = GTGTGCGCAGCGATCC-1

using 315 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 307]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=445]
1-113 ==> 2195-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
109-271 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
271-309 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
309-445 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 302
start codons at 26, 79, 134, 139, 252, 351
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1324 = GTGTGCGCAGTCGTGC-1

using 167 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[167]
surviving nonsolo ucounts = 1[167]
ids = [0]

====================================================================================

UMI info for barcode GTGTGCGCAGTCGTGC-1 contig 1 = ACAACAGGCA...
umi CGGGGGATCT = 149 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=464]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
386-425 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
425-464 ==> 0-39 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYYGSPRTF at 364, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 22, 25, 80, 94, 347, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1331 = GTGTGCGCATCTCGCT-1

using 22 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1332 = GTGTGCGCATCTGGTA-1

using 335 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 321]
surviving nonsolo ucounts = 1[321]
ids = [10]

====================================================================================

UMI info for barcode GTGTGCGCATCTGGTA-1 contig 1 = AGTCTCAGTC...
umi TGTGCAGGGG = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYTTLLTF at 347, score = 9 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1343 = GTGTGCGGTAGTAGTA-1

using 247 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [4]

====================================================================================

UMI info for barcode GTGTGCGGTAGTAGTA-1 contig 1 = GTCAGTCCCA...
umi TCGTTGGTAT = 240 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYDNPPMYTF at 350, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 23, 29, 85, 98, 237, 360, 374, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1345 = GTGTGCGGTATATGAG-1

using 317 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 308]
surviving nonsolo ucounts = 1[308]
ids = [0]

====================================================================================

UMI info for barcode GTGTGCGGTATATGAG-1 contig 1 = GGGGAGGAAC...
umi CCACTCTGAC = 269 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=499]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1346 = GTGTGCGGTCAAAGAT-1

using 272 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[270]
surviving nonsolo ucounts = 1[270]
ids = [2]

====================================================================================

UMI info for barcode GTGTGCGGTCAAAGAT-1 contig 1 = TGATCAGGAC...
umi GCCCTTCAGC = 230 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=505]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
397-434 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
434-505 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CMQALQSPRGLTF at 367, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 31, 64, 100, 188, 350, 370, 476
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1379 = GTGTGCGTCATGCATG-1

using 157 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 3, 8, 136]
surviving nonsolo ucounts = 1[136]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=515]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-315 ==> 0-285 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
315-389 ==> 289-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2) [SHIFT!]
388-426 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
426-515 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=1)
cdr3 = CQQYYNAPRTF at 365, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 30, 99, 348, 381, 468
confident = false
not full
frameshifted full length transcript of length 515
VJ delta = 18
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1382 = GTGTGCGTCCAGAAGG-1

using 430 reads

====================================================================================

graph has 144 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[13, 79, 110, 225]
surviving nonsolo ucounts = 3[79, 110, 225]
ids = [3, 0, 6]

====================================================================================

UMI info for barcode GTGTGCGTCCAGAAGG-1 contig 1 = CCACTCAGGA...
umi CCGATTAGTG = 68 reads: +388 validated

UMI info for barcode GTGTGCGTCCAGAAGG-1 contig 2 = AGCTTCAGCT...
umi TTTAATTTCC = 217 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=454]
16-367 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
365-404 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
404-454 ==> 0-50 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CLQDYTYPFSF at 343, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 16, 22, 78, 91, 173, 176, 446
confident = false

TIG 2[bases=594]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-594 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 47, 201, 351, 376, 381
confident = false

REJECT CONTIGS

TIG 1[bases=494]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
0-79 ==> 7407-7486 on rc of segment before IGHV1-24 exon 2 [len=7486] (mis=0)
43-90 ==> 3154-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=6)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=13)
432-463 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=6)
468-494 ==> 0-26 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 93
start codons at 79, 230, 235, 382, 440, 467, 470
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1389 = GTGTGCGTCGACAGCC-1

using 57 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2^2, 12, 41]
surviving nonsolo ucounts = 1[41]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1390 = GTGTGCGTCGCCATAA-1

using 204 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 4, 197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=492]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
0-25 ==> 5975-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=1)
0-25 ==> 5975-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=1)
25-70 ==> 0-45 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
70-316 ==> 102-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=23)
317-356 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
356-492 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYGSSPMYTF at 292, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 25, 176, 275, 316, 398
confident = false
not full
full length transcript of length 492
VJ delta = 72
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1391 = GTGTGCGTCGCTTGTC-1

