[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.91 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk078-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk078-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk078.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.0 = GGGTCTGTCGAATGCT-1

using 228 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 220]
surviving nonsolo ucounts = 1[220]
ids = [4]

====================================================================================

UMI info for barcode GGGTCTGTCGAATGCT-1 contig 1 = GAGGAGTCAG...
umi CTATTCAATA = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
379-416 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CQQSYSTPLTF at 355, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.7 = GGGTCTGTCGGTCTAA-1

using 256 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode GGGTCTGTCGGTCTAA-1 contig 1 = GCTCTGCTTC...
umi CTTATGTTGG = 235 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=604]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-604 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.10 = GGGTCTGTCGTCTGCT-1

using 329 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[2, 318]
surviving nonsolo ucounts = 1[318]
ids = [10]

====================================================================================

UMI info for barcode GGGTCTGTCGTCTGCT-1 contig 1 = GGGAGTCTCA...
umi TGAGTGCCGC = 281 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
411-493 ==> 0-82 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYHTPWTF at 350, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 23, 29, 85, 98, 234, 237, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.18 = GGGTCTGTCTCGATGA-1

using 60 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 4, 49]
surviving nonsolo ucounts = 1[49]
ids = [3]

====================================================================================

UMI info for barcode GGGTCTGTCTCGATGA-1 contig 1 = CCCACTCAGG...
umi CCTGCCATCG = 43 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=433]
17-368 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
367-405 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
405-433 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CLQHKSYPFTF at 344, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 43
start codons at 17, 23, 92, 228
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.25 = GGGTCTGTCTGCCCTA-1

using 428 reads

====================================================================================

graph has 220 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 3, 200, 214]
surviving nonsolo ucounts = 2[200, 214]
ids = [10, 6]

====================================================================================

UMI info for barcode GGGTCTGTCTGCCCTA-1 contig 1 = AAAAACCACA...
umi GGTGTGGGCT = 197 reads: +433 -3 non-validated
umi TGTCAGGCGT = 177 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=574]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-574 ==> 0-88 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [6, 10]
of which 2 are surviving nonsolos
reads assigned: 367
start codons at 50, 248, 253, 270, 314, 347, 540
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.32 = GGGTCTGTCTGTGCAA-1

using 16855 reads

====================================================================================

graph has 6259 edges initially, 168 edges after simplification

total ucounts = 1016
nonsolo ucounts = 480[2^199, 3^110, 4^49, 5^24, 6^14, 7^7, 8^4, 9, 10^2, 12^2, 20, 25, 26, 44, 45, 62, 84^2, 94, 96, 97, 100, 111, 113, 115, 122, 138, 144^3, 157, 161, 167, 169, 170, 183^2, 190^2, 194, 221^2, 233, 235^2, 237, 241^2, 242, 249, 255, 257, 258, 261, 263, 264, 269^2, 270, 275, 278, 280^2, 281, 282, 283, 288, 291, 299, 324, 339, 341, 343, 347, 356, 543, 597, 737]
surviving nonsolo ucounts = 65[25, 44, 45, 62, 84^2, 94, 96, 97, 111, 113, 115, 122, 138, 144^3, 157, 161, 167, 169, 170, 183^2, 190^2, 194, 221^2, 233, 235^2, 237, 241^2, 242, 249, 255, 257, 258, 261, 263, 264, 269^2, 270, 275, 278, 280^2, 281, 282, 283, 288, 291, 299, 324, 339, 341, 343, 347, 356, 543, 597, 737]
ids = [563, 916, 336, 69, 268, 672, 557, 501, 473, 237, ...]

====================================================================================

