[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.59 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk068-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk068-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk068.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.0 = GCGCAACAGGCATGGT-1

using 257 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [5]

====================================================================================

UMI info for barcode GCGCAACAGGCATGGT-1 contig 1 = ATCAGTCCCA...
umi TCTGACTAGG = 243 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=477]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-477 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.8 = GCGCAACAGTTCCACA-1

using 88 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[88]
surviving nonsolo ucounts = 1[88]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.16 = GCGCAACCAAGGTGTG-1

using 334 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 5, 321]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.19 = GCGCAACCAATGCCAT-1

using 208 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 10[2^3, 3^3, 8, 9, 17, 157]
surviving nonsolo ucounts = 1[157]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=555]
0-57 ==> 32-89 on segment before IGKV3OR2-268 exon 2 [len=221] (mis=0)
14-183 ==> 0-169 on rc of segment before IGKV3-15 exon 1 [len=169] (mis=0)
14-183 ==> 0-169 on segment before IGKV3D-15 exon 2 [len=169] (mis=0)
180-479 ==> 46-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
480-519 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
519-555 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNNWPPYTF at 455, score = 9 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 25, 95, 150, 203, 339
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.20 = GCGCAACCAATGGAAT-1

using 114 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3^2, 105]
surviving nonsolo ucounts = 1[105]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.23 = GCGCAACCACAAGTAA-1

using 108 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 1[98]
surviving nonsolo ucounts = 1[98]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=485]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
28-372 ==> 0-344 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=18)
372-485 ==> 23-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 25, 28, 83, 97, 350, 391
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.24 = GCGCAACCACAGCGTC-1

using 261 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 5, 251]
surviving nonsolo ucounts = 1[251]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACCACAGCGTC-1 contig 1 = GGTCAGTCCC...
umi AATCTGAACA = 253 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=548]
30-278 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLHYDNRRRTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 30, 86, 99, 238, 361, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.25 = GCGCAACCACATGACT-1

using 222 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 217]
surviving nonsolo ucounts = 1[217]
ids = [3]

====================================================================================

UMI info for barcode GCGCAACCACATGACT-1 contig 1 = AGTGACTCCT...
umi TTAATCATCC = 208 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=542]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=3)
393-441 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
441-542 ==> 0-101 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CARRRSPWFGALDYW at 365, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 20, 64, 243, 246, 326, 335, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.27 = GCGCAACCACCGATAT-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.28 = GCGCAACCACGAGGTA-1

using 238 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 232]
surviving nonsolo ucounts = 1[232]
ids = [4]

====================================================================================

UMI info for barcode GCGCAACCACGAGGTA-1 contig 1 = GCTGGGGTCT...
umi TGTTAGCAAC = 238 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=642]
0-41 ==> 122-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
41-367 ==> 0-326 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=13)
394-432 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
432-642 ==> 0-210 on |305|IGLC1|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 48 reads
cdr3 = CCSYAGGNIFHVF at 365, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 41, 198, 249, 258, 348, 396, 564
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.29 = GCGCAACCACGCATCG-1

using 321 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[317]
surviving nonsolo ucounts = 1[317]
ids = [1]

====================================================================================

UMI info for barcode GCGCAACCACGCATCG-1 contig 1 = AGTCCCAACC...
umi CCTCGGCACT = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 11-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
20-371 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=23)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYDDLPITF at 347, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 20, 26, 82, 95, 357, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.31 = GCGCAACCAGACGTAG-1

using 285 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 6, 7, 261]
surviving nonsolo ucounts = 1[261]
ids = [4]

====================================================================================

UMI info for barcode GCGCAACCAGACGTAG-1 contig 1 = GCTCTGCTTC...
umi ATTATATAGG = 246 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=563]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-391 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
404-442 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
442-563 ==> 0-121 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CQSYDKSLRGAVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 51, 135, 208, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.32 = GCGCAACCAGATAATG-1

using 289 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 1[289]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACCAGATAATG-1 contig 1 = GGAGGAACTG...
umi CTTCATGGCC = 287 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.34 = GCGCAACCAGATGGCA-1

using 226 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [3]

====================================================================================

UMI info for barcode GCGCAACCAGATGGCA-1 contig 1 = GCAGGAGTCA...
umi CGCTCGCAAT = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=16)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQSYSTPWQF at 356, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 29, 35, 91, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.38 = GCGCAACCAGTAAGAT-1

using 295 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[9, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.47 = GCGCAACCATGAAGTA-1

using 210 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 206]
surviving nonsolo ucounts = 1[206]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACCATGAAGTA-1 contig 1 = TGGGGAGCTC...
umi ACAGTTGTCT = 207 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=570]
84-437 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=22)
451-499 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
499-570 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 8 reads
cdr3 = CARDYSGQYSIDYW at 426, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 84, 301, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.49 = GCGCAACCATGCTAGT-1

using 153 reads

====================================================================================

graph has 75 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3, 4, 5, 138]
surviving nonsolo ucounts = 1[138]
ids = [5]

====================================================================================

UMI info for barcode GCGCAACCATGCTAGT-1 contig 1 = GTGGGTCCAG...
umi TCTCGGGTCT = 129 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=528]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
417-528 ==> 0-111 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQSADSSGTYWVF at 350, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 35, 96, 165, 183
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.68 = GCGCAACGTCCTCCAT-1

using 249 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACGTCCTCCAT-1 contig 1 = TCTGGCACCA...
umi CTACCGTATT = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-59 ==> 0-25 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=0)
59-382 ==> 28-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=2)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
422-547 ==> 0-125 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLLSYSGARPRVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 34, 239, 338
confident = false
see deletion of 3 bases at pos 25 on |388|IGLV7-46|L-REGION+V-REGION|
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.70 = GCGCAACGTCGAGATG-1

using 173 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 170]
surviving nonsolo ucounts = 1[170]
ids = [1]

====================================================================================

UMI info for barcode GCGCAACGTCGAGATG-1 contig 1 = GATCAGGACT...
umi GTCCGTGGAT = 1 reads: -365 +8 -1X +2 -1X +3 -1 +1 -1 +16 -1 invalidated
umi GTCCGTGGGA = 166 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=472]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-472 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQTPLFTF at 366, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.85 = GCGCAACGTTCCCTTG-1

using 276 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACGTTCCCTTG-1 contig 1 = GAGCTACAAC...
umi TTCATTACTG = 280 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.87 = GCGCAACTCAACACTG-1

using 295 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 288]
surviving nonsolo ucounts = 1[288]
ids = [5]

====================================================================================

UMI info for barcode GCGCAACTCAACACTG-1 contig 1 = GAGGAATCAG...
umi TTACATATCC = 275 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=487]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-487 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.93 = GCGCAACTCAGTCAGT-1

using 311 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 304]
surviving nonsolo ucounts = 1[304]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACTCAGTCAGT-1 contig 1 = GTCAGACCCA...
umi CCATAGGTTC = 302 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=541]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNSYTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 23, 29, 85, 98, 330, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.101 = GCGCAACTCCGCGCAA-1

using 456 reads

====================================================================================

graph has 198 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[17, 437]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.102 = GCGCAACTCCGGCACA-1

using 420 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 6, 7, 134, 267]
surviving nonsolo ucounts = 2[134, 267]
ids = [3, 2]

====================================================================================

