[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.34 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk066-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk066-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk066.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.0 = GATTCAGTCGCTTGTC-1

using 309 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 6, 291]
surviving nonsolo ucounts = 1[291]
ids = [1]

====================================================================================

UMI info for barcode GATTCAGTCGCTTGTC-1 contig 1 = GCTCTGCTTC...
umi CTACGACTAA = 278 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=574]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=6)
404-442 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
442-574 ==> 0-132 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQSYDSSLSGYVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 51, 205, 259, 358, 385, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.7 = GATTCAGTCTAACTTC-1

using 246 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 5[2^2, 3^2, 229]
surviving nonsolo ucounts = 1[229]
ids = [10]

====================================================================================

REJECT CONTIGS

TIG 1[bases=552]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-234 ==> 0-187 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8)
234-399 ==> 188-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=8) [SHIFT!]
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
434-552 ==> 0-118 on |306|IGLC2|C-REGION| [len=317] (mis=1)
cdr3 = CAAWDDTLNGVVF at 367, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 47, 350, 380, 392
confident = false
not full
frameshifted full length stopped transcript of length 552
VJ delta = 23
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.10 = GATTCAGTCTGGAGCC-1

using 705 reads

====================================================================================

graph has 300 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[238, 462]
surviving nonsolo ucounts = 2[238, 462]
ids = [2, 4]

====================================================================================

UMI info for barcode GATTCAGTCTGGAGCC-1 contig 1 = GAATCAGTCC...
umi CGGCACGTGA = 238 reads: +388 validated

UMI info for barcode GATTCAGTCTGGAGCC-1 contig 2 = GCTGCTCAGT...
umi TACCTCCGAC = 466 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=546]
0-28 ==> 24-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
28-376 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=23)
372-410 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 85 reads
cdr3 = CQQYGGSITF at 352, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 455
start codons at 28, 236, 362, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.21 = GCAAACTAGATCCTGT-1

using 13 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.25 = GCAAACTAGCAGCGTA-1

using 682 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[679]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.27 = GCAAACTAGCCCTAAT-1

using 187 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 181]
surviving nonsolo ucounts = 1[181]
ids = [4]

====================================================================================

UMI info for barcode GCAAACTAGCCCTAAT-1 contig 1 = AGGAGTCAGA...
umi TTTATGGTTA = 179 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQQYNSYPLTF at 354, score = 8 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 27, 33, 89, 102, 238, 241, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.30 = GCAAACTAGCGCCTCA-1

using 312 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[4, 5, 10, 15, 275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================

UMI info for barcode GCAAACTAGCGCCTCA-1 contig 1 = GGGGAGGAAC...
umi CGAGGGAGTG = 263 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=489]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=12)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-489 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQHYHNWPPITF at 357, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 36, 105, 178, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.35 = GCAAACTAGGCGATAC-1

using 312 reads

====================================================================================

graph has 94 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 6, 106, 195]
surviving nonsolo ucounts = 2[106, 195]
ids = [3, 1]

====================================================================================

UMI info for barcode GCAAACTAGGCGATAC-1 contig 1 = AGCTCTGGGA...
umi CCTCGATAGG = 188 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=570]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=1)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=25)
468-510 ==> 10-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
510-570 ==> 0-60 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CSTTRGPTITTPRGPIQHW at 422, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 80, 236, 241, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.38 = GCAAACTAGGGCTCTC-1

using 19451 reads

====================================================================================

graph has 9086 edges initially, 60 edges after simplification

total ucounts = 1360
nonsolo ucounts = 586[2^250, 3^107, 4^72, 5^28, 6^19, 7^14, 8^10, 9^4, 10^6, 11^5, 12^7, 13^3, 14, 15, 16, 17, 18, 35, 54, 123, 133, 137, 154, 159, 162, 165, 174, 177, 190, 193, 195, 213, 229, 243, 247, 258, 267^2, 276, 286^2, 289, 290, 294, 300, 302, 314, 328, 332, 334, 338, 341, 347, 354, 360, 361, 365, 366^2, 369, 373, 379, 381^2, 400, 401, 406, 410, 455, 478, 486, 582, 677]
surviving nonsolo ucounts = 53[123, 133, 137, 154, 159, 162, 165, 174, 177, 193, 195, 213, 229, 243, 247, 258, 267^2, 276, 286^2, 289, 290, 294, 300, 302, 314, 328, 332, 334, 338, 341, 347, 354, 360, 361, 365, 366^2, 369, 373, 379, 381^2, 400, 401, 406, 410, 455, 478, 486, 582, 677]
ids = [857, 88, 591, 521, 1024, 315, 1027, 363, 1199, 752, ...]

