[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.14 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk080-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk080-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk080.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.0 = GGTATTGCATCCGCGA-1

using 1060 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 1057]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2 = GGTATTGCATCCTAGA-1

using 322 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2, 3, 10, 18, 288]
surviving nonsolo ucounts = 1[288]
ids = [3]

====================================================================================

UMI info for barcode GGTATTGCATCCTAGA-1 contig 1 = GGGGGCTGGG...
umi CTTGCTCATT = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=534]
45-406 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
395-433 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
433-534 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSYTSSSTLVF at 369, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 45, 202, 246, 253, 256
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.8 = GGTATTGCATTAGCCA-1

using 375 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[371]
surviving nonsolo ucounts = 1[371]
ids = [2]

====================================================================================

UMI info for barcode GGTATTGCATTAGCCA-1 contig 1 = GAAGAGCTGC...
umi CTATTTCGGT = 374 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 366
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.23 = GGTATTGGTCAGAATA-1

using 415 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[5, 8, 13, 384]
surviving nonsolo ucounts = 1[384]
ids = [5]

====================================================================================

UMI info for barcode GGTATTGGTCAGAATA-1 contig 1 = GGGGAGGAAC...
umi CCCGATATTG = 388 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQQRSNRLTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 36, 241, 244, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.28 = GGTATTGGTCCTCCAT-1

using 441 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 5^2, 423]
surviving nonsolo ucounts = 1[423]
ids = [4]

====================================================================================

UMI info for barcode GGTATTGGTCCTCCAT-1 contig 1 = AGCTCTCAGA...
umi CCATGACGCC = 363 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=513]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=13)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
488-513 ==> 0-25 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRIYAFDIW at 421, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 79, 235, 307, 356, 382, 440, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.30 = GGTATTGGTCTCAACA-1

using 2035 reads

====================================================================================

graph has 2752 edges initially, 22 edges after simplification

total ucounts = 834
nonsolo ucounts = 365[2^163, 3^83, 4^51, 5^28, 6^8, 7^17, 8, 9^2, 10^6, 11, 12, 13, 14, 15, 329]
surviving nonsolo ucounts = 1[329]
ids = [17]

====================================================================================

UMI info for barcode GGTATTGGTCTCAACA-1 contig 1 = GGAGTCAGAC...
umi AACAACTGGG = 327 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-369 ==> 0-343 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNTPWTF at 353, score = 8 + 8
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 26, 32, 88, 101, 333, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.44 = GGTATTGGTGGTACAG-1

using 1755 reads

====================================================================================

graph has 2370 edges initially, 28 edges after simplification

total ucounts = 811
nonsolo ucounts = 348[2^131, 3^90, 4^44, 5^23, 6^23, 7^12, 8^9, 9^4, 10^4, 11^5, 14, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.45 = GGTATTGGTGGTGTAG-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.79 = GGTATTGTCCACGTGG-1

using 402 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[395]
surviving nonsolo ucounts = 1[395]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=561]
0-80 ==> 5533-5613 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=4)
30-390 ==> 0-360 on |271|IGKV2D-26|L-REGION+V-REGION| [len=360] (mis=1)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 393
start codons at 30, 63, 99, 150, 187, 250, 349, 369, 376, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.80 = GGTATTGTCCAGTATG-1

using 825 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 7, 808]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.97 = GGTATTGTCGAGCCCA-1

using 318 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 312]
surviving nonsolo ucounts = 1[312]
ids = [3]

====================================================================================

UMI info for barcode GGTATTGTCGAGCCCA-1 contig 1 = GAGCTGCTCA...
umi ATTCCCTCCA = 314 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGSSPMYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 30, 238, 364, 378, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.100 = GGTATTGTCGCCAAAT-1

using 252 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3^2, 4, 7, 230]
surviving nonsolo ucounts = 1[230]
ids = [3]

====================================================================================

UMI info for barcode GGTATTGTCGCCAAAT-1 contig 1 = TGGGACACAG...
umi CATTAAAGTA = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=460]
11-362 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
361-399 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
399-460 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQANSFPGAF at 338, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 11, 17, 73, 86, 222, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.102 = GGTATTGTCGGAAACG-1

using 5708 reads

====================================================================================

graph has 3415 edges initially, 44 edges after simplification

total ucounts = 623
nonsolo ucounts = 307[2^101, 3^65, 4^40, 5^29, 6^14, 7^12, 8^11, 9^4, 10^8, 11^3, 12^2, 16, 38, 69, 75, 84, 138, 171, 277, 289, 313, 317, 318, 326, 331, 348, 353, 381, 416]
surviving nonsolo ucounts = 16[5, 69, 84, 138, 171, 277, 289, 313, 317, 318, 326, 331, 348, 353, 381, 416]
ids = [418, 320, 330, 454, 266, 135, 437, 250, 57, 146, ...]

====================================================================================

UMI info for barcode GGTATTGTCGGAAACG-1 contig 1 = AGGAGTCAGT...
umi AACCATCGAC = 357 reads: +385 validated
umi AATTGAGTCA = 316 reads: +385 validated
umi AGGATTGCAT = 272 reads: +385 validated
umi AGTGCTCCCG = 320 reads: +385 validated
umi CCATACTCTG = 318 reads: +385 validated
umi CCCCTCCTTT = 171 reads: +385 validated
umi CGGCATCCCA = 323 reads: +385 validated
umi CGTATTCCTA = 68 reads: -8 +377 non-validated
umi GAAGTCCCTC = 395 reads: +86 -1XX +298 invalidated
umi GGCTCATCAC = 290 reads: +385 validated
umi GTCATCCCAC = 136 reads: +385 validated
umi GTTCTTCCCT = 417 reads: +385 validated
umi TGAGTGTCTT = 347 reads: +385 validated
umi TTGCCTTCCC = 329 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-359 ==> 0-332 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=10)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 14 umis using 645 reads
cdr3 = CQESYNGATF at 354, score = 9 + 8
umis assigned: [22, 57, 135, 146, 250, 266, 315, 320, 369, 437] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3971
start codons at 27, 33, 89, 102, 238, 370, 454
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.108 = GGTATTGTCTAGAGTC-1

using 408 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 401]
surviving nonsolo ucounts = 1[401]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=566]
4-320 ==> 37-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
317-355 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
355-566 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 288, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 396
start codons at 121, 271, 296, 301
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.110 = GGTATTGTCTCAAGTG-1

using 235 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 230]
surviving nonsolo ucounts = 1[230]
ids = [0]

====================================================================================

UMI info for barcode GGTATTGTCTCAAGTG-1 contig 1 = GCTTTCTGAG...
umi CCTCCTTAGG = 220 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=538]
14-385 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
423-474 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
474-538 ==> 0-64 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 374, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 14, 35, 79, 165
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.111 = GGTATTGTCTCACATT-1

using 366 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[362]
surviving nonsolo ucounts = 1[362]
ids = [0]

====================================================================================

UMI info for barcode GGTATTGTCTCACATT-1 contig 1 = ATCACATAAC...
umi CAAATCGGTG = 355 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=568]
0-58 ==> 3-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
58-411 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=3)
434-497 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CATVLGQQLVRSAYYYYGMDVW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 58, 209, 256, 355, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.123 = GGTATTGTCTTCCTTC-1

using 63 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3, 8, 10, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.126 = GGTATTGTCTTTAGGG-1

using 1736 reads

====================================================================================

graph has 1282 edges initially, 8 edges after simplification

total ucounts = 281
nonsolo ucounts = 113[2^48, 3^23, 4^12, 5^11, 6^5, 7^3, 8^2, 11, 20, 42, 62, 99, 112, 195, 337, 355]
surviving nonsolo ucounts = 7[42, 62, 99, 112, 195, 337, 355]
ids = [71, 158, 189, 262, 6, 191, 257]

====================================================================================

UMI info for barcode GGTATTGTCTTTAGGG-1 contig 1 = AGCTCTGAGA...
umi CAATATTCGT = 42 reads: +288 -3 +66 -55 non-validated
umi GCTATCTTTC = 53 reads: +375 -37 non-validated
umi GTTACGGTCT = 83 reads: +362 -8 +42 non-validated
umi GTTCACCATT = 340 reads: +412 validated
umi TTATCGTGGG = 355 reads: +412 validated
umi TTCCGTCATC = 116 reads: +367 -1 +44 non-validated

GOOD CONTIGS

TIG 1[bases=593]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=5)
443-491 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
491-593 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 64 reads
cdr3 = CAAFRVGGSFDYW at 421, score = 9 + 7
umis assigned: [71, 158, 189, 191, 257, 262]
of which 6 are surviving nonsolos
reads assigned: 970
start codons at 79, 235, 382, 509, 570
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.127 = GGTATTGTCTTTAGTC-1

using 31 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 22]
surviving nonsolo ucounts = 1[22]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.138 = GGTGAAGAGCTAAGAT-1

using 35 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[32]
surviving nonsolo ucounts = 1[32]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.140 = GGTGAAGAGGAATTAC-1

using 47 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 40]
surviving nonsolo ucounts = 1[40]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.141 = GGTGAAGAGGACTGGT-1

using 299 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 288]
surviving nonsolo ucounts = 1[288]
ids = [2]

====================================================================================

UMI info for barcode GGTGAAGAGGACTGGT-1 contig 1 = GGGAAGTGCT...
umi CCCCTATCCC = 291 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=654]
42-179 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
179-305 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
426-472 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
472-654 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 381, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 42, 86, 351
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_80.141_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.149 = GGTGAAGAGTAGATGT-1

using 854 reads

====================================================================================

graph has 344 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3, 7, 253, 262, 322]
surviving nonsolo ucounts = 3[253, 262, 322]
ids = [1, 9, 10]

====================================================================================

UMI info for barcode GGTGAAGAGTAGATGT-1 contig 1 = AAAAACCACA...
umi TTTCCAGTGC = 296 reads: +436 validated

UMI info for barcode GGTGAAGAGTAGATGT-1 contig 2 = ATCAGTCCCA...
umi TGTAAGTCGG = 259 reads: +388 validated

UMI info for barcode GGTGAAGAGTAGATGT-1 contig 3 = GAGCTCTGGG...
umi AGCTTCCCTC = 215 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=552]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-552 ==> 0-66 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false

TIG 2[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 23, 29, 98, 234, 453
confident = false

TIG 3[bases=535]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
457-504 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
504-535 ==> 0-31 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDGLRAGTPGGMDVW at 422, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 80, 231, 236, 289, 294, 297, 315, 383, 432, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.152 = GGTGAAGAGTCCAGGA-1

using 378 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 374]
surviving nonsolo ucounts = 1[374]
ids = [1]

====================================================================================

UMI info for barcode GGTGAAGAGTCCAGGA-1 contig 1 = GGCAGTCTCA...
umi CCGTTTGCGG = 373 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=1)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQSYSTLITF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.155 = GGTGAAGAGTGGTAAT-1

using 203 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 7, 187]
surviving nonsolo ucounts = 1[187]
ids = [8]

====================================================================================

UMI info for barcode GGTGAAGAGTGGTAAT-1 contig 1 = ACCCAAAAAC...
umi GTGCCATCCT = 176 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=549]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-549 ==> 0-59 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.157 = GGTGAAGAGTTCCACA-1

using 441 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[126, 315]
surviving nonsolo ucounts = 2[126, 315]
ids = [1, 0]

====================================================================================

UMI info for barcode GGTGAAGAGTTCCACA-1 contig 1 = AGGAACTGCT...
umi TGAGCCCCTT = 257 reads: +382 validated

UMI info for barcode GGTGAAGAGTTCCACA-1 contig 2 = TCACAAGAGG...
umi TTTATTCAGC = 120 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=506]
0-32 ==> 65-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYYNWPRTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 32, 87, 101, 237, 456
confident = false

TIG 2[bases=498]
0-34 ==> 128-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
34-374 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=3)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
425-498 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CCSYAGSSIDVVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 34, 173, 235, 242, 368, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.159 = GGTGAAGCAAATACAG-1

using 52 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 3, 4, 5^2, 6, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.160 = GGTGAAGCAACTGCGC-1

using 427 reads

====================================================================================

graph has 622 edges initially, 4 edges after simplification

total ucounts = 222
nonsolo ucounts = 90[2^39, 3^22, 4^13, 5^8, 6^2, 7^2, 8^3, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.161 = GGTGAAGCAAGCGCTC-1

using 249 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3, 9, 11, 14, 207]
surviving nonsolo ucounts = 1[207]
ids = [6]

====================================================================================

UMI info for barcode GGTGAAGCAAGCGCTC-1 contig 1 = TCTGCTTCAG...
umi GGCCAGTCCA = 189 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=558]
0-49 ==> 2-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
49-405 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
402-440 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
440-558 ==> 0-118 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDTSLSGSVF at 373, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 49, 203, 206, 257, 356, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.165 = GGTGAAGCAATAAGCA-1

using 84 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 14[2^4, 3, 5, 6^4, 7, 9^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.170 = GGTGAAGCACATCCGG-1

using 505 reads

====================================================================================

graph has 132 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 210, 284]
surviving nonsolo ucounts = 2[210, 284]
ids = [5, 9]

====================================================================================

UMI info for barcode GGTGAAGCACATCCGG-1 contig 1 = AGCTTCAGCT...
umi GCATGTTTGG = 192 reads: +388 validated
umi GCGTGGTTGG = 2 reads: -279 +5 -2X +8 -1 +6 -1 +8 -1X +2 -1 +5 -2 +7 -2 +5 -53 invalidated

UMI info for barcode GGTGAAGCACATCCGG-1 contig 2 = GGAGTCTCCC...
umi TGTCATAAGC = 269 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=546]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-546 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=558]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-558 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 59, 233, 531
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.176 = GGTGAAGCACGCCAGT-1

using 375 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[375]
surviving nonsolo ucounts = 1[375]
ids = [0]

====================================================================================

UMI info for barcode GGTGAAGCACGCCAGT-1 contig 1 = GGGGAGGAAC...
umi GATAGCCCCA = 317 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=489]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-489 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRSNWPPTF at 357, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.180 = GGTGAAGCACTACAGT-1

using 241 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 8, 224]
surviving nonsolo ucounts = 1[224]
ids = [6]

====================================================================================

UMI info for barcode GGTGAAGCACTACAGT-1 contig 1 = AAGCATCATC...
umi TACCGATGCG = 213 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=522]
0-62 ==> 242-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
62-415 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
444-492 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
492-522 ==> 0-30 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 404, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 62, 218, 260, 326, 359, 449
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.185 = GGTGAAGCAGACAGGT-1

using 751 reads

====================================================================================

graph has 258 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 276, 466]
surviving nonsolo ucounts = 2[276, 466]
ids = [2, 0]

====================================================================================

UMI info for barcode GGTGAAGCAGACAGGT-1 contig 1 = AGGAGTCAGA...
umi ATCTTTCTTA = 478 reads: +349 -1XX +38 invalidated
umi GGAACACCCA = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 127 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 730
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.188 = GGTGAAGCAGCCAGAA-1

using 977 reads

====================================================================================

graph has 336 edges initially, 18 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 5, 291, 302, 369]
surviving nonsolo ucounts = 3[291, 302, 369]
ids = [5, 9, 8]

====================================================================================

UMI info for barcode GGTGAAGCAGCCAGAA-1 contig 1 = AAAAACCACA...
umi CCTATACCAT = 269 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=514]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-514 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.189 = GGTGAAGCAGCCTTTC-1

using 879 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[404, 473]
surviving nonsolo ucounts = 2[404, 473]
ids = [3, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=503]
0-36 ==> 61-97 on |284|IGKV3-7|5'UTR| [len=97] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-7 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=4)
36-85 ==> 0-49 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=0)
81-327 ==> 102-348 on |285|IGKV3-7|L-REGION+V-REGION| [len=348] (mis=2)
328-367 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
367-503 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQDYNLLQYTF at 303, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 861
start codons at 36, 187, 409
confident = false
not full
full length transcript of length 503
VJ delta = 72
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.190 = GGTGAAGCAGCTGCAC-1

using 258 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 10, 242]
surviving nonsolo ucounts = 1[242]
ids = [5]

====================================================================================

UMI info for barcode GGTGAAGCAGCTGCAC-1 contig 1 = CTCAGGAGGC...
umi TAAGTTTGTC = 228 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=543]
0-33 ==> 130-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
33-387 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
383-421 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
421-543 ==> 0-122 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CASYAGGNDFVF at 357, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 33, 184, 190, 234, 241, 340, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.196 = GGTGAAGCAGGTCTCG-1

using 11 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.198 = GGTGAAGCAGTCACTA-1

using 304 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 6, 7, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode GGTGAAGCAGTCACTA-1 contig 1 = GGGCTGGGAT...
umi ACAAGGCTTT = 270 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=483]
43-397 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=2)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
431-483 ==> 0-52 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CSSYTSSSTLVF at 367, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 43, 244, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.200 = GGTGAAGCATATGGTC-1

using 229 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 10, 209]
surviving nonsolo ucounts = 1[209]
ids = [2]

====================================================================================

UMI info for barcode GGTGAAGCATATGGTC-1 contig 1 = GGGAAGTCAG...
umi ACTACAGCTC = 209 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTPFTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 207
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.211 = GGTGAAGGTACTCTCC-1

using 504 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 498]
surviving nonsolo ucounts = 1[498]
ids = [1]

====================================================================================

UMI info for barcode GGTGAAGGTACTCTCC-1 contig 1 = TGGGGGACTC...
umi ATCACTCCAC = 511 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=569]
22-380 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=4)
416-467 ==> 12-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
467-569 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARTPLRVVTFVGSFPNYGMDVW at 367, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 496
start codons at 22, 170, 178, 245, 328, 337, 424, 485, 546
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.212 = GGTGAAGGTACTTAGC-1

using 233 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 228]
surviving nonsolo ucounts = 1[228]
ids = [4]

====================================================================================

UMI info for barcode GGTGAAGGTACTTAGC-1 contig 1 = AGTCCCAGTC...
umi TTAGGTGCCA = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=3)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQLNSYPPTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.214 = GGTGAAGGTAGCGATG-1

using 54 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 11[2^3, 3^3, 4, 5, 6^2, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.219 = GGTGAAGGTCCTAGCG-1

using 1202 reads

====================================================================================

graph has 436 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[245, 265, 319, 369]
surviving nonsolo ucounts = 4[245, 265, 319, 369]
ids = [5, 2, 6, 3]

====================================================================================

UMI info for barcode GGTGAAGGTCCTAGCG-1 contig 1 = ATCAGTCCCA...
umi ATTACATGCT = 265 reads: +388 validated
umi CTGAAAGGCT = 370 reads: +388 validated
umi GTATACCCAC = 321 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 138 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2, 3, 6]
of which 3 are surviving nonsolos
reads assigned: 940
start codons at 23, 29, 98, 234, 453
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.221 = GGTGAAGGTCTAGCCG-1

using 9 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 1[9]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.232 = GGTGAAGGTGGTGTAG-1

using 197 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [8]

====================================================================================

UMI info for barcode GGTGAAGGTGGTGTAG-1 contig 1 = ACTTTCTGAG...
umi GTTCACCCTG = 176 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=549]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=17)
400-450 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
450-549 ==> 0-99 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARDFPGNYFTFDIW at 374, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 174
start codons at 35, 79, 159, 229, 431
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.235 = GGTGAAGGTGTGAAAT-1

using 1511 reads

====================================================================================

graph has 482 edges initially, 34 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[240, 262, 275, 364, 368]
surviving nonsolo ucounts = 5[240, 262, 275, 364, 368]
ids = [6, 2, 4, 5, 1]

====================================================================================

UMI info for barcode GGTGAAGGTGTGAAAT-1 contig 1 = GGGGCTCCAA...
umi ACTGTCGTAT = 265 reads: +388 validated
umi CTCAGCTGTC = 277 reads: +388 validated
umi TTTGTCTTAT = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=644]
45-397 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
395-433 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
433-644 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 121 reads
cdr3 = CSSWDSSLSAWVF at 366, score = 7 + 8
umis assigned: [2, 4, 6]
of which 3 are surviving nonsolos
reads assigned: 768
start codons at 45, 184, 256, 374
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.236 = GGTGAAGGTGTGGCTC-1

using 248 reads

====================================================================================

graph has 100 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 72, 170]
surviving nonsolo ucounts = 2[72, 170]
ids = [0, 4]

====================================================================================

UMI info for barcode GGTGAAGGTGTGGCTC-1 contig 1 = TGGGGGCTTC...
umi CTTACATTCG = 149 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=5)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-566 ==> 0-121 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.245 = GGTGAAGTCAACCATG-1

using 448 reads

====================================================================================

graph has 274 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[169, 274]
surviving nonsolo ucounts = 2[169, 274]
ids = [3, 1]

====================================================================================

UMI info for barcode GGTGAAGTCAACCATG-1 contig 1 = ACCCAAAAAC...
umi CACGTATCCG = 265 reads: +436 validated
umi CCCCGCGCTC = 168 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=558]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-558 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 42 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 417
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.248 = GGTGAAGTCACGCGGT-1

using 444 reads

====================================================================================

graph has 252 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 438]
surviving nonsolo ucounts = 1[438]
ids = [1]

====================================================================================

UMI info for barcode GGTGAAGTCACGCGGT-1 contig 1 = ACTTTCTGAG...
umi CAGAGTAGTT = 341 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=475]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
405-456 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
456-475 ==> 0-19 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CARENMEGYRDGGFDPW at 374, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 35, 79, 389, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.251 = GGTGAAGTCACTTACT-1

using 158 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 8, 142]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.252 = GGTGAAGTCAGAGGTG-1

using 61 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 9[2^2, 5, 6, 7^2, 9, 11^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.259 = GGTGAAGTCCATGAAC-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.264 = GGTGAAGTCCGTACAA-1

using 647 reads

====================================================================================

graph has 202 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[293, 352]
surviving nonsolo ucounts = 2[293, 352]
ids = [1, 0]

====================================================================================

UMI info for barcode GGTGAAGTCCGTACAA-1 contig 1 = AGTCTGGGCC...
umi GGATTTCTCA = 263 reads: +388 validated

UMI info for barcode GGTGAAGTCCGTACAA-1 contig 2 = TGGGGGATCA...
umi CCAGGGGTGT = 350 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=594]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-370 ==> 0-330 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=26)
390-428 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
428-594 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQVWDGDIYHPDVSF at 355, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 40, 101, 338, 363, 368, 389
confident = false

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTRETF at 371, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.273 = GGTGAAGTCGTTGCCT-1

using 722 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[717]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.278 = GGTGAAGTCTGCCCTA-1

using 456 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 3^3, 4, 436]
surviving nonsolo ucounts = 1[436]
ids = [0]

====================================================================================

UMI info for barcode GGTGAAGTCTGCCCTA-1 contig 1 = GAAGAGCTGC...
umi AACCGGCGGA = 430 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYGSSPWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 428
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.289 = GGTGCGTAGACTAGAT-1

using 175 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[2, 3^2, 158]
surviving nonsolo ucounts = 1[158]
ids = [7]

====================================================================================

UMI info for barcode GGTGCGTAGACTAGAT-1 contig 1 = CCAGGACACA...
umi CTAACTCAGA = 134 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=432]
12-363 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
361-400 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
400-432 ==> 0-32 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CHQYESVPYTF at 339, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 12, 18, 74, 87, 226, 322, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.291 = GGTGCGTAGAGGGATA-1

using 59 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 10[2^7, 3, 6, 26]
surviving nonsolo ucounts = 1[26]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.292 = GGTGCGTAGATAGCAT-1

using 140 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^4, 3^2, 122]
surviving nonsolo ucounts = 1[122]
ids = [0]

====================================================================================

UMI info for barcode GGTGCGTAGATAGCAT-1 contig 1 = AGCTTCAGCT...
umi CAAATGAGAG = 117 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-519 ==> 0-84 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 15 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.298 = GGTGCGTAGGACAGCT-1

using 338 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[3^2, 5, 42, 278]
surviving nonsolo ucounts = 2[42, 278]
ids = [3, 5]

====================================================================================

UMI info for barcode GGTGCGTAGGACAGCT-1 contig 1 = GAGGAACTGC...
umi CTGCACATAC = 4 reads: -324 +2 -4XX +1 -5XX +1 -5XX +2 -1XX +37 invalidated
umi GAGATTGTAC = 234 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=476]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-476 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [3, 5]
of which 2 are surviving nonsolos
reads assigned: 236
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.306 = GGTGCGTAGTCTCCTC-1

using 421 reads

====================================================================================

graph has 233 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 12[2^6, 3, 5, 8, 9, 104, 273]
surviving nonsolo ucounts = 2[104, 273]
ids = [2, 4]

====================================================================================

UMI info for barcode GGTGCGTAGTCTCCTC-1 contig 1 = GAAGAGCTGC...
umi AGAAGCTTTT = 105 reads: +382 validated
umi ATAAAGCTCT = 273 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-370 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 56 reads
cdr3 = CQQYDRSWTF at 357, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 369
start codons at 33, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.315 = GGTGCGTCAATGGATA-1

using 160 reads

====================================================================================

graph has 120 edges initially, 6 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[3^5, 5, 6, 130]
surviving nonsolo ucounts = 2[3, 130]
ids = [3, 6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=458]
0-350 ==> 3-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
347-385 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
385-458 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=1)
cdr3 = CQQSYSTPPTF at 324, score = 9 + 8
umis assigned: [3, 6]
of which 2 are surviving nonsolos
reads assigned: 115
start codons at 3, 59, 72, 208, 427, 442
confident = false
not full
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.318 = GGTGCGTCACAGTCGC-1

using 326 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================

UMI info for barcode GGTGCGTCACAGTCGC-1 contig 1 = GGGGAGGAAT...
umi CAATAATTCC = 314 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.319 = GGTGCGTCACATCCAA-1

using 291 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 5, 278]
surviving nonsolo ucounts = 1[278]
ids = [6]

====================================================================================

UMI info for barcode GGTGCGTCACATCCAA-1 contig 1 = ATCAGTCCCA...
umi TTTCATTGGC = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.323 = GGTGCGTCACGAAATA-1

using 55 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2^5, 3, 4, 6, 13, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.327 = GGTGCGTCACGGTTTA-1

using 125 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[115]
surviving nonsolo ucounts = 1[115]
ids = [10]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.337 = GGTGCGTCAGTAAGAT-1

using 262 reads

====================================================================================

graph has 140 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 29, 228]
surviving nonsolo ucounts = 2[29, 228]
ids = [3, 2]

====================================================================================

UMI info for barcode GGTGCGTCAGTAAGAT-1 contig 1 = GAGCTGCTCA...
umi CTGCATTGCG = 223 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYGSSPRTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 30, 238, 364, 457
confident = false

REJECT CONTIGS

TIG 1[bases=395]
0-218 ==> 117-335 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
221-259 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
259-395 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHRFTF at 210, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 26
start codons at 190, 301
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.338 = GGTGCGTCAGTGACAG-1

using 53 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 44]
surviving nonsolo ucounts = 1[44]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.344 = GGTGCGTCATGGAATA-1

using 194 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [0]

====================================================================================

UMI info for barcode GGTGCGTCATGGAATA-1 contig 1 = GGAGTCAGTC...
umi TTTTAACTAG = 163 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=426]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 23 reads
cdr3 = CQQNYSTPWQF at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 26, 32, 88, 101, 237
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.354 = GGTGCGTGTACAGACG-1

using 87 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 78]
surviving nonsolo ucounts = 1[78]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.362 = GGTGCGTGTCCATGAT-1

using 54 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.364 = GGTGCGTGTCCTCTTG-1

using 274 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[9, 261]
surviving nonsolo ucounts = 1[261]
ids = [3]

====================================================================================

UMI info for barcode GGTGCGTGTCCTCTTG-1 contig 1 = GCTGGGGTCT...
umi GAGCTCGGTG = 247 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=599]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-599 ==> 0-170 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CSSYAGSSHVVF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 41, 198, 242, 249, 348, 375, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.366 = GGTGCGTGTCTAGCCG-1

using 293 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 283]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.368 = GGTGCGTGTCTTCTCG-1

using 644 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3, 4, 277, 351]
surviving nonsolo ucounts = 2[277, 351]
ids = [4, 7]

====================================================================================

UMI info for barcode GGTGCGTGTCTTCTCG-1 contig 1 = AGCATCGTCC...
umi CACGTACGCT = 274 reads: +427 validated

UMI info for barcode GGTGCGTGTCTTCTCG-1 contig 2 = GTCAGACTCA...
umi GGAGTACCGT = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=600]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=10)
442-488 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
488-600 ==> 0-112 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CARGGDPEYSSGWGYDYW at 403, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 61, 259, 325, 358, 446
confident = false

TIG 2[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.379 = GGTGCGTGTTAAGGGC-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.388 = GGTGCGTTCACTTCAT-1

using 41 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 5[2, 4, 5, 7^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.395 = GGTGCGTTCCCGACTT-1

using 890 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 236, 270, 379]
surviving nonsolo ucounts = 3[236, 270, 379]
ids = [1, 5, 4]

====================================================================================

UMI info for barcode GGTGCGTTCCCGACTT-1 contig 1 = GATCAGGACT...
umi ACTGTCCACA = 236 reads: +397 validated
umi TGCCCTCCCT = 382 reads: +397 validated
umi TGCCCTCTCT = 272 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 138 reads
cdr3 = CMQALQTPLTF at 366, score = 9 + 9
umis assigned: [1, 4, 5]
of which 3 are surviving nonsolos
reads assigned: 879
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.397 = GGTGCGTTCCCTCAGT-1

using 148 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 4, 135]
surviving nonsolo ucounts = 1[135]
ids = [5]

====================================================================================

UMI info for barcode GGTGCGTTCCCTCAGT-1 contig 1 = AGGAATCAGT...
umi GAGGTTACCC = 115 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-469 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.400 = GGTGCGTTCCTAGAAC-1

using 378 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 3^2, 362]
surviving nonsolo ucounts = 1[362]
ids = [0]

====================================================================================

UMI info for barcode GGTGCGTTCCTAGAAC-1 contig 1 = CGAGCCCAGC...
umi AAAATTGGTC = 362 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=608]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=0)
455-506 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
506-608 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDPIREEDYYDSSIGWFDPW at 409, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 67, 218, 223, 281, 284, 370, 443, 524, 585
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.406 = GGTGCGTTCGCGATCG-1

using 176 reads

====================================================================================

graph has 145 edges initially, 4 edges after simplification

total ucounts = 46
nonsolo ucounts = 36[2^7, 3^8, 4^7, 5^6, 6^3, 7^2, 9, 11, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.409 = GGTGCGTTCGGCCGAT-1

using 38 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 3, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.410 = GGTGCGTTCGGCGCAT-1

using 467 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 5[2^2, 6, 13, 433]
surviving nonsolo ucounts = 1[433]
ids = [8]

====================================================================================

REJECT CONTIGS

TIG 1[bases=496]
0-61 ==> 0-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
0-61 ==> 8392-8453 on rc of segment before IGHV2-70D exon 2 [len=8453] (mis=0)
32-79 ==> 10093-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=4)
61-414 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=0)
425-496 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARDLAR at 403, score = 9 + 4
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 429
start codons at 61, 212, 259, 358
confident = false
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.416 = GGTGCGTTCTGGCGTG-1

using 713 reads

====================================================================================

graph has 304 edges initially, 6 edges after simplification

total ucounts = 23
nonsolo ucounts = 11[2, 3^5, 7, 45, 60, 265, 307]
surviving nonsolo ucounts = 3[45, 265, 307]
ids = [15, 14, 19]

====================================================================================

UMI info for barcode GGTGCGTTCTGGCGTG-1 contig 1 = GAGGAATCAG...
umi GACTGTCACA = 271 reads: +388 validated
umi TGTCCTTTAA = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 99 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [14, 19]
of which 2 are surviving nonsolos
reads assigned: 569
start codons at 28, 34, 103, 239, 458
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.428 = GGTGTTAAGAGTAAGG-1

using 12298 reads

====================================================================================

graph has 6682 edges initially, 136 edges after simplification

total ucounts = 1235
nonsolo ucounts = 582[2^213, 3^115, 4^85, 5^44, 6^29, 7^18, 8^16, 9^15, 10^3, 11^3, 12^2, 13^2, 14^2, 15^2, 16, 21, 60, 62, 85, 152, 204, 214, 217, 218, 230, 242, 244, 245, 246, 247, 253, 256, 259, 262, 273, 279, 284, 291, 297, 319, 331, 343, 503, 635, 721, 749, 822]
surviving nonsolo ucounts = 27[152, 204, 214, 217, 218, 230, 242, 244, 245, 246, 247, 253, 256, 259, 262, 273, 279, 284, 297, 319, 331, 343, 503, 635, 721, 749, 822]
ids = [190, 323, 136, 400, 898, 255, 97, 1054, 92, 40, ...]

====================================================================================

UMI info for barcode GGTGTTAAGAGTAAGG-1 contig 1 = AGAGAGGTGC...
umi ATACGCGCGC = 149 reads: -360X +1 -2X +1 -1X +1 -1X +1 -3X +1 -6X +2 -3X +38 invalidated
umi ATCACAATGG = 308 reads: -35 +1 -3X +382 invalidated
umi ATTAGAGCAT = 237 reads: +421 validated
umi ATTAGATATA = 207 reads: +421 validated
umi CTTATACCTC = 224 reads: +421 validated
umi TAGAGATCTA = 225 reads: +421 validated
umi TATCATTTCT = 165 reads: -9 +6 -1XX +5 -1XX +4 -1XX +5 -1XX +9 -1XX +26 -1XX +57 -1XX +15 -1XX +2 -1XX +6 -2XX +5 -1XX +39 -1XX +3 -3XX +6 -1XX +5 -1XX +1 -2XX +1 -1XX +1 -1XX +2 -1XX +15 -1XX +11 -1XX +21 -1XX +8 -1XX +1 -1XX +28 -1XX +12 -1XX +2 -1XX +13 -1X +1 -1X +2 -2XX +1 -1XX +1 -2XX +1 -3XX +3 -1XX +2 -2XX +1 -4XX +2 -1XX +1 -1XX +38 invalidated
umi TCTTATCTAG = 240 reads: +404 -1 +1 -1 +2 -2 +1 -2 +1 -1 +5 non-validated
umi TTAATCCCTC = 210 reads: +421 validated

UMI info for barcode GGTGTTAAGAGTAAGG-1 contig 2 = GCTGGGGAGC...
umi ACACCGTTCC = 241 reads: +385 validated
umi ACATAGCCTG = 264 reads: +385 validated
umi ACGCAGACTG = 242 reads: +385 validated
umi ATTATTCATA = 274 reads: +385 validated
umi TATCCAATAA = 279 reads: +385 validated
umi TCTTGCATTG = 243 reads: +385 validated

UMI info for barcode GGTGTTAAGAGTAAGG-1 contig 3 = GAGTCTGAGA...
umi ACGGACGCCC = 242 reads: +400 validated
umi AGACTCGTTG = 210 reads: +400 validated
umi CAGCCTTTCA = 203 reads: +400 validated
umi GCTTAGCAGG = 336 reads: +400 validated
umi TACCGTTGTT = 259 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=595]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
447-493 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
493-595 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 149 reads
cdr3 = CARDHSSSWYLDLGYW at 414, score = 8 + 7
umis assigned: [190, 207, 255, 256, 607, 898, 917, 1050, 1117]
of which 8 are surviving nonsolos
reads assigned: 1912
start codons at 72, 228, 349, 375, 511, 572
confident = true

TIG 2[bases=652]
56-403 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=0)
403-441 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
441-652 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 6 umis using 269 reads
cdr3 = CYSTDSSGNHRRVF at 371, score = 7 + 8
umis assigned: [40, 49, 92, 261, 918, 1054]
of which 6 are surviving nonsolos
reads assigned: 1515
start codons at 56, 117, 186, 204, 255, 317, 354, 573
confident = true

TIG 3[bases=606]
70-430 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
432-470 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
470-606 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 132 reads
cdr3 = CMQGTHWPPITF at 406, score = 9 + 8
umis assigned: [97, 136, 323, 723, 884]
of which 5 are surviving nonsolos
reads assigned: 1230
start codons at 70, 103, 131, 139, 227, 389, 409, 512
confident = true

REJECT CONTIGS

TIG 1[bases=635]
0-49 ==> 2887-2936 on segment before IGLVV-58 exon 1 [len=3104] (mis=3)
31-390 ==> 0-359 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=6)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-635 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [400, 488, 672, 749, 876, 966, 1111, 1198]
of which 8 are surviving nonsolos
reads assigned: 4201
start codons at 31, 192, 232, 248, 347, 385
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.433 = GGTGTTAAGATCGATA-1

using 127 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 5, 118]
surviving nonsolo ucounts = 1[118]
ids = [4]

====================================================================================

UMI info for barcode GGTGTTAAGATCGATA-1 contig 1 = TTCTGAGAGT...
umi GCGTCTTGTA = 105 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=468]
0-32 ==> 40-72 on |181|IGHV4-31|5'UTR| [len=72] (mis=0)
32-388 ==> 0-356 on |182|IGHV4-31|L-REGION+V-REGION| [len=356] (mis=1)
415-465 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGAGTILPSGPYGMDVW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 32, 76, 422
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.440 = GGTGTTAAGCCTATGT-1

using 42 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[2^2, 3, 4, 5, 6, 8, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.443 = GGTGTTAAGCGGATCA-1

using 216 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 205]
surviving nonsolo ucounts = 1[205]
ids = [5]

====================================================================================

UMI info for barcode GGTGTTAAGCGGATCA-1 contig 1 = TGAGCGCAGA...
umi TTACGTCAAT = 191 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-502 ==> 0-78 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CGTWDSSLSAYVF at 357, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 36, 190, 241, 365, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.471 = GGTGTTACAAGTTGTC-1

using 503 reads

====================================================================================

graph has 250 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 21, 477]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=465]
0-133 ==> 2174-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
129-291 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
291-329 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
329-465 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 470
start codons at 46, 99, 154, 159, 272, 371
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.476 = GGTGTTACACCAGCAC-1

using 20 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[20]
surviving nonsolo ucounts = 1[20]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.478 = GGTGTTACACGAAGCA-1

using 44 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[40]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.481 = GGTGTTACACTAAGTC-1

using 203 reads

====================================================================================

graph has 140 edges initially, 6 edges after simplification

total ucounts = 41
nonsolo ucounts = 30[2^5, 3^4, 4^3, 5^5, 6^3, 8^2, 9, 10, 11^2, 12^2, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.482 = GGTGTTACACTGAAGG-1

using 692 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 5, 7, 8, 664]
surviving nonsolo ucounts = 1[664]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.483 = GGTGTTACAGACAAGC-1

using 29 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 24]
surviving nonsolo ucounts = 1[24]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.498 = GGTGTTACATCCGTGG-1

using 366 reads

====================================================================================

graph has 234 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 9[2^2, 5^3, 6, 8, 11, 312]
surviving nonsolo ucounts = 1[312]
ids = [5]

====================================================================================

UMI info for barcode GGTGTTACATCCGTGG-1 contig 1 = GGAGAAGAGC...
umi CGTCATTGCA = 319 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYGTSPYTF at 360, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.500 = GGTGTTACATCGGAAG-1

using 491 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^3, 7, 476]
surviving nonsolo ucounts = 1[476]
ids = [4]

====================================================================================

UMI info for barcode GGTGTTACATCGGAAG-1 contig 1 = AGCTTCAGCT...
umi TCCTTTCACC = 480 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 89 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 470
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.503 = GGTGTTACATGTTGAC-1

using 303 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.509 = GGTGTTACATTGTGCA-1

using 526 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[523]
surviving nonsolo ucounts = 1[523]
ids = [0]

====================================================================================

UMI info for barcode GGTGTTACATTGTGCA-1 contig 1 = TGAGCGCAGA...
umi CATACCTTTA = 519 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=632]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=5)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
421-632 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CGTWDSSLSGVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 510
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.513 = GGTGTTAGTAGAAAGG-1

using 641 reads

====================================================================================

graph has 188 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 6, 631]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.515 = GGTGTTAGTAGCGTAG-1

using 454 reads

====================================================================================

graph has 178 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[222, 230]
surviving nonsolo ucounts = 2[222, 230]
ids = [0, 2]

====================================================================================

UMI info for barcode GGTGTTAGTAGCGTAG-1 contig 1 = GCTGGGGTCT...
umi AGTGAAACAG = 213 reads: +388 validated

UMI info for barcode GGTGTTAGTAGCGTAG-1 contig 2 = AGCTCTGAGA...
umi CTGATGGTGG = 223 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=573]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=1)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-573 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CSSYAGSNNLVF at 365, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 210
start codons at 41, 198, 242, 249, 348, 375
confident = false

TIG 2[bases=596]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-596 ==> 0-93 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.528 = GGTGTTAGTGATAAGT-1

using 3054 reads

====================================================================================

graph has 1548 edges initially, 26 edges after simplification

total ucounts = 327
nonsolo ucounts = 113[2^42, 3^28, 4^13, 5^8, 6^6, 7, 9^3, 15, 111, 115, 142, 165, 182, 212, 230, 276, 311, 316, 435]
surviving nonsolo ucounts = 11[111, 115, 142, 165, 182, 212, 230, 276, 311, 316, 435]
ids = [176, 227, 84, 182, 119, 125, 282, 35, 230, 3, ...]