UMI info for barcode GCGCAACTCCGGCACA-1 contig 1 = GGGAGTCAGT...
umi CCGCCGTAGG = 269 reads: +391 validated
umi CCGCCGTGGG = 137 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 2 umis using 63 reads
cdr3 = CQQSYSTPRFTF at 354, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 399
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.109 = GCGCAACTCGCCAGCA-1

using 277 reads

====================================================================================

graph has 78 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[14, 258]
surviving nonsolo ucounts = 1[258]
ids = [4]

====================================================================================

UMI info for barcode GCGCAACTCGCCAGCA-1 contig 1 = GAGCTACAAC...
umi GTTCACCGTG = 257 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=4)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYSTPLF at 369, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 30, 99, 352, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.110 = GCGCAACTCGCGGATC-1

using 849 reads

====================================================================================

graph has 318 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[6, 8, 237, 262, 335]
surviving nonsolo ucounts = 3[237, 262, 335]
ids = [3, 2, 4]

====================================================================================

UMI info for barcode GCGCAACTCGCGGATC-1 contig 1 = GAGCTCACAT...
umi CCGGCTCCTG = 271 reads: +436 validated
umi CGTGCGTTTC = 237 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=649]
0-31 ==> 0-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=1)
31-402 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
419-467 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
467-649 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 71 reads
cdr3 = CARYFAFVNYYFDKW at 391, score = 9 + 7
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 494
start codons at 8, 31, 52, 96
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.114 = GCGCAACTCTGCCAGG-1

using 141 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

UMI info for barcode GCGCAACTCTGCCAGG-1 contig 1 = AAAAACCACA...
umi GGGTCCAGGC = 134 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=512]
0-50 ==> 9-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
50-403 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
452-486 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
486-512 ==> 0-26 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 11 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 392, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 50, 248, 253, 270, 314, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.124 = GCGCAGTAGAACTGTA-1

using 423 reads

====================================================================================

graph has 324 edges initially, 2 edges after simplification

total ucounts = 21
nonsolo ucounts = 17[2, 4^2, 5, 6, 7, 8^2, 9, 10^2, 11, 13, 16, 17, 20, 269]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=394]
7-62 ==> 2252-2307 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=0)
58-220 ==> 5838-6000 on rc of segment after IGKJ1 exon 1 [len=6000] (mis=1)
220-258 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
258-394 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [12]
of which 0 are surviving nonsolos
reads assigned: 265
start codons at 28, 83, 88, 201, 300
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.127 = GCGCAGTAGAATTGTG-1

using 530 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 106, 420]
surviving nonsolo ucounts = 2[106, 420]
ids = [0, 2]

====================================================================================

UMI info for barcode GCGCAGTAGAATTGTG-1 contig 1 = TCTCAGGAGG...
umi CTCATGCCAG = 102 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 7-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
34-387 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
422-552 ==> 0-130 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CSSYTSSSTLVF at 358, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 102
start codons at 34, 191, 235, 242
confident = false

REJECT CONTIGS

TIG 1[bases=390]
0-128 ==> 225-353 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=15)
145-208 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=8)
208-390 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARGREYASGQDYYYGMDVW at 117, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 136, 165
confident = false
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.128 = GCGCAGTAGACAATAC-1

using 87 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 9[2, 4^2, 6, 8, 11, 15, 17, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.137 = GCGCAGTAGCTAGGCA-1

using 218 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[214]
surviving nonsolo ucounts = 1[214]
ids = [0]

====================================================================================

UMI info for barcode GCGCAGTAGCTAGGCA-1 contig 1 = GGAACTGCTC...
umi GAAACAACAG = 203 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=505]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
385-422 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
422-505 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQRSNWPPGGLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 31, 236, 239, 464
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.138 = GCGCAGTAGCTAGTGG-1

using 400 reads

====================================================================================

graph has 128 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[100, 297]
surviving nonsolo ucounts = 1[297]
ids = [1]

====================================================================================

UMI info for barcode GCGCAGTAGCTAGTGG-1 contig 1 = TATTTGGGAG...
umi CAGAATTGCC = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYSTLLTF at 359, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 32, 38, 94, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.140 = GCGCAGTAGCTCCTCT-1

using 468 reads

====================================================================================

graph has 80 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 207, 258]
surviving nonsolo ucounts = 2[207, 258]
ids = [3, 1]

====================================================================================

UMI info for barcode GCGCAGTAGCTCCTCT-1 contig 1 = GGAGTCAGAC...
umi ATTCATTACG = 258 reads: +388 validated

UMI info for barcode GCGCAGTAGCTCCTCT-1 contig 2 = GGCGCCAGGG...
umi GATCCGCTCT = 179 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQQYNSYSWTF at 353, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 26, 32, 88, 101, 333, 456
confident = false

TIG 2[bases=569]
0-31 ==> 3-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
31-368 ==> 0-337 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=9)
378-416 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
416-569 ==> 0-153 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CLLYFGDSWLF at 355, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 179
start codons at 31
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.143 = GCGCAGTAGGACTGGT-1

using 243 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode GCGCAGTAGGACTGGT-1 contig 1 = GCTGGGGTCA...
umi TCGATCTCAG = 237 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=563]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
435-563 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=3)
junction support: 1 umis using 45 reads
cdr3 = CCSEAGGGVPGLLF at 365, score = 7 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 41, 195
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.150 = GCGCAGTAGGGTTTCT-1

using 176 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[5, 169]
surviving nonsolo ucounts = 1[169]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTAGGGTTTCT-1 contig 1 = GAAGAGCTGC...
umi CGTCGACCTT = 169 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=504]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=16)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
418-504 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CQQYGSSPRTF at 357, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 33, 237, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.152 = GCGCAGTAGTAACCCT-1

using 574 reads

====================================================================================

graph has 228 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 261, 307]
surviving nonsolo ucounts = 2[261, 307]
ids = [0, 4]

====================================================================================

UMI info for barcode GCGCAGTAGTAACCCT-1 contig 1 = GGAGGAGTCA...
umi AGGTCTCGGA = 259 reads: +388 validated
umi TCGCTCGACA = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=1)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=22)
378-417 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CLQDHNYPFTF at 356, score = 9 + 8
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 558
start codons at 29, 35, 91, 104, 186, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.153 = GCGCAGTAGTATGACA-1

using 917 reads

====================================================================================

graph has 342 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 7[2^3, 5, 251, 322, 329]
surviving nonsolo ucounts = 2[251, 322]
ids = [0, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=560]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-222 ==> 0-192 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=3)
222-389 ==> 193-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=11) [SHIFT!]
386-424 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=6)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0, 2, 9]
of which 2 are surviving nonsolos
reads assigned: 584
start codons at 30, 63, 99, 187, 249, 282, 348, 368, 422, 466
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.157 = GCGCAGTAGTGTGGCA-1

using 237 reads

====================================================================================

graph has 104 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[5, 36, 193]
surviving nonsolo ucounts = 2[36, 193]
ids = [2, 1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=501]
0-272 ==> 24-296 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
0-294 ==> 24-318 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=20)
9-129 ==> 27-147 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=28)
129-327 ==> 150-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=29)
327-365 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
365-501 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 33
start codons at 38, 51, 187, 190, 313, 407
confident = false
see deletion of 3 bases at pos 147 on |292|IGKV3D-20|L-REGION+V-REGION|
did not find CDR3