====================================================================================

UMI info for barcode GCAAACTAGGGCTCTC-1 contig 1 = AGAGCTCTGG...
umi AATCGCACCA = 363 reads: +370 validated
umi ACAGTCGGGG = 280 reads: +370 validated
umi ACCTTAGCGC = 397 reads: +370 validated
umi ACTTGCGATC = 334 reads: +370 validated
umi AGAGGCATAG = 411 reads: +370 validated
umi AGTTACCCCC = 457 reads: +370 validated
umi ATCCTCCTAT = 161 reads: +370 validated
umi ATCGCGGCAG = 22 reads: -11 +1 -3XX +2 -6XX +1 -1XX +1 -5XX +1 -2XX +1 -8XX +1 -2XX +42 -282 invalidated
umi CATCCGGCTC = 274 reads: +370 validated
umi CATCGGGTCT = 312 reads: +370 validated
umi CCCAACACAG = 301 reads: +370 validated
umi CGCTGTTTAG = 288 reads: +370 validated
umi CTTGTAGGTC = 406 reads: +370 validated
umi GAGTATATAA = 303 reads: +370 validated
umi GCATCCGGGC = 191 reads: +370 validated
umi GCTATTGGAG = 403 reads: +370 validated
umi GTACAGCTTT = 293 reads: +370 validated
umi GTATCATAGC = 359 reads: +370 validated
umi GTGGCCACTA = 358 reads: +370 validated
umi GTTGAGGAAA = 370 reads: +370 validated
umi GTTTCCTCGT = 344 reads: +370 validated
umi GTTTTAACCC = 619 reads: +118 -3XX +2 -4XX +1 -1XX +2 -6XX +1 -2XX +2 -75X +1 -3XX +1 -1XX +1 -2XX +1 -1XX +2 -6XX +134 invalidated
umi GTTTTTGTTG = 335 reads: +370 validated
umi TAGCACAGTC = 378 reads: +370 validated
umi TAGGTTAAGG = 675 reads: -168X +202 invalidated
umi TATCGTCCCT = 293 reads: +370 validated
umi TATTCTTTTA = 165 reads: +370 validated
umi TATTGACTGT = 294 reads: +370 validated
umi TCGGATCCAT = 338 reads: +370 validated
umi TCTAGGTATG = 347 reads: +370 validated
umi TGCAGCATCA = 382 reads: +370 validated
umi TGTCACGTAG = 376 reads: +370 validated
umi TGTGAGTGTT = 329 reads: +370 validated
umi TTAGCGGTTG = 265 reads: +370 validated
umi TTCTATTACT = 366 reads: +370 validated
umi TTGGGTACGC = 363 reads: +370 validated
umi TTTGAACTGT = 373 reads: +370 validated

GOOD CONTIGS

TIG 1[bases=550]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-375 ==> 0-331 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 36 umis using 2131 reads
cdr3 = CQQSFTF at 365, score = 8 + 7
umis assigned: [91, 122, 158, 204, 221, 271, 315, 321, 446, 448] and 27 others
of which 36 are surviving nonsolos
reads assigned: 12308
start codons at 44, 113, 249, 456
confident = true

REJECT CONTIGS

TIG 1[bases=525]
15-269 ==> 99-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=27)
307-343 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=2)
343-525 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CATTGRFDDPRLVGFESW at 258, score = 8 + 6
umis assigned: [88, 110, 249, 363, 420, 521, 551, 578, 591, 793] and 6 others
of which 16 are surviving nonsolos
reads assigned: 2892
start codons at 144, 207, 219, 280
confident = false
VJ delta = 9
not full
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.41 = GCAAACTAGTAATCCC-1

using 251 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 4^2, 239]
surviving nonsolo ucounts = 1[239]
ids = [4]