====================================================================================

UMI info for barcode GGTGTTAGTGATAAGT-1 contig 1 = GGACTGATCA...
umi AAGAAACCTT = 321 reads: +397 validated
umi CCGAGTCTTC = 138 reads: +397 validated
umi CGTCTATTTT = 184 reads: +397 validated
umi CTATATGTGC = 213 reads: +397 validated
umi TAGTTAAGTG = 113 reads: +397 validated

UMI info for barcode GGTGTTAGTGATAAGT-1 contig 2 = ATCACATAAC...
umi AGTAGGCACT = 246 reads: +427 validated
umi GCCTACAGCG = 146 reads: +427 validated
umi TGCCGACCTA = 227 reads: +427 validated
umi TGGCTTCGGA = 441 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 124 reads
cdr3 = CMQALQTPDTF at 371, score = 9 + 8
umis assigned: [3, 84, 119, 125, 227]
of which 5 are surviving nonsolos
reads assigned: 953
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true

TIG 2[bases=556]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
411-442 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=3)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
485-556 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 77 reads
cdr3 = CARGGYYDSSGYYYFDYW at 400, score = 9 + 7
umis assigned: [35, 182, 282, 284]
of which 4 are surviving nonsolos
reads assigned: 1041
start codons at 58, 209, 256, 355, 419
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGGGGGTTACTATGATAGTAGTGGTTACTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTGACACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.529 = GGTGTTAGTGATGCCC-1

using 325 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 3^3, 4, 6, 302]
surviving nonsolo ucounts = 1[302]
ids = [5]

====================================================================================

UMI info for barcode GGTGTTAGTGATGCCC-1 contig 1 = TGGGGGTGAC...
umi GGACCTCGGT = 250 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=487]
24-382 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=1)
402-439 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
439-487 ==> 0-48 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAHSPYYDFSKYW at 369, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 24, 68, 247, 250, 330, 339, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.544 = GGTGTTATCAACGAAA-1

using 133 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 3, 118]
surviving nonsolo ucounts = 1[118]
ids = [10]

====================================================================================

UMI info for barcode GGTGTTATCAACGAAA-1 contig 1 = CCTCCTTGGG...
umi TAGAATACCT = 101 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=484]
0-38 ==> 21-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
38-391 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
440-474 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 380, score = 7 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 101
start codons at 38, 236, 241, 258, 302, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.545 = GGTGTTATCAACGGCC-1

using 11774 reads

====================================================================================

graph has 4112 edges initially, 50 edges after simplification

total ucounts = 550
nonsolo ucounts = 182[2^60, 3^38, 4^18, 5^12, 6^6, 7^4, 8^3, 9, 11, 12, 14, 15, 22, 37, 59, 62, 63, 112, 130, 147, 153, 154^2, 159, 161, 173, 179, 188, 194, 198, 212, 228, 229, 239, 274, 291, 330, 367, 373, 384, 415, 502, 523, 583, 587, 591, 908, 1509]
surviving nonsolo ucounts = 34[22, 59, 63, 112, 130, 147, 153, 154^2, 159, 161, 173, 179, 188, 194, 198, 212, 228, 229, 239, 274, 291, 330, 367, 373, 384, 415, 502, 523, 583, 587, 591, 908, 1509]
ids = [259, 50, 43, 218, 500, 483, 363, 2, 314, 309, ...]

====================================================================================

UMI info for barcode GGTGTTATCAACGGCC-1 contig 1 = AGCTTCAGCT...
umi ACAGCACGCT = 1538 reads: -346X +2 -1XX +2 -2XX +1 -1XX +1 -1XX +23 -1XX +7 invalidated
umi ACCATACCGG = 58 reads: +388 validated
umi AGCAGACCCG = 386 reads: -346X +2 -1XX +2 -2XX +1 -1XX +1 -1XX +23 -1XX +7 invalidated
umi AGTCACCCCT = 240 reads: +388 validated
umi CACATCTCGC = 504 reads: +388 validated
umi CCAGACGTTC = 601 reads: -360X +20 -1XX +7 invalidated
umi CCCATTGATT = 371 reads: +388 validated
umi CGAGCTCGCG = 103 reads: +295 -45 +48 non-validated
umi GCGTACTGGA = 581 reads: +388 validated
umi GCTAGCTACT = 940 reads: -346X +2 -1XX +2 -2XX +1 -1XX +1 -1XX +23 -1XX +7 invalidated
umi GCTCTTACCA = 606 reads: -346X +2 -1XX +2 -2XX +1 -1XX +1 -1XX +23 -1XX +7 invalidated
umi GGGAAGTCGA = 224 reads: +388 validated
umi GTGGCCTTAC = 200 reads: +388 validated
umi GTGGCTCTCG = 144 reads: +333 -1 +14 -1 +39 non-validated
umi TAGCCCATCA = 179 reads: +388 validated
umi TCCACAGGCA = 326 reads: -383 +1 -2X +2 invalidated
umi TCGTACGATC = 274 reads: +388 validated
umi TGTCCAATCG = 229 reads: +388 validated
umi TTGCTGTAAC = 291 reads: +388 validated
umi TTTGTGGTAC = 175 reads: +388 validated

UMI info for barcode GGTGTTATCAACGGCC-1 contig 2 = TGGGGACCCA...
umi AAACCTGGAC = 152 reads: +409 -1 +23 non-validated
umi AATTCGATCC = 421 reads: +433 validated
umi ACAGTGATTC = 64 reads: +433 validated
umi CGAATAACCC = 189 reads: +433 validated
umi CTTCGCCTCA = 24 reads: +269 -139 +1 -1 +23 non-validated
umi GCACCTTACT = 159 reads: +433 validated
umi TTACGTACCA = 134 reads: +433 validated
umi TTACTCCGTA = 209 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=1)
47-367 ==> 0-320 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=9)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 13 umis using 516 reads
cdr3 = CTTWDDTLKGVIF at 368, score = 8 + 9
umis assigned: [40, 50, 82, 96, 171, 194, 200, 218, 310, 316] and 10 others
of which 20 are surviving nonsolos
reads assigned: 7752
start codons at 47, 351, 376, 381
confident = true

TIG 2[bases=674]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=33)
442-492 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
492-674 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 7 umis using 130 reads
cdr3 = CARVVVMVVAANPYDAFDIW at 401, score = 9 + 8
umis assigned: [2, 37, 43, 216, 259, 293, 500, 505]
of which 8 are surviving nonsolos
reads assigned: 1327
start codons at 59, 210, 257, 262, 294, 356, 419, 441, 444, 473
confident = true

REJECT CONTIGS

TIG 1[bases=597]
0-353 ==> 24-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=16)
372-415 ==> 6-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
415-597 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARSSVRPGAFDPW at 342, score = 8 + 6
umis assigned: [280]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 41
confident = false
VJ delta = 9
not full
not full

TIG 2[bases=586]
0-31 ==> 0-31 on |224|IGKV1-27|5'UTR| [len=31] (mis=2)
16-86 ==> 8895-8965 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
16-86 ==> 8904-8974 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
16-86 ==> 8903-8973 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
31-349 ==> 0-318 on |225|IGKV1-27|L-REGION+V-REGION| [len=351] (mis=14)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
417-586 ==> 0-169 on rc of segment before IGKJ4 exon 1 [len=280] (mis=24)
umis assigned: [309, 314, 483]
of which 3 are surviving nonsolos
reads assigned: 448
start codons at 31, 37, 93, 106, 220, 242, 341
confident = false
did not find CDR3
now this is a cell
paired!

CTATATTACTGTGCGAGGGTCGTTGTGATGGTAGTGGCTGCAAATCCCTATGATGCGTTTGATATTTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGTCTGAGGATGAGGCTGATTATTATTGTACGACATGGGATGACACCCTGAAGGGTGTGATATTCGGCGGAGGGACCAAGCTGACAGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.550 = GGTGTTATCATCGGAT-1

using 184 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2^2, 171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=596]
0-55 ==> 60-115 on |368|IGLV3-9|5'UTR| [len=115] (mis=0)
28-67 ==> 5623-5662 on segment before IGLV3-29 exon 1 [len=6000] (mis=1)
55-401 ==> 0-346 on |369|IGLV3-9|L-REGION+V-REGION| [len=346] (mis=5)
400-438 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
438-596 ==> 0-158 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQVWDSST* at 370, score = 8 + 4
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 55, 116, 203, 353
confident = false
not full
frameshifted full length stopped transcript of length 596
VJ delta = 8
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.553 = GGTGTTATCCAAGTAC-1

using 311 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 148, 156]
surviving nonsolo ucounts = 2[148, 156]
ids = [5, 1]

====================================================================================

UMI info for barcode GGTGTTATCCAAGTAC-1 contig 1 = GAGCTCTGGG...
umi TATACTTCTG = 146 reads: +445 validated

UMI info for barcode GGTGTTATCCAAGTAC-1 contig 2 = GAAGAGCTGC...
umi ACCTGGTGAT = 139 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=592]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=14)
479-525 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
525-592 ==> 0-67 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CARDAPYMIGGGTAQWVPMGMDVW at 422, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 144
start codons at 80, 231, 236, 294, 297, 306, 383, 432, 443, 466, 476, 482, 506, 579
confident = false

TIG 2[bases=513]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 137
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.563 = GGTGTTATCCGTTGTC-1

using 511 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[509]
surviving nonsolo ucounts = 1[509]
ids = [2]

====================================================================================

UMI info for barcode GGTGTTATCCGTTGTC-1 contig 1 = GCTCTGCTTC...
umi TGTACCTGCT = 510 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
442-653 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQSYDINLIGVIF at 375, score = 7 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 501
start codons at 51, 114, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.575 = GGTGTTATCGTCCAGG-1

using 337 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode GGTGTTATCGTCCAGG-1 contig 1 = GAGGAACTGC...
umi ACACAGTACA = 312 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=492]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.576 = GGTGTTATCGTCTGAA-1

using 237 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 4, 223]
surviving nonsolo ucounts = 1[223]
ids = [5]

====================================================================================

UMI info for barcode GGTGTTATCGTCTGAA-1 contig 1 = AGAGCTGCTC...
umi CCACCACTCT = 225 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYGSSPPYTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 31, 239, 365, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.582 = GGTGTTATCTCGTTTA-1

using 305 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode GGTGTTATCTCGTTTA-1 contig 1 = GCTGCGGGTA...
umi AAATTCGCAT = 289 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-379 ==> 0-339 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=13)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
428-564 ==> 0-136 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CAAWDDGLHAWLF at 361, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 40, 191, 248, 251, 344, 369, 374, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.591 = GGTGTTATCTTGACGA-1

using 377 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 8, 362]
surviving nonsolo ucounts = 1[362]
ids = [4]

====================================================================================

UMI info for barcode GGTGTTATCTTGACGA-1 contig 1 = GAAGAGCTGC...
umi GTTCTTGTGC = 365 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 50 reads
cdr3 = CQQYGRSPGTF at 357, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 358
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.595 = GTAACGTAGACACGAC-1

using 365 reads

====================================================================================

graph has 530 edges initially, 2 edges after simplification

total ucounts = 155
nonsolo ucounts = 65[2^20, 3^16, 4^8, 5^8, 6^3, 7, 8, 9^3, 10, 11^3, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.596 = GTAACGTAGAGAACAG-1

using 18 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.597 = GTAACGTAGAGCAATT-1

using 364 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 355]
surviving nonsolo ucounts = 1[355]
ids = [6]

====================================================================================

UMI info for barcode GTAACGTAGAGCAATT-1 contig 1 = ATCAGTCCCA...
umi TTCACCTTCA = 335 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-492 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 331
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.605 = GTAACGTAGCCACCTG-1

using 1155 reads

====================================================================================

graph has 1352 edges initially, 12 edges after simplification

total ucounts = 429
nonsolo ucounts = 182[2^80, 3^42, 4^28, 5^13, 6^5, 7^2, 8^3, 9^2, 10^3, 11, 19, 20, 279]
surviving nonsolo ucounts = 1[279]
ids = [205]

====================================================================================

UMI info for barcode GTAACGTAGCCACCTG-1 contig 1 = AGGAATCAGA...
umi CGTGTGGGCG = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=7)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYDSYPHTF at 354, score = 9 + 8
umis assigned: [205]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 27, 33, 89, 102, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.612 = GTAACGTAGCTATGCT-1

using 319 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[3, 308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode GTAACGTAGCTATGCT-1 contig 1 = AGCTCTGAGA...
umi ATTGGGTCTT = 297 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=538]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=0)
438-456 ==> 13-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=1)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
509-538 ==> 0-29 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDQAVVAATRPYYFDYW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 79, 235, 382, 527
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.615 = GTAACGTAGGATATAC-1

using 295 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 290]
surviving nonsolo ucounts = 1[290]
ids = [1]

====================================================================================

UMI info for barcode GTAACGTAGGATATAC-1 contig 1 = GGGGAGGAAC...
umi CCGGCATTTG = 265 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQRSNWPLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.616 = GTAACGTAGGCAAAGA-1

using 331 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[329]
surviving nonsolo ucounts = 1[329]
ids = [2]

====================================================================================

UMI info for barcode GTAACGTAGGCAAAGA-1 contig 1 = GAAGAGCTGC...
umi GCGAACAGGT = 325 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPFTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.622 = GTAACGTAGTGCCAGA-1

using 21365 reads

====================================================================================

graph has 8045 edges initially, 70 edges after simplification

total ucounts = 1204
nonsolo ucounts = 539[2^211, 3^104, 4^60, 5^39, 6^20, 7^16, 8^8, 9^5, 10^2, 11^3, 12, 13^2, 14^2, 15, 16, 17^3, 20, 33, 48, 51, 127, 137, 163, 174, 191, 197^2, 207, 236, 237, 240, 243, 246, 248, 251, 253, 256, 265, 270, 273, 279^2, 281, 284, 290^2, 291, 293, 295^2, 297, 299, 300^3, 309, 312, 318^2, 320, 321, 323, 324, 333^2, 345, 352, 357, 370, 381, 479, 492, 552, 625, 802, 886, 1199]
surviving nonsolo ucounts = 55[137, 163, 174, 191, 197^2, 207, 237, 240, 243, 246, 248, 251, 253, 256, 265, 270, 273, 279^2, 281, 284, 290^2, 291, 293, 295^2, 297, 299, 300^3, 309, 312, 318^2, 320, 321, 323, 324, 333^2, 345, 352, 357, 370, 381, 479, 492, 552, 625, 802, 886, 1199]
ids = [428, 984, 900, 764, 666, 939, 280, 805, 729, 770, ...]

====================================================================================

UMI info for barcode GTAACGTAGTGCCAGA-1 contig 1 = GAGCTACAAC...
umi AAAAACGCAT = 320 reads: +409 validated
umi ACCATCCTCT = 309 reads: +409 validated
umi AGAATTAGTC = 246 reads: +409 validated
umi ATCAATGTCT = 274 reads: +409 validated
umi ATGACAGAGG = 335 reads: +409 validated
umi ATGTGTCGTC = 256 reads: +409 validated
umi ATTAGGTATA = 10 reads: -347 +5 -2XX +2 -1XX +4 -1XX +2 -1XX +1 -1XX +1 -1XX +2 -2XX +1 -1XX +5 -1XX +28 invalidated
umi ATTCGGCTTC = 211 reads: +409 validated
umi CAATACCTCT = 320 reads: +409 validated
umi CACATCCTTG = 283 reads: +409 validated
umi CCCCAGGCTC = 285 reads: +409 validated
umi CCCTAGCCTG = 138 reads: +409 validated
umi CCTAACCCAT = 290 reads: +409 validated
umi CGGACTGCCA = 301 reads: +409 validated
umi CGTAGTATTG = 300 reads: +409 validated
umi CTATACTTGG = 499 reads: +409 validated
umi CTCGCGGTCT = 266 reads: +409 validated
umi CTCGGGGAAA = 270 reads: +409 validated
umi GACTATGCTT = 292 reads: +409 validated
umi GACTGCCGGC = 192 reads: +409 validated
umi GCATCTACTG = 297 reads: +409 validated
umi GCATTACGTG = 352 reads: +409 validated
umi GCATTATTTC = 297 reads: +409 validated
umi GCCTACTCCA = 283 reads: +409 validated
umi GCGCGATGTA = 239 reads: +409 validated
umi GCGGCTTATC = 255 reads: +409 validated
umi GGGATGCAGT = 192 reads: +409 validated
umi GGGTTGAGTC = 244 reads: +409 validated
umi GTAATCTCTG = 304 reads: +409 validated
umi GTAATTGCCA = 249 reads: +409 validated
umi GTATTTATGT = 234 reads: +409 validated
umi TAGACATATG = 383 reads: +409 validated
umi TAGCTCCCCA = 321 reads: +409 validated
umi TATAGTCCGA = 180 reads: +409 validated
umi TATGTTAGCC = 312 reads: +409 validated
umi TCAAGGGAGA = 313 reads: +409 validated
umi TCGGAGCCGA = 279 reads: +409 validated
umi TCGTATCAGC = 333 reads: +409 validated
umi TCTATATCTG = 300 reads: +409 validated
umi TCTATTCTGA = 294 reads: +409 validated
umi TGCTCTGCAT = 293 reads: +409 validated
umi TGTCTTATGT = 347 reads: +409 validated
umi TTCCTAATGG = 258 reads: +409 validated
umi TTTAATAGTG = 327 reads: +409 validated
umi TTTATTCCTA = 555 reads: +409 validated
umi TTTCTTGAAG = 376 reads: +409 validated

UMI info for barcode GTAACGTAGTGCCAGA-1 contig 2 = ACATGGGAAG...
umi TCATCGCATC = 196 reads: +424 validated
umi TCGCTTGTAT = 163 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=575]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-78 ==> 0-48 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
87-402 ==> 48-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=9)
401-439 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
439-575 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 45 umis using 1574 reads
cdr3 = CQQYFITPRTF at 378, score = 9 + 8
umis assigned: [1, 75, 144, 211, 238, 259, 269, 280, 314, 329] and 36 others
of which 46 are surviving nonsolos
reads assigned: 12998
start codons at 30, 108, 361, 481
confident = true
see insertion of GTGACTACA at pos 48 on |296|IGKV4-1|L-REGION+V-REGION|

TIG 2[bases=520]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=18)
413-449 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
449-520 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CARGQLRLVSW at 385, score = 9 + 7
umis assigned: [939, 984]
of which 2 are surviving nonsolos
reads assigned: 355
start codons at 2, 25, 46, 90, 176, 240, 307
confident = true

REJECT CONTIGS

TIG 1[bases=373]
2-117 ==> 222-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=7)
124-162 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
162-373 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CQSPDSSATYVPF at 95, score = 9 + 8
umis assigned: [888, 1090, 1094]
of which 2 are surviving nonsolos
reads assigned: 2099
start codons at 123
confident = false
not full
VJ delta = 12
not full
now this is a cell
paired!

AGTTCTGTGACCGCCGCGGACACGGCTGTCTATTACTGTGCGAGGGGCCAACTGCGCCTTGTGTCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAGGATGTGGCAGTTTATTTCTGTCAGCAATATTTTATTACTCCTCGAACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.633 = GTAACGTCAAGAAGAG-1

using 15 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.637 = GTAACGTCAAGGTGTG-1

using 285 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 275]
surviving nonsolo ucounts = 1[275]
ids = [5]

====================================================================================

UMI info for barcode GTAACGTCAAGGTGTG-1 contig 1 = GAGTCAGACC...
umi TACGGGGTTA = 262 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=496]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
410-496 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYWTF at 352, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 25, 31, 87, 100, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.645 = GTAACGTCACCAGTTA-1

using 293 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3^2, 276]
surviving nonsolo ucounts = 1[276]
ids = [3]

====================================================================================

UMI info for barcode GTAACGTCACCAGTTA-1 contig 1 = ATCAGTCCCA...
umi CGTGTTCCAG = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-495 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.646 = GTAACGTCACCTGGTG-1

using 422 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[419]
surviving nonsolo ucounts = 1[419]
ids = [3]

====================================================================================

UMI info for barcode GTAACGTCACCTGGTG-1 contig 1 = GGGATTCAGT...
umi TCACGGCCCT = 418 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=530]
38-393 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=28)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
459-530 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CAKGWLAVAGESFDYW at 380, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 412
start codons at 38, 183, 189, 194, 273, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.648 = GTAACGTCACGAAATA-1

using 327 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [5]

====================================================================================

UMI info for barcode GTAACGTCACGAAATA-1 contig 1 = AGGAGTCAGA...
umi TCTAGGAGTT = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNSYSLTF at 354, score = 8 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.656 = GTAACGTCAGACAAAT-1

using 24 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.658 = GTAACGTCAGCCAATT-1

using 248 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3^2, 232]
surviving nonsolo ucounts = 1[232]
ids = [7]

====================================================================================

UMI info for barcode GTAACGTCAGCCAATT-1 contig 1 = AGTGACTCCT...
umi GAAGGGTAGT = 224 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=501]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=7)
408-459 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
459-501 ==> 0-42 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CAHRLGYCTTTNCYSDWFDPW at 365, score = 7 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 20, 64, 243, 246, 326, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.662 = GTAACGTCAGGTCCAC-1

using 332 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 328]
surviving nonsolo ucounts = 1[328]
ids = [0]

====================================================================================

UMI info for barcode GTAACGTCAGGTCCAC-1 contig 1 = GACTGATCAG...
umi CAACTAGACG = 309 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=514]
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
431-514 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CMQGTHWPRSF at 370, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 34, 67, 95, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.663 = GTAACGTCAGGTCGTC-1

using 121 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[9, 109]
surviving nonsolo ucounts = 1[109]
ids = [1]

====================================================================================

UMI info for barcode GTAACGTCAGGTCGTC-1 contig 1 = CAGGACTCAG...
umi CAGGTAGGAG = 108 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-23 ==> 91-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
23-376 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
373-411 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
411-512 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASWDDSLRGRVF at 344, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 23, 177, 327, 352, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.667 = GTAACGTCATAACCTG-1

using 106 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 101]
surviving nonsolo ucounts = 1[101]
ids = [2]

====================================================================================

UMI info for barcode GTAACGTCATAACCTG-1 contig 1 = GGGGTCACAA...
umi GGCTATATAC = 101 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=474]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-474 ==> 0-51 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.671 = GTAACGTCATCCCATC-1

using 302 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode GTAACGTCATCCCATC-1 contig 1 = AGGAGTCAGA...
umi AACCAGTTCA = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.674 = GTAACGTCATGCAACT-1

using 728 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[5, 60, 658]
surviving nonsolo ucounts = 2[60, 658]
ids = [6, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=473]
0-230 ==> 126-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=4)
224-262 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
262-473 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLRGVF at 198, score = 8 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 695
start codons at 28, 31, 82, 181, 208
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.680 = GTAACGTGTACAGACG-1

using 47 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 9[2^4, 5^2, 7, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.689 = GTAACGTGTCGTCTTC-1

using 210 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3^2, 198]
surviving nonsolo ucounts = 1[198]
ids = [3]

====================================================================================

UMI info for barcode GTAACGTGTCGTCTTC-1 contig 1 = TCACAAGAGG...
umi AGCTATCATG = 193 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=524]
0-34 ==> 128-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
34-374 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
391-419 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-524 ==> 0-105 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CFSYGTSGRTF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 34, 242, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.692 = GTAACGTGTCTTCTCG-1

using 485 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[193, 288]
surviving nonsolo ucounts = 2[193, 288]
ids = [4, 1]

====================================================================================

UMI info for barcode GTAACGTGTCTTCTCG-1 contig 1 = GGGGAGGAAC...
umi TATCAGTGCC = 286 reads: +388 validated
umi TGCCTTATGC = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=9)
386-424 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 65 reads
cdr3 = CHHRTNWPPGITF at 357, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 472
start codons at 36, 85, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.695 = GTAACGTGTGTGACGA-1

using 342 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 5, 325]
surviving nonsolo ucounts = 1[325]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 33, 241, 367, 456
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.698 = GTAACGTGTTGAGGTG-1

using 19 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.699 = GTAACGTGTTTAGCTG-1

using 284 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 60, 217]
surviving nonsolo ucounts = 2[60, 217]
ids = [5, 4]

====================================================================================

UMI info for barcode GTAACGTGTTTAGCTG-1 contig 1 = ACCCAAAAAC...
umi CAGTACATAG = 215 reads: +436 validated
umi GCCCTATCAG = 61 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=566]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-566 ==> 0-76 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 28 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 272
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.701 = GTAACGTGTTTGTGTG-1

using 216 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 3[3, 4, 198]
surviving nonsolo ucounts = 1[198]
ids = [9]

====================================================================================

UMI info for barcode GTAACGTGTTTGTGTG-1 contig 1 = AGTGACTCCT...
umi CGGGGGGTCG = 196 reads: +433 validated
umi CGGGGGTCGT = 2 reads: -154 +3 -1 +5 -1 +2 -1 +1 -1 +7 -2 +2 -2X +2 -1X +1 -1X +7 -1 +3 -1 +1 -1 +1 -1 +3 -1 +2 -224 invalidated

GOOD CONTIGS

TIG 1[bases=500]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-370 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
401-453 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
453-500 ==> 0-47 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 365, score = 8 + 6
umis assigned: [9, 10]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 20, 64, 243, 326
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.702 = GTAACGTTCAATCACG-1

using 311 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [6]

====================================================================================

UMI info for barcode GTAACGTTCAATCACG-1 contig 1 = GGAGGAACTG...
umi TACTAGATAA = 277 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
416-494 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNNWPGTF at 355, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.706 = GTAACGTTCAGTCCCT-1

using 362 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 357]
surviving nonsolo ucounts = 1[357]
ids = [1]

====================================================================================

UMI info for barcode GTAACGTTCAGTCCCT-1 contig 1 = GAAGAGCTGC...
umi TAGATGATCG = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYGSSPMYTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 33, 82, 241, 340, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.709 = GTAACGTTCCCAACGG-1

using 348 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4, 17, 323]
surviving nonsolo ucounts = 1[323]
ids = [4]

====================================================================================

UMI info for barcode GTAACGTTCCCAACGG-1 contig 1 = GGGGATCAGT...
umi GCGTACTTTC = 301 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.714 = GTAACGTTCCGTTGCT-1

using 282 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 272]
surviving nonsolo ucounts = 1[272]
ids = [0]

====================================================================================

UMI info for barcode GTAACGTTCCGTTGCT-1 contig 1 = GCTCTGCTTC...
umi AACATATGTC = 271 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.715 = GTAACGTTCCTACAGA-1

using 354 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[3, 344]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.718 = GTAACGTTCGGATGTT-1

using 6 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[6]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.722 = GTAACGTTCGTAGGAG-1

using 255 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[255]
surviving nonsolo ucounts = 1[255]
ids = [0]

====================================================================================

UMI info for barcode GTAACGTTCGTAGGAG-1 contig 1 = GAGTCAGTCT...
umi CTTTACCGAC = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=448]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-448 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 25, 31, 87, 100, 236
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.724 = GTAACGTTCTAACTTC-1

using 358 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 351]
surviving nonsolo ucounts = 1[351]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.726 = GTAACGTTCTCACATT-1

using 268 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 260]
surviving nonsolo ucounts = 1[260]
ids = [2]

====================================================================================

UMI info for barcode GTAACGTTCTCACATT-1 contig 1 = AACCACATCC...
umi CTCGGATCCG = 253 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=558]
0-48 ==> 256-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
48-401 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=8)
418-466 ==> 15-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
466-558 ==> 0-92 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARVHTVVEDGMDVW at 390, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 48, 204, 246, 312, 345, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.727 = GTAACGTTCTCCAGGG-1

using 534 reads

====================================================================================

graph has 280 edges initially, 38 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[246, 285]
surviving nonsolo ucounts = 2[246, 285]
ids = [3, 0]

====================================================================================

UMI info for barcode GTAACGTTCTCCAGGG-1 contig 1 = GTCAGTCTCA...
umi GCGATGGCGG = 253 reads: +388 validated

UMI info for barcode GTAACGTTCTCCAGGG-1 contig 2 = GGTCAGTCTC...
umi CAATCGCTTG = 285 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 23, 29, 85, 98, 234, 453
confident = false

TIG 2[bases=545]
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
371-409 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSNSYWTF at 351, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 24, 30, 84, 99, 235, 238, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.728 = GTAACGTTCTCGTTTA-1

using 56 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[54]
surviving nonsolo ucounts = 1[54]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.742 = GTAACTGAGATAGTCA-1

using 510 reads

====================================================================================

graph has 786 edges initially, 2 edges after simplification

total ucounts = 207
nonsolo ucounts = 107[2^45, 3^17, 4^18, 5^7, 6^7, 7^4, 8^4, 9^2, 12^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.743 = GTAACTGAGATCTGCT-1

using 286 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 277]
surviving nonsolo ucounts = 1[277]
ids = [0]

====================================================================================

UMI info for barcode GTAACTGAGATCTGCT-1 contig 1 = CTGCTAAACC...
umi AAACCTCCAC = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=580]
56-407 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
406-444 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
444-580 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 383, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 56, 62, 131, 267, 486
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.748 = GTAACTGAGCTAACAA-1

using 253 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[250]
surviving nonsolo ucounts = 1[250]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.757 = GTAACTGAGGCCCTTG-1

using 15 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.758 = GTAACTGAGGGAGTAA-1

using 61 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 54]
surviving nonsolo ucounts = 1[54]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=338]
0-79 ==> 75-154 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=3)
79-275 ==> 155-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=15)
274-312 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
312-338 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 251, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 43
start codons at 0, 135
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.763 = GTAACTGAGTAGGTGC-1

using 287 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[280]
surviving nonsolo ucounts = 1[280]
ids = [1]

====================================================================================

UMI info for barcode GTAACTGAGTAGGTGC-1 contig 1 = GTTCTGGGGT...
umi AGAGCTTCAA = 262 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=545]
0-19 ==> 21-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
19-356 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
363-401 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
401-545 ==> 0-144 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CNSRDSSGNHLVF at 334, score = 8 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 19, 138, 167, 218, 317
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.767 = GTAACTGAGTGCTGCC-1

using 228 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[223]
surviving nonsolo ucounts = 1[223]
ids = [2]

====================================================================================

UMI info for barcode GTAACTGAGTGCTGCC-1 contig 1 = ATCACATAAC...
umi AGTCAGAGTC = 221 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=562]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
479-562 ==> 0-83 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 29 reads
cdr3 = CARSGEVIAIQRFDYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.773 = GTAACTGCAAATCCGT-1

using 1070 reads

====================================================================================

graph has 1740 edges initially, 26 edges after simplification

total ucounts = 489
nonsolo ucounts = 216[2^90, 3^43, 4^32, 5^15, 6^12, 7^7, 8^10, 9, 10, 11, 12, 14^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.774 = GTAACTGCAACACCCG-1

using 713 reads

====================================================================================

graph has 412 edges initially, 18 edges after simplification

total ucounts = 25
nonsolo ucounts = 10[2^3, 3, 4^3, 140, 238, 299]
surviving nonsolo ucounts = 3[140, 238, 299]
ids = [7, 17, 8]

====================================================================================

UMI info for barcode GTAACTGCAACACCCG-1 contig 1 = GAGAGAGGAG...
umi GACGAGTGGG = 240 reads: +424 validated

UMI info for barcode GTAACTGCAACACCCG-1 contig 2 = GGGGGCTTTC...
umi CACGCGGTTC = 305 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=540]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-540 ==> 0-43 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 73, 224, 229, 376, 454
confident = false

TIG 2[bases=519]
18-395 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
400-448 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
448-519 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARGWELLDYW at 384, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 298
start codons at 18, 27, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.787 = GTAACTGCACGAGAGT-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[7, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.797 = GTAACTGCAGTAGAGC-1

using 551 reads

====================================================================================

graph has 228 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[7, 211, 327]
surviving nonsolo ucounts = 2[211, 327]
ids = [7, 0]

====================================================================================

UMI info for barcode GTAACTGCAGTAGAGC-1 contig 1 = AGGAACTGCT...
umi AAATTTCACG = 305 reads: +382 validated

UMI info for barcode GTAACTGCAGTAGAGC-1 contig 2 = AGAGAGGTGC...
umi TAATGAGCTA = 205 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=506]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRSNWPLTF at 353, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 32, 240, 456
confident = false

TIG 2[bases=520]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=1)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=25)
449-484 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
484-520 ==> 0-36 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CGRGDGSPAVRFW at 414, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 72, 132, 223, 228, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.802 = GTAACTGCATGCGCAC-1

using 356 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 352]
surviving nonsolo ucounts = 1[352]
ids = [0]

====================================================================================

UMI info for barcode GTAACTGCATGCGCAC-1 contig 1 = AGGAATCAGA...
umi AACTGTTCGA = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=10)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-499 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYDSYPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 27, 33, 89, 102, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.819 = GTAACTGGTATAGTAG-1

using 290 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[3, 7^2, 267]
surviving nonsolo ucounts = 1[267]
ids = [3]

====================================================================================

UMI info for barcode GTAACTGGTATAGTAG-1 contig 1 = GGAGACTCAG...
umi CCCCGCTTTA = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
22-373 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
372-410 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
410-476 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNGQSRAF at 349, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 22, 28, 97, 233, 236, 329, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.827 = GTAACTGGTCTCCACT-1

using 324 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3, 4, 315]
surviving nonsolo ucounts = 1[315]
ids = [2]