TIG 2[bases=557]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-35 ==> 5965-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 35, 243, 369, 463
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.160 = GCGCAGTCAAAGGTGC-1

using 287 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 9, 10, 265]
surviving nonsolo ucounts = 1[265]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTCAAAGGTGC-1 contig 1 = AGGAATCAGA...
umi CTTCCTCGCT = 268 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.161 = GCGCAGTCAAGAGGCT-1

using 216 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[212]
surviving nonsolo ucounts = 1[212]
ids = [1]

====================================================================================

UMI info for barcode GCGCAGTCAAGAGGCT-1 contig 1 = GAGAGAGGAG...
umi CACGATTGAA = 205 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=544]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-544 ==> 0-47 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.165 = GCGCAGTCAATGGACG-1

using 475 reads

====================================================================================

graph has 196 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[209, 263]
surviving nonsolo ucounts = 2[209, 263]
ids = [1, 4]

====================================================================================

UMI info for barcode GCGCAGTCAATGGACG-1 contig 1 = GAGGAACTGC...
umi TTAGTCGGGG = 263 reads: +379 validated

UMI info for barcode GCGCAGTCAATGGACG-1 contig 2 = GGCTTTTCTG...
umi AGCATGATTG = 188 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQRSNWWTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 33, 238, 241, 454
confident = false

TIG 2[bases=527]
16-387 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
404-452 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
452-527 ==> 0-75 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARAHGDYYTLLDYW at 376, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 16, 37, 81, 167, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.169 = GCGCAGTCACCCATTC-1

using 234 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 226]
surviving nonsolo ucounts = 1[226]
ids = [5]

====================================================================================

UMI info for barcode GCGCAGTCACCCATTC-1 contig 1 = AGCTCTGAGA...
umi TTGACAAGTA = 221 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=534]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=1)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=20)
455-503 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
503-534 ==> 0-31 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARKWGLNTVTAAFDYW at 421, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 79, 235, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.173 = GCGCAGTCACGGCGTT-1

using 543 reads

====================================================================================

graph has 160 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[9, 179, 355]
surviving nonsolo ucounts = 2[179, 355]
ids = [2, 0]

====================================================================================

UMI info for barcode GCGCAGTCACGGCGTT-1 contig 1 = AAATACTTTC...
umi GAGGGCACTC = 170 reads: +451 validated

UMI info for barcode GCGCAGTCACGGCGTT-1 contig 2 = GCAGGAGTCA...
umi ACTATCCAGC = 324 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=542]
0-39 ==> 106-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
39-389 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=15)
444-490 ==> 6-52 on |50|IGHJ2|J-REGION| [len=52] (mis=1)
490-542 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDSPENRFVFTRREETTSVNYFDLW at 378, score = 9 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 169
start codons at 39, 83
confident = false

TIG 2[bases=477]
0-29 ==> 18-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=10)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
411-477 ==> 0-66 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQAKSFSF at 356, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 29, 35, 91, 104, 240, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.176 = GCGCAGTCAGATCTGT-1

using 300 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[298]
surviving nonsolo ucounts = 1[298]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTCAGATCTGT-1 contig 1 = GGAGGAACTG...
umi TTAATCGATG = 306 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=549]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNNWRTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 34, 103, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.177 = GCGCAGTCAGATGAGC-1

using 318 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 307]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.178 = GCGCAGTCAGATGGCA-1

using 173 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[2^2, 3^2, 5, 6, 14, 135]
surviving nonsolo ucounts = 1[135]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTCAGATGGCA-1 contig 1 = GATTCAGTGA...
umi AGTTCCGCAG = 123 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=492]
36-391 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=27)
403-466 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
466-492 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CAKESHAGSSYYYYGMDVW at 378, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 121
start codons at 36, 181, 187, 192, 271, 339, 423
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.187 = GCGCAGTCATCATCCC-1

using 234 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 6, 222]
surviving nonsolo ucounts = 1[222]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTCATCATCCC-1 contig 1 = GCTCTGCTTC...
umi CTCACCGCCT = 214 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=588]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-588 ==> 0-146 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.188 = GCGCAGTCATCGGACC-1

using 309 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode GCGCAGTCATCGGACC-1 contig 1 = GGGAATCAGT...
umi AAAATCTGCT = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.190 = GCGCAGTCATGCATGT-1

using 248 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTCATGCATGT-1 contig 1 = GAAGTGCTTT...
umi GACTTGATAA = 198 reads: +464 -1 +1 non-validated

GOOD CONTIGS

TIG 1[bases=485]
0-19 ==> 12-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
19-390 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=4)
399-429 ==> 0-30 on |19|IGHD3-16|D-REGION| [len=37] (mis=2)
437-485 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARAGPKDYDYIWGSYRPQYYFDYW at 379, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 19, 40, 84, 170, 404
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.191 = GCGCAGTCATGCCTAA-1

using 329 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[12, 317]
surviving nonsolo ucounts = 1[317]
ids = [0]

====================================================================================

UMI info for barcode GCGCAGTCATGCCTAA-1 contig 1 = TGGGGGAGGA...
umi ATCCTTACCG = 320 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQSYSTLETF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 33, 39, 95, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.193 = GCGCAGTCATGGGAAC-1

using 254 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[252]
surviving nonsolo ucounts = 1[252]
ids = [1]

====================================================================================

UMI info for barcode GCGCAGTCATGGGAAC-1 contig 1 = GCTCTGCTTC...
umi TGACGCTCTT = 221 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=526]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=23)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
442-526 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQSYDSSLNGSVF at 375, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 51, 135, 208, 358, 385, 400
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.194 = GCGCAGTCATGGTCTA-1

using 295 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[292]
surviving nonsolo ucounts = 1[292]
ids = [3]

====================================================================================

UMI info for barcode GCGCAGTCATGGTCTA-1 contig 1 = GAGGAACTGC...
umi TCTACTCTCG = 270 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=486]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
412-486 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWLTF at 354, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 33, 238, 241, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.197 = GCGCAGTGTACAGTGG-1

using 593 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 589]
surviving nonsolo ucounts = 1[589]
ids = [3]

====================================================================================

UMI info for barcode GCGCAGTGTACAGTGG-1 contig 1 = GGGAGCATCA...
umi TTAGTTGGCT = 592 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=544]
0-64 ==> 0-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=1)
64-417 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=2)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CARSPKGLFDYW at 406, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 585
start codons at 64, 220, 262, 267, 299, 328, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.203 = GCGCAGTGTATGCTTG-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.208 = GCGCAGTGTGATGCCC-1

using 91 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[7, 82]
surviving nonsolo ucounts = 1[82]
ids = [3]

====================================================================================

UMI info for barcode GCGCAGTGTGATGCCC-1 contig 1 = TCAGGACGTC...
umi TGTGGTTACA = 80 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=536]
16-350 ==> 0-334 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=8)
366-404 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
404-536 ==> 0-132 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CSSFPGSIFGLF at 340, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 78
start codons at 16, 173, 224, 323
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.209 = GCGCAGTGTGTAACGG-1

using 46 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2, 3, 5^2, 10, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.212 = GCGCAGTGTGTTAAGA-1

using 467 reads

====================================================================================

graph has 180 edges initially, 18 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[222, 244]
surviving nonsolo ucounts = 2[222, 244]
ids = [2, 0]

====================================================================================

UMI info for barcode GCGCAGTGTGTTAAGA-1 contig 1 = AGCTGTGGGC...
umi ATTCAACACG = 240 reads: +379 validated

