[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 834.24 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk075-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk075-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk075.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.6 = GGATGTTTCTTGCAAG-1

using 332 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 321]
surviving nonsolo ucounts = 1[321]
ids = [0]

====================================================================================

UMI info for barcode GGATGTTTCTTGCAAG-1 contig 1 = GACTGATCAG...
umi AAACAAGGAC = 325 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=567]
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
393-431 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
431-567 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CMQGTHWPWTF at 370, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 34, 67, 95, 103, 191, 353, 373, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.14 = GGATTACAGAATTGTG-1

using 631 reads

====================================================================================

graph has 328 edges initially, 8 edges after simplification

total ucounts = 14
nonsolo ucounts = 5[3, 8, 90, 214, 307]
surviving nonsolo ucounts = 3[90, 214, 307]
ids = [7, 13, 4]

====================================================================================

UMI info for barcode GGATTACAGAATTGTG-1 contig 1 = AAGAGGCAGC...
umi TTTAAAGTGA = 194 reads: +385 validated

UMI info for barcode GGATTACAGAATTGTG-1 contig 2 = GATCAGGACT...
umi CCGCGCCGAT = 308 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=528]
0-30 ==> 132-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
30-370 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
387-415 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
415-528 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 41 reads
cdr3 = CFSYGTSGRTF at 354, score = 8 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 30, 238, 364
confident = false

TIG 2[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 44 reads
cdr3 = CMQALQTPPYTF at 366, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false

REJECT CONTIGS

TIG 1[bases=438]
3-58 ==> 5937-5992 on segment before IGLV2-5 exon 1 [len=6137] (mis=2)
12-78 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
72-387 ==> 41-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
cdr3 = CQSYDSSLSGLYVF at 355, score = 7 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 31, 185, 188, 239, 338, 365, 389
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.24 = GGATTACAGCCGCCTA-1

using 257 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [1]

====================================================================================

UMI info for barcode GGATTACAGCCGCCTA-1 contig 1 = TCACATAACA...
umi CCCCATGCCC = 253 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=536]
0-57 ==> 1-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
57-410 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
411-429 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
430-493 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
493-536 ==> 0-43 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 399, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 57, 208, 255, 354, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.28 = GGATTACAGGACTGGT-1

using 297 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode GGATTACAGGACTGGT-1 contig 1 = AGTGCTTTCT...
umi ACTATTAGGG = 302 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=650]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-650 ==> 0-182 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_75.28_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.31 = GGATTACAGGGCATGT-1

using 313 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 7, 299]
surviving nonsolo ucounts = 1[299]
ids = [0]

====================================================================================

UMI info for barcode GGATTACAGGGCATGT-1 contig 1 = GATCAGGACT...
umi AATGTTGGGT = 303 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CMQALQTPPTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.32 = GGATTACAGGGTTCCC-1

using 277 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[274]
surviving nonsolo ucounts = 1[274]
ids = [2]

====================================================================================

UMI info for barcode GGATTACAGGGTTCCC-1 contig 1 = GAGTCAGACT...
umi GTGATACATA = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQYNSYALSF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 25, 31, 87, 100, 236, 239, 332, 371, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.36 = GGATTACAGTTATCGC-1

using 202 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 193]
surviving nonsolo ucounts = 1[193]
ids = [3]

====================================================================================

UMI info for barcode GGATTACAGTTATCGC-1 contig 1 = AGCTCTGAGA...
umi GGAGGACCTG = 192 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=542]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-542 ==> 0-39 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.39 = GGATTACCAAAGGCGT-1

using 13 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.41 = GGATTACCAACCGCCA-1

using 206 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[206]
surviving nonsolo ucounts = 1[206]
ids = [0]

====================================================================================

UMI info for barcode GGATTACCAACCGCCA-1 contig 1 = ATCATCCAAC...
umi TTATACACAC = 196 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=556]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
488-556 ==> 0-68 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 58, 214, 256, 322, 355, 445, 542
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.45 = GGATTACCAATAAGCA-1

using 221 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3, 15, 197]
surviving nonsolo ucounts = 2[15, 197]
ids = [2, 6]

====================================================================================