====================================================================================

UMI info for barcode GCAAACTAGTAATCCC-1 contig 1 = AGCTTCAGCT...
umi TACCTATCGT = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=523]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-523 ==> 0-88 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.45 = GCAAACTAGTGGGATC-1

using 47 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[3^2, 4, 5, 13, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.51 = GCAAACTCAAAGGAAG-1

using 341 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[7, 330]
surviving nonsolo ucounts = 1[330]
ids = [5]

====================================================================================

UMI info for barcode GCAAACTCAAAGGAAG-1 contig 1 = GGAATCAGTC...
umi TGTGCACAGA = 330 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 325
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.54 = GCAAACTCAACTGGCC-1

using 276 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[275]
surviving nonsolo ucounts = 1[275]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=556]
9-79 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
31-342 ==> 0-311 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=13)
343-383 ==> 311-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6) [SHIFT!]
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 359, score = 4 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 273
start codons at 31, 37, 106, 242, 462
confident = false
not full
frameshifted full length stopped transcript of length 556
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.57 = GCAAACTCAATGGAAT-1

using 266 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 262]
surviving nonsolo ucounts = 2[2, 262]
ids = [0, 2]

====================================================================================

UMI info for barcode GCAAACTCAATGGAAT-1 contig 1 = GGGGGTCTCA...
umi CCGATTTGGT = 3 reads: +40 -1XX +32 -318 invalidated
umi GTCACAGCTC = 262 reads: +17 -2XX +372 invalidated

GOOD CONTIGS

TIG 1[bases=597]
39-391 ==> 0-352 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=1)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-597 ==> 0-167 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTPWVF at 363, score = 8 + 8
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 257
start codons at 39, 196, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.63 = GCAAACTCACAGCGTC-1

using 290 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[289]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.64 = GCAAACTCACATGTGT-1

using 255 reads

====================================================================================

graph has 174 edges initially, 4 edges after simplification

total ucounts = 26
nonsolo ucounts = 15[2, 3^2, 5, 6, 7^3, 8, 9^2, 10, 11, 21, 136]
surviving nonsolo ucounts = 1[136]
ids = [20]

====================================================================================

UMI info for barcode GCAAACTCACATGTGT-1 contig 1 = CACATGGGAA...
umi GTAATTTTCT = 132 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=487]
0-47 ==> 98-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
47-397 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=20)
424-474 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
junction support: 1 umis using 16 reads
cdr3 = CARGCERCMLSNNDAFDIW at 386, score = 9 + 8
umis assigned: [20]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 3, 47, 241, 410, 423, 426, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.69 = GCAAACTCACGTAAGG-1

using 622 reads

====================================================================================

graph has 258 edges initially, 30 edges after simplification

total ucounts = 11
nonsolo ucounts = 2[248, 365]
surviving nonsolo ucounts = 2[248, 365]
ids = [6, 2]

====================================================================================

UMI info for barcode GCAAACTCACGTAAGG-1 contig 1 = AGTCAGACTC...
umi AGGATTGCCC = 367 reads: +388 validated

UMI info for barcode GCAAACTCACGTAAGG-1 contig 2 = GAATCAGTCC...
umi CAGCGTCCTT = 252 reads: +22 -1XX +365 invalidated

GOOD CONTIGS

TIG 1[bases=548]
0-24 ==> 157-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
24-375 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYNGQSRAF at 351, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 361
start codons at 24, 30, 99, 235, 238, 331, 364, 454
confident = false

TIG 2[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.76 = GCAAACTCAGCTGGCT-1

using 265 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=547]
0-294 ==> 83-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=26)
317-365 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
365-547 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CARRDYYGSERVDFDYW at 283, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 86, 205, 302
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.79 = GCAAACTCAGTAACGG-1

using 470 reads

====================================================================================

graph has 200 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 77, 386]
surviving nonsolo ucounts = 2[77, 386]
ids = [0, 4]