using 2511 reads

====================================================================================

graph has 1315 edges initially, 60 edges after simplification

total ucounts = 265
nonsolo ucounts = 119[2^34, 3^21, 4^14, 5^7, 6^2, 8^3, 10, 13, 20, 22, 24, 25, 30, 31, 33, 37, 38^2, 39, 40, 45^2, 47^2, 48, 50, 53, 56, 58, 59, 61, 62, 63, 64, 65^2, 69, 72, 80, 109, 119, 121, 124, 125]
surviving nonsolo ucounts = 35[22, 24, 25, 30, 31, 33, 37, 38^2, 39, 40, 45^2, 47^2, 48, 50, 53, 56, 58, 59, 61, 62, 63, 64, 65^2, 69, 72, 80, 109, 119, 121, 124, 125]
ids = [8, 98, 74, 211, 52, 85, 17, 198, 253, 175, ...]

====================================================================================

UMI info for barcode GTGTGCGTCGCTTGTC-1 contig 1 = GTCGGCGGTG...
umi ACAGATCTAC = 27 reads: +433 validated
umi ACAGCATCGC = 57 reads: +433 validated
umi CACGACTTGG = 44 reads: +337 -1X +2 -1 +4 -2X +1 -1 +3 -1 +5 -1 +3 -1 +4 -3 +2 -1X +2 -1 +4 -1 +1 -51 invalidated
umi GTAGCATCGC = 53 reads: +433 validated
umi TTGGCCAGCG = 35 reads: +377 -56 non-validated

UMI info for barcode GTGTGCGTCGCTTGTC-1 contig 2 = GGCACTGTGC...
umi ACCCCTTGCT = 108 reads: -371X +3 -2X +30 invalidated
umi AGTTGCTCTA = 40 reads: +381 -10 +15 non-validated
umi ATACTAACCG = 31 reads: +247 -1X +3 -3 +37 -21 +94 invalidated
umi ATTGGTTTCC = 62 reads: +398 -8 non-validated
umi CAACGGGTAT = 18 reads: +37 -2X +1 -3X +273 -90 invalidated
umi CAGCGGACCG = 33 reads: +58 -25 +317 -1 +4 -1 non-validated
umi CATACGCCCT = 53 reads: +406 validated
umi CCTCCAGTGT = 24 reads: -38 +159 -21 +145 -38 +5 non-validated
umi CGCACACACA = 123 reads: -386 +20 non-validated
umi CTATAACATT = 57 reads: +406 validated
umi CTCATTACGG = 128 reads: -371X +3 -1XX +31 invalidated
umi CTTCTACAGG = 80 reads: -358 +1 -12X +3 -1XX +31 invalidated
umi GCCACTTACG = 46 reads: -15 +391 non-validated
umi GCGCTGACTT = 58 reads: +406 validated
umi GCTTCAACTC = 48 reads: +331 -1 +74 non-validated
umi GGAAAGGCCA = 39 reads: +406 validated
umi GGCCGGGGTA = 66 reads: -371X +3 -1X +23 -8 invalidated
umi GTTTAGTTCT = 64 reads: +406 validated
umi TAAAGAGTCC = 37 reads: +247 -1 +158 non-validated
umi TATGTTGGCG = 128 reads: -390 +16 non-validated
umi TCACGGCCAC = 30 reads: +355 -12 +13 -1 +19 -1 +5 non-validated
umi TCTTCTCCTT = 47 reads: -23 +371 -7 +5 non-validated
umi TGTATATTCT = 50 reads: -1 +405 non-validated
umi TTCACGGTTC = 50 reads: +277 -1XX +128 invalidated
umi TTTAATGGTC = 57 reads: +350 -1 +2 -2 +51 non-validated

GOOD CONTIGS

TIG 1[bases=498]
0-50 ==> 30-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
50-401 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=13)
443-483 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
junction support: 3 umis using 15 reads
cdr3 = CARDLDGDCSGGNCYGPDYW at 392, score = 8 + 6
umis assigned: [17, 18, 80, 185, 253]
of which 5 are surviving nonsolos
reads assigned: 214
start codons at 50, 201, 206, 259, 267, 285, 353, 408, 435
confident = true