UMI info for barcode GCGCAGTGTGTTAAGA-1 contig 2 = GCTGTGGGTC...
umi TGCCCATCCT = 216 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=560]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-560 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CNSRDSSGNVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 40, 159, 188, 239, 338, 380
confident = false

TIG 2[bases=558]
0-38 ==> 5-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
38-375 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
379-417 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
417-558 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSADSSGTWVF at 353, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 213
start codons at 38, 99, 168, 186
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.216 = GCGCAGTGTTCCCTTG-1

using 596 reads

====================================================================================

graph has 190 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[245, 351]
surviving nonsolo ucounts = 2[245, 351]
ids = [0, 1]

====================================================================================

UMI info for barcode GCGCAGTGTTCCCTTG-1 contig 1 = ACCCAAAAAC...
umi CTATTTCGCA = 240 reads: +409 validated

UMI info for barcode GCGCAGTGTTCCCTTG-1 contig 2 = TACAACAGGC...
umi CTCATGGGCG = 351 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=515]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
463-515 ==> 0-52 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 54, 205, 252, 257, 289, 351
confident = false

TIG 2[bases=562]
0-26 ==> 149-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
26-389 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYYGSPRTF at 365, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 23, 26, 81, 95, 348, 378, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.219 = GCGCAGTGTTGCTCCT-1

using 318 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[30, 287]
surviving nonsolo ucounts = 1[287]
ids = [0]

====================================================================================

UMI info for barcode GCGCAGTGTTGCTCCT-1 contig 1 = AATCAGTCCC...
umi TAATAGTATT = 287 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 3-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
24-375 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 24, 30, 99, 235, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.224 = GCGCAGTGTTTGTTGG-1

using 246 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [2]

====================================================================================

UMI info for barcode GCGCAGTGTTTGTTGG-1 contig 1 = GTGGGCTCAG...
umi GTTGTGCCCC = 243 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-559 ==> 0-139 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.243 = GCGCAGTTCTACCTGC-1

using 311 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 4, 297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode GCGCAGTTCTACCTGC-1 contig 1 = GATCAGGACT...
umi AGAGGTAAGC = 296 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CMQALQTPPYTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.244 = GCGCAGTTCTGAAAGA-1

using 364 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 361]
surviving nonsolo ucounts = 1[361]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.247 = GCGCCAAAGACTAGAT-1

using 251 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 8^2, 231]
surviving nonsolo ucounts = 1[231]
ids = [1]

====================================================================================

UMI info for barcode GCGCCAAAGACTAGAT-1 contig 1 = AGCTTCAGCT...
umi ATCACTGGGG = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=586]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-586 ==> 0-151 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.259 = GCGCCAAAGCCCAGCT-1

using 339 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[332]
surviving nonsolo ucounts = 1[332]
ids = [7]

====================================================================================

UMI info for barcode GCGCCAAAGCCCAGCT-1 contig 1 = GGGGTGGTGC...
umi TTATACTCTC = 283 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=558]
17-350 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=29)
361-399 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
399-558 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQVWDSDGHYVVF at 332, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 17, 78, 147, 315, 351, 360
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.264 = GCGCCAAAGCGTCAAG-1

using 249 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[247]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.268 = GCGCCAAAGCTGCAAG-1

using 39 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 32]
surviving nonsolo ucounts = 1[32]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.278 = GCGCCAAAGGTGACCA-1

using 222 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 213]
surviving nonsolo ucounts = 1[213]
ids = [0]

====================================================================================

UMI info for barcode GCGCCAAAGGTGACCA-1 contig 1 = GGGGTCACAA...
umi AAAGGCGGCG = 203 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=492]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=3)
385-423 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
423-492 ==> 0-69 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CCSYAGHYFVF at 362, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 199
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.279 = GCGCCAAAGGTGATTA-1

using 515 reads

====================================================================================

graph has 210 edges initially, 8 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 219, 291]
surviving nonsolo ucounts = 2[219, 291]
ids = [2, 0]

====================================================================================

UMI info for barcode GCGCCAAAGGTGATTA-1 contig 1 = AGCTTCAGCT...
umi CGTGCGCCAC = 218 reads: +388 validated
umi GTAGCTACAC = 1 reads: -21 +17 -5X +5 -1 +15 -2X +11 -311 invalidated

UMI info for barcode GCGCCAAAGGTGATTA-1 contig 2 = GGAACTGCTC...
umi CAATGGACCC = 292 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=549]
0-31 ==> 16-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
31-376 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQRSNWPLTF at 352, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 31, 239, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.285 = GCGCCAAAGTGATCGG-1

using 258 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode GCGCCAAAGTGATCGG-1 contig 1 = ATCACATAAC...
umi TTAGTTCCCT = 228 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=489]
0-58 ==> 0-58 on |89|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |90|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=21)
426-461 ==> 14-49 on |52|IGHJ3|J-REGION| [len=49] (mis=0)
461-489 ==> 0-28 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDPGAGPW at 400, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 58, 274, 355, 442
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.296 = GCGCCAACAAGTACCT-1

using 244 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[239]
surviving nonsolo ucounts = 1[239]
ids = [4]

====================================================================================

UMI info for barcode GCGCCAACAAGTACCT-1 contig 1 = CCTCAGTTCA...
umi GATAATGGGA = 227 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=455]
0-20 ==> 10-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
20-380 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
420-455 ==> 0-35 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CMQALQTPLFTF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 222
start codons at 20, 53, 89, 177, 339, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.300 = GCGCCAACACCAGCAC-1

using 361 reads

====================================================================================

graph has 112 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[44, 317]
surviving nonsolo ucounts = 2[44, 317]
ids = [1, 0]

====================================================================================

UMI info for barcode GCGCCAACACCAGCAC-1 contig 1 = AGGAGTCAGT...
umi ACCGGTTATG = 315 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 4-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
27-378 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDNLPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 27, 33, 89, 102, 241, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.302 = GCGCCAACACGAAACG-1

using 345 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 342]
surviving nonsolo ucounts = 1[342]
ids = [0]

====================================================================================

UMI info for barcode GCGCCAACACGAAACG-1 contig 1 = GAGGAACTGC...
umi ACTATGCGTA = 344 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 338
start codons at 33, 238, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.304 = GCGCCAACACGAGAGT-1

using 323 reads

====================================================================================

graph has 494 edges initially, 19 edges after simplification

total ucounts = 183
nonsolo ucounts = 65[2^40, 3^10, 4^7, 5^3, 7, 8^2, 11, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.312 = GCGCCAACAGCCAATT-1

using 483 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[5, 211, 259]
surviving nonsolo ucounts = 2[211, 259]
ids = [5, 1]

====================================================================================

UMI info for barcode GCGCCAACAGCCAATT-1 contig 1 = GCTCTGCTTC...
umi CACGTTCGGC = 196 reads: +394 validated

UMI info for barcode GCGCCAACAGCCAATT-1 contig 2 = AGCTCTGGGA...
umi AGAGGCCACT = 245 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=531]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-531 ==> 0-86 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 195
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=562]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=5)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=51)
435-455 ==> 0-20 on |30|IGHD5-24|D-REGION| [len=20] (mis=3)
467-516 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
516-562 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAKDRRDGYIYSPGYYGLDVW at 422, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 80, 231, 315, 383, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.315 = GCGCCAACAGCGAACA-1

using 182 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^3, 174]
surviving nonsolo ucounts = 1[174]
ids = [4]

====================================================================================