====================================================================================

UMI info for barcode GCAAACTCAGTAACGG-1 contig 1 = AGGAACTGCT...
umi GTACAGTGCT = 368 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=497]
0-32 ==> 15-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
32-377 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-497 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 73 reads
cdr3 = CQQRSNWLPTF at 353, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 32, 237, 240, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.81 = GCAAACTCAGTCAGCC-1

using 307 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 3, 4, 290]
surviving nonsolo ucounts = 1[290]
ids = [5]

====================================================================================

UMI info for barcode GCAAACTCAGTCAGCC-1 contig 1 = GGGGCTGATC...
umi GGAAAGGGTG = 283 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=481]
0-36 ==> 0-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=3)
36-396 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=1)
398-436 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
436-481 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CMQALQTPLFTF at 372, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 279
start codons at 36, 69, 105, 193, 355, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.87 = GCAAACTCATTAGGCT-1

using 130 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[3, 5, 122]
surviving nonsolo ucounts = 1[122]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=419]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
1-53 ==> 2818-2870 on segment before IGLV3-13 exon 1 [len=3075] (mis=4)
15-90 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
387-419 ==> 0-32 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 115
start codons at 43, 104, 173, 191
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.91 = GCAAACTGTAAGGGCT-1

using 350 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 23
nonsolo ucounts = 6[2^3, 4, 6, 317]
surviving nonsolo ucounts = 1[317]
ids = [15]

====================================================================================

UMI info for barcode GCAAACTGTAAGGGCT-1 contig 1 = CAGCTTCAGC...
umi GCGTCAGTCA = 314 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
0-48 ==> 66-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
48-401 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=23)
398-436 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
436-555 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CAAWDDSLNGVIF at 369, score = 8 + 9
umis assigned: [15]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 48, 249, 352, 377, 382, 394
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.93 = GCAAACTGTACCGAGA-1

using 322 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 313]
surviving nonsolo ucounts = 1[313]
ids = [5]

====================================================================================

UMI info for barcode GCAAACTGTACCGAGA-1 contig 1 = AGGAGTCAGA...
umi CGTTCGACGC = 304 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-512 ==> 0-97 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYSITF at 354, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.102 = GCAAACTGTCCTCTTG-1

using 537 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 529]
surviving nonsolo ucounts = 1[529]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=402]
5-229 ==> 139-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=4)
229-266 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
266-402 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYYSFALTF at 205, score = 9 + 9
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 518
start codons at 188, 308
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.103 = GCAAACTGTCGAAAGC-1

using 218 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=370]
34-262 ==> 125-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=35)
276-312 ==> 10-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
312-370 ==> 0-58 on |43|IGHG2|C-REGION| [len=977] (mis=0)
cdr3 = CAKNSGIYDW at 251, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 60, 65, 144, 173, 212, 273
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.106 = GCAAACTGTCTGGAGA-1

using 201 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[195]
surviving nonsolo ucounts = 1[195]
ids = [1]

====================================================================================

UMI info for barcode GCAAACTGTCTGGAGA-1 contig 1 = GAGCATCACC...
umi CCATGTTACT = 194 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=551]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=44)
423-474 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=6)
474-551 ==> 0-77 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 34 reads
cdr3 = CAREKRSGWFDLW at 404, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 62, 149, 260, 265, 326
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.114 = GCAAACTGTGTGCGTC-1

using 352 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 345]
surviving nonsolo ucounts = 1[345]
ids = [4]

====================================================================================

UMI info for barcode GCAAACTGTGTGCGTC-1 contig 1 = ACTTTCTGAG...
umi TCTTTCCTCG = 317 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=508]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-238 ==> 0-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=9)
435-477 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=2)
477-508 ==> 0-31 on |6|IGHD|C-REGION| [len=1289] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARVQSLKQGAISTTYYYNALDVW at 374, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 313
start codons at 35, 79, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.120 = GCAAACTGTTCGTTGA-1

using 883 reads

====================================================================================

graph has 334 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 169, 313, 396]
surviving nonsolo ucounts = 2[169, 396]
ids = [3, 1]

====================================================================================