====================================================================================

UMI info for barcode GTAACTGGTCTCCACT-1 contig 1 = AGACTCAGTC...
umi CTCCCGGGGC = 314 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYDSFSWTF at 347, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 20, 26, 82, 95, 231, 234, 327, 357, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.828 = GTAACTGGTCTCCCTA-1

using 860 reads

====================================================================================

graph has 290 edges initially, 8 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[246, 273, 339]
surviving nonsolo ucounts = 3[246, 273, 339]
ids = [2, 4, 0]

====================================================================================

UMI info for barcode GTAACTGGTCTCCCTA-1 contig 1 = GAAGAGCTGC...
umi CCTTTTGCAC = 247 reads: +385 validated

UMI info for barcode GTAACTGGTCTCCCTA-1 contig 2 = GGGAATCAGT...
umi TGTAGTTATC = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYGSSPLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 33, 241, 367, 460
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.830 = GTAACTGGTCTTCTCG-1

using 314 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[312]
surviving nonsolo ucounts = 1[312]
ids = [2]

====================================================================================

UMI info for barcode GTAACTGGTCTTCTCG-1 contig 1 = GGAGTCAGTC...
umi TACGATCGTA = 294 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
373-411 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
411-502 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.832 = GTAACTGGTGACTCAT-1

using 384 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 1[382]
ids = [2]

====================================================================================

UMI info for barcode GTAACTGGTGACTCAT-1 contig 1 = AGACCCAGTC...
umi TCCTAGGATT = 386 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 161-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
20-373 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=3)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CQQYYSFPYTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 378
start codons at 20, 26, 82, 95, 158, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.836 = GTAACTGGTGTGCCTG-1

using 325 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 320]
surviving nonsolo ucounts = 1[320]
ids = [4]

====================================================================================

UMI info for barcode GTAACTGGTGTGCCTG-1 contig 1 = GCAGGAGTCA...
umi TTTTTTATCG = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=452]
0-29 ==> 18-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=24)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
417-452 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQADSFPRTF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 29, 35, 91, 104
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.841 = GTAACTGGTTCGTCTC-1

using 158 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 152]
surviving nonsolo ucounts = 1[152]
ids = [1]

====================================================================================

UMI info for barcode GTAACTGGTTCGTCTC-1 contig 1 = CAGCATGGAC...
umi ACTTTATGGG = 135 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=407]
4-355 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=17)
354-392 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
junction support: 1 umis using 27 reads
cdr3 = CQQAHSFPLTF at 331, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 4, 10, 66, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.851 = GTAACTGTCATGCTCC-1

using 1370 reads

====================================================================================

graph has 1158 edges initially, 20 edges after simplification

total ucounts = 283
nonsolo ucounts = 115[2^57, 3^17, 4^16, 5^2, 6^6, 7^7, 8^2, 9, 12, 14^2, 19, 221, 265, 308]
surviving nonsolo ucounts = 3[221, 265, 308]
ids = [104, 236, 6]

====================================================================================

UMI info for barcode GTAACTGTCATGCTCC-1 contig 1 = CAGCTTCAGC...
umi AACATCGGAA = 306 reads: -133X +255 invalidated
umi CCGAGTTCGT = 221 reads: +388 validated
umi TCTTGACCCT = 148 reads: +6 -1XX +1 -1XX +1 -2XX +14 -1XX +6 -1XX +7 -2XX +22 -1XX +5 -1XX +5 -1XX +6 -3XX +6 -1XX +4 -1X +2 -85X +18 -1XX +2 -1XX +4 -1XX +1 -3XX +1 -2XX +37 -1XX +28 -1XX +10 -1XX +21 -1XX +3 -4XX +2 -1XX +1 -2XX +3 -2XX +8 -1XX +4 -1XX +4 -1XX +8 -1XX +21 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=647]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
436-647 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 124 reads
cdr3 = CASWDDSLNGPVF at 369, score = 8 + 8
umis assigned: [6, 104, 236]
of which 3 are surviving nonsolos
reads assigned: 647
start codons at 48, 352, 377, 394
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.852 = GTAACTGTCCCAAGTA-1

using 357 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3^2, 340]
surviving nonsolo ucounts = 1[340]
ids = [10]

====================================================================================

UMI info for barcode GTAACTGTCCCAAGTA-1 contig 1 = GAGGAACTGC...
umi TTCCCATGTT = 321 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=462]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-462 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.857 = GTAACTGTCCTTTACA-1

using 326 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 320]
surviving nonsolo ucounts = 1[320]
ids = [2]

====================================================================================

UMI info for barcode GTAACTGTCCTTTACA-1 contig 1 = GGAATCAGTC...
umi CATTTCTTTC = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.874 = GTAACTGTCTTGCATT-1

using 967 reads

====================================================================================

graph has 322 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[4, 6, 281, 672]
surviving nonsolo ucounts = 2[281, 672]
ids = [4, 2]

====================================================================================

UMI info for barcode GTAACTGTCTTGCATT-1 contig 1 = AGTCCCACTC...
umi GCACTACTTT = 673 reads: +388 validated

UMI info for barcode GTAACTGTCTTGCATT-1 contig 2 = GGGGAAGCTC...
umi GGAGCCCTTC = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 117 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 661
start codons at 20, 26, 95, 231, 450
confident = false

TIG 2[bases=557]
0-56 ==> 0-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
56-407 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
406-444 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
444-557 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDSLSGRVF at 377, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 56, 210, 360, 385, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.877 = GTAACTGTCTTTAGGG-1

using 14613 reads

====================================================================================

graph has 7348 edges initially, 56 edges after simplification

total ucounts = 1327
nonsolo ucounts = 683[2^226, 3^143, 4^93, 5^61, 6^40, 7^22, 8^16, 9^13, 10^5, 11^7, 12, 13^2, 14^3, 15, 28, 31, 36, 54, 58, 76, 101, 124, 136, 143, 156, 158, 162, 175, 179, 192, 200, 203, 205, 215, 219^2, 220, 222, 225, 230, 233, 234, 235, 239, 244, 246, 257, 266, 267, 270, 276, 277, 283, 284, 286, 301, 305, 306, 318, 326, 329, 401, 645, 755]
surviving nonsolo ucounts = 47[54, 58, 76, 101, 124, 136, 143, 156, 158, 162, 175, 179, 192, 200, 203, 205, 215, 219^2, 220, 222, 225, 230, 233, 234, 235, 239, 244, 246, 257, 266, 267, 270, 276, 277, 283, 284, 286, 301, 305, 306, 318, 326, 329, 401, 645, 755]
ids = [683, 457, 684, 589, 1236, 1190, 484, 732, 524, 1133, ...]

====================================================================================

UMI info for barcode GTAACTGTCTTTAGGG-1 contig 1 = GGGGTCACAA...
umi AAAGTCCTCA = 269 reads: +394 validated
umi AACCCTTCTA = 222 reads: +394 validated
umi AATATTGGGC = 203 reads: +394 validated
umi AATGAAAGCG = 282 reads: +394 validated
umi CAGATGTCTA = 200 reads: +394 validated
umi CATGGAGAGT = 259 reads: +394 validated
umi CCAACACCAG = 215 reads: -385 +7 -1XX +1 invalidated
umi CCAAGTTGCT = 305 reads: +394 validated
umi CGCATTGGCG = 177 reads: +394 validated
umi CGGCGTCCCG = 58 reads: +394 validated
umi CGGCGTCCCT = 331 reads: +394 validated
umi CTACTACACA = 144 reads: +394 validated
umi CTGCGTTGGT = 155 reads: +394 validated
umi CTTGCTGGGG = 803 reads: -223 +171 non-validated
umi CTTTCTCTGG = 395 reads: -35X +1 -3XX +2 -3XX +1 -2XX +347 invalidated
umi CTTTGTCATA = 239 reads: +394 validated
umi GAAGTGACTC = 101 reads: +394 validated
umi GCACCACGTG = 310 reads: +394 validated
umi GCGTCGCGTT = 53 reads: +381 -1 +12 non-validated
umi GCGTCGCTTT = 73 reads: +394 validated
umi GTCGAGGTTC = 238 reads: +394 validated
umi GTGTTTGGTG = 221 reads: +394 validated
umi GTTTGGATCC = 223 reads: +394 validated
umi TACTGCAGCT = 229 reads: +394 validated
umi TCTCACCACT = 220 reads: +394 validated
umi TCTCTCTCAA = 225 reads: +394 validated
umi TGCTTCAGGG = 159 reads: +394 validated
umi TTACATTTCC = 137 reads: +394 validated
umi TTCGCTTCTA = 125 reads: +394 validated
umi TTGTATCCAA = 243 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=643]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=12)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 29 umis using 1111 reads
cdr3 = CCSCARTTTFHVVF at 362, score = 8 + 8
umis assigned: [6, 17, 33, 36, 299, 325, 334, 338, 434, 457] and 20 others
of which 30 are surviving nonsolos
reads assigned: 6677
start codons at 38, 177, 189, 239, 246, 393
confident = true

REJECT CONTIGS

TIG 1[bases=553]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-36 ==> 5964-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
9-61 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=6)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [238, 429, 732, 749, 993, 1296]
of which 6 are surviving nonsolos
reads assigned: 1414
start codons at 36, 237, 244, 459
confident = false
did not find CDR3

TIG 2[bases=384]
11-132 ==> 166-287 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=12)
203-247 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
247-314 ==> 0-67 on rc of segment before IGHJ6 exon 1 [len=6979] (mis=5)
313-384 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1235]
of which 1 are surviving nonsolos
reads assigned: 641
start codons at 54, 153, 204
confident = false
did not find CDR3

TIG 3[bases=576]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-358 ==> 0-322 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=9)
359-397 ==> 322-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4) [SHIFT!]
401-440 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMPPLQSPPMYTF at 373, score = 3 + 8
umis assigned: [8, 441, 448, 521, 752, 795, 847, 996, 1072, 1196]
of which 10 are surviving nonsolos
reads assigned: 2604
start codons at 36, 69, 100, 105, 193, 205, 355, 376, 400, 482
confident = false
not full
frameshifted full length transcript of length 576
VJ delta = 14
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.878 = GTACGTAAGAAACCTA-1

using 466 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 3, 456]
surviving nonsolo ucounts = 1[456]
ids = [7]

====================================================================================

UMI info for barcode GTACGTAAGAAACCTA-1 contig 1 = AGCTGTGGGT...
umi TTCGTGCCCG = 457 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 73-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
41-394 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 80 reads
cdr3 = CASWDDSLRGRVF at 362, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 452
start codons at 41, 195, 345, 370, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.881 = GTACGTAAGAGGGATA-1

using 990 reads

====================================================================================

graph has 448 edges initially, 22 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^2, 3, 4, 18, 82, 257, 307, 313]
surviving nonsolo ucounts = 4[18, 82, 257, 307]
ids = [10, 8, 3, 6]

====================================================================================

UMI info for barcode GTACGTAAGAGGGATA-1 contig 1 = GAGTCAGACC...
umi CGTAAACCGT = 278 reads: +391 validated
umi TCATAGGCTG = 75 reads: +391 validated
umi TCCAACCTTG = 241 reads: +41 -1XX +10 -1XX +8 -1XX +27 -1XX +3 -1XX +2 -1XX +7 -1XX +35 -1XX +7 -2XX +4 -2XX +4 -2XX +2 -4XX +17 -1XX +4 -1XX +22 -3XX +2 -1XX +1 -2XX +5 -2XX +25 -1XX +20 -1XX +20 -1XX +5 -1XX +5 -1XX +14 -1XX +4 -1XX +1 -3XX +2 -2XX +1 -1XX +1 -1XX +1 -5XX +1 -3XX +1 -1XX +38 invalidated

UMI info for barcode GTACGTAAGAGGGATA-1 contig 2 = TCTCTGCTTC...
umi CACTTCCGTA = 252 reads: +394 validated
umi TTCATCAGTT = 6 reads: +11 -1XX +6 -1XX +7 -1X +1 -1 +1 -1X +2 -1X +3 -1 +3 -181X +1 -1X +13 -1X +16 -1X +23 -3 +8 -1X +10 -1XX +21 -1XX +3 -5XX +1 -1XX +1 -2XX +2 -3X +11 -42 invalidated

GOOD CONTIGS

TIG 1[bases=511]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-511 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 61 reads
cdr3 = CQQYNSYFPLTF at 352, score = 8 + 9
umis assigned: [6, 8, 9]
of which 2 are surviving nonsolos
reads assigned: 566
start codons at 25, 31, 87, 100, 332, 458
confident = true

TIG 2[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=1)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [3, 10]
of which 2 are surviving nonsolos
reads assigned: 256
start codons at 51, 205, 208, 259, 358, 385, 409
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.882 = GTACGTAAGAGGGCTT-1

using 328 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

UMI info for barcode GTACGTAAGAGGGCTT-1 contig 1 = GAAGAGCTGC...
umi GTAAACACCA = 329 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPPRTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 323
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.885 = GTACGTAAGCAGCCTC-1

using 112 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 104]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.888 = GTACGTAAGCCAGGAT-1

using 336 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [1]

====================================================================================

UMI info for barcode GTACGTAAGCCAGGAT-1 contig 1 = TGGGGAGGAA...
umi CTGCTCACAC = 333 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 60-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
37-382 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSDWPRTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.891 = GTACGTAAGCGATTCT-1

using 206 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 196]
surviving nonsolo ucounts = 1[196]
ids = [5]

====================================================================================

UMI info for barcode GTACGTAAGCGATTCT-1 contig 1 = AGCTCTCAGA...
umi CTCGTGTTCT = 196 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=586]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-288 ==> 0-209 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=18)
288-426 ==> 215-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=12)
468-515 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
515-586 ==> 0-71 on |47|IGHG4|C-REGION| [len=980] (mis=1)
junction support: 1 umis using 12 reads
cdr3 = CAREGTKVPGSPNRYYYAGMDVW at 415, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 79, 132, 137, 235, 350, 376, 472
confident = false
see deletion of 6 bases at pos 209 on |142|IGHV3-48|L-REGION+V-REGION|
>vscore_80.891_83.0%
ATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGTCCAATGTGATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCCGGATTCGTCTTTAGTAGATATTCCATGAACTGGGTCCGCCTGGCTCCAGGTAAGGGACTGGAGTGGATTGCTTACATTAGTTCTAGTACCATAGAATACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTTTCTGCACATGAACAGCCTGAGAGACGAGGACACGGCTCTATATTTCTGTGCGAGGGAA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.897 = GTACGTAAGTACGCGA-1

using 491 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 483]
surviving nonsolo ucounts = 1[483]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=500]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-92 ==> 0-46 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=0)
88-226 ==> 170-308 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
251-289 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
289-500 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 476
start codons at 46, 129, 222
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.898 = GTACGTAAGTAGGCCA-1

using 1315 reads

====================================================================================

graph has 1872 edges initially, 24 edges after simplification

total ucounts = 593
nonsolo ucounts = 264[2^97, 3^60, 4^36, 5^27, 6^15, 7^12, 8^7, 9^5, 10^2, 11, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.901 = GTACGTACAAGTCTGT-1

using 866 reads

====================================================================================

graph has 334 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[4, 8, 84, 155, 611]
surviving nonsolo ucounts = 3[84, 155, 611]
ids = [8, 0, 5]

====================================================================================

UMI info for barcode GTACGTACAAGTCTGT-1 contig 1 = TGATCAGGAC...
umi TCAGGGTGAT = 612 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=564]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CMQALQTRETF at 367, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 602
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false

REJECT CONTIGS

TIG 1[bases=582]
0-87 ==> 9655-9742 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=0)
82-356 ==> 9736-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=0)
356-582 ==> 0-226 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 145
start codons at 153, 212, 247, 268, 307, 356, 362, 418, 431, 567
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.908 = GTACGTACACAGGAGT-1

using 13 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.913 = GTACGTACACGGTGTC-1

using 50 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 7, 8, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.925 = GTACGTACATCTCGCT-1

using 221 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [0]

====================================================================================

UMI info for barcode GTACGTACATCTCGCT-1 contig 1 = GAGGAATCAG...
umi AAACTATGGC = 198 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-478 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.932 = GTACGTAGTAGCTGCC-1

using 360 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 352]
surviving nonsolo ucounts = 1[352]
ids = [0]

====================================================================================

UMI info for barcode GTACGTAGTAGCTGCC-1 contig 1 = ACCCAAAAAC...
umi ATAATGTTCT = 334 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=554]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-554 ==> 0-64 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 326
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.934 = GTACGTAGTATAATGG-1

using 21 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 4, 8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.935 = GTACGTAGTATAGTAG-1

using 299 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[299]
surviving nonsolo ucounts = 1[299]
ids = [0]

====================================================================================

UMI info for barcode GTACGTAGTATAGTAG-1 contig 1 = GGGGGACTCC...
umi TAACGGTGTT = 298 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=599]
21-371 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
388-439 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
439-599 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CASAAAPGDWFDPW at 366, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 292
start codons at 21, 177, 244, 336, 493
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.939 = GTACGTAGTCAAAGAT-1

using 218 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[217]
surviving nonsolo ucounts = 1[217]
ids = [1]

====================================================================================

UMI info for barcode GTACGTAGTCAAAGAT-1 contig 1 = ACCATCACAC...
umi TTTTAGGTCC = 213 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=535]
0-60 ==> 0-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
60-413 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=7)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
469-535 ==> 0-66 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CVTDLATTVDYW at 402, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 60, 216, 258, 280, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.942 = GTACGTAGTCAATACC-1

using 470 reads

====================================================================================

graph has 212 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[198, 266]
surviving nonsolo ucounts = 2[198, 266]
ids = [7, 3]

====================================================================================

UMI info for barcode GTACGTAGTCAATACC-1 contig 1 = CTCAGTTAGG...
umi CCACCTGCTG = 272 reads: +385 validated

UMI info for barcode GTACGTAGTCAATACC-1 contig 2 = GCTCTGCTTC...
umi GGAAATTTCT = 195 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=545]
0-24 ==> 28-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
24-372 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
372-409 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQHATSPFTF at 348, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 265
start codons at 24, 232, 358, 451
confident = false

TIG 2[bases=570]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-570 ==> 0-125 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.943 = GTACGTAGTCATACTG-1

using 21406 reads

====================================================================================

graph has 14708 edges initially, 212 edges after simplification

total ucounts = 3016
nonsolo ucounts = 1494[2^598, 3^325, 4^202, 5^115, 6^76, 7^48, 8^21, 9^14, 10^8, 11^7, 12^4, 13^2, 14^3, 17, 18^2, 19, 20^3, 27, 28, 33, 37, 44, 67, 70^2, 98, 112, 113, 123, 129, 139, 141, 142, 154, 168, 173, 174, 175, 177, 179, 184, 185, 188, 189, 193, 203, 204^2, 210, 213, 217, 228^3, 230, 231, 238, 239, 240^2, 247, 251, 253, 257, 262, 265, 281, 286, 289, 296, 301, 319, 321, 333, 339, 348, 379, 405, 538, 923, 1079]
surviving nonsolo ucounts = 59[2, 44, 67, 70, 98, 112, 113, 123, 129, 139, 141, 142, 154, 168, 173, 174, 175, 177, 179, 184, 185, 188, 189, 193, 203, 204^2, 210, 217, 228^3, 230, 231, 238, 239, 240^2, 247, 251, 253, 257, 262, 265, 281, 286, 289, 296, 301, 319, 321, 333, 339, 348, 379, 405, 538, 923, 1079]
ids = [210, 644, 368, 2784, 2106, 2596, 1336, 1820, 2887, 1050, ...]

====================================================================================

UMI info for barcode GTACGTAGTCATACTG-1 contig 1 = GGGGGTGGGC...
umi AAACTCACCG = 229 reads: +382 validated
umi AATTCTCAAT = 207 reads: +382 validated
umi AGACATTGGA = 227 reads: +382 validated
umi AGAGAAATGG = 173 reads: +382 validated
umi AGCCGAGCAT = 205 reads: +382 validated
umi AGGGTTTTCA = 249 reads: +121 -3XX +1 -1XX +1 -6XX +2 -3XX +1 -2XX +1 -1XX +239 invalidated
umi AGTATCCAAT = 68 reads: +382 validated
umi CAGTGTCACC = 266 reads: +382 validated
umi CCATTGACGT = 407 reads: -23X +359 invalidated
umi CGAGTTTACA = 137 reads: +382 validated
umi CGTCCAGCCT = 245 reads: +382 validated
umi CGTGCGTATG = 255 reads: +382 validated
umi CTGGAACCGT = 182 reads: +382 validated
umi CTGTATCTTC = 111 reads: +382 validated
umi CTTGAAAGGC = 145 reads: +382 validated
umi GCAAGTGGTT = 230 reads: +382 validated
umi GCGCCATCGC = 176 reads: +382 validated
umi GCTGGTCCTG = 216 reads: +382 validated
umi GGCTTCATAT = 260 reads: +382 validated
umi GGGATTTAGA = 282 reads: +382 validated
umi GGTACAGTGA = 122 reads: +382 validated
umi GTAAGCTACG = 305 reads: +382 validated
umi GTAGATTCTT = 549 reads: +382 validated
umi GTATGCGGGG = 317 reads: +382 validated
umi GTATGTCATA = 348 reads: +382 validated
umi GTCGACGGCT = 196 reads: +382 validated
umi GTGCAACTAC = 175 reads: +382 validated
umi TACAGTTACG = 172 reads: +382 validated
umi TATGTATAGG = 292 reads: +382 validated
umi TCGGTGTCCT = 296 reads: +382 validated
umi TCGTGGTCTT = 141 reads: +382 validated
umi TGAGGTCAAC = 229 reads: +382 validated
umi TGGTTTTAGG = 231 reads: +382 validated
umi TTCCTTCCTG = 261 reads: +382 validated
umi TTGAATCCTC = 233 reads: +382 validated
umi TTGCTCTTGA = 238 reads: +382 validated
umi TTTACTTCCT = 185 reads: +382 validated
umi TTTCACTTGC = 195 reads: +382 validated
umi TTTGCCATGA = 288 reads: +382 validated
umi TTTGCCCGTT = 182 reads: +382 validated

UMI info for barcode GTACGTAGTCATACTG-1 contig 2 = GGGAGAGGAG...
umi CACAGCTATT = 45 reads: +411 -13 non-validated
umi CACGTTGGTC = 175 reads: -395 +1 -3X +2 -3X +2 -1XX +2 -1XX +2 -2XX +2 -2XX +2 -1XX +3 invalidated
umi CATAGACCGT = 151 reads: -179 +245 non-validated
umi CTACGTCTTC = 167 reads: +424 validated
umi TAACGGCGGC = 7 reads: -418X +1 -2X +3 invalidated
umi TAATTCTCGT = 335 reads: -71 +2 -1 +350 non-validated
umi TGCCGTATTC = 75 reads: -396 +1 -4XX +1 -3XX +3 -3XX +1 -8XX +1 -1XX +2 invalidated
umi TTCAGGCCCA = 5 reads: -424 non-validated
umi TTGCTGTGTT = 134 reads: +117 -1XX +306 invalidated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=3)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=25)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 39 umis using 1536 reads
cdr3 = CKSRDSDGNHWVF at 355, score = 8 + 8
umis assigned: [6, 134, 283, 286, 312, 349, 368, 752, 866, 1050] and 30 others
of which 40 are surviving nonsolos
reads assigned: 9017
start codons at 40, 188, 193, 239, 260, 338, 374
confident = true

TIG 2[bases=678]
0-73 ==> 7-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
73-424 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=20)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
497-678 ==> 0-181 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 4 umis using 198 reads
cdr3 = CVRGSYDDGGYYLFDYW at 415, score = 9 + 7
umis assigned: [644, 689, 765, 1207, 2106, 2132, 2596, 2784, 2887]
of which 9 are surviving nonsolos
reads assigned: 1073
start codons at 73, 224, 287, 290, 308, 376, 431, 434, 437
confident = true

REJECT CONTIGS

TIG 1[bases=598]
4-351 ==> 0-347 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=16)
349-387 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
387-598 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CETVVVIIVVF at 326, score = 3 + 8
umis assigned: [209, 435, 804, 1710, 2468]
of which 5 are surviving nonsolos
reads assigned: 2638
start codons at 4, 65
confident = false
not full
frameshifted full length stopped transcript of length 598
VJ delta = 15
not full
now this is a cell
paired!

GACACGGCTGTTTATTACTGTGTGAGAGGGTCCTATGATGATGGTGGTTATTATTTGTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAAGTCCCGGGACAGCGATGGTAACCATTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.946 = GTACGTAGTCCCTACT-1

using 632 reads

====================================================================================

graph has 206 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[268, 361]
surviving nonsolo ucounts = 2[268, 361]
ids = [1, 0]

====================================================================================

UMI info for barcode GTACGTAGTCCCTACT-1 contig 1 = GTCAGTCTCA...
umi AGACCACCAT = 358 reads: +388 validated

UMI info for barcode GTACGTAGTCCCTACT-1 contig 2 = GCTGCGGGTA...
umi AGTTCGTCTA = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-374 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=30)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSKTSPRTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 23, 29, 85, 98, 453
confident = false

TIG 2[bases=596]
0-40 ==> 0-40 on |318|IGLV1-36|5'UTR| [len=40] (mis=0)
40-393 ==> 0-353 on |319|IGLV1-36|L-REGION+V-REGION| [len=353] (mis=2)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
428-596 ==> 0-168 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CAAWDDSLNGYVF at 361, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 40, 191, 248, 251, 344, 369, 374, 386, 392, 560
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.949 = GTACGTAGTCTGGTCG-1

using 251 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [1]

====================================================================================

UMI info for barcode GTACGTAGTCTGGTCG-1 contig 1 = GAGGAATCAG...
umi CGAGGAACCG = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.952 = GTACGTAGTGCCTGCA-1

using 92 reads

====================================================================================

graph has 70 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 24, 58]
surviving nonsolo ucounts = 1[58]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=451]
4-38 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-451 ==> 0-46 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 50
start codons at 17, 38, 82
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.955 = GTACGTAGTGTTGAGG-1

using 1124 reads

====================================================================================

graph has 1134 edges initially, 36 edges after simplification

total ucounts = 405
nonsolo ucounts = 167[2^69, 3^48, 4^18, 5^11, 6^6, 7, 8^2, 9^4, 10^6, 15, 307]
surviving nonsolo ucounts = 1[307]
ids = [6]

====================================================================================

UMI info for barcode GTACGTAGTGTTGAGG-1 contig 1 = AGGAGTCAGA...
umi AAATCGCGCC = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.960 = GTACGTAGTTCCCTTG-1

using 245 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [0]

====================================================================================

UMI info for barcode GTACGTAGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi ACAACTGCCT = 244 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.971 = GTACGTATCAAGGCTT-1

using 1394 reads

====================================================================================

graph has 1960 edges initially, 32 edges after simplification

total ucounts = 617
nonsolo ucounts = 297[2^115, 3^61, 4^50, 5^33, 6^10, 7^15, 8^7, 9, 10^2, 13, 14, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.972 = GTACGTATCAGTGCAT-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.978 = GTACGTATCCCAACGG-1

using 183 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 180]
surviving nonsolo ucounts = 1[180]
ids = [1]

====================================================================================

UMI info for barcode GTACGTATCCCAACGG-1 contig 1 = GATCAGGACT...
umi GTGCGGTTTA = 173 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=526]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-526 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQALQTPQYTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 30, 63, 99, 187, 246, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.979 = GTACGTATCCGAACGC-1

using 315 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 310]
surviving nonsolo ucounts = 1[310]
ids = [3]

====================================================================================

UMI info for barcode GTACGTATCCGAACGC-1 contig 1 = TGATCAGGAC...
umi CTGCCTATGT = 284 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=526]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
393-431 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
431-526 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPVGTF at 367, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 31, 64, 100, 188, 350, 370, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.987 = GTACGTATCGGATGGA-1

using 318 reads

====================================================================================

graph has 155 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 11, 303]
surviving nonsolo ucounts = 1[303]
ids = [4]

====================================================================================

UMI info for barcode GTACGTATCGGATGGA-1 contig 1 = GGAGTCAGTC...
umi CGGTCTACGC = 7 reads: -10 +7 -1X +23 -1X +9 -2X +1 -2X +10 -83 +4 -5XX +2 -1XX +22 -1XX +16 -1XX +5 -5 +1 -1X +1 -1X +8 -2XX +3 -1XX +2 -3XX +23 -2XX +14 -1X +4 -96X +1 -1X +7 -1X +4 invalidated
umi TGATCTTATG = 305 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [1, 4]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.996 = GTACGTATCTCTAGGA-1

using 236 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[231]
surviving nonsolo ucounts = 1[231]
ids = [4]

====================================================================================

UMI info for barcode GTACGTATCTCTAGGA-1 contig 1 = ACCCAAAAAC...
umi TGCCGCACTA = 220 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-542 ==> 0-52 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.997 = GTACGTATCTGCAGTA-1

using 1950 reads

====================================================================================

graph has 2666 edges initially, 34 edges after simplification

total ucounts = 814
nonsolo ucounts = 392[2^157, 3^91, 4^49, 5^32, 6^25, 7^14, 8^11, 9^2, 10^3, 11^2, 13^3, 14, 19, 107]
surviving nonsolo ucounts = 1[107]
ids = [322]

====================================================================================

UMI info for barcode GTACGTATCTGCAGTA-1 contig 1 = AGTGCTTTCT...
umi CCCTCTTTTA = 103 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=506]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
426-477 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
477-506 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 22 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 377, score = 9 + 7
umis assigned: [322]
of which 1 are surviving nonsolos
reads assigned: 100
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1006 = GTACTCCAGACGCACA-1

using 165 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[165]
surviving nonsolo ucounts = 1[165]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCAGACGCACA-1 contig 1 = GCTGGGGTCT...
umi TTTAATCGCT = 159 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=571]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-367 ==> 0-326 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
432-571 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 28 reads
cdr3 = CCSYAGGNIFHVF at 365, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 158
start codons at 41, 198, 249, 258, 348, 396, 564
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1019 = GTACTCCAGCCAGAAC-1

using 238 reads

====================================================================================

graph has 81 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[8, 226]
surviving nonsolo ucounts = 1[226]
ids = [5]

====================================================================================

UMI info for barcode GTACTCCAGCCAGAAC-1 contig 1 = AGGAACTGCT...
umi TTAGTTTCTC = 208 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=506]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQRSNWPLTF at 353, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 32, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1022 = GTACTCCAGCGTGTCC-1

using 907 reads

====================================================================================

graph has 856 edges initially, 2 edges after simplification

total ucounts = 274
nonsolo ucounts = 72[2^34, 3^9, 4^4, 5^8, 6^2, 7^2, 8^2, 9, 10^2, 11^2, 12^2, 13^2, 16, 394]
surviving nonsolo ucounts = 1[394]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCAGCGTGTCC-1 contig 1 = AGAGCTCTGG...
umi AAAGTACGCC = 394 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
388-426 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQYGSSPTF at 368, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 392
start codons at 44, 252, 378, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1024 = GTACTCCAGCTAAGAT-1

using 209 reads

====================================================================================

graph has 152 edges initially, 20 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^2, 3^2, 9, 52, 135]
surviving nonsolo ucounts = 2[52, 135]
ids = [2, 6]

====================================================================================

UMI info for barcode GTACTCCAGCTAAGAT-1 contig 1 = TGGGGATGCT...
umi CTCAAACATC = 2 reads: -176 +2 -1 +2 -1 +1 -3 +2 -1 +8 -2 +3 -2X +6 -1 +5 -2 +2 -1 +1 -1 +9 -234 invalidated
umi CTGTAAGATG = 127 reads: +466 validated

UMI info for barcode GTACTCCAGCTAAGAT-1 contig 2 = TGGGGATGCT...
umi CCCTTTCATA = 39 reads: -121X +82 -1XX +116 -1XX +115 invalidated

GOOD CONTIGS

TIG 1[bases=512]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
436-487 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
487-512 ==> 0-25 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARHAGDFWSGSGDPVGNWFDPW at 387, score = 9 + 7
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 5, 21, 30, 42, 86, 397
confident = false

TIG 2[bases=482]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=20)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
457-482 ==> 0-25 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARAHGDYYTLLDYW at 381, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 34
start codons at 5, 21, 30, 42, 86, 172, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1025 = GTACTCCAGCTCCTCT-1

using 386 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 377]
surviving nonsolo ucounts = 1[377]
ids = [3]

====================================================================================

UMI info for barcode GTACTCCAGCTCCTCT-1 contig 1 = GATCAGGACT...
umi CCTGTCTCGC = 379 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=16)
399-427 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CMQCIQLPWTF at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 373
start codons at 30, 63, 99, 199, 250, 349, 369, 374, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1032 = GTACTCCAGGGTTCCC-1

using 395 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 388]
surviving nonsolo ucounts = 1[388]
ids = [5]

====================================================================================

UMI info for barcode GTACTCCAGGGTTCCC-1 contig 1 = GGAGAAGAGC...
umi TCACTTGCTT = 393 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 72 reads
cdr3 = CQQYGSSLTF at 360, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 384
start codons at 36, 370, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1033 = GTACTCCAGGTGACCA-1

using 814 reads

====================================================================================

graph has 468 edges initially, 16 edges after simplification

total ucounts = 116
nonsolo ucounts = 51[2^20, 3^9, 4^7, 5^2, 6^3, 7^2, 8^2, 9, 10^2, 13, 272, 282]
surviving nonsolo ucounts = 2[272, 282]
ids = [48, 55]

====================================================================================

UMI info for barcode GTACTCCAGGTGACCA-1 contig 1 = GGAGGAACTG...
umi CGTTCAACAC = 283 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRRTWPPAF at 355, score = 9 + 6
umis assigned: [55]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 34, 83, 239, 458
confident = false

REJECT CONTIGS

TIG 1[bases=544]
0-79 ==> 5667-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
22-375 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [48]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 22, 28, 84, 97, 233, 450
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1036 = GTACTCCAGTCAAGCG-1

using 240 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[240]
surviving nonsolo ucounts = 1[240]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCAGTCAAGCG-1 contig 1 = AGCTTCAGCT...
umi TGCCTCACCT = 233 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-509 ==> 0-74 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1042 = GTACTCCAGTTAAGTG-1

using 255 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 5, 236]
surviving nonsolo ucounts = 1[236]
ids = [10]

====================================================================================

UMI info for barcode GTACTCCAGTTAAGTG-1 contig 1 = AGCTGGGAAG...
umi TGTATCGGTA = 237 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=534]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=3)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
436-534 ==> 0-98 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CVLYMGSGIHWVF at 369, score = 7 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 30, 45, 54, 57, 82, 349, 352, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1043 = GTACTCCAGTTCCACA-1

using 244 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[244]
surviving nonsolo ucounts = 1[244]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCAGTTCCACA-1 contig 1 = GGGGAGGAAC...
umi TGATCCTCCT = 246 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYYNWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 36, 91, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1044 = GTACTCCCAAACGCGA-1

using 1847 reads

====================================================================================

graph has 1678 edges initially, 24 edges after simplification

total ucounts = 326
nonsolo ucounts = 237[2^32, 3^28, 4^27, 5^19, 6^19, 7^12, 8^12, 9^9, 10^13, 11^10, 12^19, 13^11, 14^10, 15^6, 16^4, 18^2, 19^2, 22, 31]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1046 = GTACTCCCAAAGGAAG-1

using 30 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 5^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1051 = GTACTCCCAAGGTGTG-1

using 11 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1055 = GTACTCCCAATGTAAG-1

using 330 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 324]
surviving nonsolo ucounts = 1[324]
ids = [1]

====================================================================================

UMI info for barcode GTACTCCCAATGTAAG-1 contig 1 = GCATAGGCCC...
umi CAGTTAAGTC = 323 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-97 ==> 78-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
97-460 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
459-497 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
497-564 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYSTPVTF at 436, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 97, 166, 419, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1062 = GTACTCCCACGGCTAC-1

using 62 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2, 3^2, 6, 7^2, 8^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1064 = GTACTCCCACTGAAGG-1

using 3232 reads

====================================================================================

graph has 1284 edges initially, 10 edges after simplification

total ucounts = 149
nonsolo ucounts = 66[2^19, 3^7, 4^10, 5^4, 6^2, 7^3, 8^4, 9, 11, 12, 121, 147, 151, 161, 184, 190, 193, 226, 233, 236, 239, 264, 271, 317]
surviving nonsolo ucounts = 12[147, 151, 184, 190, 193, 226, 233, 236, 239, 264, 271, 317]
ids = [26, 36, 135, 40, 109, 19, 69, 148, 12, 46, ...]