TIG 2[bases=646]
29-398 ==> 0-369 on |376|IGLV5-37|L-REGION+V-REGION| [len=369] (mis=4)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 102 reads
cdr3 = CMIWPSNSPVVF at 371, score = 8 + 8
umis assigned: [21, 51, 52, 68, 74, 85, 86, 98, 109, 119] and 15 others
of which 25 are surviving nonsolos
reads assigned: 1443
start codons at 10, 29, 171, 303, 354, 374
confident = true

REJECT CONTIGS

TIG 1[bases=547]
1-69 ==> 5669-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
21-374 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [8, 56, 67, 117, 124]
of which 5 are surviving nonsolos
reads assigned: 337
start codons at 21, 27, 83, 331, 364, 453
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTATTGTGCGAGAGATTTAGATGGGGATTGTAGTGGTGGGAACTGCTATGGACCCGACTACTGGGGCCAGGGAATCCTGGTCACCGTCTCCTCAG <==> TCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATTCTCCCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1392 = GTGTGCGTCGGAATCT-1

using 54 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[53]
surviving nonsolo ucounts = 1[53]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1401 = GTGTGCGTCTGCCAGG-1

using 207 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 4, 5, 192]
surviving nonsolo ucounts = 1[192]
ids = [7]

====================================================================================

UMI info for barcode GTGTGCGTCTGCCAGG-1 contig 1 = AGCTCTGAGA...
umi TTTATCACCA = 186 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=629]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=3)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=30)
467-515 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
515-629 ==> 0-114 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CARVLDDYCLGGICSYYFDSW at 421, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 79, 382, 437
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1407 = GTGTTAGAGAAGGGTA-1

using 280 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 272]
surviving nonsolo ucounts = 1[272]
ids = [3]

====================================================================================

UMI info for barcode GTGTTAGAGAAGGGTA-1 contig 1 = GGGGAGGAAC...
umi ATTTAGTGAT = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=481]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-481 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1409 = GTGTTAGAGACAGGCT-1

using 151 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 5, 138]
surviving nonsolo ucounts = 1[138]
ids = [4]

====================================================================================

UMI info for barcode GTGTTAGAGACAGGCT-1 contig 1 = GTGGGCACAA...
umi TGTTTTGGCT = 123 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=541]
0-37 ==> 14-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
37-393 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
428-541 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CQSYDTSLSGSVF at 361, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 37, 191, 194, 245, 344, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1422 = GTGTTAGAGCCAACAG-1

using 10040 reads

====================================================================================

graph has 4432 edges initially, 78 edges after simplification

total ucounts = 662
nonsolo ucounts = 267[2^94, 3^54, 4^33, 5^15, 6^11, 7^9, 8^4, 9^3, 10^2, 12, 14, 26, 28, 45, 85, 106, 108, 119, 132, 138, 140, 149, 162, 164, 175, 189, 193, 197, 200, 203, 206, 207, 211, 213, 219, 221, 226, 230, 233, 239, 244, 245, 252, 261, 264^2, 277, 314, 319, 554, 1096]
surviving nonsolo ucounts = 38[26, 45, 85, 106, 108, 119, 132, 138, 140, 149, 162, 164, 175, 189, 193, 197, 200, 203, 206, 211, 213, 219, 221, 226, 230, 233, 239, 244, 245, 252, 261, 264^2, 277, 314, 319, 554, 1096]
ids = [283, 29, 597, 217, 529, 547, 367, 152, 527, 369, ...]

====================================================================================

UMI info for barcode GTGTTAGAGCCAACAG-1 contig 1 = AGCTCTGGGA...
umi ACAATTTCCC = 51 reads: +245 -1 +36 -2X +1 -2 +6 -7X +62 -2 +1 -2 +7 -1 +1 -1 +2 -1 +2 -1 +56 -1 +14 invalidated
umi ATTACGGTCT = 225 reads: +443 -1 +5 -5 non-validated
umi CAAAGCCCCG = 140 reads: +454 validated
umi CACAGATCTG = 553 reads: -236X +218 invalidated
umi CTAATGTCCT = 25 reads: +225 -1 +1 -1 +128 -1 +81 -16 non-validated
umi CTCTAAAGGG = 193 reads: +454 validated
umi TCGAACGTGG = 207 reads: +454 validated
umi TGGTAATGTA = 87 reads: +406 -1 +20 -27 non-validated