UMI info for barcode GCGCCAACAGCGAACA-1 contig 1 = ATCACATAAC...
umi TTCACACCTC = 170 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=543]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=12)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=1)
431-494 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
494-543 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CARVGYSSSSSYHYYYAMDVW at 400, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 165
start codons at 58, 209, 256, 355, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.321 = GCGCCAACAGGACGTA-1

using 666 reads

====================================================================================

graph has 268 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[291, 373]
surviving nonsolo ucounts = 2[291, 373]
ids = [2, 3]

====================================================================================

UMI info for barcode GCGCCAACAGGACGTA-1 contig 1 = GGGGAGGAAC...
umi TCAAGGGTAC = 375 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=551]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=2)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQRSNWLTF at 357, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 368
start codons at 36, 241, 244, 457
confident = false

REJECT CONTIGS

TIG 1[bases=569]
0-79 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
34-394 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
395-433 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
433-569 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 354, score = 4 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 34, 67, 103, 191, 353, 373, 475
confident = false
not full
frameshifted full length transcript of length 569
VJ delta = 30
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.325 = GCGCCAACAGTCAGAG-1

using 74 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 13[2^3, 3^2, 4^2, 5^2, 7^2, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.332 = GCGCCAACATATGAGA-1

using 19 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.338 = GCGCCAACATGTCGAT-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.348 = GCGCCAAGTCCATGAT-1

using 32613 reads

====================================================================================

graph has 9704 edges initially, 78 edges after simplification

total ucounts = 854
nonsolo ucounts = 370[2^123, 3^51, 4^26, 5^21, 6^7, 7^8, 8^6, 9^3, 11, 13^2, 19, 22, 25, 32, 33, 34, 55, 62^2, 86, 93, 100, 106, 109, 130, 131, 142, 143, 147, 151, 156, 159, 175^2, 177, 179^2, 184, 187, 188, 192, 198, 203, 204, 206, 207, 209, 210, 215, 221^3, 222, 224, 227, 228, 237, 240, 242^2, 243, 250, 251, 254, 256^2, 257^2, 259^2, 260, 267^2, 269, 270, 272, 274, 276, 279^4, 282^2, 284, 285^2, 286^2, 288, 291, 297, 299^2, 301, 304, 309, 310, 312, 313^3, 314, 316, 317, 322, 324, 325, 326, 328, 331, 332, 346, 349, 352, 358, 364^2, 368, 376^2, 378, 402, 405, 414, 430, 445, 453, 484, 517, 653, 680]
surviving nonsolo ucounts = 105[55, 93, 109, 130, 131, 143, 151, 156, 175, 177, 179^2, 184, 188, 192, 198, 203, 204, 206, 207, 209, 210, 215, 221^3, 222, 224, 227, 228, 237, 240, 242^2, 243, 250, 251, 254, 256^2, 257^2, 259^2, 260, 267^2, 269, 270, 272, 274, 276, 279^4, 282^2, 284, 285^2, 286^2, 288, 291, 299^2, 301, 304, 309, 310, 312, 313^3, 314, 316, 317, 322, 324, 325, 326, 328, 331, 332, 346, 349, 352, 358, 364^2, 368, 376^2, 378, 402, 405, 414, 430, 445, 453, 484, 517, 653, 680]
ids = [765, 106, 606, 354, 315, 150, 615, 577, 762, 193, ...]

====================================================================================

UMI info for barcode GCGCCAAGTCCATGAT-1 contig 1 = AGAGCTCTGG...
umi AAACCACGAT = 281 reads: +385 validated
umi AAGTCGTTTG = 372 reads: +385 validated
umi AATATGAGGG = 260 reads: +385 validated
umi AATCGCCATC = 286 reads: +385 validated
umi AGACCTTTAA = 253 reads: +385 validated
umi AGATCTTCAC = 369 reads: +385 validated
umi AGATTTGTCT = 287 reads: +385 validated
umi AGGATCACGC = 312 reads: +385 validated
umi AGTGAAGGGT = 310 reads: +385 validated
umi ATAACATTAT = 282 reads: +385 validated
umi ATCGTTCCAC = 320 reads: +385 validated
umi ATCTTGTACT = 284 reads: +385 validated
umi ATGCAGTTCA = 254 reads: +385 validated
umi ATGCATGCGT = 322 reads: +385 validated
umi ATGCTTGGGG = 254 reads: +385 validated
umi ATGTCCTACC = 200 reads: +385 validated
umi CAACAACTGT = 428 reads: -134 +251 non-validated
umi CATCTCTGGA = 219 reads: +385 validated
umi CATTACACCA = 330 reads: +385 validated
umi CCCATGCCGC = 310 reads: +275 -1 +109 non-validated
umi CCCTCCTGGG = 650 reads: +385 validated
umi CGAGCAATAT = 209 reads: +385 validated
umi CGCCTCCGTG = 425 reads: -347X +1 -1XX +4 -1XX +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi CGGAGCTGGG = 224 reads: +385 validated
umi CGTATACATT = 340 reads: +385 validated
umi CGTCGAATAG = 280 reads: +385 validated
umi CGTCGTTCAA = 300 reads: +385 validated
umi CGTTCTTATA = 223 reads: +385 validated
umi CTCTAGCCCT = 395 reads: +168 -1XX +216 invalidated
umi CTGGAGCGTC = 275 reads: +385 validated
umi CTGGTCTCTC = 328 reads: +385 validated
umi CTGTCATCGC = 235 reads: +18 -1XX +366 invalidated
umi CTTGCCGCCA = 385 reads: -347 +1 -1XX +4 -1XX +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi CTTGGGGGGT = 316 reads: +385 validated
umi CTTTATCAAT = 314 reads: +385 validated
umi GAATAACATA = 199 reads: +385 validated
umi GACTTCGAGC = 342 reads: +283 -1XX +101 invalidated
umi GACTTGAGGG = 322 reads: +385 validated
umi GAGCAAAGTC = 268 reads: +385 validated
umi GATCCTAGGG = 291 reads: +385 validated
umi GATTACCTAT = 367 reads: +385 validated
umi GCCCAAACCC = 262 reads: +385 validated
umi GCCCACCTCG = 245 reads: +385 validated
umi GCCCTGACTT = 300 reads: +385 validated
umi GCGGGTCGAG = 363 reads: +385 validated
umi GCTGTCTGGC = 267 reads: +385 validated
umi GCTTCCTCTT = 240 reads: +385 validated
umi GCTTGCTCTC = 230 reads: +13 -7XX +1 -3XX +361 invalidated
umi GGACTCTCAG = 338 reads: +385 validated
umi GGATTGACCA = 304 reads: +385 validated
umi GGCAAGCGAC = 238 reads: +385 validated
umi GGGCGTACTT = 279 reads: +385 validated
umi GTAACACATG = 209 reads: +385 validated
umi GTAGTTTCCA = 475 reads: -347X +1 -1XX +4 -1XX +2 -1XX +5 -1XX +8 -2XX +4 -1XX +7 invalidated
umi GTATGGCCGC = 402 reads: +385 validated
umi GTATTCCGCG = 262 reads: +385 validated
umi GTCCGAGCCC = 158 reads: +385 validated
umi GTTATCTCTC = 185 reads: +385 validated
umi GTTATGAGGA = 277 reads: +385 validated
umi GTTCCAGCGG = 111 reads: +385 validated
umi TAACAGCTGA = 300 reads: +385 validated
umi TACGCAGGTC = 259 reads: +385 validated
umi TCAACCTCAT = 242 reads: +385 validated
umi TCCACTTCTC = 316 reads: +385 validated
umi TCCCATTTCT = 243 reads: +385 validated
umi TCCCTCGCAA = 380 reads: +385 validated
umi TCGTTCCGCC = 192 reads: +385 validated
umi TCTAAGAACG = 400 reads: +385 validated
umi TCTACCTGCT = 102 reads: +357 -28 non-validated
umi TCTCTGTTCA = 270 reads: +385 validated
umi TCTTTGTCGC = 201 reads: +385 validated
umi TGCTTGCGCA = 351 reads: +385 validated
umi TGTATTGCTC = 314 reads: +385 validated
umi TGTGGCGCAC = 254 reads: +385 validated
umi TTAACGCCAA = 283 reads: +385 validated
umi TTCGTTTCGC = 272 reads: +385 validated
umi TTTACTGCTA = 217 reads: +385 validated
umi TTTTCGCTCT = 222 reads: +385 validated