====================================================================================

UMI info for barcode GTACTCCCACTGAAGG-1 contig 1 = GGAGTCTCCC...
umi ATATGACCAC = 122 reads: +415 validated
umi CAGACGAACA = 154 reads: +415 validated
umi CATCTTGGTG = 191 reads: +415 validated

UMI info for barcode GTACTCCCACTGAAGG-1 contig 2 = GGGGGGGTCT...
umi ACTAGCCCTG = 239 reads: +391 validated
umi AGCAATCACA = 225 reads: +391 validated
umi CCCTGCGGGA = 266 reads: +391 validated
umi CTCTCTGGGA = 235 reads: +391 validated
umi CTTAAGTCTG = 41 reads: -359X +1 -2XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi TAATGCCTCA = 194 reads: +391 validated
umi TTACTTGACA = 185 reads: +391 validated
umi TTTAGGCGGA = 322 reads: +391 validated
umi TTTCCCCATG = 234 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=576]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=0)
434-474 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
474-576 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 48 reads
cdr3 = CARQSSSFPIGDYW at 401, score = 8 + 7
umis assigned: [26, 36, 40]
of which 3 are surviving nonsolos
reads assigned: 460
start codons at 59, 233, 257, 392, 492, 553
confident = true

TIG 2[bases=643]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=2)
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
432-643 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 8 umis using 291 reads
cdr3 = CSSYTSSSTLEVF at 365, score = 8 + 8
umis assigned: [12, 19, 46, 69, 75, 109, 135, 146, 148]
of which 9 are surviving nonsolos
reads assigned: 1910
start codons at 41, 198, 242, 249
confident = true
now this is a cell
paired!

AAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACAAAGCAGCTCGTTCCCAATTGGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCGAGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1068 = GTACTCCCAGCCACCA-1

using 12 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1076 = GTACTCCCAGTCGTGC-1

using 248 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[20, 224]
surviving nonsolo ucounts = 1[224]
ids = [2]

====================================================================================

UMI info for barcode GTACTCCCAGTCGTGC-1 contig 1 = GAGAAGAGCT...
umi ACATAACCGG = 226 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYARSPRTF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 35, 177, 182, 243, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1077 = GTACTCCCATATACGC-1

using 237 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[237]
surviving nonsolo ucounts = 1[237]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCCATATACGC-1 contig 1 = GCTCTGCTTC...
umi CGCTATTCTA = 228 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=529]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-529 ==> 0-84 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1081 = GTACTCCCATCTATGG-1

using 280 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[277]
surviving nonsolo ucounts = 1[277]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=478]
0-76 ==> 5532-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
31-391 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
430-478 ==> 0-48 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 351, score = 4 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 31, 64, 100, 151, 188, 350, 370, 472
confident = false
not full
frameshifted full length stopped transcript of length 478
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1089 = GTACTCCGTACTTGAC-1

using 214 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 203]
surviving nonsolo ucounts = 1[203]
ids = [2]

====================================================================================

UMI info for barcode GTACTCCGTACTTGAC-1 contig 1 = TGGGGTCTCA...
umi ATTCGCCCTG = 186 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=447]
0-39 ==> 3-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
39-383 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
386-424 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
424-447 ==> 0-23 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CCSYAGSVYVF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 39, 178, 196, 240, 247, 250, 346, 373, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1090 = GTACTCCGTAGAGGAA-1

using 209 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode GTACTCCGTAGAGGAA-1 contig 1 = GGGGTCTCAG...
umi CGTATGGTTA = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=565]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-366 ==> 0-328 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
426-565 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSVAGSYSLVF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 38, 177, 195, 246, 249, 345
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1092 = GTACTCCGTAGCTAAA-1

using 2719 reads

====================================================================================

graph has 3460 edges initially, 64 edges after simplification

total ucounts = 1110
nonsolo ucounts = 528[2^185, 3^122, 4^73, 5^52, 6^31, 7^17, 8^15, 9^12, 10^4, 11^4, 12^5, 13^2, 16, 18^2, 20, 28, 45]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1094 = GTACTCCGTATGAAAC-1

using 374 reads

====================================================================================

graph has 138 edges initially, 16 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 70, 295]
surviving nonsolo ucounts = 2[70, 295]
ids = [8, 4]

====================================================================================

UMI info for barcode GTACTCCGTATGAAAC-1 contig 1 = GAGCTACAAC...
umi CTCGGCCTTT = 276 reads: +400 validated

UMI info for barcode GTACTCCGTATGAAAC-1 contig 2 = TCAGTTAGGA...
umi TATAAGACAT = 67 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=3)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-516 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYYSTPFTF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 30, 99, 352, 472
confident = false

TIG 2[bases=417]
0-23 ==> 24-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
23-368 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
junction support: 1 umis using 12 reads
cdr3 = CQQRSNWPGTF at 344, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 66
start codons at 23, 164, 228, 231
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1100 = GTACTCCGTCTACCTC-1

using 202 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 5, 188]
surviving nonsolo ucounts = 1[188]
ids = [6]

====================================================================================

UMI info for barcode GTACTCCGTCTACCTC-1 contig 1 = GCTGTGCTGT...
umi TTTTTCACAA = 1 reads: -85 +2 -2 +1 -5X +2 -1X +1 -2X +1 -1 +4 -1 +1 -1 +6 -1 +2 -1 +6 -1X +6 -1 +6 -251 invalidated
umi TTTTTCCCAT = 180 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=538]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-363 ==> 0-320 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=28)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=5)
434-538 ==> 0-104 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQSADSISPLATRVTF at 358, score = 8 + 9
umis assigned: [5, 6]
of which 1 are surviving nonsolos
reads assigned: 180
start codons at 43, 173, 191, 310
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1112 = GTACTCCGTTACTGAC-1

using 230 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 4, 213]
surviving nonsolo ucounts = 1[213]
ids = [5]

====================================================================================

UMI info for barcode GTACTCCGTTACTGAC-1 contig 1 = TTGACTGATC...
umi GGCGGTTTCA = 207 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=569]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=7)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQGLQSPRTF at 372, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 36, 69, 105, 193, 355, 375, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1118 = GTACTCCGTTCGCGAC-1

using 39 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 3, 27]
surviving nonsolo ucounts = 1[27]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1120 = GTACTCCGTTCTGAAC-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1121 = GTACTCCGTTGAGTTC-1

using 45 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 3, 5, 12, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1142 = GTACTCCTCCCATTTA-1

using 5242 reads

====================================================================================

graph has 2330 edges initially, 44 edges after simplification

total ucounts = 526
nonsolo ucounts = 241[2^92, 3^41, 4^39, 5^19, 6^19, 7^6, 8^4, 9^2, 11, 12, 13, 16, 56, 115, 136, 179, 188, 257, 270, 280, 290, 309, 314, 315, 323, 366, 743]
surviving nonsolo ucounts = 15[56, 115, 136, 179, 188, 257, 270, 280, 290, 309, 314, 315, 323, 366, 743]
ids = [406, 345, 432, 508, 68, 40, 56, 169, 396, 342, ...]

====================================================================================

UMI info for barcode GTACTCCTCCCATTTA-1 contig 1 = AGGAGTCAGA...
umi ACCACATCCT = 324 reads: +388 validated
umi ATGAGTCATA = 270 reads: +388 validated
umi ATTTGCGACT = 184 reads: +11 -1 +376 non-validated
umi CCGCTACTCT = 276 reads: +388 validated
umi GTCCTCTCCT = 319 reads: +56 -1XX +1 -1XX +2 -2XX +1 -4XX +4 -9XX +1 -10X +1 -3XX +3 -11XX +278 invalidated
umi TCCACCGGCA = 294 reads: +388 validated
umi TCCTATTGCG = 370 reads: +388 validated
umi TCTCCTTCCC = 142 reads: +56 -1XX +1 -1XX +2 -2XX +1 -4XX +4 -20XX +1 -3XX +3 -11XX +278 invalidated
umi TGGGTAGGCG = 591 reads: -322X +1 -2XX +1 -3XX +1 -1XX +1 -5XX +1 -8XX +1 -1XX +1 -1XX +1 -1XX +4 -1XX +20 -1XX +2 -1XX +5 -2XX invalidated
umi TTGTAACGCA = 314 reads: +388 validated
umi TTGTGCATCA = 176 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 422 reads
cdr3 = CQHYDGFSRTF at 354, score = 8 + 8
umis assigned: [21, 56, 68, 169, 342, 396, 408, 432, 459, 506] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3200
start codons at 27, 33, 102, 292, 334, 364, 367, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1155 = GTACTCCTCGTCGTTC-1

using 589 reads

====================================================================================

graph has 192 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 7, 175, 398]
surviving nonsolo ucounts = 3[7, 175, 398]
ids = [4, 2, 5]

====================================================================================

UMI info for barcode GTACTCCTCGTCGTTC-1 contig 1 = GAGAGAGGAG...
umi CAGTACTCAC = 167 reads: +424 validated
umi CATTTTGGCT = 7 reads: -4 +101 -2 +92 -104 +56 -65 non-validated

UMI info for barcode GTACTCCTCGTCGTTC-1 contig 2 = GGGGTCTCAG...
umi CTTGTCCTCG = 382 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-524 ==> 0-27 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 173
start codons at 73, 224, 229, 376, 454
confident = false

TIG 2[bases=582]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-353 ==> 0-315 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=12)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
426-582 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CTSYAGGSNVVF at 362, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 379
start codons at 38, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1168 = GTACTCCTCTTTACAC-1

using 172 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[3, 4^2, 5, 152]
surviving nonsolo ucounts = 1[152]
ids = [4]

====================================================================================

UMI info for barcode GTACTCCTCTTTACAC-1 contig 1 = AGCTCTGAGA...
umi GATTCTCTGC = 153 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=510]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 17 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1171 = GTACTTTAGAAGGTGA-1

using 357 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[357]
surviving nonsolo ucounts = 1[357]
ids = [0]

====================================================================================

UMI info for barcode GTACTTTAGAAGGTGA-1 contig 1 = GGAGTCAGTC...
umi CTTATTATCG = 361 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=553]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPQITF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 26, 32, 88, 101, 237, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1178 = GTACTTTAGAGAGCTC-1

using 486 reads

====================================================================================

graph has 140 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[236, 247]
surviving nonsolo ucounts = 2[236, 247]
ids = [2, 0]

====================================================================================

UMI info for barcode GTACTTTAGAGAGCTC-1 contig 1 = GCTGGGGTCT...
umi ATTTAGCCAG = 232 reads: +388 validated

UMI info for barcode GTACTTTAGAGAGCTC-1 contig 2 = GGAGGAACTG...
umi AGTTGTACTA = 246 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
41-395 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
429-551 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSGTLVF at 365, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 41, 198, 242, 249, 252
confident = false

TIG 2[bases=549]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-379 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=20)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQRDNWPTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 34, 239, 242, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1181 = GTACTTTAGATAGTCA-1

using 67 reads

====================================================================================

graph has 75 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^3, 3, 6, 10, 11, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1182 = GTACTTTAGATCTGCT-1

using 1212 reads

====================================================================================

graph has 296 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 4, 8, 10, 1183]
surviving nonsolo ucounts = 1[1183]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=339]
3-86 ==> 254-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=3)
90-128 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
128-339 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CQSIDTSAIWVF at 64, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 1167
start codons at 
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1190 = GTACTTTAGGCATGTG-1

using 184 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 6[2^2, 4, 5^2, 155]
surviving nonsolo ucounts = 1[155]
ids = [4]

====================================================================================

UMI info for barcode GTACTTTAGGCATGTG-1 contig 1 = GATCAGGACT...
umi ATACAAACCG = 153 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=493]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-493 ==> 0-69 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CMQALHSLTF at 366, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 30, 63, 99, 187, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1200 = GTACTTTAGTCCAGGA-1

using 1339 reads

====================================================================================

graph has 330 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 1336]
surviving nonsolo ucounts = 1[1336]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1202 = GTACTTTAGTGAACAT-1

using 197 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=427]
7-38 ==> 5969-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
17-186 ==> 0-169 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
186-288 ==> 269-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3) [SHIFT!]
310-356 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
356-427 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CARGAARSGTVTLDYW at 277, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 17, 38, 82, 168
confident = false
frameshifted full length stopped transcript of length 427
VJ delta = 106
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1203 = GTACTTTAGTGAACGC-1

using 549 reads

====================================================================================

graph has 898 edges initially, 2 edges after simplification

total ucounts = 256
nonsolo ucounts = 117[2^49, 3^27, 4^15, 5^11, 6^5, 7^3, 8, 9^3, 10^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1209 = GTACTTTCAAAGCGGT-1

using 66 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 11[2^4, 3, 4, 5, 7^2, 12, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1217 = GTACTTTCAATACGCT-1

using 466 reads

====================================================================================

graph has 158 edges initially, 12 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 5, 211, 238]
surviving nonsolo ucounts = 2[211, 238]
ids = [6, 10]

====================================================================================

UMI info for barcode GTACTTTCAATACGCT-1 contig 1 = CTCAGGACAA...
umi GGAATAGGGT = 34 reads: -9 +1 -2X +14 -1XX +6 -1XX +7 -2XX +20 -1XX +1 -1XX +5 -1XX +3 -1XX +1 -1XX +7 -1XX +12 -238X +1 -2X +1 -13X +3 -1X +8 -1XX +21 -1XX invalidated
umi TTGATGTGCT = 224 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=558]
18-371 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=32)
368-406 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
406-558 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CAAWDNRLNGWVF at 339, score = 8 + 8
umis assigned: [6, 10]
of which 2 are surviving nonsolos
reads assigned: 253
start codons at 18, 142, 322, 347, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1219 = GTACTTTCAATGGAGC-1

using 262 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^3, 250]
surviving nonsolo ucounts = 1[250]
ids = [7]

====================================================================================

UMI info for barcode GTACTTTCAATGGAGC-1 contig 1 = GCTCTGCTTC...
umi GACTTTAGCC = 250 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=539]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-539 ==> 0-97 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1226 = GTACTTTCACGAAGCA-1

using 108 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 7, 92]
surviving nonsolo ucounts = 1[92]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1227 = GTACTTTCACGGCCAT-1

using 747 reads

====================================================================================

graph has 1182 edges initially, 26 edges after simplification

total ucounts = 327
nonsolo ucounts = 163[2^70, 3^36, 4^27, 5^5, 6^7, 7^5, 8^4, 9^3, 10^2, 11^3, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1228 = GTACTTTCACTCTGTC-1

using 879 reads

====================================================================================

graph has 275 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^2, 4, 5, 9, 268, 274, 308]
surviving nonsolo ucounts = 3[268, 274, 308]
ids = [7, 9, 2]

====================================================================================

UMI info for barcode GTACTTTCACTCTGTC-1 contig 1 = GGGCTGGTCG...
umi AGGCCCTTTG = 309 reads: +388 validated
umi GATTGCCTGT = 265 reads: +388 validated
umi GGCACTCACG = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 0-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
47-398 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 117 reads
cdr3 = CQQSYRRPITF at 374, score = 8 + 8
umis assigned: [2, 7, 9]
of which 3 are surviving nonsolos
reads assigned: 837
start codons at 47, 53, 109, 122, 258, 357, 477
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1245 = GTACTTTCATACCATG-1

using 574 reads

====================================================================================

graph has 868 edges initially, 4 edges after simplification

total ucounts = 296
nonsolo ucounts = 108[2^49, 3^27, 4^15, 5^3, 6^4, 7^2, 9^3, 11, 12, 13, 15, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1253 = GTACTTTCATGCAATC-1

using 245 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[8^2, 229]
surviving nonsolo ucounts = 1[229]
ids = [0]

====================================================================================

UMI info for barcode GTACTTTCATGCAATC-1 contig 1 = GAAGAGCTGC...
umi ACTATATGGC = 214 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=465]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-465 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYGSSPKTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1254 = GTACTTTCATTATCTC-1

using 471 reads

====================================================================================

graph has 120 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[182, 288]
surviving nonsolo ucounts = 2[182, 288]
ids = [2, 1]

====================================================================================

UMI info for barcode GTACTTTCATTATCTC-1 contig 1 = GAGGAACTGC...
umi AAGCTGTCAC = 270 reads: +382 validated

UMI info for barcode GTACTTTCATTATCTC-1 contig 2 = GGCTGGGGTC...
umi TGACTCGGCT = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQRRTWPPAF at 354, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 267
start codons at 33, 82, 238, 457
confident = false

TIG 2[bases=543]
42-381 ==> 0-339 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=12)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-543 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CSSYTSSRTWVF at 366, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 178
start codons at 42, 199, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1270 = GTACTTTGTCAAAGAT-1

using 262 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode GTACTTTGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi ATGACGTTCC = 255 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=501]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-501 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 30, 63, 99, 187, 349, 369, 475
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1274 = GTACTTTGTCCGAATT-1

using 18 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1278 = GTACTTTGTCTCCACT-1

using 283 reads

====================================================================================

graph has 90 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 68, 209]
surviving nonsolo ucounts = 2[68, 209]
ids = [3, 5]

====================================================================================

UMI info for barcode GTACTTTGTCTCCACT-1 contig 1 = GGCTGGGGTC...
umi TGTTCACCAC = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=586]
42-388 ==> 0-346 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=9)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
430-586 ==> 0-156 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CSSYTSSTTVVF at 366, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 42, 199, 250, 253
confident = false

REJECT CONTIGS

TIG 1[bases=397]
0-341 ==> 7-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
370-397 ==> 0-27 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
cdr3 = CARDLLWF at 338, score = 9 + 4
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 63
start codons at 37, 355
confident = false
VJ delta = -25
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1280 = GTACTTTGTCTCGTTC-1

using 260 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 2[2, 248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode GTACTTTGTCTCGTTC-1 contig 1 = GTCAGACCCA...
umi ATGGACCAAC = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=499]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
411-499 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYNSPPYTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 23, 29, 85, 98, 330, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1284 = GTACTTTGTGAGCGAT-1

using 41 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 34]
surviving nonsolo ucounts = 1[34]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1290 = GTACTTTGTTAAAGTG-1

using 355 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 344]
surviving nonsolo ucounts = 1[344]
ids = [5]

====================================================================================

UMI info for barcode GTACTTTGTTAAAGTG-1 contig 1 = GAGAAGAGCT...
umi TACATCCTGA = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-350 ==> 0-315 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
385-423 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
423-506 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYTSSSPVTF at 359, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 35, 243, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1294 = GTACTTTGTTCGGCAC-1

using 265 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 260]
surviving nonsolo ucounts = 1[260]
ids = [0]

====================================================================================

UMI info for barcode GTACTTTGTTCGGCAC-1 contig 1 = GGGGTCACAA...
umi AGGACCCTGC = 263 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=547]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
432-547 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CCSYAGSRTPNWVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1302 = GTACTTTTCAACACAC-1

using 273 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 8[2^2, 3^2, 4, 7, 9, 234]
surviving nonsolo ucounts = 1[234]
ids = [1]

====================================================================================

UMI info for barcode GTACTTTTCAACACAC-1 contig 1 = TGAGCGCAGA...
umi ACCATTGTCT = 229 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=525]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-525 ==> 0-101 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CGTWDASLSAGVF at 357, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 36, 190, 237, 241, 247, 365, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1303 = GTACTTTTCACAGGCC-1

using 443 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 3, 4, 5^2, 6^2, 406]
surviving nonsolo ucounts = 1[406]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1305 = GTACTTTTCACGCATA-1

using 90 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 26
nonsolo ucounts = 12[2, 3^4, 4, 5^4, 6, 32]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1311 = GTACTTTTCATGGTCA-1

using 78 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 13[2, 3^3, 4, 5, 6^2, 7^2, 9^2, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1314 = GTACTTTTCCAAACTG-1

using 90 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 28
nonsolo ucounts = 18[2^3, 3^6, 4^2, 5^3, 8^3, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1317 = GTACTTTTCCGCAAGC-1

using 280 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 6, 261]
surviving nonsolo ucounts = 1[261]
ids = [7]

====================================================================================

UMI info for barcode GTACTTTTCCGCAAGC-1 contig 1 = GGGGAGAGGA...
umi CTTGCACAGC = 262 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=536]
74-389 ==> 0-315 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=20)
447-495 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
495-536 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARETDYGDYGYFDTW at 416, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 74, 230, 291, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1320 = GTACTTTTCGAATCCA-1

using 70 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 13[2^4, 3^2, 4, 5^2, 8^2, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1326 = GTACTTTTCTCGGACG-1

using 310 reads

====================================================================================

graph has 180 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2^3, 3^2, 4, 5, 6, 10, 15^2, 237]
surviving nonsolo ucounts = 1[237]
ids = [5]

====================================================================================

UMI info for barcode GTACTTTTCTCGGACG-1 contig 1 = GAGGAATCAG...
umi CTCGCCCTCA = 215 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=424]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 28, 34, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1327 = GTACTTTTCTTAACCT-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1334 = GTACTTTTCTTGTACT-1

using 301 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2^3, 5, 6, 10, 271]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1335 = GTACTTTTCTTTAGTC-1

using 385 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 12[3^3, 4^3, 5, 6, 8, 9^2, 320]
surviving nonsolo ucounts = 1[320]
ids = [17]

====================================================================================

UMI info for barcode GTACTTTTCTTTAGTC-1 contig 1 = GGAACTGCTC...
umi TTGCTGTGGT = 322 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 66-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
31-376 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
375-413 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNNWPPAF at 352, score = 8 + 7
umis assigned: [17]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1337 = GTAGGCCAGAATTGTG-1

using 261 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 253]
surviving nonsolo ucounts = 1[253]
ids = [5]

====================================================================================

UMI info for barcode GTAGGCCAGAATTGTG-1 contig 1 = ACAAGAGGCA...
umi GTGCCGGGGC = 238 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=484]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-371 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
422-484 ==> 0-62 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDKSLRGAVF at 355, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 31, 115, 188, 338, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1355 = GTAGGCCAGTACGCGA-1

using 240 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[230]
surviving nonsolo ucounts = 1[230]
ids = [6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=548]
2-36 ==> 5966-6000 on rc of segment after IGHV4-4 exon 1 [len=6000] (mis=0)
15-82 ==> 0-67 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0)
82-165 ==> 0-83 on rc of segment before IGHV4-34 exon 1 [len=83] (mis=0)
165-469 ==> 67-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=0) [SHIFT!]
472-503 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=2)
506-548 ==> 15-57 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
cdr3 = CARGPRYCSGGSCYSGYMDVW at 458, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 15, 36, 80, 97, 105, 113, 118, 249, 509
confident = false
VJ delta = -62
delta too large
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1357 = GTAGGCCAGTCACGCC-1

using 294 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 4, 5, 276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode GTAGGCCAGTCACGCC-1 contig 1 = ATCAGTCCCA...
umi ACGGGCAGCG = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1383 = GTAGGCCCAGCATGAG-1

using 312 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [0]

====================================================================================

UMI info for barcode GTAGGCCCAGCATGAG-1 contig 1 = GCTCTGCTTC...
umi CCAGACTTCA = 311 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=653]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-653 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1392 = GTAGGCCCATCCGCGA-1

using 248 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [0]

====================================================================================

UMI info for barcode GTAGGCCCATCCGCGA-1 contig 1 = GGGGAGGAAC...
umi AACATACTTC = 247 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=24)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQRSSWPITF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 36, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1397 = GTAGGCCCATTGAGCT-1

using 76 reads

====================================================================================

graph has 70 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[3, 4, 5, 7, 9, 14, 15, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1399 = GTAGGCCGTAACGCGA-1

using 633 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 627]
surviving nonsolo ucounts = 1[627]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=397]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-76 ==> 0-29 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=0)
72-151 ==> 274-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=5)
148-186 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
186-397 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CASWDDSLRGRVF at 119, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 620
start codons at 47, 102, 127, 132
confident = false
not full
full length transcript of length 397
VJ delta = 271
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1407 = GTAGGCCGTCACCTAA-1

using 143 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[143]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1418 = GTAGGCCGTGTCGCTG-1

using 526 reads

====================================================================================

graph has 209 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[8, 239, 276]
surviving nonsolo ucounts = 2[239, 276]
ids = [1, 3]

====================================================================================

UMI info for barcode GTAGGCCGTGTCGCTG-1 contig 1 = AGTCCCAGTC...
umi GGAATTGTTG = 240 reads: +388 validated
umi TCCAGATACG = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 38-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
20-371 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 97 reads
cdr3 = CQQLNSYPHTF at 347, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 508
start codons at 20, 26, 82, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1428 = GTAGGCCGTTTAAGCC-1

using 348 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 340]
surviving nonsolo ucounts = 1[340]
ids = [6]

====================================================================================

UMI info for barcode GTAGGCCGTTTAAGCC-1 contig 1 = GTCAGACTCA...
umi TTTTGGATCA = 339 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 334
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1429 = GTAGGCCTCAATCTCT-1

using 670 reads

====================================================================================

graph has 246 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[4, 13, 318, 332]
surviving nonsolo ucounts = 2[318, 332]
ids = [2, 4]

====================================================================================

UMI info for barcode GTAGGCCTCAATCTCT-1 contig 1 = TGGGGAGGAA...
umi CACAGGTGCT = 316 reads: +388 validated
umi TGAACAATGC = 328 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 114 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [2, 4]
of which 2 are surviving nonsolos
reads assigned: 634
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1448 = GTAGGCCTCGCCCTTA-1

using 249 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 7, 235]
surviving nonsolo ucounts = 1[235]
ids = [5]

====================================================================================

UMI info for barcode GTAGGCCTCGCCCTTA-1 contig 1 = GGAGTCAGTC...
umi CGACTCCTCT = 242 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSSPRTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1449 = GTAGGCCTCGGCGCTA-1

using 343 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 337]
surviving nonsolo ucounts = 1[337]
ids = [0]

====================================================================================

UMI info for barcode GTAGGCCTCGGCGCTA-1 contig 1 = GGATCACCCA...
umi CATTATCGTC = 300 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=594]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=2)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-594 ==> 0-99 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 59, 257, 262, 279, 323, 356, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1459 = GTAGGCCTCTTCCTTC-1

using 13137 reads

====================================================================================

graph has 5668 edges initially, 32 edges after simplification

total ucounts = 871
nonsolo ucounts = 414[2^167, 3^80, 4^41, 5^32, 6^22, 7^10, 8^5, 9^3, 10^2, 11^2, 12, 13^2, 15, 16, 22, 23, 48, 76, 109, 140, 148, 177, 181, 193, 200, 208, 211, 212, 215, 222, 228, 229, 238, 242, 245^2, 248, 252, 253, 256, 258, 262, 263, 268, 269, 270^2, 271^2, 282, 283, 295, 297, 299, 317, 331, 337, 733, 1005]
surviving nonsolo ucounts = 42[12, 76, 140, 148, 177, 181, 193, 200, 208, 211, 212, 215, 222, 228, 229, 238, 242, 245^2, 248, 252, 253, 256, 258, 262, 263, 268, 269, 270^2, 271^2, 282, 283, 295, 297, 299, 317, 331, 337, 733, 1005]
ids = [420, 814, 731, 71, 57, 286, 557, 632, 604, 714, ...]

====================================================================================

UMI info for barcode GTAGGCCTCTTCCTTC-1 contig 1 = AGGTGTTTTC...
umi ATCGAATCCG = 243 reads: +424 validated
umi CTCTCGCAGA = 209 reads: +424 validated
umi CTTTATCCCA = 13 reads: +13 -41 +1 -1 +1 -2X +2 -1 +1 -2 +1 -1 +2 -2 +2 -1 +1 -2 +99 -29 +110 -22 +78 -1 +8 invalidated
umi TTCCAATATC = 225 reads: +424 validated

UMI info for barcode GTAGGCCTCTTCCTTC-1 contig 2 = TGGGGGCTGG...
umi AAACAGCGAG = 255 reads: +391 validated
umi AAACTAGGTT = 294 reads: +391 validated
umi AACCAGCTAT = 259 reads: +391 validated
umi AACGAGTTTC = 734 reads: -272X +119 invalidated
umi AAGCAAGCTT = 214 reads: +391 validated
umi AATGCAGAAG = 274 reads: +391 validated
umi ACAGTGGTAG = 181 reads: +391 validated
umi ACCCTATGCA = 148 reads: +391 validated
umi ACCGGCATCC = 1014 reads: -272X +119 invalidated
umi ACCTGTAACC = 227 reads: +391 validated
umi ACGGATCGTA = 297 reads: +391 validated
umi ACGTAATGCA = 261 reads: +391 validated
umi ACTGGCTTTT = 283 reads: +391 validated
umi AGTCATCCGT = 246 reads: +391 validated
umi ATAACACCCT = 263 reads: +391 validated
umi ATTCATACTC = 254 reads: +391 validated
umi CCCAGTCCAG = 178 reads: +391 validated
umi CGCAACCACC = 265 reads: +391 validated
umi CGCGCCACAG = 269 reads: +391 validated
umi CTTTTATTCG = 227 reads: +391 validated
umi GGCACCATCA = 270 reads: +391 validated
umi GGGCGGGTCC = 319 reads: +391 validated
umi GTCCTCGACT = 197 reads: +391 validated
umi TACAGTCTCC = 340 reads: +391 validated
umi TACGACCTCA = 212 reads: +391 validated
umi TATGCACGTA = 274 reads: +391 validated
umi TCCAAACCCA = 333 reads: +391 validated
umi TCCGTTTCAA = 238 reads: +391 validated
umi TCGATTACTC = 284 reads: +391 validated
umi TCGCGGGTGC = 247 reads: +391 validated
umi TCTTTTTTGG = 213 reads: +391 validated
umi TGCATTACTT = 142 reads: +391 validated
umi TGTGGGATTA = 271 reads: +391 validated
umi TTAATTACCT = 297 reads: +391 validated
umi TTATACCGCA = 226 reads: +391 validated
umi TTCTCTGGGG = 76 reads: +336 -6 +49 non-validated
umi TTGGTTCGAC = 246 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=571]
0-45 ==> 34-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
45-398 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
416-469 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
469-571 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 48 reads
cdr3 = CAKAGVAAGPYWYFDLW at 387, score = 9 + 7
umis assigned: [186, 392, 420, 795]
of which 4 are surviving nonsolos
reads assigned: 681
start codons at 45, 196, 201, 348, 487, 548
confident = true

TIG 2[bases=648]
46-398 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 36 umis using 1551 reads
cdr3 = CSSYTSSSTPVVF at 370, score = 8 + 8
umis assigned: [1, 3, 14, 19, 25, 44, 57, 71, 73, 83] and 27 others
of which 37 are surviving nonsolos
reads assigned: 10140
start codons at 46, 203, 247, 254, 257
confident = true
now this is a cell
paired!

GACACGGCCGTATATTACTGTGCGAAAGCGGGGGTAGCAGCTGGTCCCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> GGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCCCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1461 = GTAGGCCTCTTGTTTG-1

using 354 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 343]
surviving nonsolo ucounts = 1[343]
ids = [5]

====================================================================================

UMI info for barcode GTAGGCCTCTTGTTTG-1 contig 1 = AGAAGAGCTG...
umi GCAGTACAAG = 342 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPVTF at 358, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 337
start codons at 34, 242, 245, 368, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1463 = GTAGTCAAGAAACGAG-1

using 183 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 18
nonsolo ucounts = 9[2, 4, 5, 9, 12, 16^2, 36, 74]
surviving nonsolo ucounts = 8[4, 5, 9, 12, 16^2, 36, 74]
ids = [14, 4, 12, 11, 5, 13, 9, 10]

====================================================================================

UMI info for barcode GTAGTCAAGAAACGAG-1 contig 1 = TGGGGTGATC...
umi TCGTGAAGGG = 4 reads: -16 +2 -1 +14 -1 +1 -1 +23 -1 +9 -30 +56 -136 +97 -9 non-validated
umi TCGTGAAGGT = 14 reads: +40 -1 +152 -1 +5 -1 +10 -6 +1 -2 +5 -1 +5 -1 +6 -1 +4 -1 +1 -1 +9 -1 +6 -3 +7 -6 +57 -1 +2 -1 +2 -1 +3 -1 +13 -1 +10 -1 +6 -1 +7 -13 non-validated
umi TCGTGGAGGG = 35 reads: -1 +396 non-validated
umi TCGTGGAGGT = 72 reads: +364 -1 +32 non-validated
umi TCGTGGTGGG = 12 reads: -39 +4 -1 +248 -38 +31 -1 +24 -11 non-validated
umi TCGTGGTGGT = 9 reads: +199 -124 +56 -18 non-validated
umi TCGTGTAGGT = 15 reads: +17 -1 +5 -2 +10 -1 +13 -2 +214 -49 +83 non-validated
umi TCGTGTATGT = 4 reads: -157 +56 -80 +56 -48 non-validated
umi TCGTGTTAGT = 1 reads: -41 +11 -1 +6 -1 +4 -1 +2 -1 +1 -2 +6 -3 +7 -1 +4 -1 +1 -2 +1 -300 non-validated
umi TCGTGTTCGT = 2 reads: -276 +4 -1 +6 -2 +3 -1 +2 -1 +3 -1X +1 -2 +4 -3 +9 -1 +3 -1 +1 -1 +2 -69 invalidated

GOOD CONTIGS

TIG 1[bases=516]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=3)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
394-433 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
433-516 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 13 reads
cdr3 = CMQALQTPRTF at 372, score = 9 + 8
umis assigned: [4, 5, 9, 10, 11, 12, 13, 14, 15, 16]
of which 8 are surviving nonsolos
reads assigned: 166
start codons at 36, 69, 105, 193, 355, 375, 475
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1465 = GTAGTCAAGAGCTATA-1

using 269 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [3]

====================================================================================

UMI info for barcode GTAGTCAAGAGCTATA-1 contig 1 = AGAGCCCTGG...
umi CTGGTACGTG = 268 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 3-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
44-389 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
391-429 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWPPVTF at 365, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 44, 249, 252, 471
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1466 = GTAGTCAAGAGCTGGT-1

using 1295 reads

====================================================================================

graph has 1812 edges initially, 12 edges after simplification

total ucounts = 630
nonsolo ucounts = 256[2^105, 3^66, 4^29, 5^15, 6^16, 7^10, 8^7, 9, 10, 11, 12, 13, 15^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1474 = GTAGTCAAGCCACGCT-1

using 1283 reads

====================================================================================

graph has 412 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[10, 383, 889]
surviving nonsolo ucounts = 2[383, 889]
ids = [3, 0]

====================================================================================

UMI info for barcode GTAGTCAAGCCACGCT-1 contig 1 = GATCAGGACT...
umi TGCCTACACG = 382 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
395-427 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CMQALQTPPTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1475 = GTAGTCAAGCCAGGAT-1

using 370 reads

====================================================================================

graph has 134 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2, 4, 5, 157, 200]
surviving nonsolo ucounts = 2[157, 200]
ids = [5, 2]

====================================================================================

UMI info for barcode GTAGTCAAGCCAGGAT-1 contig 1 = AGCTGCTCAG...
umi CGCATCCCGT = 202 reads: +382 validated

UMI info for barcode GTAGTCAAGCCAGGAT-1 contig 2 = GGGGGATCTC...
umi GGGGCACATG = 153 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-29 ==> 23-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
29-365 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYRNSITF at 353, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 29, 453
confident = false

TIG 2[bases=524]
40-394 ==> 0-354 on |341|IGLV2-18|L-REGION+V-REGION| [len=354] (mis=6)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
428-524 ==> 0-96 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTTSTTWVF at 364, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 40, 241, 248
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1480 = GTAGTCAAGCTACCTA-1

using 588 reads

====================================================================================

graph has 865 edges initially, 42 edges after simplification

total ucounts = 344
nonsolo ucounts = 117[2^65, 3^28, 4^5, 5^5, 6^6, 7^3, 8^3, 9, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1485 = GTAGTCAAGGAGCGAG-1

using 166 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 7[3, 4, 5^2, 6, 16, 127]
surviving nonsolo ucounts = 1[127]
ids = [4]

====================================================================================

UMI info for barcode GTAGTCAAGGAGCGAG-1 contig 1 = GGGGTCTCAG...
umi GAGCCACCGG = 122 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=439]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-381 ==> 0-343 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=7)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CCSYAGTFYVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 38, 177, 195, 239, 249, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1493 = GTAGTCAAGGTGTGGT-1

using 10273 reads

====================================================================================

graph has 9645 edges initially, 172 edges after simplification

total ucounts = 1845
nonsolo ucounts = 1406[2^235, 3^185, 4^150, 5^113, 6^129, 7^86, 8^73, 9^72, 10^65, 11^58, 12^51, 13^43, 14^35, 15^35, 16^21, 17^14, 18^8, 19^11, 20^5, 21^5, 22^4, 24^3, 26, 27^2, 36, 154]
surviving nonsolo ucounts = 1[154]
ids = [339]

====================================================================================

UMI info for barcode GTAGTCAAGGTGTGGT-1 contig 1 = TCAGGACACA...
umi ATCGCTTGCC = 144 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
12-363 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
362-400 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
400-481 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNSYSRTF at 339, score = 8 + 8
umis assigned: [339]
of which 1 are surviving nonsolos
reads assigned: 142
start codons at 12, 18, 74, 87, 319, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1498 = GTAGTCAAGTACGTTC-1

using 295 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 3, 285]
surviving nonsolo ucounts = 1[285]
ids = [3]

====================================================================================

UMI info for barcode GTAGTCAAGTACGTTC-1 contig 1 = GAGTCAGTCT...
umi GCTTGCTGCC = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1503 = GTAGTCAAGTTCGATC-1

using 142 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[142]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1504 = GTAGTCAAGTTGCAGG-1

using 469 reads

====================================================================================

graph has 144 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[199, 267]
surviving nonsolo ucounts = 2[199, 267]
ids = [1, 2]

====================================================================================

UMI info for barcode GTAGTCAAGTTGCAGG-1 contig 1 = GATCAGGACT...
umi AACCACACTG = 199 reads: +394 validated
umi AGGCACATAT = 44 reads: -329X +3 -1XX +1 -1XX +1 -7XX +1 -4XX +1 -3XX +1 -1XX +1 -1XX +36 -1XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=560]
0-30 ==> 0-30 on |274|IGKV2D-29|5'UTR| [len=30] (mis=1)
30-375 ==> 0-345 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=4)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CMQAIQLLTF at 366, score = 9 + 9
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 238
start codons at 30, 63, 187, 250, 349, 369, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1506 = GTAGTCACAAACGCGA-1

using 617 reads

====================================================================================

graph has 348 edges initially, 2 edges after simplification

total ucounts = 60
nonsolo ucounts = 20[2^8, 3^6, 4, 6, 7, 8, 12, 505]
surviving nonsolo ucounts = 1[505]
ids = [55]

====================================================================================

UMI info for barcode GTAGTCACAAACGCGA-1 contig 1 = AGCTTCAGCT...
umi TGTCCGCAGC = 489 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-550 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [55]
of which 1 are surviving nonsolos
reads assigned: 479
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1510 = GTAGTCACAACGATCT-1

using 814 reads

====================================================================================

graph has 290 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^3, 8, 793]
surviving nonsolo ucounts = 1[793]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=329]
0-29 ==> 152-181 on |247|IGKV1D-17|5'UTR| [len=181] (mis=0)
7-38 ==> 5667-5698 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
37-156 ==> 232-351 on |248|IGKV1D-17|L-REGION+V-REGION| [len=351] (mis=8)
155-193 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
193-329 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 132, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 775
start codons at 29, 35, 235
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1518 = GTAGTCACAATGAATG-1

using 604 reads

====================================================================================

graph has 182 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[15, 253, 329]
surviving nonsolo ucounts = 2[253, 329]
ids = [2, 7]

====================================================================================

UMI info for barcode GTAGTCACAATGAATG-1 contig 1 = TGTCTGCTTC...
umi ATCTAGCACT = 240 reads: +394 validated
umi CTTTATCGTG = 1 reads: -34X +4 -3X +7 -1 +15 -3X +4 -1X +5 -2X +4 -1X +5 -305 invalidated

UMI info for barcode GTAGTCACAATGAATG-1 contig 2 = AGAAACCACA...
umi GCACTGGTTT = 328 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=591]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=2)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-591 ==> 0-146 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2, 5]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false

TIG 2[bases=559]
0-51 ==> 10-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=0)
51-404 ==> 0-353 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=1)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
457-559 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CAADSNQVGYW at 393, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 51, 111, 254, 327, 348, 475, 536
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1520 = GTAGTCACACACCGAC-1

using 24562 reads

====================================================================================

graph has 7096 edges initially, 52 edges after simplification

total ucounts = 528
nonsolo ucounts = 240[2^67, 3^42, 4^12, 5^7, 6^10, 7^4, 8^3, 9^2, 10, 12^2, 19, 26, 27, 30, 40, 49, 61, 63, 69^2, 87, 91, 93, 106, 116, 145, 147, 167, 179, 193, 195^2, 198, 204, 222, 223^2, 224, 225, 233^2, 237, 240, 243, 246, 247^2, 250, 253, 254, 258, 282, 283, 285, 286^2, 287, 288^2, 289, 296, 300^2, 302, 304, 308, 311, 313, 316, 317^2, 318, 319, 320, 321, 324^2, 325, 331, 332, 334, 354, 356, 358, 362, 371, 372, 373, 378, 384, 396, 402, 410, 415, 428, 435, 478, 490, 563, 609]
surviving nonsolo ucounts = 83[26, 30, 49, 63, 91, 93, 106, 116, 145, 147, 167, 179, 193, 195^2, 198, 204, 222, 223^2, 224, 225, 233^2, 237, 240, 243, 246, 247^2, 250, 253, 254, 258, 282, 283, 285, 286^2, 287, 288^2, 289, 296, 300^2, 302, 304, 308, 311, 313, 316, 317^2, 318, 319, 320, 321, 324^2, 325, 331, 332, 334, 354, 356, 358, 362, 371, 372, 373, 378, 384, 396, 402, 410, 415, 428, 435, 478, 490, 563, 609]
ids = [264, 111, 322, 527, 504, 132, 462, 354, 396, 505, ...]