UMI info for barcode GCAAACTGTTCGTTGA-1 contig 1 = GTCAGTCCCA...
umi ATGGATCATC = 397 reads: +385 validated
umi GCGATGACAT = 170 reads: +385 validated
umi TCGGAGTGGT = 284 reads: +58 -1XX +51 -1XX +11 -1XX +31 -2XX +2 -1XX +5 -3XX +24 -1XX +5 -1XX +12 -1XX +3 -1XX +8 -1XX +41 -1XX +36 -1XX +17 -1XX +11 -1XX +1 -14 +1 -2X +2 -1XX +14 -5XX +4 -1XX +2 -1XX +4 invalidated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CQQYDNLPTF at 350, score = 9 + 8
umis assigned: [1, 3, 6]
of which 2 are surviving nonsolos
reads assigned: 814
start codons at 23, 29, 85, 98, 237, 360, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.121 = GCAAACTGTTGCGTTA-1

using 373 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 364]
surviving nonsolo ucounts = 1[364]
ids = [1]

====================================================================================

UMI info for barcode GCAAACTGTTGCGTTA-1 contig 1 = AGAGCTGCTC...
umi ATATTTCATC = 362 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=7)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSLTTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 31, 239, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.122 = GCAAACTGTTGGACCC-1

using 469 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 222, 241]
surviving nonsolo ucounts = 2[222, 241]
ids = [2, 0]

====================================================================================

UMI info for barcode GCAAACTGTTGGACCC-1 contig 1 = ACTTTCTGAG...
umi AAATCAATGT = 232 reads: +424 validated
umi TCACCCATGC = 222 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=595]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-595 ==> 0-136 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 2 umis using 51 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 451
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.126 = GCAAACTTCAACACGT-1

using 1959 reads

====================================================================================

graph has 2911 edges initially, 38 edges after simplification

total ucounts = 912
nonsolo ucounts = 414[2^174, 3^109, 4^52, 5^34, 6^14, 7^8, 8^6, 9^4, 10^2, 11, 12, 13^3, 14, 15, 16, 17, 18, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.127 = GCAAACTTCAACACTG-1

using 198 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 190]
surviving nonsolo ucounts = 1[190]
ids = [0]

====================================================================================

UMI info for barcode GCAAACTTCAACACTG-1 contig 1 = GGGGTCTCAG...
umi AAGGTGCAGA = 187 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=534]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-380 ==> 0-342 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=5)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
432-534 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CSSYTSRITLGVIF at 362, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.141 = GCAAACTTCCCGACTT-1

using 328 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[325]
surviving nonsolo ucounts = 1[325]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=442]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=7)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
cdr3 = CWGLLLHASSTNPLTF at 350, score = 4 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 30, 63, 99, 187, 349, 369
confident = false
not full
frameshifted full length transcript of length 442
VJ delta = 29
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.143 = GCAAACTTCCCTCTTT-1

using 310 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [0]

====================================================================================

UMI info for barcode GCAAACTTCCCTCTTT-1 contig 1 = AGCTTCAGCT...
umi ACAATGTACA = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-537 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 299
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.148 = GCAAACTTCGAGGTAG-1

using 264 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[257]
surviving nonsolo ucounts = 1[257]
ids = [2]

====================================================================================

UMI info for barcode GCAAACTTCGAGGTAG-1 contig 1 = GTCAGTCCCA...
umi CCCGTTTGAC = 241 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-473 ==> 0-62 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPLTF at 350, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 23, 29, 85, 98, 237, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.149 = GCAAACTTCGATGAGG-1

using 251 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 3, 6, 233]
surviving nonsolo ucounts = 1[233]
ids = [4]

====================================================================================

UMI info for barcode GCAAACTTCGATGAGG-1 contig 1 = GCTCTGCTTC...
umi GCGTATATGC = 224 reads: +391 validated
umi TTTGGGACCG = 1 reads: -66 +5 -1X +5 -1X +7 -1X +3 -1X +3 -1X +4 -1X +20 -1X +2 -269 invalidated