UMI info for barcode GTGTTAGAGCCAACAG-1 contig 2 = GTGGGCTCAG...
umi ATTTACGCGC = 192 reads: +385 validated
umi CGTTTTATCA = 263 reads: +385 validated
umi GATTATTGGT = 254 reads: +385 validated
umi GCACAGTAAG = 147 reads: +385 validated
umi TCATATCTCC = 163 reads: +385 validated
umi TCCATCGTGT = 256 reads: +385 validated
umi TCCCAGCCTG = 281 reads: +385 validated
umi TGCAATAGCC = 212 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=605]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=0)
445-476 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=5)
471-534 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
534-605 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 96 reads
cdr3 = CTTDLGRYCSSTSCYGYYYYGMDVW at 428, score = 8 + 7
umis assigned: [29, 138, 152, 167, 283, 300, 553, 597]
of which 8 are surviving nonsolos
reads assigned: 1441
start codons at 80, 236, 303, 360, 389, 471, 491
confident = true

TIG 2[bases=631]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=1)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
420-631 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 292 reads
cdr3 = CYSTDSSGNHKGVF at 350, score = 7 + 8
umis assigned: [145, 279, 364, 369, 528, 540, 543, 584]
of which 8 are surviving nonsolos
reads assigned: 1747
start codons at 35, 96, 165, 183, 234, 296, 333
confident = true

REJECT CONTIGS

TIG 1[bases=653]
0-52 ==> 62-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
52-405 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [91, 107, 128, 223, 234, 262, 288, 476, 507, 527] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4060
start codons at 52, 356, 381, 386, 398
confident = false
did not find CDR3

TIG 2[bases=560]
22-380 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
387-415 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=2)
432-458 ==> 20-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
458-560 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [217, 356, 367, 404, 566, 608]
of which 6 are surviving nonsolos
reads assigned: 1021
start codons at 22, 66, 245, 248, 328, 337, 476, 537
confident = false
full length stopped transcript of length 560
frameshifted full length stopped transcript of length 560
did not find CDR3
now this is a cell
paired!

ACAGATTTGGGTCGCTATTGTAGTAGTACCAGCTGCTATGGTTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> GCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCATAAAGGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1423 = GTGTTAGAGCCAGTTT-1

using 577 reads

====================================================================================

graph has 154 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[259, 316]
surviving nonsolo ucounts = 2[259, 316]
ids = [3, 1]

====================================================================================

UMI info for barcode GTGTTAGAGCCAGTTT-1 contig 1 = GGGAGGAACT...
umi TCATCCGCTT = 260 reads: +382 validated

UMI info for barcode GTGTTAGAGCCAGTTT-1 contig 2 = AGGAGTCAGA...
umi GATGGTTTAC = 316 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNNWPRTF at 356, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 35, 104, 240, 459
confident = false

TIG 2[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1424 = GTGTTAGAGCTGAAAT-1

using 364 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 355]
surviving nonsolo ucounts = 1[355]
ids = [3]

====================================================================================

UMI info for barcode GTGTTAGAGCTGAAAT-1 contig 1 = AGCTCTGGGA...
umi CATTCTAGGT = 328 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=543]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=12)
466-516 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
516-543 ==> 0-27 on |60|IGHM|C-REGION| [len=1358] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CTTGSWSTVTTRLWAFDIW at 428, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 80, 140, 236, 303, 332, 360, 374, 381, 389, 497
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1426 = GTGTTAGAGGATGGTC-1

using 366 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 7, 356]
surviving nonsolo ucounts = 1[356]
ids = [2]

====================================================================================

UMI info for barcode GTGTTAGAGGATGGTC-1 contig 1 = ATCAGTCCCA...
umi GACGTGGTTA = 363 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 85.1427 = GTGTTAGAGGCAAAGA-1

using 170 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 164]
surviving nonsolo ucounts = 1[164]
ids = [2]

====================================================================================

UMI info for barcode GTGTTAGAGGCAAAGA-1 contig 1 = GAATCAGTCC...
umi GTAAATGCAG = 152 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-476 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!
sorting bam, mem = 0.07
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk085-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk085-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

65.961 seconds used processing barcodes, peak mem = 0.23