====================================================================================

UMI info for barcode GTAGTCACACACCGAC-1 contig 1 = GGAGGAGTCA...
umi AAAACAGGCC = 303 reads: +388 validated
umi AAACTTCCTG = 314 reads: +388 validated
umi AACCCGTCCA = 419 reads: +388 validated
umi AAGATGAACG = 225 reads: +388 validated
umi AAGTTACCAG = 437 reads: +388 validated
umi ACCTCCCCCG = 251 reads: +388 validated
umi ACGCCCATTA = 298 reads: +388 validated
umi ACGCCCCTCA = 249 reads: +388 validated
umi ACGGCCATCT = 311 reads: +388 validated
umi AGGACCGCCT = 283 reads: +388 validated
umi AGTTGCTGAC = 614 reads: -117 +271 non-validated
umi ATAAGTCCCT = 309 reads: +388 validated
umi ATACGTTTCA = 440 reads: +388 validated
umi ATATTTGCGT = 327 reads: +388 validated
umi ATCAAGGCTT = 407 reads: +388 validated
umi ATGAATCCTT = 285 reads: +388 validated
umi ATTACAGCAC = 358 reads: +388 validated
umi ATTATGTGCA = 94 reads: +388 validated
umi ATTATTGGTA = 319 reads: +388 validated
umi ATTCTCTCTG = 242 reads: +388 validated
umi CACGCCCCTG = 330 reads: +388 validated
umi CCGCTAGAAA = 300 reads: +388 validated
umi CCGCTATAAC = 219 reads: +388 validated
umi CCTGCCCACA = 319 reads: +388 validated
umi CGAATGTAAT = 320 reads: +388 validated
umi CGATCCGGGT = 253 reads: +388 validated
umi CGCAGAACTA = 356 reads: +388 validated
umi CGTACGCTCT = 365 reads: +388 validated
umi CTATTTCCAG = 312 reads: +388 validated
umi CTCCACCGTC = 251 reads: +388 validated
umi CTCTTCTGGT = 238 reads: +388 validated
umi CTTTAGCAGC = 318 reads: +388 validated
umi GAAGCAGTAG = 303 reads: +388 validated
umi GACCATTCAC = 288 reads: +388 validated
umi GACTCCCATC = 286 reads: +388 validated
umi GAGGCTTGAA = 307 reads: +388 validated
umi GAGGGCTTCG = 286 reads: +388 validated
umi GATACCGGGA = 285 reads: +388 validated
umi GATGATGCTT = 200 reads: +388 validated
umi GATGGTATAG = 359 reads: +388 validated
umi GCAGCTGGCA = 283 reads: +388 validated
umi GCGCTATCTA = 287 reads: +388 validated
umi GCTATGGGCT = 304 reads: +388 validated
umi GGACTCCCCT = 244 reads: +388 validated
umi GGCCCATTCC = 342 reads: +388 validated
umi GTACTAGTCG = 333 reads: +388 validated
umi GTATGCTGCT = 225 reads: +388 validated
umi GTCGCGATCA = 252 reads: +388 validated
umi GTCTGATCTA = 408 reads: +388 validated
umi GTTCAATGCT = 377 reads: +388 validated
umi TAACGTGGGA = 568 reads: +388 validated
umi TACGAAACGA = 167 reads: +388 validated
umi TACTACCCGC = 321 reads: +388 validated
umi TAGCAGGTGA = 196 reads: +388 validated
umi TAGGCGATCA = 226 reads: +388 validated
umi TATAACAACG = 374 reads: +388 validated
umi TATAGCTCTT = 146 reads: +388 validated
umi TATGGTTAGG = 374 reads: +388 validated
umi TCAATGCCTT = 191 reads: +388 validated
umi TGCCGACCTC = 386 reads: +388 validated
umi TGCCTTGCGA = 369 reads: +388 validated
umi TGCTACTCAT = 108 reads: +388 validated
umi TTCGCCCCTC = 324 reads: +388 validated
umi TTGAACTTTG = 145 reads: +388 validated

UMI info for barcode GTAGTCACACACCGAC-1 contig 2 = AGAGAGGAGC...
umi AATTGGGTTC = 286 reads: +439 validated
umi ACCCGGCATT = 182 reads: +439 validated
umi ATCCCTTCAT = 30 reads: +166 -1 +20 -1 +4 -1 +9 -2 +8 -1 +3 -1 +2 -1X +162 -57 invalidated
umi ATCTTCACCG = 224 reads: +439 validated
umi ATGTTTGGGT = 219 reads: +439 validated
umi CGGAATGTAT = 310 reads: -356X +1 -2XX +1 -6XX +2 -2XX +1 -8XX +1 -1XX +58 invalidated
umi GAATTAGTCT = 18 reads: -356X +1 -2X +1 -6X +2 -2X +1 -8X +1 -1X +58 invalidated
umi GATCCGGCCT = 180 reads: +439 validated
umi GGACCTGGGT = 141 reads: -348X +2 -6XX +1 -2XX +1 -6XX +2 -2XX +1 -8XX +1 -1XX +58 invalidated
umi GGTTGATTTT = 45 reads: +293 -11 +8 -1X +1 -1 +2 -1 +1 -3 +1 -2 +1 -1 +3 -1 +2 -1 +7 -1 +1 -1X +3 -1 +5 -2 +4 -13X +67 invalidated
umi GTTGTCCTGT = 108 reads: -411X +3 -6XX +1 -4XX +2 -5XX +1 -2XX +1 -1XX +1 -1XX invalidated
umi TAATGTCCTA = 243 reads: +439 validated
umi TCCCGAGGGA = 182 reads: +439 validated
umi TTAAGCGTAT = 255 reads: +439 validated
umi TTTTTTACAG = 65 reads: +410 -29 non-validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=1)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 64 umis using 3094 reads
cdr3 = CLQDYNYPPTF at 356, score = 9 + 8
umis assigned: [1, 6, 14, 23, 29, 44, 50, 52, 53, 79] and 54 others
of which 64 are surviving nonsolos
reads assigned: 18995
start codons at 29, 35, 91, 104, 186, 240, 459
confident = true

TIG 2[bases=613]
0-72 ==> 7-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=4)
430-446 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=1)
448-511 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
511-613 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 8 umis using 129 reads
cdr3 = CARSQMTTVTKGEYYYYGMDVW at 414, score = 9 + 7
umis assigned: [35, 39, 111, 117, 128, 211, 264, 281, 307, 322] and 5 others
of which 15 are surviving nonsolos
reads assigned: 2435
start codons at 72, 228, 289, 307, 375, 429, 468, 529, 590
confident = true
now this is a cell
paired!

TACTGTGCGAGATCCCAAATGACTACGGTGACTAAGGGAGAATACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCCGACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1528 = GTAGTCACACGGCGTT-1

using 330 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 324]
surviving nonsolo ucounts = 1[324]
ids = [1]

====================================================================================

UMI info for barcode GTAGTCACACGGCGTT-1 contig 1 = TGGGGGATCA...
umi CCACATAGGC = 298 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=525]
35-395 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
396-435 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
435-525 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQGTHWPPYTF at 371, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 35, 68, 96, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1530 = GTAGTCACAGATCTGT-1

using 386 reads

====================================================================================

graph has 208 edges initially, 4 edges after simplification

total ucounts = 20
nonsolo ucounts = 13[2^3, 3^4, 4, 5, 6, 9, 39, 298]
surviving nonsolo ucounts = 1[298]
ids = [18]

====================================================================================

UMI info for barcode GTAGTCACAGATCTGT-1 contig 1 = GAGTGCTCTC...
umi GTTCTTGGCT = 249 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=476]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
411-457 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
457-476 ==> 0-19 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGAARSGTVTLDYW at 378, score = 9 + 7
umis assigned: [18]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 18, 39, 83, 169, 274
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1538 = GTAGTCACATAAGACA-1

using 393 reads

====================================================================================

graph has 546 edges initially, 22 edges after simplification

total ucounts = 225
nonsolo ucounts = 73[2^42, 3^12, 4^5, 5^4, 6^5, 7, 8, 10, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1539 = GTAGTCACATACCATG-1

using 333 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 323]
surviving nonsolo ucounts = 1[323]
ids = [4]

====================================================================================

UMI info for barcode GTAGTCACATACCATG-1 contig 1 = GAGGAATCAG...
umi CTGAGTATGA = 326 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1541 = GTAGTCACATATGGTC-1

using 152 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 31
nonsolo ucounts = 23[2^3, 3^3, 4, 5^5, 6^2, 7, 8^5, 11, 14, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1545 = GTAGTCACATCGATTG-1

using 61 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 13[2^3, 3^4, 4^2, 5, 6^2, 9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1547 = GTAGTCACATGACATC-1

using 275 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [0]

====================================================================================

UMI info for barcode GTAGTCACATGACATC-1 contig 1 = AGCTTCAGCT...
umi CGCGCAGACG = 267 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-549 ==> 0-114 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1549 = GTAGTCACATGCGCAC-1

using 202 reads

====================================================================================

graph has 99 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 10, 183]
surviving nonsolo ucounts = 1[183]
ids = [6]

====================================================================================

UMI info for barcode GTAGTCACATGCGCAC-1 contig 1 = AGTCAGTCCC...
umi TATTTACATC = 162 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=462]
0-24 ==> 34-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
24-375 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-462 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQLNSYPPSTF at 351, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 24, 30, 86, 235, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1551 = GTAGTCACATGTCTCC-1

using 1368 reads

====================================================================================

graph has 466 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 248, 320, 347, 447]
surviving nonsolo ucounts = 4[248, 320, 347, 447]
ids = [1, 8, 7, 4]

====================================================================================

UMI info for barcode GTAGTCACATGTCTCC-1 contig 1 = GAGTCAGTCC...
umi ATATTAGAGG = 248 reads: +385 validated
umi GTTAGCCTCA = 458 reads: +154 -1XX +195 -1XX +2 -1XX +7 -2XX +5 -3XX +1 -1XX +4 -1XX +2 -1XX +4 invalidated
umi TTCTTTCCGA = 345 reads: +385 validated
umi TTCTTTCCGG = 320 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 135 reads
cdr3 = CQQYDNLPTF at 352, score = 9 + 8
umis assigned: [1, 4, 7, 8]
of which 4 are surviving nonsolos
reads assigned: 1332
start codons at 25, 31, 87, 100, 239, 362, 452
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1552 = GTAGTCACATTAGGCT-1

using 166 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 1[166]
ids = [0]

====================================================================================

UMI info for barcode GTAGTCACATTAGGCT-1 contig 1 = AGCTCATCAC...
umi GTTGCTCCGC = 150 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=518]
11-362 ==> 0-351 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=52)
387-435 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
435-518 ==> 0-83 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARLQVDAPLAHGGDYW at 353, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 11, 209, 372, 489
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1572 = GTAGTCAGTCTAGCGC-1

using 63 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[63]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1583 = GTAGTCAGTTAAGACA-1

using 863 reads

====================================================================================

graph has 652 edges initially, 4 edges after simplification

total ucounts = 169
nonsolo ucounts = 62[2^27, 3^14, 4^12, 5^3, 6, 8^2, 18, 35, 522]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1587 = GTAGTCAGTTGTACAC-1

using 217 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 209]
surviving nonsolo ucounts = 1[209]
ids = [4]

====================================================================================

UMI info for barcode GTAGTCAGTTGTACAC-1 contig 1 = GCTCTGCTTC...
umi TATACTTATT = 199 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=551]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-551 ==> 0-106 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1601 = GTAGTCATCCTTAATC-1

using 486 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 183, 294]
surviving nonsolo ucounts = 2[183, 294]
ids = [1, 5]

====================================================================================

UMI info for barcode GTAGTCATCCTTAATC-1 contig 1 = AGCTTCAGCT...
umi GGTCCTAAGT = 295 reads: +388 validated

UMI info for barcode GTAGTCATCCTTAATC-1 contig 2 = GGGGCTTTCT...
umi ATGTTATTAG = 180 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=549]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-549 ==> 0-96 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1622 = GTAGTCATCTTGGGTA-1

using 620 reads

====================================================================================

graph has 202 edges initially, 20 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 4, 5, 16, 243, 349]
surviving nonsolo ucounts = 3[16, 243, 349]
ids = [4, 6, 5]

====================================================================================

UMI info for barcode GTAGTCATCTTGGGTA-1 contig 1 = AGGAATCAGT...
umi TTAACGTTAG = 351 reads: +388 validated

UMI info for barcode GTAGTCATCTTGGGTA-1 contig 2 = GCTCTGCTTC...
umi TTTTAGAACC = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 345
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=594]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
442-594 ==> 0-152 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQSYDSSLSAVVF at 375, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 51, 205, 208, 259, 358, 385
confident = false

REJECT CONTIGS

TIG 1[bases=350]
0-177 ==> 174-351 on |244|IGKV1D-13|L-REGION+V-REGION| [len=351] (mis=17)
176-214 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
214-350 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 153, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 13
start codons at 40, 256
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1626 = GTATCTTAGAACAACT-1

using 53 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 18, 25]
surviving nonsolo ucounts = 1[25]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1633 = GTATCTTAGAATTGTG-1

using 80000 reads

====================================================================================

graph has 40832 edges initially, 362 edges after simplification

total ucounts = 8407
nonsolo ucounts = 4174[2^1561, 3^955, 4^540, 5^332, 6^185, 7^106, 8^78, 9^44, 10^20, 11^16, 12^11, 13^6, 14^3, 15^3, 16^4, 17, 19, 21, 22, 29, 30, 32, 36, 37, 39, 40, 41, 42, 43, 48, 50^2, 53, 62^2, 63^2, 65, 66, 70^2, 74, 78, 81^2, 84, 85^2, 86, 91, 96, 98^2, 100^2, 102, 111^2, 112^2, 116, 119, 121^2, 123, 124, 126, 128^3, 129^2, 130, 132, 133^2, 135^3, 136^2, 137, 138, 144^2, 145^2, 147, 148^2, 149, 152^2, 153^2, 155, 156^2, 157, 158, 160, 161^2, 162^2, 163^3, 164^3, 165, 166, 167, 168, 169^3, 173^2, 174^3, 177^3, 178^3, 180^2, 181^3, 182^2, 183, 184, 185^3, 187^5, 188, 189, 190^4, 191, 192^4, 193^3, 194, 196^4, 197, 198^3, 199^2, 200^2, 201^3, 203, 204^4, 205, 206^2, 207, 209^3, 210, 211^5, 212^2, 213^5, 214^2, 215^3, 216, 217^2, 218^4, 219^2, 220, 221^4, 222, 223^2, 224^3, 226^4, 227, 229^2, 230^5, 231^2, 232^2, 233^3, 234, 236^2, 237^3, 238^2, 239, 240, 241, 242^3, 243^2, 245, 246^3, 248^3, 249, 251^2, 253^4, 254, 256^2, 258, 259, 260, 261, 262^2, 266^2, 267, 269, 270^2, 271, 273, 275, 276, 286, 289^2, 295, 298, 301, 303, 308, 310, 312, 318, 323, 328, 334, 346, 358, 368, 377, 384, 396, 399, 412, 413, 426, 452^2, 476, 508, 569, 620, 1337]
surviving nonsolo ucounts = 296[2^6, 10, 16, 32, 48, 50, 53, 62^2, 63, 70, 78, 81, 84, 85^2, 96, 98^2, 100^2, 102, 111^2, 112^2, 116, 119, 121^2, 123, 124, 126, 128^3, 129^2, 130, 132, 133^2, 135^3, 136^2, 137, 138, 144^2, 145^2, 147, 148^2, 149, 152^2, 153^2, 155, 156^2, 157, 158, 160, 161^2, 162^2, 163^3, 164^3, 165, 166, 167, 168, 169^3, 173^2, 174^3, 177^3, 178^3, 180^2, 181^3, 182^2, 183, 184, 185^3, 187^5, 188, 189, 190^4, 191, 192^4, 193^3, 194, 196^4, 197, 198^3, 199^2, 200^2, 201^3, 203, 204^4, 205, 206^2, 207, 209^3, 210, 211^5, 212^2, 213^5, 214^2, 215^3, 216, 217^2, 218^4, 219^2, 220, 221^4, 222, 223^2, 224^3, 226^4, 227, 229^2, 230^5, 231^2, 232^2, 233^3, 234, 236^2, 237^3, 238^2, 239, 240, 241, 242^3, 243^2, 245, 246^3, 248^3, 249, 251^2, 253^4, 254, 256^2, 258, 259, 260, 261, 262^2, 266^2, 267, 269, 270^2, 271, 273, 275, 276, 286, 289^2, 295, 298, 301, 303, 308, 310, 312, 318, 323, 328, 334, 346, 358, 368, 377, 384, 396, 399, 412, 413, 426, 452^2, 476, 508, 569, 620, 1337]
ids = [857, 2594, 3379, 3781, 4636, 7706, 6341, 6683, 5987, 3497, ...]

====================================================================================

UMI info for barcode GTATCTTAGAATTGTG-1 contig 1 = TGGGGCTCCA...
umi AAAGCAACCG = 246 reads: +388 validated
umi AACAGACCTT = 186 reads: +388 validated
umi AATAACCGAT = 208 reads: +388 validated
umi AATTGTTCAG = 161 reads: +388 validated
umi ACACACCGGG = 216 reads: +388 validated
umi ACACGGTAAT = 239 reads: +388 validated
umi ACAGCATATA = 227 reads: +388 validated
umi ACATGCCCTC = 220 reads: +388 validated
umi ACCCATTCCC = 243 reads: +388 validated
umi ACCCGCTCTA = 1 reads: -388 non-validated
umi ACCGTATATA = 250 reads: +388 validated
umi ACGCATTGTG = 576 reads: -337 +51 non-validated
umi ACGTCGGGGA = 194 reads: +388 validated
umi AGACTATGCG = 213 reads: +388 validated
umi AGCACACTAT = 223 reads: +388 validated
umi AGCGTATTGC = 226 reads: +388 validated
umi AGTCACTGCC = 172 reads: +388 validated
umi AGTCCAGCCC = 171 reads: +388 validated
umi AGTCCCTCTT = 163 reads: +388 validated
umi ATACCCCTGC = 211 reads: +388 validated
umi ATATATAGTC = 84 reads: +388 validated
umi ATCCCGCCCC = 231 reads: +388 validated
umi ATCCGTACCC = 131 reads: +388 validated
umi ATTAAAAGGC = 216 reads: +388 validated
umi ATTCCGAATC = 209 reads: +388 validated
umi ATTGGTAATG = 221 reads: +388 validated
umi ATTGTCTTCT = 242 reads: +388 validated
umi ATTTGTGACC = 260 reads: +388 validated
umi CAAAGCTCTT = 204 reads: +388 validated
umi CAACCTATAC = 205 reads: +388 validated
umi CACCGATTTC = 218 reads: +388 validated
umi CACGGTGTTT = 126 reads: +388 validated
umi CAGCATGAAT = 191 reads: +388 validated
umi CATACTCCAT = 233 reads: +388 validated
umi CATTACCGGT = 207 reads: +388 validated
umi CCAATGCTCG = 155 reads: +388 validated
umi CCACCCTTCA = 186 reads: +388 validated
umi CCCCAGGCAT = 200 reads: +388 validated
umi CCCTCAGGGG = 210 reads: +388 validated
umi CCGTCGCTGT = 178 reads: +388 validated
umi CCTAACCCCT = 213 reads: +388 validated
umi CCTCTATCAG = 311 reads: +388 validated
umi CCTGTACTTA = 219 reads: +388 validated
umi CGATTATCGT = 237 reads: +388 validated
umi CGCCGTTTTC = 1 reads: -388 non-validated
umi CGCTTTCGCC = 125 reads: +366 -22 non-validated
umi CGGAACTGGT = 206 reads: +388 validated
umi CGGAATGCGA = 235 reads: +388 validated
umi CGTCTAGGAA = 220 reads: +388 validated
umi CTACCATTCC = 208 reads: +388 validated
umi CTATTAACCG = 193 reads: +388 validated
umi CTCATACTCG = 185 reads: +388 validated
umi CTCCCCCCCG = 135 reads: +388 validated
umi CTGAATCTGT = 173 reads: +388 validated
umi CTGGGATTTT = 197 reads: +388 validated
umi CTGTCTTGTG = 291 reads: +388 validated
umi CTTATTCAGT = 182 reads: +388 validated
umi GAACACTGTG = 1 reads: -388 non-validated
umi GAGCCATTAC = 215 reads: +388 validated
umi GAGGAAAGTT = 188 reads: +388 validated
umi GATATTCATT = 375 reads: -149 +239 non-validated
umi GCCCCTTCCC = 238 reads: +388 validated
umi GCCGCTGTCT = 235 reads: +334 -5XX +49 invalidated
umi GCGTCGTTAT = 152 reads: +388 validated
umi GCTATTTGCA = 167 reads: +388 validated
umi GCTTCGTTAG = 165 reads: +388 validated
umi GGAAACCTCT = 356 reads: -144X +244 invalidated
umi GGACCCCCCG = 1338 reads: -337X +51 invalidated
umi GGATCAGCAC = 230 reads: +388 validated
umi GGCCATAAAG = 80 reads: +388 validated
umi GTAACTCTAA = 206 reads: +388 validated
umi GTATCCCGTA = 132 reads: +388 validated
umi GTCGGTAATA = 238 reads: +388 validated
umi GTGACTGCAA = 144 reads: +388 validated
umi TACCGAGCCC = 397 reads: -27X +361 invalidated
umi TACGCCTAGC = 418 reads: +388 validated
umi TAGCTAGAAA = 231 reads: +388 validated
umi TATAAGTGCG = 232 reads: +388 validated
umi TATAGCTTGC = 201 reads: +388 validated
umi TATTATCTCG = 515 reads: +388 validated
umi TCACACCGGC = 1 reads: -388 non-validated
umi TCATGGATCG = 211 reads: +388 validated
umi TCCCGCCGTC = 183 reads: +388 validated
umi TCCTCATGGA = 223 reads: +388 validated
umi TCGCAATCTT = 182 reads: +388 validated
umi TCGCTTATGG = 129 reads: +388 validated
umi TCGTTAGTAG = 248 reads: +262 -1XX +125 invalidated
umi TCGTTCGTAA = 162 reads: +388 validated
umi TCTCACCGCC = 174 reads: +388 validated
umi TCTCTTATCG = 232 reads: +388 validated
umi TGATCTAGCG = 251 reads: +388 validated
umi TGCCGGAGCG = 239 reads: +388 validated
umi TGCCTACCCC = 237 reads: +388 validated
umi TGTTTTTGCT = 230 reads: +388 validated
umi TTAAACGCCT = 191 reads: +388 validated
umi TTACCTACGG = 149 reads: +388 validated
umi TTACCTGGAT = 204 reads: +388 validated
umi TTGTGTGGTT = 1 reads: -388 non-validated
umi TTTATGCCTG = 190 reads: +388 validated
umi TTTGTTAAAT = 163 reads: -77 +311 non-validated
umi TTTGTTACTT = 159 reads: +388 validated

UMI info for barcode GTATCTTAGAATTGTG-1 contig 2 = GAGCTCTGGG...
umi AAAAAAGCTT = 155 reads: +406 validated
umi AAACCAACGT = 172 reads: +406 validated
umi AAAGATACAT = 195 reads: +406 validated
umi AACGATTTAT = 138 reads: +370 -4 +32 non-validated
umi AAGAATCCGC = 80 reads: +406 validated
umi AAGGACAGCT = 164 reads: +22 -1XX +383 invalidated
umi AATCCGCATA = 135 reads: +387 -19 non-validated
umi AATCGCGACA = 185 reads: +406 validated
umi ACCATCAGTA = 109 reads: +382 -1 +11 -12 non-validated
umi ACCTCACCTA = 83 reads: +378 -28 non-validated
umi ACGGCTGACA = 230 reads: +397 -9 non-validated
umi ACGTCTGGGT = 199 reads: +406 validated
umi AGGGTAGCTG = 134 reads: +406 validated
umi AGTAAATGGG = 176 reads: +406 validated
umi AGTGTATCCG = 110 reads: +406 validated
umi ATACCTGTGC = 203 reads: +364 -3X +2 -1X +1 -2X +2 -5XX +2 -1 +23 invalidated
umi ATCATTCCCT = 275 reads: +406 validated
umi ATCCGCATTG = 191 reads: +406 validated
umi ATGTCGACTC = 265 reads: -263 +143 non-validated
umi ATTAATTGGT = 248 reads: +406 validated
umi ATTATCCGTT = 105 reads: +400 -6 non-validated
umi ATTATTGTCT = 129 reads: +370 -20 +16 non-validated
umi ATTCACGGCT = 200 reads: +406 validated
umi ATTTCTGTAA = 178 reads: +406 validated
umi CACAAATAAC = 63 reads: +369 -37 non-validated
umi CACGAGGGAT = 53 reads: +406 validated
umi CATGCTCTCC = 170 reads: +406 validated
umi CATTAACACG = 164 reads: +406 validated
umi CATTTGTGAG = 160 reads: +344 -37 +25 non-validated
umi CCTCCCGTAG = 60 reads: +404 -2 non-validated
umi CCTGAAACTC = 138 reads: -132 +12 -1 +261 non-validated
umi CCTTCCATGG = 199 reads: +406 validated
umi CCTTTTGATT = 250 reads: +406 validated
umi CGAATGATTC = 200 reads: +406 validated
umi CGACACTACT = 131 reads: +394 -12 non-validated
umi CGCTTTCCTA = 46 reads: +397 -9 non-validated
umi CGTACCTCGA = 116 reads: +389 -17 non-validated
umi CGTCTCGTAA = 186 reads: +406 validated
umi CGTCTCTCAT = 217 reads: +389 -1X +7 -9 invalidated
umi CTCACCCAAG = 166 reads: +391 -1 +5 -1 +8 non-validated
umi CTCTTACAAC = 101 reads: +367 -39 non-validated
umi CTTACTACGC = 222 reads: +406 validated
umi GAAAAACGGT = 188 reads: +406 validated
umi GACCTCAACC = 187 reads: +406 validated
umi GAGACTTCTC = 86 reads: +339 -1 +3 -1 +11 -3 +4 -1X +16 -1 +6 -1 +3 -1 +5 -10 invalidated
umi GCTAATTGTT = 132 reads: +406 validated
umi GCTCACGCCG = 112 reads: +406 validated
umi GGTATGCTAT = 98 reads: +406 validated
umi GTCCTTTGGC = 188 reads: +404 -2 non-validated
umi GTTCAACGGG = 126 reads: +406 validated
umi GTTGCATCAG = 175 reads: +378 -1 +1 -1 +1 -1 +2 -1 +4 -1 +2 -1 +1 -1 +10 non-validated
umi TAGCAGTTAA = 210 reads: +406 validated
umi TATAGCGGAA = 100 reads: +406 validated
umi TCACATTGGG = 144 reads: +401 -5 non-validated
umi TCACGACCCC = 251 reads: +406 validated
umi TCAGCCCGTT = 69 reads: +406 validated
umi TCCATCATGC = 126 reads: +393 -1 +10 -1 +1 non-validated
umi TCCCAGGGGT = 220 reads: +391 -1 +1 -1 +12 non-validated
umi TCCGCCTACT = 151 reads: +406 validated
umi TGAGCATGTG = 216 reads: +396 -4 +6 non-validated
umi TGCTTGTTGC = 116 reads: +406 validated
umi TGGGGTGCTT = 63 reads: +392 -14 non-validated
umi TGTGGTAGGA = 221 reads: +382 -24 non-validated
umi TGTGTACTAG = 96 reads: +401 -5 non-validated
umi TTAAGAGTCG = 215 reads: +406 validated
umi TTAGAACGCC = 113 reads: +406 validated
umi TTCAGGATGC = 166 reads: +391 -15 non-validated
umi TTGAGCTCTG = 126 reads: +406 validated
umi TTTACCTCGA = 162 reads: +401 -5 non-validated
umi TTTTACCTCT = 271 reads: +389 -12 +5 non-validated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 91 umis using 3358 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [55, 114, 351, 481, 525, 538, 561, 602, 690, 701] and 91 others
of which 101 are surviving nonsolos
reads assigned: 21457
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=20)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 44 umis using 582 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [1, 31, 52, 188, 255, 296, 396, 402, 664, 762] and 60 others
of which 70 are surviving nonsolos
reads assigned: 10823
start codons at 80, 231, 236, 297, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=397]
0-58 ==> 290-348 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
108-265 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
263-326 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
326-397 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1294, 2266, 2741, 3431, 3434, 3907, 5234, 6482, 7321, 7562]
of which 10 are surviving nonsolos
reads assigned: 2461
start codons at 115, 149, 188, 243, 283
confident = false
did not find CDR3

TIG 2[bases=368]
48-205 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
203-266 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
266-368 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [310, 8034]
of which 2 are surviving nonsolos
reads assigned: 734
start codons at 55, 89, 128, 183, 223, 284, 345
confident = false
did not find CDR3

TIG 3[bases=571]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 356, score = 4 + 8
umis assigned: [51, 68, 100, 123, 176, 203, 256, 299, 304, 306] and 93 others
of which 103 are surviving nonsolos
reads assigned: 22904
start codons at 36, 69, 105, 156, 193, 355, 375, 477
confident = false
not full
frameshifted full length stopped transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AACAGCCTGAGAGCTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1650 = GTATCTTAGCTAACTC-1

using 333 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode GTATCTTAGCTAACTC-1 contig 1 = GAAGAGCTGC...
umi AATTACTGGC = 313 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=486]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-486 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYGSSPYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1651 = GTATCTTAGCTCCCAG-1

using 258 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 4, 243]
surviving nonsolo ucounts = 2[3, 243]
ids = [0, 1]

====================================================================================

UMI info for barcode GTATCTTAGCTCCCAG-1 contig 1 = GAGTCAGACC...
umi ACCCGTCGGT = 3 reads: -36 +62 -1 +24 -1 +1 -60 +2 -1 +1 -2 +4 -2 +6 -2 +4 -1 +3 -1 +2 -2 +2 -1 +1 -2 +1 -1 +3 -2 +1 -4 +1 -151 non-validated
umi ACCCGTCTGT = 234 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-486 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNTFPITF at 352, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 236
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1652 = GTATCTTAGCTGTCTA-1

using 89 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^3, 10, 67]
surviving nonsolo ucounts = 1[67]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1659 = GTATCTTAGGCCGAAT-1

using 286 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 4, 115, 162]
surviving nonsolo ucounts = 2[115, 162]
ids = [0, 4]

====================================================================================

UMI info for barcode GTATCTTAGGCCGAAT-1 contig 1 = GCTGGGGTCT...
umi ACAGTCTCCC = 110 reads: +388 validated
umi GGAGGTTCTC = 151 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=520]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=15)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
429-520 ==> 0-91 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 40 reads
cdr3 = CSSYAGGNNLLF at 365, score = 8 + 9
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 260
start codons at 41, 249, 348, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1661 = GTATCTTAGGCTAGGT-1

using 348 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 340]
surviving nonsolo ucounts = 1[340]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=551]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-26 ==> 6796-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
15-78 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
26-333 ==> 0-307 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=13)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 26, 32, 101, 240, 457
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1671 = GTATCTTAGTGCCATT-1

using 241 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 7, 227]
surviving nonsolo ucounts = 1[227]
ids = [2]

====================================================================================

UMI info for barcode GTATCTTAGTGCCATT-1 contig 1 = GGGGAGGAAC...
umi GGAGGCGGAT = 205 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
424-478 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQRSNWPSRVTF at 357, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 202
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1672 = GTATCTTAGTGTCTCA-1

using 555 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 6^2, 534]
surviving nonsolo ucounts = 1[534]
ids = [5]

====================================================================================

REJECT CONTIGS

TIG 1[bases=407]
1-155 ==> 190-344 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
158-196 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
196-407 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CQVWDSSSDHNWVF at 126, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 527
start codons at 10, 13, 109
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1692 = GTATCTTCACGAAAGC-1

using 263 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 256]
surviving nonsolo ucounts = 1[256]
ids = [5]

====================================================================================

UMI info for barcode GTATCTTCACGAAAGC-1 contig 1 = GGAGTCTCCC...
umi GTGATTAGAG = 248 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=521]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
413-433 ==> 7-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=1)
439-489 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
489-521 ==> 0-32 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARRDILTGYSHRDAFDIW at 401, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 59, 233, 257, 392, 441, 470, 507
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1701 = GTATCTTCAGATCTGT-1

using 586 reads

====================================================================================

graph has 552 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 16[2^5, 3^2, 5^2, 7, 9, 10, 14, 15, 36, 465]
surviving nonsolo ucounts = 1[465]
ids = [0]

====================================================================================

UMI info for barcode GTATCTTCAGATCTGT-1 contig 1 = GCTCCAAACA...
umi ATCTTAGAAT = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
42-394 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-559 ==> 0-129 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSAWDSSLNVWVF at 363, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 42, 181, 371, 388
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1715 = GTATCTTCATAACCTG-1

using 228 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 6, 214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode GTATCTTCATAACCTG-1 contig 1 = AGCTCTCAGA...
umi AGGCCATCAC = 199 reads: +407 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=489]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=13)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 8 reads
cdr3 = CARDRIYAFDIW at 421, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 79, 235, 307, 356, 382, 440, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1716 = GTATCTTCATCCCACT-1

using 595 reads

====================================================================================

graph has 250 edges initially, 12 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^3, 3^2, 7, 270, 301]
surviving nonsolo ucounts = 2[270, 301]
ids = [7, 1]

====================================================================================

UMI info for barcode GTATCTTCATCCCACT-1 contig 1 = TTATGGGGAG...
umi ACTACAGTCA = 63 reads: -242 +1 -3XX +17 -1XX +11 -1XX +20 -1XX +3 -1XX +1 -1XX +15 -2XX +3 -1XX +4 -6X +1 -4XX +1 -8XX +1 -5XX +1 -1XX +27 -1XX +4 -1XX +2 invalidated
umi GTTAATTTGT = 272 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=559]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
385-423 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQSYSTPPITF at 359, score = 9 + 8
umis assigned: [1, 7]
of which 2 are surviving nonsolos
reads assigned: 329
start codons at 2, 32, 38, 94, 107, 243, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1718 = GTATCTTCATCGTCGG-1

using 153 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 148]
surviving nonsolo ucounts = 1[148]
ids = [2]

====================================================================================

UMI info for barcode GTATCTTCATCGTCGG-1 contig 1 = GGGGAGTGAC...
umi CTAATCTTTT = 146 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=475]
24-375 ==> 0-351 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=26)
394-442 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
442-475 ==> 0-33 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAVSSRADGYFDSW at 369, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 141
start codons at 24, 68, 250, 330, 339
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1720 = GTATCTTCATGCCCGA-1

using 3468 reads

====================================================================================

graph has 1226 edges initially, 22 edges after simplification

total ucounts = 152
nonsolo ucounts = 60[2^21, 3^9, 4^4, 5^2, 6^4, 7, 8, 9^4, 10, 11, 34, 54, 106, 163, 198, 220, 224, 230, 348, 365, 550, 693]
surviving nonsolo ucounts = 12[34, 54, 106, 163, 198, 220, 224, 230, 348, 365, 550, 693]
ids = [58, 132, 97, 51, 119, 88, 65, 111, 38, 34, ...]