GOOD CONTIGS

TIG 1[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=14)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-564 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDTSLSGWVF at 375, score = 8 + 7
umis assigned: [4, 8]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 51, 205, 358, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.152 = GCAAACTTCGGTCCGA-1

using 74 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 15, 50]
surviving nonsolo ucounts = 1[50]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.153 = GCAAACTTCGGTTAAC-1

using 300 reads

====================================================================================

graph has 117 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 296]
surviving nonsolo ucounts = 1[296]
ids = [3]

====================================================================================

UMI info for barcode GCAAACTTCGGTTAAC-1 contig 1 = AGGAGTCAGT...
umi TACTCAGGCA = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-27 ==> 20-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=14)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
415-482 ==> 0-67 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQSYRRPITF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 27, 33, 89, 102, 238, 337, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.160 = GCAAACTTCTCGTTTA-1

using 246 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[7, 9, 229]
surviving nonsolo ucounts = 1[229]
ids = [3]

====================================================================================

UMI info for barcode GCAAACTTCTCGTTTA-1 contig 1 = GGGCTGGGGT...
umi TCAGTTGGGC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
43-404 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
393-431 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
431-524 ==> 0-93 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CSSYTSSSTLVF at 367, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 43, 200, 244, 251, 254
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.165 = GCAAACTTCTGATTCT-1

using 399 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 3[2, 151, 238]
surviving nonsolo ucounts = 2[151, 238]
ids = [1, 7]

====================================================================================

UMI info for barcode GCAAACTTCTGATTCT-1 contig 1 = ATCACACAAC...
umi ATCCGTCGGT = 150 reads: +418 validated

UMI info for barcode GCAAACTTCTGATTCT-1 contig 2 = GTCAGACTCA...
umi GTTCTCCGCT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=514]
0-57 ==> 3-60 on |68|IGHV1-24|5'UTR| [len=60] (mis=0)
57-408 ==> 0-351 on |69|IGHV1-24|L-REGION+V-REGION| [len=351] (mis=44)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
475-514 ==> 0-39 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CATAAGINKWAFDSW at 399, score = 10 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 57, 202, 213, 255, 277, 321, 354, 425
confident = false

TIG 2[bases=466]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-466 ==> 0-55 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.167 = GCAAACTTCTGCTTGC-1

using 229 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[226]
surviving nonsolo ucounts = 1[226]
ids = [2]

====================================================================================

UMI info for barcode GCAAACTTCTGCTTGC-1 contig 1 = GAGTCAGACC...
umi CGGGGCGTTC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=441]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
413-441 ==> 0-28 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNSYLCSF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 25, 31, 87, 100, 332
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.170 = GCAAACTTCTTGCAAG-1

using 301 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 298]
surviving nonsolo ucounts = 1[298]
ids = [0]

====================================================================================

UMI info for barcode GCAAACTTCTTGCAAG-1 contig 1 = AGCTTCAGCT...
umi AAGAGGTCAC = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=596]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-596 ==> 0-161 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 288
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.171 = GCAAACTTCTTTAGGG-1

using 143 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 5, 131]
surviving nonsolo ucounts = 1[131]
ids = [2]

====================================================================================

UMI info for barcode GCAAACTTCTTTAGGG-1 contig 1 = GCTCTGCTTC...
umi CATCGGTTGT = 125 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=463]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 18 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.173 = GCAATCAAGACAAAGG-1

using 418 reads

====================================================================================

graph has 204 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 46, 364]
surviving nonsolo ucounts = 2[46, 364]
ids = [0, 3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.177 = GCAATCAAGACTTTCG-1

using 180 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 14, 159]
surviving nonsolo ucounts = 1[159]
ids = [7]

====================================================================================

UMI info for barcode GCAATCAAGACTTTCG-1 contig 1 = GAATCAGTCC...
umi TTCATTTACA = 147 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-504 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 143
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.184 = GCAATCAAGATGTTAG-1

using 324 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[319]
surviving nonsolo ucounts = 1[319]
ids = [2]

====================================================================================