UMI info for barcode GGATTACCAATAAGCA-1 contig 1 = CCTGGGTCAG...
umi CTATACCCAT = 11 reads: -60 +1 -1 +124 -36 +8 -1XX +35 -1XX +62 -1X +5 -50 invalidated
umi TCCTTTACCG = 195 reads: +107 -1XX +36 -1XX +3 -1XX +5 -1XX +230 invalidated

GOOD CONTIGS

TIG 1[bases=438]
0-52 ==> 0-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
52-400 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
398-437 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
junction support: 1 umis using 29 reads
cdr3 = CQQYGSSPGTF at 376, score = 9 + 8
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 190
start codons at 52, 260, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.52 = GGATTACCACCGTTGG-1

using 1416 reads

====================================================================================

graph has 470 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 366, 393, 655]
surviving nonsolo ucounts = 3[366, 393, 655]
ids = [3, 2, 0]

====================================================================================

UMI info for barcode GGATTACCACCGTTGG-1 contig 1 = GGCGCCAGGG...
umi TTTATCATGG = 364 reads: +385 validated

UMI info for barcode GGATTACCACCGTTGG-1 contig 2 = TGGGGCTTTC...
umi CTTCGCGCGC = 355 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=627]
0-31 ==> 3-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
31-382 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=1)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
416-627 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLLYYGGARVF at 355, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 31, 368
confident = false

TIG 2[bases=577]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=11)
421-469 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
469-577 ==> 0-108 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CARGSGILVIAIEDYYFDHW at 378, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 348
start codons at 18, 39, 83, 169, 256, 523
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.55 = GGATTACCACTCAGGC-1

using 288 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 1[278]
ids = [2]

====================================================================================

UMI info for barcode GGATTACCACTCAGGC-1 contig 1 = GGGCACCATG...
umi ACATACCTTT = 250 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=521]
7-344 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=17)
351-389 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
389-521 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CNSRDSGTNRLVF at 322, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 7, 126, 206, 305
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.56 = GGATTACCACTGTCGG-1

using 200 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[194]
surviving nonsolo ucounts = 1[194]
ids = [1]

====================================================================================

UMI info for barcode GGATTACCACTGTCGG-1 contig 1 = GCTCTGCTTC...
umi ATCTCGCTGG = 1 reads: -344 +2 -2 +5 -1 +1 -1 +4 -1 +6 -1 +1 -1 +6 -1 +3 -1X +1 -1 +1 -2 +8 invalidated
umi ATCTCGGTTG = 183 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=545]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-545 ==> 0-100 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.60 = GGATTACCAGGAACGT-1

using 431 reads

====================================================================================

graph has 106 edges initially, 6 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[177, 251]
surviving nonsolo ucounts = 2[177, 251]
ids = [1, 4]

====================================================================================

UMI info for barcode GGATTACCAGGAACGT-1 contig 1 = GCTGTGGGTC...
umi AGCTACTATT = 32 reads: -357 +1 -4XX +2 -2XX +1 -1XX +1 -3XX +1 -4XX +2 invalidated
umi GTTCACTGGA = 249 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=628]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=3)
379-417 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
417-628 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSTDSSGIYVF at 353, score = 8 + 7
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 281
start codons at 38, 99, 168, 186, 381, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.67 = GGATTACCATCTACGA-1

using 287 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 9, 270]
surviving nonsolo ucounts = 1[270]
ids = [4]

====================================================================================

UMI info for barcode GGATTACCATCTACGA-1 contig 1 = AGTTCACCTT...
umi GGATACCCTT = 237 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=491]
16-376 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-491 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CMQALQTRETF at 352, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 16, 49, 85, 173, 335, 355, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.69 = GGATTACCATGATCCA-1

using 67 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[3, 4^2, 5^3, 8, 10^2, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.71 = GGATTACCATGGGAAC-1

using 67 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.72 = GGATTACCATGGTCAT-1

using 197 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

UMI info for barcode GGATTACCATGGTCAT-1 contig 1 = GGGAGAAGAG...
umi TCGAAGCAAC = 199 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=551]
0-74 ==> 46-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
74-427 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=8)
432-480 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARGGDYFDYW at 416, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 74, 230, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.79 = GGATTACGTACCGGCT-1

using 744 reads

====================================================================================

graph has 280 edges initially, 6 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^2, 3, 5, 8, 314, 404]
surviving nonsolo ucounts = 2[314, 404]
ids = [4, 12]