UMI info for barcode GGGTCTGTCTGTGCAA-1 contig 1 = GGGGAGGAGT...
umi AAAAGATGCA = 236 reads: +388 validated
umi AATAAGCTTG = 201 reads: +388 validated
umi ACAGGGGCGC = 280 reads: +388 validated
umi ACCCTATTTC = 122 reads: +388 validated
umi ACTTTCTCTT = 266 reads: +388 validated
umi ATGTGTCCAG = 280 reads: +388 validated
umi CAACCGTCAT = 257 reads: +388 validated
umi CATATTACAC = 335 reads: +388 validated
umi CCCCACCGGC = 261 reads: +388 validated
umi CCCCCTCTAG = 269 reads: +388 validated
umi CCCTTAGACT = 350 reads: +388 validated
umi CCTGCCGCGC = 234 reads: +388 validated
umi CCTTTAGTAA = 190 reads: +388 validated
umi CCTTTAGTCC = 327 reads: +388 validated
umi CGACATGGGC = 545 reads: +388 validated
umi CGACGATTGG = 295 reads: +388 validated
umi CGAGTAAGTC = 281 reads: +388 validated
umi CTCGTATTTC = 287 reads: +388 validated
umi CTTACCATTA = 256 reads: +388 validated
umi GACGCACCAT = 289 reads: +388 validated
umi GACTAGGGTT = 147 reads: +388 validated
umi GCCAAAACAG = 138 reads: +1 -1XX +4 -6XX +1 -1X +2 -1X +1 -5X +1 -2XX +362 invalidated
umi GCCATTGCCT = 148 reads: +388 validated
umi GCGATGGGGT = 250 reads: +388 validated
umi GCTATTCCTT = 237 reads: +388 validated
umi GGTGTCATAT = 338 reads: +388 validated
umi GTCCTGGGCC = 256 reads: +388 validated
umi GTTAATACCA = 233 reads: +388 validated
umi TACAACGCGG = 260 reads: +388 validated
umi TATCATGCCT = 345 reads: +388 validated
umi TTATACCCGG = 184 reads: +388 validated

UMI info for barcode GGGTCTGTCTGTGCAA-1 contig 2 = ATCACATAAC...
umi AGTGTATTGT = 187 reads: +393 -8 +23 non-validated
umi ATTAGACCGT = 280 reads: +424 validated
umi CACGATCGAG = 85 reads: +392 -1 +31 non-validated
umi CATTCACGGG = 222 reads: +424 validated
umi CCATGGCTTA = 45 reads: +297 -6 +2 -1 +2 -1 +2 -1 +1 -1 +1 -1 +2 -1 +56 -49 non-validated
umi CCCGTTGGCC = 283 reads: +424 validated
umi CGAGGGAGGC = 356 reads: +424 validated
umi GAACTTGGGT = 80 reads: +424 validated
umi GGGGACACCG = 66 reads: +379 -1 +16 -1 +27 non-validated
umi GTCTAGACAC = 283 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=555]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 31 umis using 1146 reads
cdr3 = CQQYDNPSLTF at 358, score = 9 + 9
umis assigned: [4, 55, 80, 97, 137, 226, 242, 300, 350, 355] and 21 others
of which 31 are surviving nonsolos
reads assigned: 7958
start codons at 31, 37, 93, 106, 245, 368, 461
confident = true

TIG 2[bases=553]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=2)
436-482 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 135 reads
cdr3 = CARPRPQVGATGGFYYW at 400, score = 9 + 7
umis assigned: [171, 232, 268, 310, 336, 365, 432, 557, 672, 713]
of which 10 are surviving nonsolos
reads assigned: 1844
start codons at 58, 209, 256, 355
confident = true

REJECT CONTIGS

TIG 1[bases=754]
0-68 ==> 5924-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=3)
41-84 ==> 0-43 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=0)
44-202 ==> 0-158 on segment before IGLV2-8 exon 2 [len=158] (mis=0)
199-510 ==> 43-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=3) [SHIFT!]
505-543 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
543-754 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [14, 54, 69, 136, 155, 202, 237, 259, 468, 496] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2446
start codons at 41, 90, 313, 357, 364, 463, 490, 505
confident = false
did not find CDR3

TIG 2[bases=627]
1-88 ==> 5924-6011 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
42-67 ==> 0-25 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=0)
67-377 ==> 26-336 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=26) [SHIFT!]
394-416 ==> 16-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
416-627 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [200, 266, 410, 444, 501, 546, 794, 819, 867]
of which 9 are surviving nonsolos
reads assigned: 2178
start codons at 42, 180, 192, 198, 242, 252, 320
confident = false
did not find CDR3

TIG 3[bases=592]
4-81 ==> 5923-6000 on rc of segment after IGHV3-47 exon 1 [len=6000] (mis=0)
78-123 ==> 0-45 on |173|IGHV3/OR16-10|L-REGION+V-REGION| [len=350] (mis=2)
81-157 ==> 0-76 on segment before IGHV3OR16-10 exon 2 [len=151] (mis=3)
153-458 ==> 45-350 on |173|IGHV3/OR16-10|L-REGION+V-REGION| [len=350] (mis=22)
454-485 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=6)
485-521 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
521-592 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [473, 563, 916]
of which 3 are surviving nonsolos
reads assigned: 71
start codons at 122, 131, 259, 340, 354, 408, 432
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCGAGACCTAGGCCCCAAGTGGGAGCTACTGGGGGGTTTTACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCCCTCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.35 = GGGTCTGTCTTCCTTC-1

using 191 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 176]
surviving nonsolo ucounts = 1[176]
ids = [8]