====================================================================================

UMI info for barcode GTATCTTCATGCCCGA-1 contig 1 = GGAGTCTCCC...
umi ACGCTAGGGT = 497 reads: -391 +1 -1XX +4 -1XX +1 -2XX +6 -1XX +1 -1XX +12 -1XX +4 invalidated
umi CCGGCATCAA = 164 reads: +427 validated
umi CGCTAGCCAT = 32 reads: +30 -4 +325 -1 +12 -1 +5 -2 +47 non-validated
umi GCCAGAGGAT = 221 reads: +427 validated
umi GTATATTACC = 104 reads: +427 validated
umi TAGTGATGCC = 228 reads: +403 -1X +23 invalidated
umi TCCCCCTTTC = 199 reads: +427 validated
umi TGGACACGGG = 51 reads: +423 -4 non-validated
umi TGGCTATATA = 656 reads: -427X invalidated

UMI info for barcode GTATCTTCATGCCCGA-1 contig 2 = GGAGGAACTG...
umi CACAATGATC = 367 reads: +382 validated
umi CACTTCATCC = 348 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=646]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=3)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=18)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-646 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 4 umis using 73 reads
cdr3 = CARRCSGARCPYDAFDIW at 401, score = 8 + 8
umis assigned: [12, 51, 58, 88, 97, 111, 119, 132, 133]
of which 9 are surviving nonsolos
reads assigned: 2128
start codons at 59, 233, 257, 323, 392, 435, 438, 451, 467, 540
confident = true

TIG 2[bases=552]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
34-359 ==> 0-325 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=4)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 125 reads
cdr3 = CLQRGSWPYTF at 355, score = 9 + 8
umis assigned: [34, 38]
of which 2 are surviving nonsolos
reads assigned: 704
start codons at 34, 239, 242, 458
confident = true
now this is a cell
paired!

ACCGCCATGTATTACTGTGCGAGACGCTGTAGTGGTGCTAGGTGCCCCTATGATGCTTTTGATATATGGGGCCGAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCTTCAGCGTGGTTCCTGGCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1722 = GTATCTTCATTATCTC-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1726 = GTATCTTCATTTCACT-1

using 274 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 266]
surviving nonsolo ucounts = 1[266]
ids = [2]

====================================================================================

UMI info for barcode GTATCTTCATTTCACT-1 contig 1 = GCTGTGCTGT...
umi CCCGGTCCCT = 257 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=554]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
422-554 ==> 0-132 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSADSSGTYWF at 358, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1756 = GTATCTTGTGGGTCAA-1

using 335 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 321]
surviving nonsolo ucounts = 1[321]
ids = [4]

====================================================================================

UMI info for barcode GTATCTTGTGGGTCAA-1 contig 1 = ACAACAGGCA...
umi GCATGGCATC = 308 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=517]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
425-517 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYYSTRLTF at 364, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1759 = GTATCTTGTGTTGGGA-1

using 166 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 159]
surviving nonsolo ucounts = 1[159]
ids = [2]

====================================================================================

UMI info for barcode GTATCTTGTGTTGGGA-1 contig 1 = GGGAATCAGT...
umi CTCATCGATC = 148 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=448]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-448 ==> 0-33 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 147
start codons at 27, 33, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1766 = GTATCTTGTTCCCGAG-1

using 100 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2, 3, 4^2, 7, 8^2, 9, 15, 35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1772 = GTATCTTGTTGTGGCC-1

using 698 reads

====================================================================================

graph has 238 edges initially, 14 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[283, 410]
surviving nonsolo ucounts = 2[283, 410]
ids = [0, 1]

====================================================================================

UMI info for barcode GTATCTTGTTGTGGCC-1 contig 1 = AGAGCTCTGG...
umi ATTAGTCCGT = 293 reads: +51 -1XX +55 -1XX +21 -1XX +14 -1XX +9 -1XX +66 -1XX +8 -1XX +101 -1XX +12 -1X +1 -1XX +1 -1XX +2 -2XX +20 -1XX +13 invalidated
umi CCCTCAACTG = 415 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYGSSPRVTF at 368, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 670
start codons at 44, 252, 378, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1777 = GTATCTTTCAATCTCT-1

using 281 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 271]
surviving nonsolo ucounts = 1[271]
ids = [3]

====================================================================================

UMI info for barcode GTATCTTTCAATCTCT-1 contig 1 = GCTGGGGTCT...
umi TAACGTTCGC = 269 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=537]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-392 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
426-537 ==> 0-111 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CSSYTSSSTVF at 365, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1792 = GTATCTTTCCACGAAT-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1796 = GTATCTTTCCAGATCA-1

using 15 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1811 = GTATCTTTCGTACGGC-1

using 2016 reads

====================================================================================

graph has 2606 edges initially, 22 edges after simplification

total ucounts = 972
nonsolo ucounts = 387[2^171, 3^79, 4^36, 5^38, 6^22, 7^10, 8^10, 9^8, 10^5, 11, 12^2, 13^2, 16, 17, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1829 = GTATCTTTCTTGACGA-1

using 64 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 59]
surviving nonsolo ucounts = 1[59]
ids = [2]

====================================================================================

UMI info for barcode GTATCTTTCTTGACGA-1 contig 1 = CTGGGCCTAA...
umi GGCAGTTGGG = 53 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=437]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-388 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=5)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CQVWDSSSDHQNVVF at 352, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 53
start codons at 37, 98, 236, 239, 335, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1831 = GTATCTTTCTTGAGGT-1

using 575 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[167, 407]
surviving nonsolo ucounts = 2[167, 407]
ids = [1, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=436]
0-199 ==> 154-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=13)
228-276 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
276-436 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARGDRRAAAFYYHYMDVW at 188, score = 8 + 7
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 571
start codons at 2, 44, 110, 143, 233, 330
confident = false
VJ delta = 21
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1833 = GTATTCTAGACAAGCC-1

using 483 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 39
nonsolo ucounts = 7[2^2, 3, 4, 5^2, 430]
surviving nonsolo ucounts = 1[430]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=553]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5703-5737 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=1)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 423
start codons at 33, 241, 367, 459
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1838 = GTATTCTAGACGCAAC-1

using 27860 reads

====================================================================================

graph has 11409 edges initially, 68 edges after simplification

total ucounts = 1756
nonsolo ucounts = 779[2^275, 3^148, 4^97, 5^51, 6^36, 7^24, 8^19, 9^15, 10^7, 11^4, 12^6, 13^2, 14^2, 15^2, 16, 17, 21, 33, 54, 57, 62, 78, 84, 85, 92^2, 127, 131, 134, 136, 139, 140, 142, 153, 155, 162, 171, 174, 182, 185, 195^2, 199, 209, 220, 226, 227, 228, 230, 236, 240, 247, 250, 257, 258^2, 259, 272, 279, 286, 287, 290, 291, 299, 300, 301^2, 303, 305, 312, 313^2, 317^2, 318, 322, 328, 329^2, 330^2, 335, 337, 341, 347, 358, 359, 362, 366, 367, 384, 385, 405, 416, 418^2, 425, 426, 427, 432, 445, 485, 525, 653, 761]
surviving nonsolo ucounts = 82[54, 78, 85, 92^2, 127, 131, 134, 139, 140, 142, 153, 162, 171, 174, 182, 185, 195^2, 199, 209, 220, 226, 227, 228, 230, 236, 240, 247, 250, 257, 258^2, 259, 272, 279, 286, 287, 290, 291, 299, 300, 301^2, 303, 305, 312, 313^2, 317^2, 318, 322, 328, 329^2, 330^2, 335, 337, 341, 347, 358, 359, 362, 366, 367, 384, 385, 405, 416, 418^2, 425, 426, 427, 432, 445, 485, 525, 653, 761]
ids = [1713, 371, 929, 335, 1517, 96, 975, 1406, 492, 284, ...]

====================================================================================

UMI info for barcode GTATTCTAGACGCAAC-1 contig 1 = GGGGAGGAGT...
umi AACAGCGAGG = 336 reads: +388 validated
umi AACGCATATG = 361 reads: +388 validated
umi AAGTTCCCTC = 298 reads: +46 -4X +338 invalidated
umi AATCGTGCTC = 129 reads: +388 validated
umi AATTCTGAAT = 254 reads: +388 validated
umi ACAGTGCTAC = 425 reads: +388 validated
umi ACATTTCATA = 257 reads: +388 validated
umi ACCCCCGCGA = 340 reads: +388 validated
umi ACGTATACAA = 421 reads: +388 validated
umi ACGTCTCTCG = 262 reads: +388 validated
umi AGGAGACCCA = 367 reads: +388 validated
umi AGTCTTGTCC = 321 reads: +388 validated
umi ATATGCACTT = 236 reads: +388 validated
umi ATCTACGCGT = 152 reads: +388 validated
umi ATGAGTGCCC = 523 reads: -275 +1 -2X +1 -7X +102 invalidated
umi ATGTACGTGG = 301 reads: +388 validated
umi ATTACTGTTA = 421 reads: -23X +1 -3X +361 invalidated
umi CAAATGAATA = 171 reads: +379 -6 +3 non-validated
umi CAACTAACCT = 309 reads: +388 validated
umi CACTCCGGGA = 279 reads: +388 validated
umi CACTCCTCTC = 318 reads: +388 validated
umi CCAATGGCCG = 233 reads: +388 validated
umi CGACCAACCT = 271 reads: +388 validated
umi CGGACTCTCC = 246 reads: +388 validated
umi CGTCGTGCGC = 238 reads: +388 validated
umi CGTCTTGCCT = 127 reads: -28X +1 -5XX +1 -2XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +2 -1XX +333 invalidated
umi CGTGTTTGAG = 298 reads: +388 validated
umi CGTTAGCCAT = 363 reads: +388 validated
umi CTGCACCTGA = 346 reads: +388 validated
umi CTTAGACATT = 299 reads: +388 validated
umi CTTTTACTGT = 332 reads: +388 validated
umi GAAAGAGCGA = 331 reads: +388 validated
umi GACCAACGAC = 336 reads: +388 validated
umi GAGATAAGCA = 329 reads: +388 validated
umi GATACCTACG = 193 reads: +388 validated
umi GATGACTATA = 359 reads: +388 validated
umi GATGATCGGT = 314 reads: +388 validated
umi GCACTATGCT = 128 reads: +388 validated
umi GCCCCACCAA = 350 reads: +388 validated
umi GCGATGATAT = 387 reads: +388 validated
umi GCTATAGTAC = 336 reads: +388 validated
umi GCTCAGAACT = 194 reads: +388 validated
umi GCTCGCTTTC = 308 reads: +388 validated
umi GCTGCCGGGA = 413 reads: +388 validated
umi GGAAGTTCCT = 297 reads: +388 validated
umi GGCATCAACA = 298 reads: +388 validated
umi GGGTTTGGCC = 757 reads: -213 +175 non-validated
umi GGTTCTGAGG = 162 reads: +3 -1 +4 -3 +377 non-validated
umi GTACTATTGG = 308 reads: +388 validated
umi GTCCACGGGC = 222 reads: +388 validated
umi TAACAAGGGC = 482 reads: +388 validated
umi TACTGTACCT = 470 reads: +160 -1XX +227 invalidated
umi TAGACATCAC = 314 reads: +388 validated
umi TAGAGTTTTA = 385 reads: +388 validated
umi TAGATTGAGA = 420 reads: +388 validated
umi TATCCATCAG = 198 reads: +388 validated
umi TCCGACATAG = 134 reads: +388 validated
umi TCGCTTACTA = 291 reads: +388 validated
umi TCGGTATCAG = 256 reads: +388 validated
umi TCTCTAAGGA = 654 reads: +388 validated
umi TGATTGTCCT = 227 reads: +388 validated
umi TTACCAACCA = 150 reads: +188 -1XX +199 invalidated
umi TTCCTTTTAA = 141 reads: -28X +1 -5XX +1 -2XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +2 -1XX +333 invalidated
umi TTCTATCTCT = 364 reads: +388 validated
umi TTGTATAGCA = 311 reads: +388 validated
umi TTTATCTGGT = 228 reads: +388 validated
umi TTTCCGCAGC = 408 reads: +388 validated

UMI info for barcode GTATTCTAGACGCAAC-1 contig 2 = ATACTTTCTG...
umi ACGGATGTCG = 214 reads: -385X +1 -3XX +9 -1XX +2 -1XX +2 -2XX +1 -2XX +1 -3XX +6 -1XX +4 invalidated
umi ACTAATCTCC = 171 reads: -402X +5 -2XX +1 -3XX +11 invalidated
umi AGCAATGTCG = 144 reads: +424 validated
umi AGTACTTGGT = 89 reads: +67 -1X +2 -2X +1 -351 invalidated
umi ATACAATCCG = 388 reads: -382X +1 -2XX +2 -2XX +12 -1XX +5 -2XX +1 -3XX +11 invalidated
umi ATACATCAGT = 34 reads: -389X +7 -1X +1 -1XX +2 -1XX +3 -4XX +1 -3XX +11 invalidated
umi ATTGCTAGCT = 7 reads: -382X +1 -2X +2 -2X +12 -1X +5 -2XX +1 -3XX +11 invalidated
umi GAACATATCT = 181 reads: +424 validated
umi GTTAAGTTCT = 175 reads: -379 +1 -2XX +1 -2XX +2 -2XX +7 -1XX +1 -1XX +2 -1XX +3 -4XX +1 -3XX +11 invalidated
umi TATAAGTCCT = 141 reads: -390 +8 -1XX +2 -1XX +2 -2XX +1 -2XX +1 -3XX +6 -1XX +4 invalidated
umi TCTTGCCCCT = 234 reads: -382X +1 -2XX +2 -2XX +7 -1XX +1 -1XX +2 -1XX +3 -4XX +1 -3XX +11 invalidated
umi TGATGCCCGC = 90 reads: +17 -2 +405 non-validated
umi TTTCTCACAC = 184 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=18)
381-419 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=5)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 66 umis using 3232 reads
cdr3 = CQQFDSLPVTF at 358, score = 9 + 7
umis assigned: [34, 45, 87, 96, 110, 146, 158, 169, 209, 212] and 57 others
of which 67 are surviving nonsolos
reads assigned: 20310
start codons at 31, 37, 93, 106, 245, 412, 461
confident = true

TIG 2[bases=643]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=32)
426-461 ==> 17-52 on |49|IGHJ1|J-REGION| [len=52] (mis=5)
461-643 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 4 umis using 90 reads
cdr3 = CARAEGSGWFRYLHPW at 382, score = 9 + 6
umis assigned: [202, 216, 284, 335, 368, 371, 492, 890, 1214, 1336] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2008
start codons at 37, 81, 237, 260
confident = true
now this is a cell
paired!

GCGGACACGGCCGTGTATTACTGTGCGAGAGCAGAGGGCAGTGGCTGGTTTCGGTATCTCCACCCCTGGGGCCAGGGCACCCTACTTTTCGTCTCCTCAG <==> ATCACCAGCCTCCAGCCTGAAGATTTTGCAACATATTACTGTCAACAGTTTGATAGTCTTCCGGTCACTTTCGGCCCTGGGACCAAAGTCGACATGAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1850 = GTATTCTAGATGAGAG-1

using 110 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 3, 98]
surviving nonsolo ucounts = 1[98]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=454]
3-84 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-454 ==> 0-41 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 92
start codons at 27, 33, 89, 102, 238
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1851 = GTATTCTAGATGTCGG-1

using 2170 reads

====================================================================================

graph has 1302 edges initially, 38 edges after simplification

total ucounts = 168
nonsolo ucounts = 66[2^20, 3^17, 4^7, 5^4, 6^3, 7^2, 8^2, 10, 17^2, 101, 211, 224, 237, 240, 258, 270, 296]
surviving nonsolo ucounts = 7[101, 211, 224, 240, 258, 270, 296]
ids = [21, 86, 57, 87, 150, 138, 79]

====================================================================================

UMI info for barcode GTATTCTAGATGTCGG-1 contig 1 = GCTGGGGTCT...
umi CCTCGCGGCT = 221 reads: +388 validated
umi GCGCGCATGC = 244 reads: +388 validated
umi GGTTTACGGT = 211 reads: +17 -1XX +22 -1XX +37 -1XX +6 -1XX +3 -1XX +17 -2XX +31 -1XX +5 -3XX +6 -3XX +45 -1XX +8 -1XX +4 -1XX +4 -1XX +7 -1XX +5 -2XX +2 -1XX +43 -2XX +22 -1XX +8 -1XX +9 -1XX +5 -1X +1 -1X +4 -10X +1 -3XX +2 -1XX +5 -4XX +7 -1XX +1 -1XX +1 -1XX +10 invalidated
umi TGCCCATTTA = 274 reads: +388 validated
umi TTAATCTTGG = 260 reads: +388 validated

UMI info for barcode GTATTCTAGATGTCGG-1 contig 2 = CGAGCCCAGC...
umi GCCTATCGAC = 185 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=640]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-395 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 4 umis using 161 reads
cdr3 = CSSYAGSSHVVF at 365, score = 8 + 8
umis assigned: [57, 87, 94, 138, 150]
of which 4 are surviving nonsolos
reads assigned: 1164
start codons at 41, 198, 242, 249, 348, 375, 390
confident = true

TIG 2[bases=504]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-504 ==> 0-22 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [86]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 67, 218, 223, 281, 284, 370
confident = true

REJECT CONTIGS

TIG 1[bases=646]
0-30 ==> 16-46 on |389|IGLV8-61|5'UTR| [len=46] (mis=0)
30-398 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=23)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [21, 79]
of which 2 are surviving nonsolos
reads assigned: 394
start codons at 30, 45, 54, 57, 82, 349, 352
confident = false
did not find CDR3
now this is a cell
paired!

AGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGTGCTACTCGTAGCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> TCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCTCCCATGTGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1853 = GTATTCTAGCCACTAT-1

using 279 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 276]
surviving nonsolo ucounts = 1[276]
ids = [2]

====================================================================================

UMI info for barcode GTATTCTAGCCACTAT-1 contig 1 = GGGGTCTCAG...
umi TTTAGATGCG = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=597]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=2)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-597 ==> 0-171 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 40 reads
cdr3 = CSSYAGSNNLVF at 362, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 38, 239, 246, 345, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1860 = GTATTCTAGCTACCGC-1

using 6821 reads

====================================================================================

graph has 3930 edges initially, 74 edges after simplification

total ucounts = 715
nonsolo ucounts = 329[2^121, 3^66, 4^43, 5^24, 6^17, 7^11, 8^9, 9^3, 10, 11^4, 12^6, 14, 16, 17, 30, 67, 94, 128, 131, 171, 194, 204, 232, 240, 248, 292, 293, 299^2, 313, 331^2, 334, 398, 623]
surviving nonsolo ucounts = 24[2, 4, 7, 9, 67, 94, 128, 131, 171, 194, 204, 232, 240, 248, 292, 293, 299^2, 313, 331^2, 334, 398, 623]
ids = [110, 627, 660, 537, 297, 519, 282, 533, 287, 234, ...]

====================================================================================

UMI info for barcode GTATTCTAGCTACCGC-1 contig 1 = ATACTTTCTG...
umi CAAACATGCT = 231 reads: +442 validated
umi CGACCCTGGA = 172 reads: +442 validated
umi GGTAACTGCC = 246 reads: +442 validated
umi TAACAATTGA = 237 reads: +442 validated

UMI info for barcode GTATTCTAGCTACCGC-1 contig 2 = CCTGGGTCAG...
umi AACCGCGTGG = 200 reads: +388 validated
umi AAGGCCTCGT = 297 reads: +388 validated
umi ACGCAGTTAG = 288 reads: +388 validated
umi CACCATGAGG = 306 reads: +272 -1XX +115 invalidated
umi CACTCACGGC = 195 reads: +388 validated
umi CCTCCTCGTA = 126 reads: +354 -2 +32 non-validated
umi CGACGTCATA = 330 reads: +388 validated
umi CGCAGAACCC = 70 reads: +357 -9 +22 non-validated
umi CTTTATTAGC = 629 reads: +388 validated
umi GAACATGCAG = 329 reads: +388 validated
umi GTGGTCCGGA = 327 reads: +388 validated
umi TACATCTCTA = 315 reads: +388 validated
umi TGTTGTGTCC = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-37 ==> 35-72 on |181|IGHV4-31|5'UTR| [len=72] (mis=0)
37-393 ==> 0-356 on |182|IGHV4-31|L-REGION+V-REGION| [len=356] (mis=13)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 63 reads
cdr3 = CARATGSGDYYTDTRNHYFDSW at 382, score = 9 + 7
umis assigned: [207, 287, 477, 523]
of which 4 are surviving nonsolos
reads assigned: 873
start codons at 37, 81
confident = true

TIG 2[bases=576]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
402-440 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
440-576 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 12 umis using 604 reads
cdr3 = CQQYGNSPRFTF at 376, score = 9 + 8
umis assigned: [18, 27, 86, 226, 234, 282, 288, 297, 377, 384] and 3 others
of which 13 are surviving nonsolos
reads assigned: 3638
start codons at 52, 260, 386, 482
confident = true

REJECT CONTIGS

TIG 1[bases=567]
0-59 ==> 0-59 on |200|IGHV5-51|5'UTR| [len=59] (mis=1)
16-106 ==> 5828-5918 on rc of segment after IGHV5-78 exon 1 [len=6000] (mis=10)
59-183 ==> 0-124 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=3)
183-261 ==> 154-232 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=2)
290-398 ==> 232-340 on |201|IGHV5-51|L-REGION+V-REGION| [len=351] (mis=4) [SHIFT!]
443-496 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=7)
496-567 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [533]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 59, 203, 391, 437
confident = false
frameshifted full length stopped transcript of length 567
did not find CDR3
now this is a cell
paired!

TACTGTGCCAGAGCGACGGGAAGTGGGGACTACTACACGGATACGCGGAACCACTACTTTGACTCCTGGGGCCCGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAACTCACCTCGATTCACTTTCGGCCCTGGGACCAAAGTGGGAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1879 = GTATTCTAGTGTCCCG-1

using 63 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 57]
surviving nonsolo ucounts = 1[57]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=333]
0-293 ==> 52-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=25)
296-333 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
cdr3 = CQQFHNWPSVGF at 269, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 40
start codons at 17, 153
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1881 = GTATTCTAGTTATCGC-1

using 855 reads

====================================================================================

graph has 404 edges initially, 42 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 4^4, 236, 274, 321]
surviving nonsolo ucounts = 3[236, 274, 321]
ids = [4, 6, 3]

====================================================================================

UMI info for barcode GTATTCTAGTTATCGC-1 contig 1 = GGAATCAGTC...
umi CAGCTGCAGC = 263 reads: +22 -1XX +87 -1XX +13 -1XX +23 -1XX +5 -1XX +4 -1XX +12 -1XX +8 -1XX +76 -2XX +128 invalidated

UMI info for barcode GTATTCTAGTTATCGC-1 contig 2 = GGAATCAGTC...
umi ACCCATCATT = 270 reads: +17 -1XX +30 -1XX +2 -1XX +10 -1XX +73 -1XX +3 -1XX +7 -1XX +6 -1XX +2 -2XX +5 -3XX +34 -1XX +9 -1XX +1 -1XX +8 -1XX +4 -1XX +3 -2XX +20 -1XX +2 -1XX +17 -1XX +2 -1XX +3 -1XX +4 -1XX +24 -1XX +7 -1XX +10 -1XX +4 -1XX +2 -1X +3 -14X +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi ATCGTCTCTG = 232 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=9)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 26, 32, 101, 183, 237, 456
confident = false

TIG 2[bases=553]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQHNSYPRWTF at 353, score = 9 + 8
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 492
start codons at 26, 32, 101, 183, 237, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1887 = GTATTCTCAAGCCTAT-1

using 1522 reads

====================================================================================

graph has 2185 edges initially, 18 edges after simplification

total ucounts = 628
nonsolo ucounts = 309[2^112, 3^75, 4^40, 5^31, 6^21, 7^5, 8^5, 9^6, 10^4, 11^3, 12^2, 13, 14, 15, 17, 28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1889 = GTATTCTCAATAGCGG-1

using 23 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 21]
surviving nonsolo ucounts = 1[21]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1896 = GTATTCTCACGAGGTA-1

using 231 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[225]
surviving nonsolo ucounts = 1[225]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=511]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
7-59 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
34-334 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
419-511 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 355, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 34, 239, 461
confident = false
not full
full length stopped transcript of length 511
frameshifted full length stopped transcript of length 511
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1897 = GTATTCTCACGGTTTA-1

using 21 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1913 = GTATTCTCAGGATTGG-1

using 162 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^3, 155]
surviving nonsolo ucounts = 1[155]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTCAGGATTGG-1 contig 1 = GGAGTCAGAC...
umi TACGATATTA = 158 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1918 = GTATTCTCAGGTGCCT-1

using 408 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 401]
surviving nonsolo ucounts = 1[401]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTCAGGTGCCT-1 contig 1 = AGGAGTCAGA...
umi GTCCTGTCCT = 376 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=13)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-487 ==> 0-72 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQQYDTYPWTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 27, 33, 89, 102, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1926 = GTATTCTCATGATCCA-1

using 311 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 8, 296]
surviving nonsolo ucounts = 1[296]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTCATGATCCA-1 contig 1 = GGGGGTCTCA...
umi TCCAACCTGG = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=566]
39-377 ==> 0-338 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
427-566 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CSSYTTIHTFVF at 363, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 39, 247, 250, 559
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1941 = GTATTCTGTACGCACC-1

using 47 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 40]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1943 = GTATTCTGTACTCGCG-1

using 229 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode GTATTCTGTACTCGCG-1 contig 1 = GAGTCAGTCT...
umi ACCGTCGACT = 211 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-509 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQSYTTLLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1945 = GTATTCTGTACTTGAC-1

using 366 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 5, 354]
surviving nonsolo ucounts = 1[354]
ids = [5]

====================================================================================

UMI info for barcode GTATTCTGTACTTGAC-1 contig 1 = AGTGCTTTCT...
umi TCTTTCCCCG = 355 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=527]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=19)
426-456 ==> 16-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
456-527 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGAARSTTVIIDFW at 377, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 17, 38, 82, 168, 255
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1961 = GTATTCTGTCCCTACT-1

using 30 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 25]
surviving nonsolo ucounts = 1[25]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1964 = GTATTCTGTCTAAAGA-1

using 1266 reads

====================================================================================

graph has 1331 edges initially, 8 edges after simplification

total ucounts = 316
nonsolo ucounts = 130[2^45, 3^28, 4^18, 5^12, 6^13, 7^3, 8^4, 9, 10, 12, 13, 14, 277, 307]
surviving nonsolo ucounts = 2[277, 307]
ids = [77, 173]

====================================================================================

UMI info for barcode GTATTCTGTCTAAAGA-1 contig 1 = GGGAGTCAGT...
umi GCCATACGAT = 310 reads: +388 validated

UMI info for barcode GTATTCTGTCTAAAGA-1 contig 2 = GCTCTGCTTC...
umi CCATTTTATA = 271 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=551]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYTTLLTF at 354, score = 9 + 9
umis assigned: [173]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 27, 33, 89, 102, 238, 457
confident = false

TIG 2[bases=584]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-584 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [77]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1966 = GTATTCTGTCTCTTAT-1

using 327 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 10, 308]
surviving nonsolo ucounts = 1[308]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTGTCTCTTAT-1 contig 1 = GAGTCAGTCC...
umi GTCCGCACGG = 275 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=496]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
410-496 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYDNLPFF at 352, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 25, 31, 87, 100, 239, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1973 = GTATTCTGTGACTACT-1

using 566 reads

====================================================================================

graph has 274 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^4, 552]
surviving nonsolo ucounts = 1[552]
ids = [7]

====================================================================================

UMI info for barcode GTATTCTGTGACTACT-1 contig 1 = GATCAGGACT...
umi GATCTCGCTC = 559 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 92 reads
cdr3 = CMQALQTPYTF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 547
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1974 = GTATTCTGTGAGGGTT-1

using 1292 reads

====================================================================================

graph has 548 edges initially, 16 edges after simplification

total ucounts = 161
nonsolo ucounts = 67[2^32, 3^16, 4^5, 5^6, 6^3, 9, 12, 17, 482, 498]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1981 = GTATTCTGTGCTGTAT-1

using 2975 reads

====================================================================================

graph has 3262 edges initially, 46 edges after simplification

total ucounts = 914
nonsolo ucounts = 453[2^201, 3^99, 4^60, 5^39, 6^16, 7^14, 8^8, 9^4, 10^3, 11^2, 14, 15, 16, 17, 33, 406, 532]
surviving nonsolo ucounts = 2[406, 532]
ids = [377, 131]

====================================================================================

UMI info for barcode GTATTCTGTGCTGTAT-1 contig 1 = GAAGAGCTGC...
umi AGGGACATCT = 537 reads: +362 -1XX +19 invalidated
umi CGTTATCTTG = 411 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-370 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYDRSWTF at 357, score = 9 + 8
umis assigned: [131, 377]
of which 2 are surviving nonsolos
reads assigned: 923
start codons at 33, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1986 = GTATTCTGTGTGCCTG-1

using 9 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1987 = GTATTCTGTGTTAAGA-1

using 357 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 348]
surviving nonsolo ucounts = 1[348]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTGTGTTAAGA-1 contig 1 = GGGAATCAGT...
umi TCGTAAACTC = 349 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 346
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1989 = GTATTCTGTTAAAGTG-1

using 232 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^3, 221]
surviving nonsolo ucounts = 1[221]
ids = [3]

====================================================================================

UMI info for barcode GTATTCTGTTAAAGTG-1 contig 1 = ACCCAAAAAC...
umi CTCATAATCA = 216 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=551]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-551 ==> 0-61 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1994 = GTATTCTGTTAAGTAG-1

using 21302 reads

====================================================================================

graph has 9325 edges initially, 80 edges after simplification

total ucounts = 1324
nonsolo ucounts = 683[2^233, 3^129, 4^103, 5^51, 6^35, 7^31, 8^16, 9^7, 10^10, 11^6, 12^2, 13^2, 14, 15^3, 16, 18, 19, 21, 56, 68, 83, 87, 100, 140, 147, 153, 158, 160, 171, 190, 210, 217, 222^2, 231, 232, 233, 241^2, 244, 246, 247, 250, 254, 260, 263, 276, 281, 287, 293^2, 315, 333, 355, 372, 395, 439, 468, 514, 571, 642, 665, 782^2, 904, 927, 1014, 1940]
surviving nonsolo ucounts = 46[11, 56, 68, 87, 100, 140, 147, 153, 160, 171, 190, 210, 217, 222^2, 231, 232, 233, 241^2, 244, 246, 247, 250, 254, 260, 263, 276, 281, 287, 293, 315, 372, 395, 439, 468, 514, 571, 642, 665, 782^2, 904, 927, 1014, 1940]
ids = [662, 941, 874, 962, 584, 183, 831, 473, 46, 258, ...]

====================================================================================

UMI info for barcode GTATTCTGTTAAGTAG-1 contig 1 = AGTCTGGGCC...
umi AATTTCGGTT = 246 reads: +385 validated
umi ACATGATTAT = 647 reads: -167 +218 non-validated
umi ACTGATATTG = 1011 reads: -342X +1 -2XX +1 -5XX +34 invalidated
umi ACTTTTGGAT = 211 reads: +385 validated
umi AGTTTATCTA = 279 reads: +385 validated
umi ATATTCGGGC = 231 reads: +385 validated
umi ATCGAAGTAC = 663 reads: -351X +34 invalidated
umi CAAATATAGT = 242 reads: +385 validated
umi CACCATGCGA = 217 reads: +385 validated
umi CCCAATAGCC = 261 reads: +385 validated
umi CCTCGGCCCC = 902 reads: -342X +1 -2XX +1 -5XX +34 invalidated
umi CGTCTGTGCG = 230 reads: +385 validated
umi CGTTAAGGAT = 782 reads: -345X +1 -5XX +34 invalidated
umi CTAGGCCTCA = 469 reads: -342X +1 -2XX +1 -5XX +34 invalidated
umi CTCTCGTCGG = 520 reads: -351X +34 invalidated
umi GAGCCCCATC = 1949 reads: -342X +1 -2XX +1 -5XX +34 invalidated
umi GTTAGGCAAA = 34 reads: -378 +1 -4X +2 invalidated
umi TACGCTCTCC = 566 reads: -342X +1 -2XX +1 -5XX +34 invalidated
umi TCACATGTCA = 437 reads: -27X +1 -8X +2 -4XX +343 invalidated
umi TCATATGTCA = 918 reads: -323X +1 -1XX +2 -1XX +2 -5XX +1 -6XX +1 -2XX +1 -5XX +34 invalidated
umi TCCAAGCAGG = 257 reads: +385 validated
umi TGCTCCCTCT = 13 reads: -378X +1 -4X +2 invalidated
umi TGGAATTGCC = 242 reads: +385 validated
umi TGGGGTTGCT = 242 reads: +385 validated
umi TTCATATACC = 46 reads: -340 +1 -1XX +1 -3XX +3 -8XX +1 -5XX +1 -1XX +1 -4XX +2 -1XX +1 -1XX +10 invalidated
umi TTCCCCGTAG = 792 reads: -351X +34 invalidated

UMI info for barcode GTATTCTGTTAAGTAG-1 contig 2 = GGGAGAGGAG...
umi AAGGGAATAC = 232 reads: +424 validated
umi AATGGACCAG = 160 reads: +414 -10 non-validated
umi ACATCCCGGT = 246 reads: +424 validated
umi AGGTTTGTTT = 293 reads: +424 validated
umi ATATATGGAT = 285 reads: +424 validated
umi ATGTGAGATG = 169 reads: +424 validated
umi CGAGGCCAAT = 153 reads: +424 validated
umi CTGTATTCGG = 101 reads: +424 validated
umi GAACGCTTGG = 313 reads: +424 validated
umi GGGGTTCCAT = 267 reads: +422 -2 non-validated
umi TAAAATCCGG = 68 reads: +400 -24 non-validated
umi TACATGTGCA = 272 reads: +424 validated
umi TACGGACTTA = 222 reads: +424 validated
umi TAGGGTTGGC = 367 reads: +424 validated
umi TATAAGTACT = 54 reads: -413X +2 -1X +1 -6X +1 invalidated
umi TCGAACGTAG = 258 reads: +409 -1X +9 -5 invalidated
umi TGCTGTCTTT = 234 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=636]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-383 ==> 0-343 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=4)
387-425 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
425-636 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 13 umis using 755 reads
cdr3 = CQVWDSSSDLFPVF at 355, score = 8 + 8
umis assigned: [58, 69, 121, 133, 192, 216, 235, 285, 312, 395] and 16 others
of which 23 are surviving nonsolos
reads assigned: 12203
start codons at 40, 101, 242, 338
confident = true

TIG 2[bases=568]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
73-423 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=3)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
497-568 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 210 reads
cdr3 = CARGAGDCTGGVCYFDYW at 412, score = 9 + 7
umis assigned: [29, 46, 68, 174, 210, 258, 473, 584, 619, 772] and 7 others
of which 17 are surviving nonsolos
reads assigned: 3629
start codons at 73, 229, 373, 447
confident = true
now this is a cell
paired!