====================================================================================

UMI info for barcode GGATTACGTACCGGCT-1 contig 1 = GGGCTGGGGT...
umi ATTGCTTTCT = 320 reads: +388 validated
umi TTCTCCAGTG = 53 reads: -352X +1 -1XX +1 -4XX +2 -3XX +1 -1XX +1 -4XX +1 -3XX +1 -1XX +1 -3XX +1 -4XX +2 invalidated

GOOD CONTIGS

TIG 1[bases=642]
43-394 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
431-642 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSYTSSSTYVF at 367, score = 8 + 8
umis assigned: [4, 12]
of which 2 are surviving nonsolos
reads assigned: 365
start codons at 43, 200, 244, 251, 254, 395, 563
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.89 = GGATTACGTCGCATAT-1

using 1148 reads

====================================================================================

graph has 366 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[165, 286, 332, 362]
surviving nonsolo ucounts = 4[165, 286, 332, 362]
ids = [6, 0, 3, 5]

====================================================================================

UMI info for barcode GGATTACGTCGCATAT-1 contig 1 = GAAAACCCTG...
umi TTCATTGGCT = 165 reads: +436 validated

UMI info for barcode GGATTACGTCGCATAT-1 contig 2 = GGGAGGAATC...
umi AATCCTCCGC = 290 reads: +388 validated
umi ATGAGGTTAT = 331 reads: +388 validated
umi TACCCCAGTC = 364 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
28-381 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=0)
383-400 ==> 0-17 on |11|IGHD1-7|D-REGION| [len=17] (mis=3)
401-464 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
464-535 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGGGNWNYVYYYYYGMDVW at 370, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 28, 179, 226, 231, 235, 263, 292, 325, 421
confident = true

TIG 2[bases=554]
30-381 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 152 reads
cdr3 = CLQYSSSPWTF at 357, score = 9 + 8
umis assigned: [0, 3, 5]
of which 3 are surviving nonsolos
reads assigned: 973
start codons at 30, 36, 105, 241, 460
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.92 = GGATTACGTGATAAGT-1

using 2439 reads

====================================================================================

graph has 3232 edges initially, 29 edges after simplification

total ucounts = 1040
nonsolo ucounts = 473[2^177, 3^89, 4^63, 5^42, 6^40, 7^22, 8^17, 9^8, 10^4, 11^2, 12^2, 13^3, 14^2, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.105 = GGATTACGTTGCGCAC-1

using 230 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 227]
surviving nonsolo ucounts = 1[227]
ids = [0]

====================================================================================

UMI info for barcode GGATTACGTTGCGCAC-1 contig 1 = AGCTCTGAGA...
umi ATAATGTCGA = 218 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=579]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-579 ==> 0-76 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.108 = GGATTACGTTTCCACC-1

using 16 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.109 = GGATTACTCAACTCTT-1

using 230 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 222]
surviving nonsolo ucounts = 1[222]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=347]
0-174 ==> 177-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
174-211 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
211-347 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPLTF at 150, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 122
start codons at 34, 253
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.115 = GGATTACTCACATGCA-1

using 844 reads

====================================================================================

graph has 364 edges initially, 12 edges after simplification

total ucounts = 17
nonsolo ucounts = 14[2^3, 3^3, 5, 8, 9, 10, 13, 14, 379, 388]
surviving nonsolo ucounts = 2[379, 388]
ids = [15, 5]

====================================================================================

UMI info for barcode GGATTACTCACATGCA-1 contig 1 = GAGTCAGACT...
umi TCAGTCGTCG = 379 reads: +388 validated

UMI info for barcode GGATTACTCACATGCA-1 contig 2 = GGGAGGAACT...
umi CGTCTTCCAC = 391 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYNSYPLTF at 352, score = 8 + 9
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false

TIG 2[bases=553]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
380-417 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQRSNWPLTF at 356, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 35, 243, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.123 = GGATTACTCCAGGGCT-1

using 491 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 198, 286]
surviving nonsolo ucounts = 2[198, 286]
ids = [6, 4]