UMI info for barcode GCGCCAAGTCCATGAT-1 contig 2 = AGCTCTGGGA...
umi AGGAAGTCGT = 80 reads: +408 -28 non-validated
umi ATCTTCGAAC = 124 reads: +366 -1 +49 -20 non-validated
umi CACACCCCGA = 157 reads: +436 validated
umi CACTTTAGGT = 221 reads: +407 -29 non-validated
umi CGCAAATCTA = 105 reads: +404 -1 +24 -7 non-validated
umi CGTCTCAGAC = 117 reads: +213 -2XX +209 -12 invalidated
umi CTCGTGCTAG = 187 reads: +413 -23 non-validated
umi CTCTTTTCAG = 163 reads: +427 -9 non-validated
umi CTTGGAAGCT = 212 reads: +434 -2 non-validated
umi GAGCAGCGTG = 249 reads: +436 validated
umi TCTTCCACTG = 199 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 73 umis using 3372 reads
cdr3 = CQQYGSSPGTF at 368, score = 9 + 8
umis assigned: [5, 29, 31, 33, 88, 93, 94, 107, 115, 120] and 68 others
of which 78 are surviving nonsolos
reads assigned: 22202
start codons at 44, 252, 378, 471
confident = true

TIG 2[bases=572]
0-80 ==> 0-80 on |111|IGHV3-15|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |112|IGHV3-15|L-REGION+V-REGION| [len=359] (mis=14)
444-460 ==> 0-16 on |25|IGHD4-17|D-REGION| [len=16] (mis=3)
466-516 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=5)
516-572 ==> 0-56 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 58 reads
cdr3 = CTTGYWSTVTTRLWAFDIW at 428, score = 8 + 9
umis assigned: [106, 150, 193, 205, 315, 354, 385, 394, 428, 453] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1757
start codons at 80, 140, 236, 303, 332, 360, 374, 381, 389, 534
confident = true

REJECT CONTIGS

TIG 1[bases=493]
93-250 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
248-311 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
311-493 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
umis assigned: [165]
of which 0 are surviving nonsolos
reads assigned: 54
start codons at 100, 134, 173, 228, 268
confident = false
did not find CDR3

TIG 2[bases=343]
5-63 ==> 4685-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
63-273 ==> 0-210 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
272-343 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [70, 161, 204, 539, 765]
of which 5 are surviving nonsolos
reads assigned: 1403
start codons at 19, 63, 107
confident = false
did not find CDR3
now this is a cell
paired!

GCCGTGTATTACTGCACCACGGGCTATTGGTCCACGGTGACTACCCGGCTGTGGGCTTTTGATATCTGGGGCCAAGGGACAAGGGTCACCGTCTCTTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTACTACTGTCAGCAGTATGGTAGCTCACCGGGGACTTTTGGCCAGGGGACCAAACTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.355 = GCGCCAAGTCGCTTTC-1

using 25823 reads

====================================================================================

graph has 6840 edges initially, 56 edges after simplification

total ucounts = 938
nonsolo ucounts = 374[2^134, 3^59, 4^28, 5^15, 6^9, 7^11, 8, 9^5, 10, 11, 12, 13^3, 14, 25, 29, 34, 36, 39, 41^2, 55, 56, 62, 63, 65, 66, 67, 86, 98, 107^2, 120, 133, 135, 143, 148, 160, 161, 163, 169, 180, 184, 186, 187, 194, 196, 197, 202, 207, 216, 222, 224, 225, 228, 234, 235, 236, 238, 239^2, 242, 246, 247, 248, 252, 253, 254^2, 256^2, 258^3, 260, 268, 270, 271, 273, 274, 275, 276, 280, 281^2, 282, 286, 288, 290, 291, 292, 293^2, 294, 297, 298, 302, 303, 308^2, 311, 312, 313, 314, 316, 324, 327, 328, 330^2, 331, 333, 334, 345, 360, 366, 544, 557, 588]
surviving nonsolo ucounts = 97[14, 41, 62, 65, 66, 67, 86, 98, 107^2, 120, 133, 135, 143, 148, 160, 161, 163, 169, 180, 184, 186, 187, 194, 196, 197, 202, 207, 216, 222, 224, 225, 228, 234, 235, 236, 238, 239^2, 242, 246, 247, 248, 252, 253, 254^2, 256^2, 258^3, 260, 268, 270, 271, 273, 274, 275, 276, 280, 281^2, 282, 286, 288, 290, 291, 292, 293^2, 294, 297, 298, 302, 303, 308^2, 311, 312, 313, 314, 316, 324, 327, 328, 330^2, 331, 333, 334, 345, 360, 366, 544, 557, 588]
ids = [126, 361, 284, 285, 693, 168, 335, 660, 230, 251, ...]

====================================================================================

UMI info for barcode GCGCCAAGTCGCTTTC-1 contig 1 = CAGCTCTGGG...
umi AAAGCCCCGA = 504 reads: -408 +1 -2X +1 -1X +1 -8X +1 -11XX +2 -1XX +1 -6XX +1 invalidated
umi ACGATATCGC = 115 reads: +445 validated
umi AGCTGTAGAA = 14 reads: -412X +1 -1 +5 -1X +2 -1X +3 -2X +17 invalidated
umi AGTCCTCCTT = 142 reads: -445 non-validated
umi ATACTAGATG = 61 reads: -405 +2 -3X +9 -1XX +2 -1XX +3 -2XX +17 invalidated
umi ATTTGTGCAT = 102 reads: -445 non-validated
umi CATTGCGCCT = 65 reads: +445 validated
umi CGGTCGTGGT = 41 reads: -403X +1 -2X +1 -3X +9 -1X +2 -1X +3 -2X +17 invalidated
umi TCACCGCTTA = 66 reads: +445 validated
umi TTAACAGTAA = 307 reads: +445 validated
umi TTTTGCCCAG = 160 reads: +435 -1 +9 non-validated