ACGGCCGTGTATTACTGTGCGAGAGGGGCCGGAGATTGTACTGGTGGTGTATGCTATTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCTATTCCCCGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.1995 = GTATTCTGTTACGCGC-1

using 80000 reads

====================================================================================

graph has 18874 edges initially, 130 edges after simplification

total ucounts = 1997
nonsolo ucounts = 914[2^267, 3^141, 4^72, 5^53, 6^28, 7^17, 8^17, 9^5, 10^3, 11^5, 12^4, 13^3, 14, 15, 16^2, 17, 19, 20^2, 21, 40, 43, 49, 52, 53, 56, 57, 63^2, 72^2, 74, 78, 108, 110, 115^2, 123, 126, 127, 128, 135^2, 136, 138, 139^2, 141, 144, 146, 149, 150, 153, 157^2, 167^2, 168, 172^2, 175, 177, 178, 184, 186, 187, 188, 190, 191, 193, 194, 195, 196, 198, 201, 203^2, 204^2, 206^3, 207, 208^2, 211^2, 212, 213^2, 214, 215, 218^6, 222, 223^2, 227, 228, 229^2, 230^3, 233, 234, 235, 238^3, 239, 241^3, 242, 244, 245, 246^2, 247^4, 248, 249, 250^2, 251, 253^2, 254^2, 257^2, 258, 259^2, 261, 262, 263^4, 264, 266^2, 267, 268^5, 269^3, 270^2, 271, 272, 273^2, 276^2, 277^4, 278, 279^2, 280, 281, 282^3, 283, 285^2, 286, 287^3, 289^3, 290^6, 292^2, 293, 294, 295^2, 296, 297^2, 298, 299^2, 301, 302, 303, 304^2, 306, 307^2, 308^2, 309^3, 310^6, 311, 312^4, 313^2, 314^3, 315^2, 316^2, 317, 318^2, 319, 320^7, 322^2, 323, 324, 326^3, 327, 328, 329^2, 330, 331, 332, 335, 336^2, 339^3, 341, 342, 344^2, 346^2, 347, 350, 351, 352, 354^3, 355, 356, 357^2, 360, 362^4, 366, 367, 371, 374, 379, 383^2, 386, 389, 393, 420, 436, 457, 512, 525, 594, 622]
surviving nonsolo ucounts = 277[19, 21, 40, 43, 49, 52, 53, 56, 57, 63^2, 72^2, 74, 108, 110, 115^2, 127, 138, 139, 141, 144, 146, 149, 150, 153, 157^2, 167^2, 168, 172^2, 175, 177, 178, 184, 186, 187, 188, 190, 191, 193, 194, 195, 196, 198, 201, 203^2, 204^2, 206^3, 207, 208^2, 211^2, 212, 213^2, 214, 215, 218^6, 222, 223^2, 227, 228, 229^2, 230^3, 233, 234, 235, 238^3, 239, 241^3, 242, 244, 245, 246^2, 247^4, 248, 249, 250, 251, 253^2, 254, 257^2, 258, 259^2, 261, 262, 263^3, 264, 266, 267, 268^4, 269^3, 270^2, 271, 272, 273^2, 276^2, 277^4, 278, 279^2, 280, 281, 282^3, 283, 285^2, 286, 287^2, 289^3, 290^6, 292^2, 293, 294, 295^2, 296, 297^2, 298, 299^2, 301, 302, 303, 304^2, 306, 307^2, 308^2, 309^3, 310^5, 311, 312^4, 313^2, 314^3, 315^2, 316^2, 317, 318^2, 319, 320^7, 322^2, 323, 324, 326^3, 327, 328, 329^2, 330, 331, 332, 335, 336^2, 339^3, 341, 342, 344^2, 346^2, 347, 350, 351, 352, 354^3, 355, 356, 357^2, 360, 362^4, 366, 367, 371, 374, 379, 383^2, 386, 389, 393, 420, 436, 457, 512, 525, 594, 622]
ids = [49, 1177, 771, 28, 352, 1199, 487, 688, 277, 1788, ...]

====================================================================================

UMI info for barcode GTATTCTGTTACGCGC-1 contig 1 = AGTGCTTTCT...
umi AAAGGCTCCT = 46 reads: -14 +100 -12 +166 -1XX +73 -8 +62 invalidated
umi AAAGGGCTAC = 287 reads: +436 validated
umi AACCATTGGG = 21 reads: -3 +117 -1 +65 -2X +104 -1XX +107 -1 +3 -2X +2 -28 invalidated
umi AAGTCACGCG = 141 reads: +292 -1XX +143 invalidated
umi ACAGTGGATG = 213 reads: +436 validated
umi ACCATGTCAC = 103 reads: +436 validated
umi ACTCTCGCAC = 215 reads: +292 -1XX +143 invalidated
umi ACTTACCGCA = 59 reads: +292 -1XX +143 invalidated
umi ACTTCTTCCG = 273 reads: +436 validated
umi AGAAAACTCC = 192 reads: +292 -1XX +143 invalidated
umi AGACGGCTAC = 148 reads: +436 validated
umi AGAGTTGCTT = 204 reads: +436 validated
umi AGGCACAGTG = 51 reads: -9 +427 non-validated
umi AGTGCACCGT = 210 reads: +292 -1XX +143 invalidated
umi ATAACTAAGC = 260 reads: +292 -1XX +143 invalidated
umi ATCTACCTCC = 179 reads: +436 validated
umi ATGCTTTTTG = 54 reads: +436 validated
umi ATTATACTGG = 280 reads: +436 validated
umi CAGCCTATAC = 77 reads: +292 -1XX +143 invalidated
umi CATAGCAGCT = 280 reads: +436 validated
umi CATCTCGGGA = 177 reads: +317 -1XX +118 invalidated
umi CATGCACTTC = 176 reads: +436 validated
umi CCACGGATCG = 279 reads: +436 validated
umi CCATACTTCC = 56 reads: +56 -5 +231 -1XX +143 invalidated
umi CCCCAATCGC = 220 reads: +292 -1XX +143 invalidated
umi CCCCTAGTGA = 190 reads: +436 validated
umi CCTGCGATAT = 41 reads: +436 validated
umi CGGTGTCCCT = 75 reads: -7 +285 -1XX +143 invalidated
umi CTATCACCCA = 72 reads: +436 validated
umi CTGCTTGTGT = 194 reads: +292 -1XX +143 invalidated
umi CTTAGGATCT = 315 reads: +436 validated
umi CTTCTGTTCA = 109 reads: +292 -1XX +143 invalidated
umi GAATTCACCG = 117 reads: +436 validated
umi GCTGGCCGGC = 22 reads: +41 -9 +298 -88 non-validated
umi GGATCTCACC = 54 reads: +427 -9 non-validated
umi GGGGAGCTTC = 172 reads: +292 -1XX +143 invalidated
umi GTATTAGCCT = 251 reads: +292 -1XX +143 invalidated
umi GTGTTTATGC = 177 reads: +436 validated
umi GTTTGTTATG = 145 reads: +292 -1XX +143 invalidated
umi TACTATCCCC = 213 reads: +292 -1XX +143 invalidated
umi TAGAGTATCA = 202 reads: +292 -1XX +143 invalidated
umi TATGCTCGTT = 209 reads: +292 -1XX +143 invalidated
umi TATGTGTGAA = 206 reads: +292 -1XX +47 -1 +4 -1 +90 invalidated
umi TCAATATCAC = 291 reads: +436 validated
umi TCAGCTCAAC = 217 reads: +436 validated
umi TGCCTCTGGG = 138 reads: +436 validated
umi TGGACGGTCT = 178 reads: +436 validated
umi TTAATCTGGC = 62 reads: +425 -1 +4 -1 +4 -1 non-validated
umi TTATGTGCTT = 148 reads: +292 -1XX +143 invalidated
umi TTCGGGACCT = 153 reads: +436 validated
umi TTCTCTGTTT = 208 reads: +292 -1XX +143 invalidated
umi TTCTTTTATG = 196 reads: +436 validated
umi TTGAGACTTT = 61 reads: +382 -46 +8 non-validated
umi TTGGCTCCTT = 211 reads: +436 validated

UMI info for barcode GTATTCTGTTACGCGC-1 contig 2 = TGTGGGGAGG...
umi AAACGCATAA = 232 reads: +388 validated
umi AAAGCCCACG = 171 reads: +388 validated
umi AACAATCTCT = 208 reads: +388 validated
umi AACCGGAGGC = 265 reads: +388 validated
umi AACTATAACA = 322 reads: +388 validated
umi AACTGACCTA = 222 reads: +388 validated
umi AACTTAGCTG = 320 reads: +388 validated
umi AAGACGTAGG = 216 reads: +388 validated
umi AAGCATATGG = 248 reads: +388 validated
umi AAGCGATTGC = 370 reads: +388 validated
umi AAGGCTCAGG = 223 reads: +388 validated
umi AAGTTCCATT = 291 reads: +388 validated
umi AATATCGATC = 257 reads: +388 validated
umi AATCGGGGTA = 277 reads: +388 validated
umi AATGAATGGC = 342 reads: +388 validated
umi AATTGTTCGG = 144 reads: +388 validated
umi AATTTTTGCT = 238 reads: +388 validated
umi ACAATAGCGG = 307 reads: +388 validated
umi ACAATATGCT = 380 reads: +388 validated
umi ACACACTGCA = 279 reads: +388 validated
umi ACACCAACTA = 419 reads: +388 validated
umi ACATAAGCTC = 288 reads: +388 validated
umi ACATCCTTTC = 361 reads: +388 validated
umi ACATGTAATG = 296 reads: +388 validated
umi ACCACGACTA = 315 reads: +388 validated
umi ACCAGTGGCT = 343 reads: +388 validated
umi ACCAGTTGCC = 380 reads: +388 validated
umi ACCGTTCCTC = 240 reads: +388 validated
umi ACCTCGGGCA = 194 reads: +388 validated
umi ACGCCTCGGC = 319 reads: +388 validated
umi ACGGTGATCA = 279 reads: +388 validated
umi ACTCACATTC = 185 reads: +388 validated
umi ACTCAGCCTT = 286 reads: +388 validated
umi ACTCCTGCAG = 329 reads: +388 validated
umi ACTCTGTTTC = 351 reads: +388 validated
umi ACTTAACCCG = 266 reads: +388 validated
umi ACTTTGGCTC = 12 reads: -365 +8 -1X +6 -1XX +7 invalidated
umi AGAACTTACT = 273 reads: +388 validated
umi AGACAGCCAT = 307 reads: +388 validated
umi AGAGCATGCA = 197 reads: +388 validated
umi AGCAATGCCA = 323 reads: +388 validated
umi AGCACTTAGG = 229 reads: +388 validated
umi AGCAGTCAGT = 339 reads: +388 validated
umi AGCCGGTGCT = 307 reads: +388 validated
umi AGCTTATGCC = 225 reads: +388 validated
umi AGCTTCTGTC = 314 reads: +388 validated
umi AGGACGATCC = 318 reads: +388 validated
umi AGGCCTATCG = 315 reads: +388 validated
umi AGGTACCCTC = 353 reads: +388 validated
umi AGGTATTCCA = 282 reads: +388 validated
umi AGTCCACTTC = 356 reads: +388 validated
umi ATACCGATCA = 284 reads: +388 validated
umi ATAGCTTCGA = 153 reads: +388 validated
umi ATATACTCAG = 363 reads: +388 validated
umi ATATAGGCTC = 311 reads: +388 validated
umi ATATCCGTCG = 305 reads: +388 validated
umi ATCCCTATCT = 322 reads: +388 validated
umi ATCGCACCTG = 325 reads: +388 validated
umi ATCTTAATAT = 264 reads: +388 validated
umi ATGGGAAATT = 265 reads: +388 validated
umi ATGTACCCAC = 309 reads: +388 validated
umi ATGTACGTAA = 312 reads: +388 validated
umi ATGTCTAGTA = 201 reads: +388 validated
umi ATGTGTTTCT = 291 reads: +388 validated
umi ATTACGCTTC = 244 reads: +388 validated
umi ATTCAGCCCA = 189 reads: +388 validated
umi ATTCTCGCTT = 32 reads: -361 +2 -2X +8 -1XX +6 -1XX +7 invalidated
umi ATTGGGGGCT = 266 reads: +388 validated
umi ATTTGCGATG = 268 reads: +388 validated
umi CAAAGAGGGT = 272 reads: +388 validated
umi CAAAGCACTC = 264 reads: +388 validated
umi CAAAGTAGTG = 325 reads: +388 validated
umi CAAATTTTAC = 302 reads: +388 validated
umi CAAGTTCTTC = 344 reads: +385 -1X +2 invalidated
umi CAAGTTGGGC = 318 reads: +388 validated
umi CAATAGCCTC = 596 reads: +388 validated
umi CACACAACAA = 194 reads: +388 validated
umi CAGATAATAG = 332 reads: +388 validated
umi CAGCCCACTC = 359 reads: +388 validated
umi CAGGTATTGC = 262 reads: +388 validated
umi CATAATCCGG = 263 reads: +388 validated
umi CATCCTTTTA = 314 reads: +388 validated
umi CATTCAACTA = 274 reads: +388 validated
umi CCAACCTCTT = 307 reads: +388 validated
umi CCAGGTGTGG = 247 reads: +388 validated
umi CCCCCGAAAC = 386 reads: +388 validated
umi CCCCTTTGGA = 246 reads: +388 validated
umi CCCGCTCGGG = 287 reads: +388 validated
umi CCCTACAGCC = 344 reads: +388 validated
umi CCCTCTGTCC = 280 reads: +388 validated
umi CCGCCAACTA = 393 reads: +388 validated
umi CCGCCTCAAT = 259 reads: -7X +381 invalidated
umi CCGCTCTCTT = 626 reads: +388 validated
umi CCGGTGGTAT = 292 reads: +388 validated
umi CCGTGCAGGA = 366 reads: +388 validated
umi CCTCGTGTGG = 291 reads: +388 validated
umi CCTCTTGTGC = 516 reads: -81 +307 non-validated
umi CCTGTCAGCC = 320 reads: +388 validated
umi CGCATACTCT = 218 reads: +388 validated
umi CGCTATGCCT = 267 reads: +388 validated
umi CGGCCAGGTC = 235 reads: +388 validated
umi CGTCGGGTTC = 255 reads: +388 validated
umi CTACGTTAAG = 311 reads: +388 validated
umi CTACTCCTTT = 307 reads: +388 validated
umi CTAGCCTCTG = 280 reads: +388 validated
umi CTAGGGCCCT = 264 reads: +388 validated
umi CTAGGGCTGG = 300 reads: +388 validated
umi CTAGTTGTTA = 279 reads: +388 validated
umi CTATAATCCG = 229 reads: +388 validated
umi CTATATATTG = 223 reads: +129 -2XX +1 -3XX +1 -11XX +1 -1XX +1 -230XX +1 -7XX invalidated
umi CTATTAACAG = 143 reads: +388 validated
umi CTCGCATCGG = 269 reads: +388 validated
umi CTCTAACTAT = 331 reads: +388 validated
umi CTGCTATTCT = 30 reads: -347X +2 -5XX +2 -1XX +6 -2XX +8 -1XX +6 -1XX +7 invalidated
umi CTTAATTCTC = 361 reads: +388 validated
umi CTTAGGTCTG = 315 reads: +388 validated
umi CTTCCCTGGC = 318 reads: +388 validated
umi CTTGATTCAG = 350 reads: +388 validated
umi CTTTCTGCAC = 30 reads: -347 +2 -5X +2 -1XX +6 -2XX +8 -1XX +6 -1XX +7 invalidated
umi GAAAACGTGG = 203 reads: +388 validated
umi GAAGGCTCGC = 11 reads: -360 +3 -2X +8 -1XX +6 -1XX +7 invalidated
umi GAATGTGTAC = 243 reads: +388 validated
umi GACGCATCTA = 292 reads: +388 validated
umi GACGCTGTGG = 302 reads: +388 validated
umi GACTCATTGG = 331 reads: +388 validated
umi GAGCGCAGTC = 248 reads: +388 validated
umi GAGGACCTCT = 315 reads: +388 validated
umi GATATGCATC = 357 reads: +388 validated
umi GATGCTCGCT = 311 reads: +388 validated
umi GATTTAGATC = 288 reads: +183 -1XX +1 -2XX +2 -1X +198 invalidated
umi GCAACAACTT = 239 reads: +388 validated
umi GCACATACGA = 358 reads: +388 validated
umi GCAGACATAG = 286 reads: +388 validated
umi GCGACTGCGA = 247 reads: +388 validated
umi GCTACCTAAC = 203 reads: +388 validated
umi GGACAGGCAT = 336 reads: +388 validated
umi GGACGCTCTT = 365 reads: +388 validated
umi GGATAAACCC = 358 reads: +388 validated
umi GGCTTGGGCT = 237 reads: +388 validated
umi GGTATGGAGA = 247 reads: +388 validated
umi GGTCATCCAC = 220 reads: +388 validated
umi GTACTGTTCA = 309 reads: +388 validated
umi GTAGTGCAAC = 242 reads: +388 validated
umi GTATAAGTTG = 215 reads: +388 validated
umi GTCAAGCGTA = 253 reads: +388 validated
umi GTCTCATTGA = 17 reads: -348X +1 -5X +2 -1XX +6 -2XX +8 -1XX +6 -1XX +7 invalidated
umi GTGGGATCGT = 257 reads: +388 validated
umi GTTCACCCTT = 212 reads: +388 validated
umi GTTGTGTGTT = 273 reads: +388 validated
umi TAAAAGCTAC = 338 reads: +266 -1XX +121 invalidated
umi TAAGACAGCT = 27 reads: -347X +2 -5XX +2 -1XX +6 -2XX +8 -1XX +6 -1XX +7 invalidated
umi TAAGTCCCTC = 316 reads: +388 validated
umi TAATAGCTTG = 300 reads: +388 validated
umi TAATTATGCT = 320 reads: +388 validated
umi TAATTGTTCG = 302 reads: +388 validated
umi TACCTGATAC = 330 reads: +388 validated
umi TACGGTTATG = 313 reads: +388 validated
umi TAGGCACTTG = 377 reads: +388 validated
umi TAGGTGGTCT = 222 reads: +388 validated
umi TATCATGGGT = 336 reads: +388 validated
umi TATCCATTCT = 325 reads: +388 validated
umi TATGGTAACA = 372 reads: +388 validated
umi TATTTTTGGA = 272 reads: +388 validated
umi TCAAAGCACC = 329 reads: +388 validated
umi TCACCGGGAC = 288 reads: +388 validated
umi TCATGCTGTG = 263 reads: +388 validated
umi TCCATGGTAC = 283 reads: +388 validated
umi TCCCGTCCGC = 266 reads: +388 validated
umi TCCTGGGGGG = 230 reads: +388 validated
umi TCCTTCAAGC = 156 reads: +388 validated
umi TCGAATGGGT = 195 reads: +388 validated
umi TCGACATACG = 324 reads: +388 validated
umi TCGAGATCGA = 325 reads: +388 validated
umi TCGCCGGGGC = 301 reads: +388 validated
umi TCGCTATCTT = 344 reads: +388 validated
umi TCGCTCGCAA = 524 reads: +388 validated
umi TCGGGTTCAC = 310 reads: +388 validated
umi TCTAATAGCC = 251 reads: +388 validated
umi TCTGTAACCA = 275 reads: +280 -1XX +107 invalidated
umi TCTGTCGGGA = 245 reads: +388 validated
umi TCTTGACAGC = 321 reads: +388 validated
umi TGAATACTTA = 257 reads: +388 validated
umi TGAATGATGC = 283 reads: +388 validated
umi TGACCGTATG = 272 reads: +388 validated
umi TGAGACTTAC = 233 reads: +388 validated
umi TGATCCGCAT = 290 reads: +388 validated
umi TGCAAAGTCT = 286 reads: +388 validated
umi TGCATATATA = 352 reads: +388 validated
umi TGCGCCTCCC = 384 reads: +388 validated
umi TGCTGAGTAT = 309 reads: +388 validated
umi TGGGCCACGG = 307 reads: +388 validated
umi TGTCTTGGTA = 244 reads: +388 validated
umi TGTGCCTAAC = 315 reads: +388 validated
umi TGTGTCTCAT = 241 reads: +388 validated
umi TGTGTCTCTG = 288 reads: +388 validated
umi TGTTGTCTCT = 338 reads: +388 validated
umi TTAAACCGCT = 279 reads: +388 validated
umi TTAAAGATCA = 437 reads: +388 validated
umi TTAAGTGCAA = 354 reads: +388 validated
umi TTAATTATAC = 366 reads: +388 validated
umi TTACTTGAAA = 232 reads: +388 validated
umi TTAGACTTCC = 309 reads: +388 validated
umi TTATTACATG = 213 reads: +388 validated
umi TTCATGATTA = 348 reads: +388 validated
umi TTCCTATCTC = 301 reads: +388 validated
umi TTCGCGATCC = 341 reads: +388 validated
umi TTCTCAGTTC = 310 reads: +388 validated
umi TTCTCTGTGT = 311 reads: +388 validated
umi TTGGATGGTA = 321 reads: +388 validated
umi TTGTATTTAC = 319 reads: +388 validated
umi TTTATACACC = 226 reads: +388 validated
umi TTTATACCAT = 298 reads: +388 validated
umi TTTCACTCGT = 368 reads: +388 validated
umi TTTCATTAGT = 288 reads: +388 validated
umi TTTCCTCCCG = 328 reads: +388 validated
umi TTTCGCTCCC = 288 reads: +388 validated
umi TTTGTCGGGG = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
453-635 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 49 umis using 1069 reads
cdr3 = CARAHGDYYTLLDCW at 377, score = 8 + 7
umis assigned: [28, 30, 49, 104, 168, 191, 264, 277, 280, 288] and 44 others
of which 54 are surviving nonsolos
reads assigned: 8573
start codons at 17, 38, 82, 168, 368
confident = true

TIG 2[bases=558]
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 209 umis using 9987 reads
cdr3 = CQQSYTTLLTF at 361, score = 9 + 9
umis assigned: [21, 26, 40, 55, 65, 68, 72, 78, 84, 86] and 207 others
of which 210 are surviving nonsolos
reads assigned: 60954
start codons at 34, 40, 96, 109, 245, 464
confident = true
now this is a cell
paired!

GCCGCGGACACGGCTATGTATTACTGTGCGAGAGCACACGGTGACTACTACACCCTCCTTGACTGCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACACTACCCTCCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2002 = GTATTCTGTTCCCTTG-1

using 309 reads

====================================================================================

graph has 98 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[33, 274]
surviving nonsolo ucounts = 2[33, 274]
ids = [2, 1]

====================================================================================

UMI info for barcode GTATTCTGTTCCCTTG-1 contig 1 = GGATCACCCA...
umi GGGCCTTTCA = 268 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=570]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
417-468 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
468-570 ==> 0-102 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CARGSTSWYDYW at 401, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 59, 210, 257, 262, 294, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2011 = GTATTCTTCAAGGTAA-1

using 513 reads

====================================================================================

graph has 212 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 7, 8, 11, 198, 285]
surviving nonsolo ucounts = 2[198, 285]
ids = [2, 6]

====================================================================================

UMI info for barcode GTATTCTTCAAGGTAA-1 contig 1 = ACCCAAAAAC...
umi ATATAGCCCT = 191 reads: +436 validated

UMI info for barcode GTATTCTTCAAGGTAA-1 contig 2 = GCTCTGCTTC...
umi CTTGTCATAT = 290 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=521]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-521 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=656]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
445-656 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQSYDSSLSGKGVF at 375, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2013 = GTATTCTTCACAATGC-1

using 22 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2014 = GTATTCTTCACCACCT-1

using 612 reads

====================================================================================

graph has 284 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[3, 4, 6^4, 278, 300]
surviving nonsolo ucounts = 3[6, 278, 300]
ids = [8, 0, 1]

====================================================================================

UMI info for barcode GTATTCTTCACCACCT-1 contig 1 = GGCTTTCTGA...
umi AGCTGAGGAT = 265 reads: +460 validated

UMI info for barcode GTATTCTTCACCACCT-1 contig 2 = GGGGAGTCTC...
umi ATCGCATACA = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
424-475 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
475-518 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARGHFYFASGSRIPGGVWFDPW at 375, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 15, 36, 80, 166
confident = false

TIG 2[bases=548]
24-375 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=13)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQSYRRPITF at 351, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 24, 30, 86, 99, 235, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2019 = GTATTCTTCAGCGATT-1

using 707 reads

====================================================================================

graph has 270 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[2, 3^2, 101, 291, 305]
surviving nonsolo ucounts = 3[101, 291, 305]
ids = [2, 0, 3]

====================================================================================

UMI info for barcode GTATTCTTCAGCGATT-1 contig 1 = CTATCCACTT...
umi ACCGTGACCA = 98 reads: +448 validated

UMI info for barcode GTATTCTTCAGCGATT-1 contig 2 = GAGTCAGACC...
umi AAAGCCACAA = 279 reads: +394 validated

UMI info for barcode GTATTCTTCAGCGATT-1 contig 3 = ATCACATAAC...
umi AGGAAAGGGC = 305 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=534]
0-41 ==> 38-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
41-394 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=25)
445-489 ==> 19-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
489-534 ==> 0-45 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CARVGPIVVEPSAEPFYNYHAMDVW at 383, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 41, 197, 344, 446
confident = false

TIG 2[bases=500]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
380-419 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
419-500 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNSYSPRYTF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 25, 31, 87, 100, 332, 461
confident = false

TIG 3[bases=550]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=7)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CAGAGSSPDGRLFDYW at 400, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 58, 104, 209, 256, 293, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2023 = GTATTCTTCATACGGT-1

using 403 reads

====================================================================================

graph has 226 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 4, 387]
surviving nonsolo ucounts = 1[387]
ids = [0]

====================================================================================

UMI info for barcode GTATTCTTCATACGGT-1 contig 1 = ACCCAAAAAC...
umi AAAGGACGAG = 373 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=576]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-576 ==> 0-86 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 367
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2024 = GTATTCTTCATATCGG-1

using 62 reads

====================================================================================

graph has 62 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 7[2, 4, 6, 9, 10, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2025 = GTATTCTTCATCGGAT-1

using 337 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 8[2^2, 5^3, 6, 10, 297]
surviving nonsolo ucounts = 1[297]
ids = [7]

====================================================================================

UMI info for barcode GTATTCTTCATCGGAT-1 contig 1 = AGCTTCAGCT...
umi GTATCCTTCA = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-574 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2030 = GTATTCTTCCCAGGTG-1

using 530 reads

====================================================================================

graph has 248 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 12[2, 3^2, 4^2, 5^2, 6^2, 9, 10, 465]
surviving nonsolo ucounts = 1[465]
ids = [15]

====================================================================================

REJECT CONTIGS

TIG 1[bases=495]
0-322 ==> 29-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
321-359 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
359-495 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 298, score = 9 + 8
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 441
start codons at 46, 182, 401
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2032 = GTATTCTTCCGCAGTG-1

using 34 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 5, 20]
surviving nonsolo ucounts = 3[2^2, 5]
ids = [3, 5, 4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2037 = GTATTCTTCCTGTACC-1

using 163 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[162]
surviving nonsolo ucounts = 1[162]
ids = [1]

====================================================================================

UMI info for barcode GTATTCTTCCTGTACC-1 contig 1 = GGACTCCAAG...
umi TTTGCTTCTC = 145 reads: +417 -1 +3 non-validated

GOOD CONTIGS

TIG 1[bases=495]
0-53 ==> 26-79 on |158|IGHV3-7|5'UTR| [len=79] (mis=0)
53-406 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=12)
441-474 ==> 13-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
474-495 ==> 0-21 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARGGARGDYGRFGTG at 395, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 53, 209, 270, 288, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2043 = GTATTCTTCGGAGCAA-1

using 253 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 1[247]
ids = [1]

====================================================================================

UMI info for barcode GTATTCTTCGGAGCAA-1 contig 1 = AGCTCTGAGA...
umi ATCTGATCGC = 239 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=554]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-554 ==> 0-51 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2049 = GTATTCTTCTACCTGC-1

using 62 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 5[2^3, 3, 39]
surviving nonsolo ucounts = 1[39]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2055 = GTATTCTTCTGCGGCA-1

using 326 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 4, 6, 311]
surviving nonsolo ucounts = 1[311]
ids = [1]

====================================================================================

UMI info for barcode GTATTCTTCTGCGGCA-1 contig 1 = GAGTCAGACC...
umi ACAGGCAATT = 288 reads: +388 validated
umi GCCCATGGCG = 3 reads: -68 +4 -1 +4 -1 +2 -2 +7 -1X +3 -1X +4 -1 +23 -1 +1 -26X +2 -1X +2 -8X +1 -1X +1 -1X +35 -1X +2 -183 invalidated

GOOD CONTIGS

TIG 1[bases=490]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-490 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYKAYSWTF at 352, score = 8 + 8
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2057 = GTATTCTTCTGGGCCA-1

using 7532 reads

====================================================================================

graph has 4879 edges initially, 94 edges after simplification

total ucounts = 948
nonsolo ucounts = 486[2^158, 3^90, 4^54, 5^47, 6^23, 7^22, 8^19, 9^16, 10^11, 11^11, 12, 13^3, 14^3, 15, 16^2, 17^3, 19, 20, 27, 63, 69, 105, 117, 119, 231, 238, 245, 263, 283, 311, 318, 320, 330, 348, 379, 382, 407, 429]
surviving nonsolo ucounts = 16[117, 119, 231, 238, 245, 263, 283, 311, 318, 320, 330, 348, 379, 382, 407, 429]
ids = [419, 632, 45, 303, 34, 83, 575, 788, 707, 296, ...]

====================================================================================

UMI info for barcode GTATTCTTCTGGGCCA-1 contig 1 = ACTTTCTGAG...
umi AATACGGGGG = 231 reads: +433 validated
umi ACAGTCGTGC = 6 reads: -371X +1 -6XX +2 -2XX +1 -2XX +2 -1XX +1 -2XX +5 -1XX +1 -1XX +34 invalidated
umi CAGAGTGAGC = 272 reads: +433 validated
umi CGGTACCGCC = 118 reads: +433 validated
umi GAGTTGTTCG = 292 reads: +433 validated
umi GCATTGGGGG = 286 reads: +433 validated
umi GCTCGGTGTA = 376 reads: +433 validated

UMI info for barcode GTATTCTTCTGGGCCA-1 contig 2 = AGAGCTCTGG...
umi AAGCACGGTT = 248 reads: +385 validated
umi ATTTAACTCC = 410 reads: +385 validated
umi CATCAAAGTC = 321 reads: +385 validated
umi CTCAATAGCT = 432 reads: +385 validated
umi GGTCATTTGA = 119 reads: +385 validated
umi TACAAGTCCT = 323 reads: +385 validated
umi TCGACTTGGC = 313 reads: +385 validated
umi TGGCCATCCT = 383 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=570]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=3)
388-419 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=7)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
468-570 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 6 umis using 164 reads
cdr3 = CARRALCSGGSCYWSPFDYW at 377, score = 9 + 7
umis assigned: [45, 83, 287, 419, 550, 575, 604]
of which 7 are surviving nonsolos
reads assigned: 1555
start codons at 14, 35, 79, 486, 547
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 347 reads
cdr3 = CQQYGSSPGTF at 368, score = 9 + 8
umis assigned: [34, 247, 296, 453, 632, 707, 788, 857]
of which 8 are surviving nonsolos
reads assigned: 2503
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

GTGTATTACTGTGCGCGACGGGCCCTTTGTAGTGGTGGTAGCTGCTACTGGAGCCCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCCCCGGGCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2058 = GTATTCTTCTGTCAAG-1

using 47 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 5, 34]
surviving nonsolo ucounts = 1[34]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2070 = GTCAAGTAGCAGGCTA-1

using 787 reads

====================================================================================

graph has 910 edges initially, 14 edges after simplification

total ucounts = 353
nonsolo ucounts = 111[2^62, 3^28, 4^6, 5^4, 6^3, 7^4, 9, 23, 95, 120]
surviving nonsolo ucounts = 2[95, 120]
ids = [140, 121]

====================================================================================

UMI info for barcode GTCAAGTAGCAGGCTA-1 contig 1 = AGGAGTCAGA...
umi CCGCTAACAT = 85 reads: +382 validated

UMI info for barcode GTCAAGTAGCAGGCTA-1 contig 2 = TAACAACCAC...
umi CATTCAAGGT = 115 reads: +427 validated
umi TCGTACCTCA = 4 reads: -2X +1 -4X +1 -2 +12 -1 +39 -1X +11 -1X +8 -179 +8 -1X +9 -2X +1 -2X +23 -1X +8 -110X invalidated

GOOD CONTIGS

TIG 1[bases=483]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-483 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYYSYTWTF at 354, score = 9 + 8
umis assigned: [140]
of which 1 are surviving nonsolos
reads assigned: 85
start codons at 33, 89, 102, 238, 457
confident = false

TIG 2[bases=605]
0-52 ==> 6-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
52-199 ==> 0-147 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=4)
205-266 ==> 147-208 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=4)
266-399 ==> 220-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=17)
437-479 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
479-605 ==> 0-126 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 14 reads
cdr3 = CATIDCRTTECHYYFDLDVW at 388, score = 9 + 7
umis assigned: [121, 291]
of which 1 are surviving nonsolos
reads assigned: 118
start codons at 52, 256, 343
confident = false
see insertion of TTCACG at pos 147 on |88|IGHV1-69D|L-REGION+V-REGION|
see deletion of 12 bases at pos 208 on |88|IGHV1-69D|L-REGION+V-REGION|
funny annotation
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2074 = GTCAAGTAGCTCAACT-1

using 140 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[139]
surviving nonsolo ucounts = 1[139]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTAGCTCAACT-1 contig 1 = GGACACAGCA...
umi GTCGCGCTTT = 125 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
9-360 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
360-397 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
397-456 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYNSYALSF at 336, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 9, 15, 71, 84, 220, 223, 316, 355, 439
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2080 = GTCAAGTAGGGATACC-1

using 327 reads

====================================================================================

graph has 118 edges initially, 10 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[40, 73, 213]
surviving nonsolo ucounts = 3[40, 73, 213]
ids = [2, 0, 3]

====================================================================================

UMI info for barcode GTCAAGTAGGGATACC-1 contig 1 = GGAGGAACTG...
umi TTTCGGCGTA = 213 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
381-419 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQQYNNWPPVTF at 355, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 34, 103, 239, 461
confident = false

REJECT CONTIGS

TIG 1[bases=497]
0-324 ==> 27-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
323-361 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
361-497 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 300, score = 9 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 110
start codons at 48, 184, 403
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2087 = GTCAAGTCAACAACCT-1

using 185 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[182]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2100 = GTCAAGTCACGTGAGA-1

using 1052 reads

====================================================================================

graph has 1362 edges initially, 12 edges after simplification

total ucounts = 458
nonsolo ucounts = 213[2^82, 3^49, 4^32, 5^19, 6^8, 7^5, 8^5, 9^3, 10^3, 11, 12^2, 13, 14^2, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2104 = GTCAAGTCAGCAGTTT-1

using 286 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTCAGCAGTTT-1 contig 1 = GGGGATCAGT...
umi AACTATCTCA = 262 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=494]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=2)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-494 ==> 0-79 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2107 = GTCAAGTCAGCGTAAG-1

using 221 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 4, 6, 209]
surviving nonsolo ucounts = 1[209]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTCAGCGTAAG-1 contig 1 = GAGTGCTTTC...
umi ATGCATTGAC = 197 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=567]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
454-567 ==> 0-113 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CARYFAFVNYYFDKW at 378, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 18, 39, 83
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2112 = GTCAAGTCATCCGTGG-1

using 300 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^3, 10, 280]
surviving nonsolo ucounts = 1[280]
ids = [7]

====================================================================================

UMI info for barcode GTCAAGTCATCCGTGG-1 contig 1 = ATCAGTCCCA...
umi TATGTGCTTC = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-456 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 23, 29, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2115 = GTCAAGTCATTAGGCT-1

using 283 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 6, 269]
surviving nonsolo ucounts = 1[269]
ids = [4]

====================================================================================

UMI info for barcode GTCAAGTCATTAGGCT-1 contig 1 = GGAATCAGTC...
umi CCTTGCTCGT = 246 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=456]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-456 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 26, 32, 101, 237
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2124 = GTCAAGTGTAGGCTGA-1

using 131 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[126]
surviving nonsolo ucounts = 1[126]
ids = [3]

====================================================================================

UMI info for barcode GTCAAGTGTAGGCTGA-1 contig 1 = GGGGAGGAGT...
umi CTGCCAATAG = 113 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=463]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
419-463 ==> 0-44 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYDNLPLTF at 358, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 111
start codons at 31, 37, 93, 106, 245, 368
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2125 = GTCAAGTGTATAAACG-1

using 59 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^2, 3, 8, 9, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2129 = GTCAAGTGTCTAACGT-1

using 1779 reads

====================================================================================

graph has 2782 edges initially, 8 edges after simplification

total ucounts = 805
nonsolo ucounts = 402[2^174, 3^75, 4^68, 5^38, 6^19, 7^13, 8^7, 9^6, 10, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2130 = GTCAAGTGTCTCACCT-1

using 175 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[174]
surviving nonsolo ucounts = 1[174]
ids = [1]

====================================================================================

UMI info for barcode GTCAAGTGTCTCACCT-1 contig 1 = GGGGTCACAA...
umi TTGCCTGTTT = 170 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-502 ==> 0-79 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CFSYGTSGRTF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2133 = GTCAAGTGTGGCTCCA-1

using 389 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[387]
surviving nonsolo ucounts = 1[387]
ids = [1]

====================================================================================

UMI info for barcode GTCAAGTGTGGCTCCA-1 contig 1 = AGTCAGTCCC...
umi CACGCAGGCT = 393 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 7-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
24-375 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
373-412 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CHQYESVPYTF at 351, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 385
start codons at 24, 30, 86, 99, 238, 334, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2139 = GTCAAGTGTTAAGTAG-1

using 379 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[372]
surviving nonsolo ucounts = 1[372]
ids = [7]

====================================================================================

UMI info for barcode GTCAAGTGTTAAGTAG-1 contig 1 = GGGGAGGAAT...
umi TCCGACTGTG = 375 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 370
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2142 = GTCAAGTGTTCCCTTG-1

using 319 reads

====================================================================================

graph has 97 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[318]
surviving nonsolo ucounts = 1[318]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi CATAGGAACG = 315 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2144 = GTCAAGTGTTGTCGCG-1

using 461 reads

====================================================================================

graph has 328 edges initially, 8 edges after simplification

total ucounts = 96
nonsolo ucounts = 29[2^16, 3^3, 4^2, 5^4, 6, 9, 11, 299]
surviving nonsolo ucounts = 1[299]
ids = [12]

====================================================================================

UMI info for barcode GTCAAGTGTTGTCGCG-1 contig 1 = GGGAGTCTCA...
umi AGAATCTCGT = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPPTF at 350, score = 9 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2145 = GTCAAGTTCAAACCGT-1

using 370 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 364]
surviving nonsolo ucounts = 1[364]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTTCAAACCGT-1 contig 1 = GTCAGTCCCA...
umi ATCTCCACTC = 333 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-497 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYDNLPRTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2147 = GTCAAGTTCAACCATG-1

using 613 reads

====================================================================================

graph has 184 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 5, 6, 272, 322]
surviving nonsolo ucounts = 2[272, 322]
ids = [9, 4]

====================================================================================

UMI info for barcode GTCAAGTTCAACCATG-1 contig 1 = GATCAGGACT...
umi GAGGGTGTTC = 311 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=515]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-515 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false

REJECT CONTIGS

TIG 1[bases=475]
1-352 ==> 0-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=0)
353-390 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
390-475 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 1, 7, 63, 76, 215, 432
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2149 = GTCAAGTTCACATACG-1

using 439 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[439]
surviving nonsolo ucounts = 1[439]
ids = [0]

====================================================================================

UMI info for barcode GTCAAGTTCACATACG-1 contig 1 = AGTGACTCCT...
umi CAATTTGTAT = 432 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=585]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-585 ==> 0-132 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 56 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 426
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2150 = GTCAAGTTCACATAGC-1

using 62 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[59]
surviving nonsolo ucounts = 1[59]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2162 = GTCAAGTTCCTTTCTC-1

using 1985 reads

====================================================================================

graph has 2797 edges initially, 10 edges after simplification

total ucounts = 921
nonsolo ucounts = 438[2^174, 3^97, 4^87, 5^31, 6^22, 7^11, 8^9, 9^3, 10, 11, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2167 = GTCAAGTTCGGACAAG-1

using 6022 reads

====================================================================================

graph has 2528 edges initially, 38 edges after simplification

total ucounts = 411
nonsolo ucounts = 194[2^61, 3^50, 4^20, 5^13, 6^11, 7^12, 8^3, 9^2, 10, 12, 13^3, 199, 200, 204, 232, 252, 254, 269, 286, 316, 335, 338, 346, 349, 369, 372, 378, 436]
surviving nonsolo ucounts = 16[200, 204, 232, 252, 254, 269, 286, 316, 335, 338, 346, 349, 369, 372, 378, 436]
ids = [27, 261, 115, 340, 13, 234, 277, 8, 248, 61, ...]