====================================================================================

UMI info for barcode GGATTACTCCAGGGCT-1 contig 1 = GGGACTCCTG...
umi TGGCCCCTAC = 245 reads: +415 validated

UMI info for barcode GGATTACTCCAGGGCT-1 contig 2 = AGCTTCAGCT...
umi TGTGGGCCTT = 192 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=531]
19-377 ==> 0-358 on |96|IGHV2-26|L-REGION+V-REGION| [len=358] (mis=15)
394-434 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
434-531 ==> 0-97 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CALSRGVGAGDYW at 364, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 19, 167, 175, 325, 334, 488
confident = false

TIG 2[bases=571]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
435-571 ==> 0-136 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAAWDDSLNGPVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 188
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.126 = GGATTACTCCCTAACC-1

using 11778 reads

====================================================================================

graph has 6550 edges initially, 64 edges after simplification

total ucounts = 1371
nonsolo ucounts = 694[2^260, 3^150, 4^106, 5^51, 6^36, 7^20, 8^10, 9^8, 10^2, 11^4, 12^3, 13^3, 16, 17, 20, 21, 25, 35, 39, 42, 63, 89, 100, 124, 125, 133, 147, 173, 187, 195, 234, 235, 237, 240, 265, 266, 269, 284, 287, 313, 322, 324, 337, 342, 344, 346, 349, 351, 355, 374, 375, 388, 417]
surviving nonsolo ucounts = 28[124, 133, 147, 173, 195, 234, 235, 237, 240, 265, 266, 269, 284, 287, 313, 322, 324, 337, 342, 344, 346, 349, 351, 355, 374, 375, 388, 417]
ids = [687, 1007, 911, 1283, 724, 1279, 381, 983, 485, 132, ...]

====================================================================================

UMI info for barcode GGATTACTCCCTAACC-1 contig 1 = TGGGGAGGAG...
umi AAAGCGACCG = 347 reads: +388 validated
umi ACCAATCGAC = 315 reads: +388 validated
umi ACCGGCCCTA = 267 reads: +388 validated
umi AGCATGTTAG = 355 reads: +388 validated
umi ATATTACCCG = 288 reads: +388 validated
umi ATCTCCGCAA = 288 reads: +388 validated
umi ATTCCAAATC = 339 reads: -306 +82 non-validated
umi ATTTGGCATT = 238 reads: +388 validated
umi CACACTGGCG = 413 reads: +388 validated
umi CCAACCACAA = 274 reads: +388 validated
umi CCATGACCTC = 243 reads: +388 validated
umi CCCACGGCAT = 348 reads: +388 validated
umi CCCATGATCT = 315 reads: +388 validated
umi CTTAGTTCGT = 126 reads: +388 validated
umi GGATCTCTAC = 320 reads: +388 validated
umi GTAATGCCCT = 342 reads: +388 validated
umi GTCCGGCCCA = 146 reads: +388 validated
umi TAAGCTCCTT = 236 reads: +388 validated
umi TACTGCCGTC = 131 reads: +388 validated
umi TAGCATGTTC = 388 reads: +388 validated
umi TCAATGTACC = 353 reads: +388 validated
umi TCTGTATCGT = 375 reads: +388 validated
umi TTCCGGACTA = 234 reads: +388 validated
umi TTCCTCACTA = 174 reads: +388 validated
umi TTTGACAGTG = 341 reads: +388 validated
umi TTTTGTCTTC = 375 reads: +388 validated

UMI info for barcode GGATTACTCCCTAACC-1 contig 2 = GAGGGGTCCT...
umi ACCACTTCCT = 264 reads: +451 validated
umi GACAAATTAA = 188 reads: +451 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 1117 reads
cdr3 = CQQSYSTPWTF at 359, score = 9 + 8
umis assigned: [12, 130, 152, 236, 295, 324, 363, 381, 397, 463] and 16 others
of which 26 are surviving nonsolos
reads assigned: 7456
start codons at 32, 38, 94, 107, 462
confident = true

TIG 2[bases=609]
60-408 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=17)
448-511 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
511-609 ==> 0-98 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 46 reads
cdr3 = CARESYCSGTNCPYNYYYYYAMDIW at 405, score = 9 + 8
umis assigned: [132, 724]
of which 2 are surviving nonsolos
reads assigned: 441
start codons at 16, 60, 104, 339, 468
confident = true
now this is a cell
paired!