====================================================================================

UMI info for barcode GGGTCTGTCTTCCTTC-1 contig 1 = GGCTTTCTGA...
umi TCCCATCCTC = 174 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=543]
15-386 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
423-472 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
472-543 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CARSSRKFRVFGVTLSYGMDVW at 375, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 15, 36, 80, 166, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.41 = GGGTTGCAGAACTCGG-1

using 21 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.44 = GGGTTGCAGAAGGTGA-1

using 284 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 276]
surviving nonsolo ucounts = 1[276]
ids = [4]

====================================================================================

UMI info for barcode GGGTTGCAGAAGGTGA-1 contig 1 = GAAGAGCTGC...
umi TAGCCACGAG = 1 reads: -223X +5 -3X +2 -2X +2 -1 +1 -1X +1 -1 +18 -1X +2 -1X +2 -1X +5 -1X +2 -110X invalidated
umi TCATGCATGG = 238 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=503]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
418-503 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYGSSPNTF at 357, score = 9 + 8
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.53 = GGGTTGCAGAGTAATC-1

using 352 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[347]
surviving nonsolo ucounts = 1[347]
ids = [2]

====================================================================================

UMI info for barcode GGGTTGCAGAGTAATC-1 contig 1 = ACATGGGAAG...
umi CTAATGAGCT = 305 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=3)
416-464 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
464-499 ==> 0-35 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CATKGVVAATRYVDYW at 385, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 2, 25, 46, 90, 176, 482
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.67 = GGGTTGCAGCCTATGT-1

using 281 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 3, 273]
surviving nonsolo ucounts = 1[273]
ids = [3]

====================================================================================

UMI info for barcode GGGTTGCAGCCTATGT-1 contig 1 = GGAGTCAGAC...
umi TGCCGTCGCC = 218 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=450]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
414-450 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNGQSRAF at 353, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 26, 32, 101, 237, 240, 333, 366
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.68 = GGGTTGCAGCTAACTC-1

using 103 reads

====================================================================================

graph has 76 edges initially, 4 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^3, 3^2, 4, 7, 8, 9, 12, 48]
surviving nonsolo ucounts = 1[48]
ids = [10]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.86 = GGGTTGCAGTCAATAG-1

using 312 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 5, 297]
surviving nonsolo ucounts = 1[297]
ids = [4]

====================================================================================

UMI info for barcode GGGTTGCAGTCAATAG-1 contig 1 = GAGTCAGTCT...
umi GTCTCACATC = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYSTPWQF at 352, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.99 = GGGTTGCCAACTGCTA-1

using 221 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 12, 203]
surviving nonsolo ucounts = 1[203]
ids = [3]

====================================================================================

UMI info for barcode GGGTTGCCAACTGCTA-1 contig 1 = GCTCTGCTTC...
umi TATGGATTAG = 188 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=538]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-538 ==> 0-96 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.115 = GGGTTGCCACATTAGC-1

using 218 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 213]
surviving nonsolo ucounts = 1[213]
ids = [0]

====================================================================================

UMI info for barcode GGGTTGCCACATTAGC-1 contig 1 = GGGAATCAGT...
umi ACCAGGACAC = 216 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.116 = GGGTTGCCACCACCAG-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[29]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.122 = GGGTTGCCACGGCGTT-1

using 148 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 87
nonsolo ucounts = 17[2^4, 3^6, 4, 5^2, 6, 7, 9, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.129 = GGGTTGCCACTTGGAT-1

using 273 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 267]
surviving nonsolo ucounts = 1[267]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=475]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
0-80 ==> 10060-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=10)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=3)
434-475 ==> 0-41 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
cdr3 = CARTPGGSGSQWDYW at 404, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 62, 218, 260, 265, 297, 326, 359, 436
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.139 = GGGTTGCCAGGCGATA-1

using 306 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [0]

====================================================================================

UMI info for barcode GGGTTGCCAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi CACTCCCCCT = 272 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=568]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-568 ==> 0-155 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 269
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.145 = GGGTTGCCATAAGACA-1

using 200 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 6, 183]
surviving nonsolo ucounts = 1[183]
ids = [5]

====================================================================================