UMI info for barcode GCGCCAAGTCGCTTTC-1 contig 2 = AGGAGTCAGA...
umi AAAACCATTA = 122 reads: +379 validated
umi AAAGAACAGC = 281 reads: +379 validated
umi AAATATCCGG = 236 reads: +379 validated
umi AAATGTCGGA = 262 reads: +379 validated
umi AACTTGGGTC = 279 reads: +379 validated
umi AATTTAGGCG = 295 reads: +379 validated
umi ACAGTACTGT = 270 reads: +379 validated
umi ACCTTACCCC = 560 reads: +379 validated
umi ACCTTTCCAT = 334 reads: +196 -1XX +182 invalidated
umi ACTACGTGGC = 294 reads: +379 validated
umi ACTATTGGGC = 201 reads: +379 validated
umi ACTCCCACCT = 228 reads: +379 validated
umi AGCATTCGGT = 292 reads: +379 validated
umi AGTAAAATCG = 305 reads: +379 validated
umi ATAAGGGAGT = 286 reads: +379 validated
umi ATATAATCGT = 255 reads: +379 validated
umi ATATTATCTG = 246 reads: +379 validated
umi ATGGTTCCGG = 264 reads: +379 validated
umi ATGGTTCTAC = 291 reads: +379 validated
umi ATTCCGTGAG = 198 reads: +379 validated
umi CAACACTGTT = 224 reads: +379 validated
umi CAACTCGTCC = 184 reads: +379 validated
umi CACCCGTTTA = 113 reads: +173 -1XX +205 invalidated
umi CACTTTAGGG = 253 reads: -54X +325 invalidated
umi CAGATGTATT = 299 reads: +379 validated
umi CAGGCCATCT = 292 reads: +379 validated
umi CATTTAATTA = 245 reads: +379 validated
umi CCCCTAGGCC = 156 reads: +379 validated
umi CCCCTATCAG = 308 reads: +379 validated
umi CCGTCCTGGT = 256 reads: +379 validated
umi CCTGGTATCA = 87 reads: -156X +2 -2X +1 -1X +2 -2X +213 invalidated
umi CCTGGTTTCT = 256 reads: -68 +1 -3X +1 -1XX +1 -6XX +2 -10XX +2 -1XX +30 -2X +1 -1X +1 -3XX +2 -2X +5 -1 +11 -1X +3 -1X +1 -1X +10 -1X +2 -1XX +2 -1X +2 -1XX +197 invalidated
umi CGGTTCCGGT = 258 reads: +379 validated
umi CGTCAATTCT = 312 reads: -73 +306 non-validated
umi CTAACCTCAA = 204 reads: +379 validated
umi CTAAGTCACT = 335 reads: +379 validated
umi CTACGCCGCG = 142 reads: +379 validated
umi CTTCAAGCCC = 236 reads: +379 validated
umi CTTTTTATTA = 263 reads: +379 validated
umi GACCTATTAA = 303 reads: +379 validated
umi GATTAACCCG = 246 reads: +379 validated
umi GCAAACTTGA = 221 reads: +379 validated
umi GCCATCTGGC = 290 reads: +379 validated
umi GCCGAAGTGC = 359 reads: +379 validated
umi GCTCGTATGG = 189 reads: +379 validated
umi GCTCTACCTA = 236 reads: +379 validated
umi GGATCGCAGG = 256 reads: +379 validated
umi GGATGCACCT = 330 reads: +379 validated
umi GTCCAGCCCC = 368 reads: +379 validated
umi GTGATTATTC = 133 reads: +379 validated
umi GTGCGCTGCG = 298 reads: +379 validated
umi GTTAAAGATC = 284 reads: +379 validated
umi GTTACCACTC = 308 reads: +379 validated
umi GTTGTTGAAG = 216 reads: +379 validated
umi TAATGTACTG = 158 reads: +379 validated
umi TAATTCGCTG = 170 reads: +379 validated
umi TACAATGGCG = 197 reads: +379 validated
umi TACGATCTGT = 297 reads: +379 validated
umi TAGCTAGATG = 242 reads: +379 validated
umi TAGTGGGGGG = 94 reads: -368 +11 non-validated
umi TCAACGTGCC = 284 reads: +379 validated
umi TCAACGTGTA = 187 reads: +379 validated
umi TCACAGCATT = 259 reads: +379 validated
umi TCACTGACTG = 325 reads: +379 validated
umi TCCCGTACTC = 132 reads: +379 validated
umi TCGCAATACT = 316 reads: +379 validated
umi TCTACCTACT = 225 reads: +379 validated
umi TCTGGTCCAT = 265 reads: +379 validated
umi TCTTTGTCGG = 238 reads: +379 validated
umi TGCATCCTCC = 275 reads: +379 validated
umi TGGAGGTTGC = 332 reads: +379 validated
umi TGTATATGGC = 243 reads: +379 validated
umi TGTATCGTCA = 275 reads: +379 validated
umi TGTATCTGGG = 327 reads: +379 validated
umi TGTGTATCTG = 348 reads: +379 validated
umi TGTTAATCGT = 275 reads: +379 validated
umi TTACAGCTGG = 292 reads: +379 validated
umi TTACGTCGAT = 330 reads: +379 validated
umi TTCCTTACCC = 235 reads: +379 validated
umi TTGCCTTTCC = 254 reads: +379 validated
umi TTGCGCGCTG = 206 reads: -77X +302 invalidated
umi TTTCAGTATC = 280 reads: +379 validated
umi TTTGTGGGAC = 311 reads: +379 validated

UMI info for barcode GCGCCAAGTCGCTTTC-1 contig 3 = GGGGACTCCT...
umi GCCATCGGAC = 505 reads: +433 validated
umi GGAATCATCG = 318 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=627]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=0)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=5)
436-463 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=2)
462-525 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=5)
525-627 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 44 reads
cdr3 = CAKDLDYYGSGSYYGVYYYGMDVW at 422, score = 9 + 7
umis assigned: [10, 90, 126, 143, 168, 230, 285, 361, 693, 839] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1554
start codons at 80, 231, 236, 294, 297, 315, 383, 444, 462, 482, 543, 604
confident = true

TIG 2[bases=542]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-367 ==> 0-340 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
368-406 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
406-542 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 82 umis using 3554 reads
cdr3 = CQQYTGTF at 354, score = 8 + 8
umis assigned: [1, 9, 13, 18, 28, 55, 67, 85, 86, 98] and 73 others
of which 83 are surviving nonsolos
reads assigned: 21020
start codons at 27, 33, 89, 102, 334, 448
confident = true

TIG 3[bases=572]
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-572 ==> 0-119 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 122 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [498, 527]
of which 2 are surviving nonsolos
reads assigned: 809
start codons at 20, 64, 243, 246, 249, 335, 405
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.370 = GCGCCAAGTTACAGAA-1

using 125 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 45
nonsolo ucounts = 30[2^9, 3^9, 4^2, 5^5, 6^3, 7^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.371 = GCGCCAAGTTAGTGGG-1

using 347 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 342]
surviving nonsolo ucounts = 1[342]
ids = [1]

====================================================================================

UMI info for barcode GCGCCAAGTTAGTGGG-1 contig 1 = TGGGGAGGAG...
umi CCGCACATAT = 344 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSAPFTF at 359, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 32, 38, 94, 107, 413, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.373 = GCGCCAAGTTCCACAA-1

using 12074 reads

====================================================================================

graph has 4936 edges initially, 54 edges after simplification

total ucounts = 572
nonsolo ucounts = 227[2^98, 3^42, 4^17, 5^5, 6^6, 7^6, 9^2, 10, 12^2, 13, 16, 22, 51, 58, 61, 80, 92, 101, 170, 174, 186, 190, 195, 202^2, 204, 233, 240^2, 246, 250, 252, 254, 255^2, 258, 260, 272, 277, 279, 281, 283^2, 284^2, 297, 301, 306, 317, 318, 328, 334, 345, 348, 358, 388, 541]
surviving nonsolo ucounts = 42[58, 61, 92, 101, 174, 186, 190, 195, 202^2, 204, 233, 240^2, 246, 250, 252, 254, 255^2, 258, 260, 272, 277, 279, 281, 283^2, 284^2, 297, 301, 306, 317, 318, 328, 334, 345, 348, 358, 388, 541]
ids = [35, 568, 172, 17, 348, 457, 407, 352, 26, 104, ...]