AGAGAAAGCTACTGTAGTGGTACCAACTGCCCGTACAATTACTACTACTACTACGCTATGGACATCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.130 = GGATTACTCCTAAGTG-1

using 302 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 293]
surviving nonsolo ucounts = 1[293]
ids = [6]

====================================================================================

UMI info for barcode GGATTACTCCTAAGTG-1 contig 1 = ATCACATAAC...
umi CGCATTACAA = 285 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=578]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=10)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-578 ==> 0-99 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CARSELVIAIQRFDYW at 400, score = 8 + 6
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 281
start codons at 58, 209, 256, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.132 = GGATTACTCCTGTAGA-1

using 102 reads

====================================================================================

graph has 167 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 15[2^2, 3, 4^2, 5^3, 6, 8, 10^2, 11^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.134 = GGATTACTCGCAAACT-1

using 290 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 285]
surviving nonsolo ucounts = 1[285]
ids = [3]

====================================================================================

UMI info for barcode GGATTACTCGCAAACT-1 contig 1 = GGCTGGGGTC...
umi TTTATCCGCA = 276 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-386 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=16)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-584 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CCSFAGSHAWVF at 366, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 42, 181, 199, 243, 250, 253, 349, 562
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.145 = GGATTACTCTTCGAGA-1

using 382 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[382]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=423]
3-270 ==> 2169-2436 on rc of segment before IGHD2-2 exon 1 [len=2436] (mis=0)
312-352 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
352-423 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 369
start codons at 25, 31, 72
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.152 = GGCAATTAGAGCAATT-1

using 734 reads

====================================================================================

graph has 336 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 5, 322, 400]
surviving nonsolo ucounts = 2[322, 400]
ids = [7, 1]

====================================================================================

UMI info for barcode GGCAATTAGAGCAATT-1 contig 1 = GGAGGAACTG...
umi GACCTTGTTG = 360 reads: +382 validated

UMI info for barcode GGCAATTAGAGCAATT-1 contig 2 = ATCACATAAC...
umi TTAGTCGGCA = 302 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=505]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
416-505 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 64 reads
cdr3 = CQQYNNWRFTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 34, 103, 239, 458
confident = false

TIG 2[bases=505]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=21)
426-461 ==> 14-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
461-505 ==> 0-44 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CARDPGAGPW at 400, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 58, 274, 355, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.156 = GGCAATTAGATAGCAT-1

using 22765 reads

====================================================================================

graph has 10183 edges initially, 84 edges after simplification

total ucounts = 1278
nonsolo ucounts = 673[2^246, 3^100, 4^94, 5^55, 6^38, 7^19, 8^15, 9^8, 10^7, 11^4, 12^2, 13^5, 14^2, 16^2, 17, 19, 20, 22, 24, 26, 28, 29, 36, 45, 49, 55, 74, 77, 117, 131, 136, 140, 154, 156, 157, 163, 169, 178, 181^2, 185, 187, 189, 217, 218, 231, 236, 238^3, 240, 242, 254^2, 257, 268^2, 271, 279, 280, 282, 283, 286, 291, 294, 300, 303, 305, 306, 317, 318, 325, 340, 341, 347, 348, 365, 372, 377^2, 380, 425, 448, 504, 635, 663, 670, 804, 820, 900]
surviving nonsolo ucounts = 66[7, 28, 36, 49, 55, 74, 131, 136, 140, 154, 156, 157, 163, 169, 178, 181^2, 185, 187, 189, 217, 218, 231, 236, 238^3, 240, 242, 254^2, 257, 268^2, 271, 279, 280, 282, 283, 286, 291, 294, 300, 303, 305, 306, 317, 318, 325, 340, 341, 347, 348, 365, 372, 377, 380, 425, 448, 504, 635, 663, 670, 804, 820, 900]
ids = [138, 235, 1276, 1229, 628, 1007, 671, 193, 1083, 514, ...]