====================================================================================

UMI info for barcode GTCAAGTTCGGACAAG-1 contig 1 = GGAGTCAGTC...
umi AAGCATTCGT = 255 reads: +388 validated
umi AATCTTGGCA = 198 reads: +388 validated
umi AGCATACCGG = 338 reads: +388 validated
umi CGAGCTCCTA = 350 reads: +388 validated
umi CTTCCTTCCT = 369 reads: +388 validated
umi GATGTAGGTC = 270 reads: +388 validated
umi GCATGTATAC = 336 reads: +388 validated
umi GCGTACATGT = 376 reads: +102 -1XX +5 -4XX +2 -1XX +1 -5XX +1 -1XX +1 -1XX +2 -8X +1 -252X invalidated
umi GGAACAACTC = 205 reads: +388 validated
umi GTCAACACTG = 286 reads: +388 validated
umi TATCGCCCAC = 396 reads: +156 -2XX +230 invalidated
umi TCCTCCCTCA = 436 reads: +388 validated
umi TCCTTTTCGT = 251 reads: +388 validated
umi TCGCCAATCA = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=17)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 13 umis using 683 reads
cdr3 = CQQISRYPSTF at 353, score = 10 + 8
umis assigned: [13, 27, 61, 171, 212, 234, 248, 255, 261, 277] and 4 others
of which 14 are surviving nonsolos
reads assigned: 4320
start codons at 26, 32, 88, 456
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2173 = GTCAAGTTCTACCTGC-1

using 426 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[422]
surviving nonsolo ucounts = 1[422]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=456]
1-82 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
25-163 ==> 0-138 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
163-285 ==> 231-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=7)
282-320 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
320-456 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSFNSPRTF at 259, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 416
start codons at 25, 31, 87, 100, 311, 362
confident = false
not full
full length transcript of length 456
VJ delta = 109
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2176 = GTCAAGTTCTCGCTTG-1

using 2969 reads

====================================================================================

graph has 4180 edges initially, 44 edges after simplification

total ucounts = 1463
nonsolo ucounts = 613[2^270, 3^140, 4^84, 5^50, 6^24, 7^12, 8^11, 9^4, 10^4, 11^8, 12, 13, 15, 17^2, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2180 = GTCAAGTTCTGTCAAG-1

using 56 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[3^3, 4^2, 5, 7, 11, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2183 = GTCAAGTTCTTCCTTC-1

using 2132 reads

====================================================================================

graph has 2710 edges initially, 12 edges after simplification

total ucounts = 770
nonsolo ucounts = 380[2^132, 3^92, 4^65, 5^34, 6^19, 7^17, 8^6, 9^5, 11, 12^4, 13, 14, 21, 45, 293]
surviving nonsolo ucounts = 1[293]
ids = [163]

====================================================================================

UMI info for barcode GTCAAGTTCTTCCTTC-1 contig 1 = AGTGCTTTCT...
umi ATCGACGGCA = 276 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=522]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
420-468 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
468-522 ==> 0-54 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 377, score = 9 + 7
umis assigned: [163]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 17, 38, 82, 168, 255
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2187 = GTCACAAAGAATAGGG-1

using 233 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[3^2, 225]
surviving nonsolo ucounts = 1[225]
ids = [1]

====================================================================================

UMI info for barcode GTCACAAAGAATAGGG-1 contig 1 = GAGGAATCAG...
umi CTATCGTGGG = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2188 = GTCACAAAGACCGGAT-1

using 435 reads

====================================================================================

graph has 194 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 7, 418]
surviving nonsolo ucounts = 1[418]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2190 = GTCACAAAGAGCTGCA-1

using 8165 reads

====================================================================================

graph has 3704 edges initially, 64 edges after simplification

total ucounts = 407
nonsolo ucounts = 209[2^71, 3^38, 4^24, 5^16, 6^9, 7^5, 8^6, 9^2, 10, 11^2, 13, 14, 17^2, 18, 37, 39^2, 48, 58, 65, 82, 142, 151, 190, 194^2, 240, 253, 257, 268, 280, 294, 295, 300, 316, 318, 338, 360, 369, 370, 383, 388, 497, 503]
surviving nonsolo ucounts = 28[39, 48, 58, 65, 82, 142, 151, 190, 194^2, 240, 253, 257, 268, 280, 294, 295, 300, 316, 318, 338, 360, 369, 370, 383, 388, 497, 503]
ids = [71, 144, 41, 317, 52, 395, 46, 66, 15, 99, ...]

====================================================================================

UMI info for barcode GTCACAAAGAGCTGCA-1 contig 1 = ATTCGGTGAT...
umi AACGTTCCAG = 177 reads: +436 validated
umi AAGGCTCGTA = 363 reads: -138X +298 invalidated
umi ACCATAGCGG = 36 reads: -155 +281 non-validated
umi ATTAGACCAC = 195 reads: +436 validated
umi CCCAAGTGTA = 41 reads: +358 -78 non-validated
umi TTGGTTACAC = 27 reads: +8 -1XX +2 -1XX +9 -1X +7 -2XX +1 -1XX +3 -1X +6 -1X +13 -1X +1 -1XX +27 -1XX +4 -1XX +8 -1XX +23 -1XX +7 -1XX +9 -7X +2 -1 +1 -2X +2 -59X +2 -1X +1 -2X +1 -1XX +1 -2XX +1 -1XX +1 -2XX +6 -1XX +5 -1XX +32 -2XX +8 -1XX +1 -1XX +20 -1XX +20 -2XX +13 -1X +2 -86 invalidated
umi TTTCGCTCGT = 127 reads: +436 validated

UMI info for barcode GTCACAAAGAGCTGCA-1 contig 2 = GGGGAGGAAC...
umi AATCCCTGCC = 282 reads: +385 validated
umi ACCACCACGC = 384 reads: +385 validated
umi ACGACCGTTA = 151 reads: +385 validated
umi ACGTGAGGGC = 392 reads: +385 validated
umi AGTCTGGAAA = 192 reads: +385 validated
umi ATAGAGTTCG = 339 reads: +385 validated
umi CAAGTCATTT = 295 reads: +385 validated
umi CATAATGGTC = 303 reads: -255X +130 invalidated
umi CCAAAACGTC = 7 reads: -351X +2 -1XX +2 -1XX +11 -5XX +4 -1XX +2 -1XX +4 invalidated
umi CTACATGAGG = 259 reads: +385 validated
umi GACATTTTCT = 366 reads: +385 validated
umi GCCAATCCAA = 318 reads: +385 validated
umi TAGTACATAA = 498 reads: +385 validated
umi TCCGACATCC = 297 reads: +385 validated
umi TCCTCCTGTC = 68 reads: +23 -2 +303 -4X +5 -2 +2 -1 +1 -1X +7 -1 +1 -1 +6 -1 +24 invalidated
umi TGCCTTTCAT = 252 reads: +385 validated
umi TGCTGACCGG = 502 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 45-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
35-386 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
394-425 ==> 0-31 on |20|IGHD3-22|D-REGION| [len=31] (mis=4)
420-471 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=2)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 103 reads
cdr3 = CAKDPPNYYDSSGYSNWFDPW at 377, score = 9 + 7
umis assigned: [15, 20, 41, 99, 144, 381, 395]
of which 6 are surviving nonsolos
reads assigned: 954
start codons at 35, 186, 191, 249, 252, 270, 338, 402
confident = true

TIG 2[bases=557]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 15 umis using 790 reads
cdr3 = CQQYNNWPPFTF at 357, score = 9 + 8
umis assigned: [24, 40, 46, 49, 66, 78, 111, 128, 137, 194] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4826
start codons at 36, 105, 241, 463
confident = true

REJECT CONTIGS

TIG 1[bases=736]
3-52 ==> 8180-8229 on rc of segment before IGHV2-70D exon 2 [len=8453] (mis=6)
35-61 ==> 6617-6643 on rc of segment before IGHV3-13 exon 2 [len=6830] (mis=1)
86-222 ==> 8264-8400 on rc of segment before IGHV2-70D exon 2 [len=8453] (mis=6)
275-628 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=3)
634-736 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [52, 71, 241, 302, 342]
of which 5 are surviving nonsolos
reads assigned: 878
start codons at 83, 90, 154, 160, 275, 426, 473, 478, 482, 510, 539, 572, 652, 713
confident = false
did not find CDR3
now this is a cell
paired!

TATTACTGTGCGAAAGATCCCCCGAATTACTATGATAGTAGTGGTTATTCTAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCTTTCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2196 = GTCACAAAGCCCAATT-1

using 20 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 15]
surviving nonsolo ucounts = 1[15]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2209 = GTCACAAAGGTAAACT-1

using 21701 reads

====================================================================================

graph has 10153 edges initially, 128 edges after simplification

total ucounts = 1177
nonsolo ucounts = 846[2^155, 3^101, 4^87, 5^73, 6^52, 7^44, 8^51, 9^39, 10^27, 11^27, 12^31, 13^22, 14^15, 15^12, 16^10, 17^10, 18^7, 19^6, 20^5, 21, 23^3, 31, 35, 48, 82, 87, 106, 107, 111, 135, 150^2, 151, 152, 154, 168^2, 173, 174, 179, 192, 195, 201, 209, 211^2, 213, 214, 221, 231, 234, 239, 243, 251^2, 256, 258, 259, 262, 265, 266^2, 267, 274, 276, 277, 282, 283, 287, 288^2, 293, 295, 296, 297, 298, 303, 305^2, 309, 311, 315, 332, 343, 357, 367, 384, 474, 675]
surviving nonsolo ucounts = 64[82, 106, 107, 111, 135, 150^2, 151, 152, 154, 168^2, 173, 174, 179, 192, 195, 201, 209, 211^2, 213, 214, 221, 231, 234, 239, 243, 251^2, 256, 258, 259, 262, 265, 266^2, 267, 274, 276, 277, 282, 283, 287, 288^2, 293, 295, 296, 297, 298, 303, 305^2, 309, 311, 315, 332, 343, 357, 367, 384, 474, 675]
ids = [17, 307, 350, 84, 405, 204, 516, 789, 23, 477, ...]

====================================================================================

UMI info for barcode GTCACAAAGGTAAACT-1 contig 1 = TGGGGCTCCA...
umi ACAAATCTTC = 227 reads: +388 validated
umi ACACACCGAA = 256 reads: +388 validated
umi ACCAACCTGT = 115 reads: +388 validated
umi ACCTGACCAA = 201 reads: +388 validated
umi ACTCCTCAGC = 267 reads: +388 validated
umi AGAGCTGCGT = 269 reads: +388 validated
umi ATTCATTTCC = 273 reads: +388 validated
umi ATTCTTCCTT = 177 reads: +388 validated
umi CACGAGCGTC = 170 reads: +388 validated
umi CACGTGGCTG = 243 reads: +388 validated
umi CATTTATCCT = 198 reads: +388 validated
umi CCCCACGATC = 285 reads: +388 validated
umi CGATTTATGT = 150 reads: +388 validated
umi CGCTCGCATT = 3 reads: -388 non-validated
umi CGTCCTACGT = 149 reads: +388 validated
umi CGTGCCTTCG = 671 reads: -190X +198 invalidated
umi CTGCATCACG = 268 reads: +388 validated
umi GACTTTCCCA = 257 reads: +388 validated
umi GCAGAACGCA = 216 reads: +388 validated
umi GGACACCTTC = 267 reads: +388 validated
umi GGTAACTCTT = 300 reads: +388 validated
umi GTATCGTTGC = 150 reads: +388 validated
umi GTCCTGCAAC = 243 reads: +388 validated
umi GTGATATTAC = 333 reads: +388 validated
umi GTTAGCACCG = 314 reads: +388 validated
umi TAAAAACCCT = 221 reads: +388 validated
umi TAAGCCGGTT = 211 reads: +388 validated
umi TATCCTAGTA = 128 reads: +31 -5X +1 -1XX +4 -1XX +345 invalidated
umi TATTGCATCC = 230 reads: +388 validated
umi TCATTTCGCG = 305 reads: +388 validated
umi TCTGATCTTT = 117 reads: +37 -1XX +4 -1XX +345 invalidated
umi TGCCAAAGCG = 210 reads: +388 validated
umi TGTCACGACA = 133 reads: +15 -3X +3 -5XX +3 -7XX +1 -1XX +4 -1XX +310 -1 +3 -1 +30 invalidated
umi TTACGCCTTT = 253 reads: +388 validated
umi TTCCATAGCA = 281 reads: +388 validated
umi TTCGCGGAGT = 251 reads: +388 validated
umi TTGTCGCGCC = 316 reads: +327 -1XX +60 invalidated
umi TTTGTACCAT = 306 reads: +388 validated

UMI info for barcode GTCACAAAGGTAAACT-1 contig 2 = GAGCTCTGGG...
umi AAAGTCGGCG = 264 reads: +406 validated
umi AACCCGGGCG = 143 reads: -406 non-validated
umi AAGCGGCCGG = 468 reads: -153X +253 invalidated
umi ATCTTACAGC = 149 reads: +401 -5 non-validated
umi CACTCTATCC = 104 reads: +406 validated
umi CCCCACTTCT = 133 reads: +406 validated
umi CCCTTTGCGT = 289 reads: +406 validated
umi CGTGTATGTC = 296 reads: +406 validated
umi CTCAGCAAGC = 209 reads: +406 validated
umi CTGCGCTAGG = 190 reads: +406 validated
umi GCAGTGACGG = 295 reads: +406 validated
umi TCAAATAGGC = 214 reads: +406 validated
umi TCAAATCCAT = 386 reads: +165 -3XX +1 -9XX +1 -1XX +1 -37XX +1 -7XX +1 -13XX +166 invalidated
umi TCCACACAAT = 282 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=20)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 35 umis using 1430 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [64, 71, 84, 103, 133, 152, 245, 254, 298, 303] and 28 others
of which 38 are surviving nonsolos
reads assigned: 8818
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=23)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 12 umis using 272 reads
cdr3 = CVKEEDAFDIW at 422, score = 8 + 8
umis assigned: [11, 23, 37, 204, 307, 405, 422, 523, 541, 576] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3323
start codons at 80, 231, 236, 297, 315, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=571]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 356, score = 4 + 8
umis assigned: [15, 17, 88, 110, 385, 499, 556, 636, 725, 836]
of which 10 are surviving nonsolos
reads assigned: 2769
start codons at 36, 69, 105, 193, 355, 375, 477
confident = false
not full
frameshifted full length transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AGCGGCCTGAGAGCTGAGGACACGCCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGGTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2216 = GTCACAAAGTCATCCA-1

using 210 reads

====================================================================================

graph has 136 edges initially, 18 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 64, 140]
surviving nonsolo ucounts = 2[64, 140]
ids = [2, 6]

====================================================================================

REJECT CONTIGS

TIG 1[bases=489]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
0-54 ==> 11310-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=0)
40-72 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
413-440 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=1)
447-489 ==> 0-42 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
cdr3 = CAREWGYYDILTGYSGGPPDYW at 396, score = 8 + 7
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 150
start codons at 54, 205, 252, 257, 274, 289, 318, 351
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2217 = GTCACAAAGTCCCACG-1

using 250 reads

====================================================================================

graph has 218 edges initially, 4 edges after simplification

total ucounts = 29
nonsolo ucounts = 20[2^5, 3^2, 4^2, 5^2, 6, 7^2, 9^2, 13, 16, 19, 121]
surviving nonsolo ucounts = 1[121]
ids = [12]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2218 = GTCACAAAGTGAAGTT-1

using 307 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 5, 6, 8, 9, 272]
surviving nonsolo ucounts = 1[272]
ids = [1]

====================================================================================

UMI info for barcode GTCACAAAGTGAAGTT-1 contig 1 = GAAGAGCTGC...
umi ACCATCAGAG = 272 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 33, 241, 244, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2222 = GTCACAAAGTGGGCTA-1

using 277 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [3]

====================================================================================

UMI info for barcode GTCACAAAGTGGGCTA-1 contig 1 = ATGGCCTGGT...
umi TGAGCAGCGT = 259 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=541]
0-356 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
356-394 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
394-541 ==> 0-147 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQSYDSSLSGLYVF at 324, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 253
start codons at 0, 154, 157, 208, 307, 334, 358, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2237 = GTCACAACACCGAATT-1

using 7121 reads

====================================================================================

graph has 4078 edges initially, 38 edges after simplification

total ucounts = 623
nonsolo ucounts = 310[2^104, 3^76, 4^34, 5^34, 6^11, 7^13, 8^3, 9^4, 10, 11, 12, 15, 19, 26, 31, 116, 123, 138, 144, 152, 168, 175, 176, 200, 214, 218, 228, 262, 269, 271, 283, 300^2, 307, 318, 324, 326, 341, 372]
surviving nonsolo ucounts = 24[31, 116, 123, 138, 152, 168, 175, 176, 200, 214, 218, 228, 262, 269, 271, 283, 300^2, 307, 318, 324, 326, 341, 372]
ids = [283, 202, 365, 342, 472, 416, 437, 23, 121, 215, ...]

====================================================================================

UMI info for barcode GTCACAACACCGAATT-1 contig 1 = GATCAGGACT...
umi CCTCTCGGAT = 261 reads: +400 validated
umi CTGCATCTGA = 270 reads: +400 validated
umi GCCGGTAGTA = 271 reads: +400 validated
umi GTAATTCTCA = 147 reads: +400 validated
umi TCCACATGTG = 304 reads: +400 validated
umi TGTCTGCAGC = 296 reads: +400 validated

UMI info for barcode GTCACAACACCGAATT-1 contig 2 = AGCTCTGAGA...
umi ATATGTCTGG = 194 reads: -386 +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi CATGGATCTA = 119 reads: +356 -2 +63 non-validated
umi CCCAGACCGC = 315 reads: +421 validated
umi CTAGATTCCT = 31 reads: -16 +36 -1 +24 -1 +283 -6 +54 non-validated
umi GACGTCCGCC = 136 reads: +421 validated
umi GCATTATCTT = 124 reads: +421 validated
umi GCGCCTTGGG = 230 reads: +401 -1X +19 invalidated
umi GCTTACTCGC = 328 reads: +421 validated
umi GGAGTCATCA = 301 reads: +421 validated
umi GTTCTGGGCG = 173 reads: +421 validated
umi TAGTATGGTG = 328 reads: +421 validated
umi TATAAACCTT = 145 reads: +352 -32 +37 non-validated
umi TGCATGACAC = 343 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 207 reads
cdr3 = CMQALQTPLLTF at 366, score = 9 + 9
umis assigned: [249, 306, 373, 416, 507, 562]
of which 6 are surviving nonsolos
reads assigned: 1521
start codons at 30, 63, 99, 187, 349, 369, 472
confident = true

TIG 2[bases=571]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=3)
432-456 ==> 0-24 on |19|IGHD3-16|D-REGION| [len=37] (mis=3)
452-500 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
500-571 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 9 umis using 172 reads
cdr3 = CAKRPYDYVWGSLDYW at 421, score = 9 + 7
umis assigned: [121, 202, 222, 283, 342, 365, 378, 392, 397, 437] and 3 others
of which 13 are surviving nonsolos
reads assigned: 2704
start codons at 79, 230, 235, 382, 437
confident = true

REJECT CONTIGS

TIG 1[bases=656]
0-37 ==> 0-37 on |391|IGLV9-49|5'UTR| [len=37] (mis=0)
37-406 ==> 0-369 on |392|IGLV9-49|L-REGION+V-REGION| [len=369] (mis=0)
407-445 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
445-656 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [23, 57, 160, 215, 300]
of which 5 are surviving nonsolos
reads assigned: 1238
start codons at 37, 235, 275, 353, 383
confident = false
did not find CDR3
now this is a cell
paired!

GAGGACACGGCCGTATATTACTGTGCGAAACGGCCATATGATTACGTTTGGGGGAGCCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCTGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2238 = GTCACAACACGCATCG-1

using 212 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 205]
surviving nonsolo ucounts = 1[205]
ids = [2]

====================================================================================

UMI info for barcode GTCACAACACGCATCG-1 contig 1 = GAGAGAGGAG...
umi ATAGACTTGA = 200 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=580]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-580 ==> 0-83 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2245 = GTCACAACAGATAATG-1

using 1075 reads

====================================================================================

graph has 360 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[469, 604]
surviving nonsolo ucounts = 2[469, 604]
ids = [0, 2]

====================================================================================

UMI info for barcode GTCACAACAGATAATG-1 contig 1 = CATGGCCTGG...
umi CGGGTTATTC = 455 reads: +382 validated

UMI info for barcode GTCACAACAGATAATG-1 contig 2 = TGGGGAGTCA...
umi CTTTGAGTTC = 604 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=500]
1-348 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=1)
345-383 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
383-500 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 83 reads
cdr3 = CYSTDSSGNHGVF at 316, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 448
start codons at 1, 62, 131, 149, 200, 262, 299, 344
confident = false

TIG 2[bases=550]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 97 reads
cdr3 = CQQSYSTPSF at 356, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 597
start codons at 29, 35, 91, 104, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2248 = GTCACAACAGCATGAG-1

using 123 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[123]
surviving nonsolo ucounts = 1[123]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2267 = GTCACAAGTACCATCA-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2274 = GTCACAAGTCTAGGTT-1

using 56 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 9[2^2, 3^2, 5^2, 6, 8, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2276 = GTCACAAGTGAGGGTT-1

using 290 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 9, 274]
surviving nonsolo ucounts = 1[274]
ids = [0]

====================================================================================

UMI info for barcode GTCACAAGTGAGGGTT-1 contig 1 = GGGTCAGTCC...
umi ATAGACACCG = 273 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2277 = GTCACAAGTGCAACTT-1

using 365 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3, 5, 6, 8, 335]
surviving nonsolo ucounts = 1[335]
ids = [0]

====================================================================================

UMI info for barcode GTCACAAGTGCAACTT-1 contig 1 = AGTGATCTGC...
umi AAGGGCAAGA = 340 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=514]
0-31 ==> 48-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=0)
31-381 ==> 0-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=16)
393-443 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
443-514 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CARATGSSRAFDIW at 370, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 31, 187, 331, 347, 424
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2279 = GTCACAAGTGGCTCCA-1

using 220 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[3, 208]
surviving nonsolo ucounts = 1[208]
ids = [10]

====================================================================================

UMI info for barcode GTCACAAGTGGCTCCA-1 contig 1 = AGTCCTGGTG...
umi TCGTGTTCGT = 203 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
0-45 ==> 41-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
45-398 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=4)
397-436 ==> 7-46 on |317|IGLJ7|J-REGION| [len=46] (mis=0)
436-549 ==> 0-113 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CQSYDSSNSAVF at 372, score = 6 + 7
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 45, 108, 199, 250, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2281 = GTCACAAGTTACCAGT-1

using 378 reads

====================================================================================

graph has 146 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[2^5, 10, 74, 280]
surviving nonsolo ucounts = 2[74, 280]
ids = [5, 10]

====================================================================================

UMI info for barcode GTCACAAGTTACCAGT-1 contig 1 = AGTGACTCCT...
umi CGTCCGTTAC = 68 reads: +433 validated

UMI info for barcode GTCACAAGTTACCAGT-1 contig 2 = GGAGTCAGAC...
umi TCCATGCCGC = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-370 ==> 0-350 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=23)
401-453 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
453-482 ==> 0-29 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CAGPWSSGFFATAEYFPHW at 365, score = 8 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 68
start codons at 20, 64, 243, 326
confident = false

TIG 2[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2289 = GTCACAAGTTTGTTTC-1

using 356 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 351]
surviving nonsolo ucounts = 1[351]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2290 = GTCACAATCAACGGGA-1

using 370 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3, 4, 357]
surviving nonsolo ucounts = 1[357]
ids = [0]

====================================================================================

UMI info for barcode GTCACAATCAACGGGA-1 contig 1 = AGGAATCAGT...
umi AGCAGTGGCG = 357 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |247|IGKV1D-17|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |248|IGKV1D-17|L-REGION+V-REGION| [len=351] (mis=14)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CLQHSSYPYTF at 354, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 354
start codons at 27, 33, 102, 123, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2295 = GTCACAATCAGTCAGT-1

using 477 reads

====================================================================================

graph has 208 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 4, 461]
surviving nonsolo ucounts = 1[461]
ids = [6]

====================================================================================

UMI info for barcode GTCACAATCAGTCAGT-1 contig 1 = AGCTCAGCTT...
umi GTCAATCCAA = 452 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=569]
0-51 ==> 5-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
51-402 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
439-569 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CAAWDDSLSGRVF at 372, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 445
start codons at 51, 205, 355, 380, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2296 = GTCACAATCAGTTTGG-1

using 548 reads

====================================================================================

graph has 212 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[266, 276]
surviving nonsolo ucounts = 2[266, 276]
ids = [0, 6]

====================================================================================

UMI info for barcode GTCACAATCAGTTTGG-1 contig 1 = GCTGGGGTCT...
umi GTCTTTCATT = 264 reads: +385 validated

UMI info for barcode GTCACAATCAGTTTGG-1 contig 2 = TGGGGGATCA...
umi CAAGACGCTA = 259 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=467]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-388 ==> 0-347 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-467 ==> 0-41 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYTGSSQVF at 365, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 41, 198, 242, 249
confident = false

TIG 2[bases=492]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-492 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQALQTPPITF at 371, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 252
start codons at 35, 68, 104, 192, 354, 374, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2298 = GTCACAATCCAGAGGA-1

using 15 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2300 = GTCACAATCCGCAGTG-1

using 14 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2303 = GTCACAATCCGTCAAA-1

using 251 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2^2, 3, 5, 235]
surviving nonsolo ucounts = 1[235]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2308 = GTCACAATCGGACAAG-1

using 8330 reads

====================================================================================

graph has 6263 edges initially, 98 edges after simplification

total ucounts = 1168
nonsolo ucounts = 622[2^223, 3^126, 4^93, 5^46, 6^35, 7^17, 8^13, 9^7, 10^9, 11^5, 12^12, 13, 14^2, 15^4, 19, 20, 23, 24, 25^2, 27, 37, 76, 77, 86, 94, 96, 109, 115, 166, 178, 207, 211, 212, 213, 214, 248, 254, 270, 326, 681, 694, 745]
surviving nonsolo ucounts = 21[15, 25^2, 37, 77, 86, 96, 115, 178, 207, 211, 212, 213, 214, 248, 254, 270, 326, 681, 694, 745]
ids = [1134, 399, 674, 867, 361, 512, 51, 756, 534, 797, ...]

====================================================================================

UMI info for barcode GTCACAATCGGACAAG-1 contig 1 = GCTGTGCTGT...
umi ACGTGCGTTT = 253 reads: +379 validated
umi CAGTTCTTTA = 331 reads: +379 validated
umi CATGCACGCG = 273 reads: +379 validated
umi CCTTACAGTG = 212 reads: +379 validated
umi GGTCGCCTTC = 118 reads: +379 validated
umi GTTCAAGCAG = 213 reads: +379 validated
umi TCGTGTGGGG = 212 reads: +379 validated

UMI info for barcode GTCACAATCGGACAAG-1 contig 2 = TGGGGACCCA...
umi ACACTTTAGG = 94 reads: +424 validated
umi CATCTCGGTC = 75 reads: +363 -1 +2 -1 +57 non-validated
umi CCCATCAACG = 25 reads: +407 -17 non-validated
umi CTAACGGTCC = 91 reads: +405 -15 +4 non-validated
umi CTCACTTCCC = 179 reads: +424 validated
umi GCCATCTCGG = 25 reads: +276 -1 +93 -1 +7 -1 +1 -1 +2 -41 non-validated
umi GCTGACACCT = 212 reads: +424 validated
umi GTCTTCAAGG = 205 reads: +424 validated
umi TTGTTCTGCG = 15 reads: +181 -2X +7 -18X +155 -61 invalidated

GOOD CONTIGS

TIG 1[bases=633]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=3)
384-422 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
422-633 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 7 umis using 273 reads
cdr3 = CQSTDSSGTYVF at 358, score = 8 + 8
umis assigned: [96, 350, 363, 453, 756, 804, 962]
of which 7 are surviving nonsolos
reads assigned: 1579
start codons at 43, 104, 173, 191, 386, 554
confident = true

TIG 2[bases=585]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=11)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
483-585 ==> 0-102 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 5 umis using 93 reads
cdr3 = CARNFDLVTYGDSLDMW at 401, score = 8 + 7
umis assigned: [51, 361, 399, 512, 534, 674, 706, 797, 1134]
of which 9 are surviving nonsolos
reads assigned: 908
start codons at 59, 182, 210, 257, 262, 294, 323, 356, 429, 446, 464
confident = true

REJECT CONTIGS

TIG 1[bases=314]
0-110 ==> 2535-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
149-212 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=1)
212-314 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [448, 867]
of which 2 are surviving nonsolos
reads assigned: 725
start codons at 169, 230, 291
confident = false
did not find CDR3

TIG 2[bases=406]
37-111 ==> 3076-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=7)
157-195 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
195-406 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [85, 692, 951]
of which 3 are surviving nonsolos
reads assigned: 1432
start codons at 31, 45, 53, 138
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTTTATTACTGTGCGAGAAATTTTGATTTAGTGACTTATGGAGATTCTCTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAGTCAACAGACAGCAGTGGTACTTATGTCTTCGGACCTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2310 = GTCACAATCTCGATGA-1

using 4969 reads

====================================================================================

graph has 2283 edges initially, 50 edges after simplification

total ucounts = 348
nonsolo ucounts = 163[2^62, 3^31, 4^19, 5^9, 6^14, 7^5, 9^3, 10^2, 16, 24, 144, 191, 205, 208, 243, 245^3, 261, 273, 282, 318, 326, 338, 344, 371]
surviving nonsolo ucounts = 17[24, 144, 191, 205, 208, 243, 245^3, 261, 273, 282, 318, 326, 338, 344, 371]
ids = [85, 79, 297, 315, 200, 293, 38, 62, 291, 77, ...]

====================================================================================

UMI info for barcode GTCACAATCTCGATGA-1 contig 1 = GAGTCAGTCC...
umi GTAGAATCAT = 212 reads: +17 -1XX +33 -1XX +336 invalidated

UMI info for barcode GTCACAATCTCGATGA-1 contig 2 = AGTCCCAACC...
umi CAGGAATCCT = 369 reads: +388 validated
umi CAGTTGATCT = 23 reads: +154 -1XX +43 -1XX +1 -1XX +87 -7 +47 -2XX +5 -1XX +1 -1X +4 -1X +6 -18 +2 -1X +3 -1 invalidated

UMI info for barcode GTCACAATCTCGATGA-1 contig 3 = CGAGCCCAGC...
umi AAAGACGGCC = 268 reads: +415 validated
umi ACTCCGATCA = 276 reads: +415 validated
umi AGGTTCATGG = 246 reads: +415 validated
umi ATGGGCAGTC = 325 reads: +415 validated
umi ATTCTGTACT = 251 reads: +128 -1XX +25 -2XX +55 -2XX +11 -1XX +11 -1XX +83 -1XX +29 -1XX +1 -1XX +1 -1XX +3 -9XX +3 -2XX +1 -5XX +1 -1X +1 -6X +1 -2X +2 -1X +11 -1X +10 invalidated
umi CACTGAAATC = 264 reads: +415 validated
umi CAGACAGCAT = 140 reads: +415 validated
umi CTAGCATCGT = 344 reads: +415 validated
umi CTATTTGGAC = 317 reads: +415 validated
umi GTTCTCCATA = 339 reads: +415 validated
umi TGGCATTGGG = 244 reads: +415 validated
umi TGGGATATTT = 246 reads: +415 validated
umi TGTCAAACTT = 190 reads: +415 validated
umi TTATTAATAG = 185 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 33-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
25-376 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=3)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQLNSYPLTF at 352, score = 9 + 9
umis assigned: [200]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 25, 31, 87, 236, 455
confident = true

TIG 2[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=6)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYDFLPLTF at 347, score = 9 + 9
umis assigned: [83, 85]
of which 2 are surviving nonsolos
reads assigned: 386
start codons at 20, 26, 82, 95, 234, 357, 450
confident = true

TIG 3[bases=553]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-482 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 224 reads
cdr3 = CASATRSYWYFDLW at 409, score = 9 + 7
umis assigned: [0, 28, 38, 59, 62, 77, 79, 141, 143, 210] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3559
start codons at 67, 218, 223, 281, 284, 370
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2312 = GTCACAATCTCTTGAT-1

using 18 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2318 = GTCACAATCTTCATGT-1

using 427 reads

====================================================================================

graph has 156 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 178, 237]
surviving nonsolo ucounts = 2[178, 237]
ids = [7, 4]

====================================================================================

UMI info for barcode GTCACAATCTTCATGT-1 contig 1 = GAGGAATCAG...
umi CCCCTCCCAA = 237 reads: +388 validated
umi TGTATCTTCC = 182 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 80 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [4, 7]
of which 2 are surviving nonsolos
reads assigned: 409
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 80.2319 = GTCACAATCTTCGGTC-1

using 363 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[360]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.15
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk080-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk080-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

117.585 seconds used processing barcodes, peak mem = 0.35