====================================================================================

UMI info for barcode GCGCCAAGTTCCACAA-1 contig 1 = ATGGGACCCA...
umi AAGCCTAGCC = 166 reads: +454 validated
umi AATAGACCGG = 47 reads: +2 -1 +28 -27 +373 -1 +22 non-validated
umi ACATTGTATC = 281 reads: +454 validated
umi AGACAACTAA = 254 reads: +454 validated
umi CATCCTGCAC = 95 reads: +371 -1 +4 -1 +2 -1 +74 non-validated
umi CCATTACCGT = 286 reads: +432 -7 +1 -2 +12 non-validated
umi CCCTAAACCC = 393 reads: -1XX +3 -31X +1 -1X +1 -7XX +2 -6XX +1 -1XX +399 invalidated
umi CGTCAGGCTA = 303 reads: +454 validated
umi GAGTTTCAGG = 258 reads: +454 validated
umi TAAGACCCCT = 215 reads: +454 validated
umi TAGGCGCGTC = 242 reads: +454 validated
umi TCGGGACATT = 281 reads: +454 validated
umi TGATATCGAA = 226 reads: +454 validated
umi TTTTGTCGCG = 105 reads: -411 +1 -4X +1 -8XX +2 -10XX +1 -2XX +1 -2XX +2 -2XX +7 invalidated

UMI info for barcode GCGCCAAGTTCCACAA-1 contig 2 = AGGAGTCAGA...
umi AACGCGTGGG = 100 reads: +388 validated
umi ACGGGCGGGT = 359 reads: +56 -1XX +1 -1XX +2 -1XX +1 -5XX +4 -20XX +1 -3XX +3 -11XX +278 invalidated
umi ACTTGAACTT = 244 reads: +388 validated
umi AGTGCTAATG = 335 reads: +388 validated
umi ATCATTTGTA = 329 reads: +388 validated
umi ATCGTGGGCT = 304 reads: +388 validated
umi CAATCGTGGT = 284 reads: +388 validated
umi CAGGGCCTTA = 287 reads: +388 validated
umi CAGGTGCGTA = 256 reads: +388 validated
umi CCTGAGGGCA = 319 reads: +388 validated
umi CCTTTGCATT = 246 reads: +388 validated
umi CGTACACTAC = 314 reads: +388 validated
umi CTATTACTCA = 284 reads: +388 validated
umi CTCTTATGTC = 283 reads: +388 validated
umi CTTGGTGCTG = 307 reads: +388 validated
umi GCCATATCTC = 356 reads: +388 validated
umi GCCCCCGAAG = 175 reads: +388 validated
umi GCCTGTTAGC = 195 reads: +388 validated
umi GGGCTGGGGT = 285 reads: +388 validated
umi GTGCGTGTCC = 252 reads: +388 validated
umi GTTATCGGTT = 190 reads: +388 validated
umi TCAGACTGGT = 187 reads: +388 validated
umi TCGGGCCGAT = 543 reads: +27 -5XX +1 -8XX +1 -1XX +2 -149XX +1 -4X +1 -2XX +1 -3XX +1 -1XX +2 -3XX +1 -1XX +1 -5XX +167 invalidated
umi TCTAATGTTG = 229 reads: +388 validated
umi TGACCAATCT = 274 reads: +388 validated
umi TGGCACCTGC = 256 reads: +388 validated
umi TTTGTGCCCC = 61 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=584]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=5)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
414-445 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
450-513 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=3)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 196 reads
cdr3 = CARDLGIVVVPAASLRRSYYYYGMDVW at 401, score = 8 + 7
umis assigned: [26, 35, 49, 74, 172, 198, 207, 267, 326, 423] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3097
start codons at 0, 59, 210, 257, 262, 279, 294, 323, 356, 470
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=6)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 27 umis using 1177 reads
cdr3 = CQQYNSYSVTF at 354, score = 8 + 8
umis assigned: [17, 61, 71, 94, 105, 112, 140, 162, 164, 229] and 17 others
of which 27 are surviving nonsolos
reads assigned: 7125
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = true
now this is a cell
paired!

CTGGGTATTGTAGTAGTACCAGCTGCTTCCTTGCGGCGGTCCTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCGGTGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.387 = GCGCCAATCAGCGATT-1

using 200 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[199]
surviving nonsolo ucounts = 1[199]
ids = [0]

====================================================================================

UMI info for barcode GCGCCAATCAGCGATT-1 contig 1 = GCTCTGCTTC...
umi CCTTATTTGT = 197 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=582]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-582 ==> 0-137 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.395 = GCGCCAATCCACGACG-1

using 237 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode GCGCCAATCCACGACG-1 contig 1 = GCTCTGCTTC...
umi AATATAGGTG = 226 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=574]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-574 ==> 0-129 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.413 = GCGCCAATCTCAACTT-1

using 26 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.416 = GCGCCAATCTCTGAGA-1

using 324 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[320]
surviving nonsolo ucounts = 1[320]
ids = [4]

====================================================================================

UMI info for barcode GCGCCAATCTCTGAGA-1 contig 1 = GCTCTGCTTC...
umi TCCATATCTG = 300 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=515]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-515 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQSYDTSLSGSVF at 375, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 51, 205, 208, 259, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.418 = GCGCCAATCTGCCAGG-1

using 264 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode GCGCCAATCTGCCAGG-1 contig 1 = AGGAATCAGT...
umi CCGCTCTCTA = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.419 = GCGCCAATCTGCGACG-1

using 10 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.423 = GCGCCAATCTTTACGT-1

using 177 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[18, 156]
surviving nonsolo ucounts = 1[156]
ids = [2]

====================================================================================

UMI info for barcode GCGCCAATCTTTACGT-1 contig 1 = ACAACAGGCA...
umi CGTGTTCAGG = 148 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=474]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
388-425 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
425-474 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYYSTPLTF at 364, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.425 = GCGCGATAGAAACGCC-1

using 377 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 370]
surviving nonsolo ucounts = 1[370]
ids = [2]

====================================================================================

UMI info for barcode GCGCGATAGAAACGCC-1 contig 1 = GAGTCAGTCT...
umi TAGTGCGATA = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
25-378 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQSYSTPYTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 363
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.430 = GCGCGATAGAGGTTAT-1

using 234 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[16, 215]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 68.439 = GCGCGATAGCCACGCT-1

using 238 reads

====================================================================================

graph has 142 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 235]
surviving nonsolo ucounts = 1[235]
ids = [1]

====================================================================================

UMI info for barcode GCGCGATAGCCACGCT-1 contig 1 = GGGGTCACAA...
umi TGTATATCGC = 216 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=574]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
382-420 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
420-574 ==> 0-154 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CCSYAGSRVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 38, 177, 239, 246, 372, 552
confident = false
NOT paired!
sorting bam, mem = 0.09
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk068-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk068-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

19.767 seconds used processing barcodes, peak mem = 0.23