====================================================================================

UMI info for barcode GGCAATTAGATAGCAT-1 contig 1 = AGCTCTGAGA...
umi AAAATTACAG = 169 reads: +409 -1 +5 -10 +29 non-validated
umi ACTCAACAGG = 187 reads: +454 validated
umi AGATCAGCAC = 301 reads: +454 validated
umi AGCAATTGTG = 184 reads: +400 -1X +2 -3X +1 -5X +1 -3X +2 -1X +6 -5X +13 -1 +10 invalidated
umi ATCAGTTGAG = 156 reads: +372 -1 +2 -1X +9 -1 +5 -1X +2 -2 +10 -1 +5 -1 +1 -33 +7 invalidated
umi CAACAGCCAC = 260 reads: +454 validated
umi CCGTGGCTCA = 43 reads: -329X +125 invalidated
umi CTGTATTCAA = 55 reads: +383 -1 +13 -1 +11 -1 +35 -9 non-validated
umi GTAGGCTTTA = 257 reads: +454 validated
umi TCCCGGTCCA = 76 reads: +423 -1 +5 -25 non-validated
umi TCGGGCTCAT = 126 reads: -380 +1 -1XX +1 -5XX +2 -6XX +1 -6XX +1 -1XX +1 -2XX +3 -3XX +39 -1XX invalidated
umi TCTTTCTCAC = 580 reads: -443X +2 -1XX +1 -6XX +1 invalidated
umi TGAAGACGCC = 141 reads: +443 -11 non-validated
umi TGCACATGCT = 241 reads: +454 validated
umi TGGTATGATC = 241 reads: +454 validated
umi TGTACCCTGA = 186 reads: +442 -12 non-validated
umi TTATAGCGGG = 228 reads: +454 validated
umi TTATTGTTTG = 234 reads: +454 validated
umi TTGCGGGCCG = 49 reads: +319 -1 +3 -1 +14 -1 +115 non-validated
umi TTTTTCCAGC = 34 reads: +282 -2 +8 -1 +23 -1 +2 -16 +102 -17 non-validated

UMI info for barcode GGCAATTAGATAGCAT-1 contig 2 = AGGAGTCAGA...
umi AACCCAAGGG = 307 reads: +388 validated
umi AATGAGGGCC = 296 reads: -28X +360 invalidated
umi ACGACCTATA = 219 reads: +388 validated
umi ACGACCTTTG = 314 reads: +388 validated
umi AGAAACCGGA = 139 reads: +388 validated
umi CAAACACATA = 382 reads: +388 validated
umi CAACTTAGAT = 298 reads: +388 validated
umi CAGCCTTACC = 252 reads: +388 validated
umi CATGCATTGT = 310 reads: +388 validated
umi CATTCAATAA = 428 reads: +388 validated
umi CCCAAGATAC = 332 reads: +388 validated
umi CCGCGGCCGC = 271 reads: +388 validated
umi CCTCGGCACT = 339 reads: +388 validated
umi CCTGGCCTCC = 152 reads: +388 validated
umi CGCCGGTTAC = 187 reads: +388 validated
umi CGCTTTTATA = 184 reads: +388 validated
umi CTGAACTGCT = 271 reads: +388 validated
umi CTTGCTCAGA = 239 reads: +388 validated
umi GAACCACATG = 216 reads: +388 validated
umi GATCCGTCCG = 379 reads: +388 validated
umi GCCACTCCTT = 234 reads: +388 validated
umi GCCCGGCACC = 348 reads: +388 validated
umi GCTCCCTTCT = 285 reads: +388 validated
umi GTAATCGATC = 243 reads: +388 validated
umi GTTCGTGGGT = 354 reads: +388 validated
umi TAAATCGTAC = 290 reads: +388 validated
umi TAACGCATCC = 157 reads: +388 validated
umi TAACGTGCAC = 170 reads: +388 validated
umi TAGCACTCAT = 372 reads: +388 validated
umi TCGTGTACGG = 279 reads: +388 validated
umi TCTATAGGGA = 297 reads: +388 validated
umi TGACCGTGGA = 284 reads: +388 validated
umi TGCTCGTTTG = 371 reads: +388 validated
umi TTCCGTACTA = 667 reads: -282 +106 non-validated
umi TTCGCGACAT = 285 reads: +388 validated
umi TTGCCTGCTC = 162 reads: +388 validated
umi TTGTGTCGCC = 340 reads: +388 validated
umi TTTGTCCTCA = 274 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=604]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=2)
441-469 ==> 0-28 on |15|IGHD2-21|D-REGION| [len=28] (mis=4)
485-533 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
533-604 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 10 umis using 178 reads
cdr3 = CAGEKGGPYCGGDCYSGTPGAHGLDYW at 421, score = 9 + 7
umis assigned: [7, 173, 202, 210, 270, 316, 490, 628, 798, 1007] and 10 others
of which 19 are surviving nonsolos
reads assigned: 3667
start codons at 79, 235, 382
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 38 umis using 1663 reads
cdr3 = CQQYNSYLLTF at 354, score = 8 + 9
umis assigned: [45, 86, 150, 151, 193, 311, 322, 366, 404, 409] and 28 others
of which 38 are surviving nonsolos
reads assigned: 10747
start codons at 27, 33, 89, 102, 334, 457
confident = true