UMI info for barcode GGGTTGCCATAAGACA-1 contig 1 = GGGGTCACAA...
umi CTTATTTTAG = 180 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=640]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-331 ==> 0-293 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=22)
391-429 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=7)
429-640 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CSSYAGRTTFDVF at 362, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 176
start codons at 38, 174, 177, 192, 195, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.151 = GGGTTGCCATGCCCGA-1

using 1016 reads

====================================================================================

graph has 665 edges initially, 6 edges after simplification

total ucounts = 100
nonsolo ucounts = 37[2^13, 3^3, 4^4, 5^4, 6, 7^2, 9^3, 10, 11, 12, 13, 169, 274, 346]
surviving nonsolo ucounts = 3[169, 274, 346]
ids = [3, 50, 89]

====================================================================================

UMI info for barcode GGGTTGCCATGCCCGA-1 contig 1 = GGAGTCAGTC...
umi TGCTTTTCTG = 294 reads: +388 validated

UMI info for barcode GGGTTGCCATGCCCGA-1 contig 2 = TGGGAGAGGA...
umi AAGTGCTCTC = 163 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=503]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
414-503 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQSYRRPITF at 353, score = 8 + 8
umis assigned: [89]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 26, 32, 88, 101, 237, 336, 456
confident = false

TIG 2[bases=530]
0-74 ==> 147-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
74-404 ==> 0-330 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=27)
458-507 ==> 0-49 on |52|IGHJ3|J-REGION| [len=49] (mis=5)
507-530 ==> 0-23 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CASSRITVVQGVFGVGGFETW at 413, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 159
start codons at 74, 299, 306, 374, 488
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.164 = GGGTTGCGTAAGTAGT-1

using 629 reads

====================================================================================

graph has 256 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[629]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.165 = GGGTTGCGTAATAGCA-1

using 7592 reads

====================================================================================

graph has 5525 edges initially, 105 edges after simplification

total ucounts = 1172
nonsolo ucounts = 906[2^125, 3^112, 4^104, 5^82, 6^74, 7^79, 8^62, 9^52, 10^43, 11^42, 12^22, 13^21, 14^20, 15^19, 16^13, 17^6, 18^8, 19^7, 20^4, 21, 22, 23, 25, 28, 51, 88, 185, 206, 313, 330]
surviving nonsolo ucounts = 5[51, 88, 206, 313, 330]
ids = [677, 586, 503, 430, 72]

====================================================================================

UMI info for barcode GGGTTGCGTAATAGCA-1 contig 1 = CCCTCCCAGC...
umi ACATGACGGG = 332 reads: +382 validated
umi CCATACCTGT = 317 reads: +382 validated
umi CCGTTATTCG = 208 reads: +382 validated
umi CGGGCTCAAT = 86 reads: +349 -1 +32 non-validated

GOOD CONTIGS

TIG 1[bases=609]
0-91 ==> 6-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
91-436 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=11)
435-473 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
473-609 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 134 reads
cdr3 = CQQYNDWRWAF at 412, score = 9 + 7
umis assigned: [72, 430, 503, 586]
of which 4 are surviving nonsolos
reads assigned: 923
start codons at 36, 91, 160, 296, 425, 515
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.168 = GGGTTGCGTAGCTCCG-1

using 2510 reads

====================================================================================

graph has 1944 edges initially, 26 edges after simplification

total ucounts = 516
nonsolo ucounts = 204[2^87, 3^52, 4^24, 5^18, 6^4, 7^8, 8^3, 9, 10^2, 11, 98, 314, 470, 656]
surviving nonsolo ucounts = 4[98, 314, 470, 656]
ids = [471, 400, 24, 273]

====================================================================================

UMI info for barcode GGGTTGCGTAGCTCCG-1 contig 1 = GGAGTCAGTC...
umi CTTAGGTCTA = 580 reads: -357X +1 -2XX +1 -6XX +1 -1XX +1 -2XX +2 -2XX +1 -2XX +1 -3XX +1 -5XX +1 -1XX invalidated
umi TAGGTGTCGG = 312 reads: +391 validated
umi TGTTATCGCG = 102 reads: +139 -15XX +1 -4XX +1 -1XX +2 -1XX +1 -226X invalidated

GOOD CONTIGS

TIG 1[bases=553]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=14)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYDNLPLFTF at 353, score = 9 + 8
umis assigned: [273, 400, 471]
of which 3 are surviving nonsolos
reads assigned: 972
start codons at 26, 32, 88, 101, 240, 363, 459
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 78.169 = GGGTTGCGTAGGAGTC-1

using 316 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode GGGTTGCGTAGGAGTC-1 contig 1 = GGGGAGGAAC...
umi ACACTTCACT = 279 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=493]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-493 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSDWPRTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 36, 105, 241, 460
confident = false
NOT paired!
sorting bam, mem = 0.06
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk078-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk078-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

6.512 seconds used processing barcodes, peak mem = 0.23