REJECT CONTIGS

TIG 1[bases=776]
0-254 ==> 11248-11502 on segment before IGLV3-6 exon 1 [len=11502] (mis=0)
49-95 ==> 0-46 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=1)
251-290 ==> 56-95 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=2) [SHIFT!]
251-327 ==> 56-132 on |361|IGLV3-22|L-REGION+V-REGION| [len=345] (mis=7) [SHIFT!]
435-507 ==> 246-318 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=10) [SHIFT!]
454-507 ==> 265-318 on |361|IGLV3-22|L-REGION+V-REGION| [len=345] (mis=5) [SHIFT!]
504-529 ==> 0-25 on segment before IGLV2-5 exon 1 [len=6137] (mis=0)
527-565 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
565-776 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
cdr3 = CHRYNRNSAVF at 504, score = 7 + 8
umis assigned: [336, 671, 673, 747, 838, 906]
of which 6 are surviving nonsolos
reads assigned: 3276
start codons at 49, 161, 256, 306, 337, 343, 392, 450
confident = false
not full
frameshifted full length stopped transcript of length 776
VJ delta = -126
delta too large
not full
now this is a cell
paired!

AAGGGCGGTCCATATTGTGGTGGTGATTGCTATTCGGGAACCCCAGGAGCACACGGGCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTTGCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.159 = GGCAATTAGATGTCGG-1

using 88 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 15[2^2, 3^2, 4, 5^3, 6^3, 9^4]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.161 = GGCAATTAGCAGCCTC-1

using 308 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 6, 7, 292]
surviving nonsolo ucounts = 1[292]
ids = [1]

====================================================================================

UMI info for barcode GGCAATTAGCAGCCTC-1 contig 1 = AATTAGGACT...
umi CCAGTAGACG = 294 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=4)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQATQYPWTF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.164 = GGCAATTAGCTAGTTC-1

using 322 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[4, 5, 310]
surviving nonsolo ucounts = 1[310]
ids = [2]

====================================================================================

UMI info for barcode GGCAATTAGCTAGTTC-1 contig 1 = AGAGAGGTGC...
umi ACCACTCGTA = 309 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=555]
0-72 ==> 7-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
72-425 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=11)
433-484 ==> 10-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CAIIPSHYYMDVW at 414, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 72, 228, 349, 375, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 75.169 = GGCAATTAGGCCCGTT-1

using 100 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2^4, 3, 4, 5, 8, 70]
surviving nonsolo ucounts = 1[70]
ids = [6]

====================================================================================

UMI info for barcode GGCAATTAGGCCCGTT-1 contig 1 = CTCCACCATC...
umi CTACTTACCT = 69 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=475]
10-363 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=51)
396-449 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=6)
449-475 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CVRLGGALSSHGDYEHWYFDVW at 352, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 69
start codons at 10, 204, 214, 245, 410
confident = false
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk075-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk075-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

10.098 seconds used processing barcodes, peak mem = 0.23