UMI info for barcode GCAATCAAGATGTTAG-1 contig 1 = AGGAGTCAGA...
umi CCAATGACAA = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=468]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-468 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQANSFPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.187 = GCAATCAAGCATGGCA-1

using 21 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 10]
surviving nonsolo ucounts = 1[10]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.188 = GCAATCAAGCCAGGAT-1

using 26 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 6, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.194 = GCAATCAAGCGTTTAC-1

using 66 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 57]
surviving nonsolo ucounts = 1[57]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.195 = GCAATCAAGCTTTGGT-1

using 330 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[324]
surviving nonsolo ucounts = 1[324]
ids = [5]

====================================================================================

UMI info for barcode GCAATCAAGCTTTGGT-1 contig 1 = AGGAATCAGA...
umi GGGGATCTGC = 307 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-491 ==> 0-76 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 306
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.197 = GCAATCAAGGACTGGT-1

using 366 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[147, 219]
surviving nonsolo ucounts = 2[147, 219]
ids = [0, 1]

====================================================================================

UMI info for barcode GCAATCAAGGACTGGT-1 contig 1 = GGTCACAAGA...
umi CGGGGGTCAA = 148 reads: +394 validated
umi TAGGGTGAAT = 214 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=533]
0-36 ==> 126-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
36-376 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=29)
392-430 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
430-533 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 2 umis using 49 reads
cdr3 = CCSEAGGGVPGLLF at 360, score = 7 + 9
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 358
start codons at 36, 190
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.202 = GCAATCAAGGTAGCCA-1

using 38 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 32]
surviving nonsolo ucounts = 1[32]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.210 = GCAATCAAGTCATCCA-1

using 1011 reads

====================================================================================

graph has 294 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[9, 328, 671]
surviving nonsolo ucounts = 2[328, 671]
ids = [3, 0]

====================================================================================

UMI info for barcode GCAATCAAGTCATCCA-1 contig 1 = GGGGAGGAAC...
umi CAACTATGAA = 673 reads: +382 validated
umi CTGTTCATAT = 327 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 179 reads
cdr3 = CQQYNHWPCSF at 357, score = 9 + 7
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 987
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.211 = GCAATCAAGTGGAGTC-1

using 365 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^3, 354]
surviving nonsolo ucounts = 1[354]
ids = [1]

====================================================================================

UMI info for barcode GCAATCAAGTGGAGTC-1 contig 1 = GAAGAGCTGC...
umi ACTAGCACGG = 323 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=499]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
418-499 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CHQYGTSPLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 33, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.222 = GCAATCACAAGCTGGA-1

using 32 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[7^2, 15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.224 = GCAATCACAAGTAATG-1

using 41 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 8, 9, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.226 = GCAATCACAATCTACG-1

using 1085 reads

====================================================================================

graph has 368 edges initially, 4 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^2, 3, 5, 315, 752]
surviving nonsolo ucounts = 2[315, 752]
ids = [4, 6]

====================================================================================

UMI info for barcode GCAATCACAATCTACG-1 contig 1 = GGAGAAGAGC...
umi GCCAGCTATC = 300 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-519 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYGSSPGLTF at 360, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 36, 244, 370, 466
confident = false

REJECT CONTIGS

TIG 1[bases=436]
8-187 ==> 177-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=5)
187-225 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
225-436 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 155, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 744
start codons at 39, 138, 165, 189, 357
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.234 = GCAATCACACCGTTGG-1

using 18 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.236 = GCAATCACACCTGGTG-1

using 274 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 7, 255]
surviving nonsolo ucounts = 1[255]
ids = [5]

====================================================================================

UMI info for barcode GCAATCACACCTGGTG-1 contig 1 = GTCAGACTCA...
umi CGCTCTCCTG = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.241 = GCAATCACACGGTTTA-1

using 158 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 3, 5^3, 137]
surviving nonsolo ucounts = 1[137]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.242 = GCAATCACACGTAAGG-1

using 73 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 6^2, 13, 40]
surviving nonsolo ucounts = 1[40]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.243 = GCAATCACACGTGAGA-1

using 373 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[10, 14, 347]
surviving nonsolo ucounts = 1[347]
ids = [1]

====================================================================================

UMI info for barcode GCAATCACACGTGAGA-1 contig 1 = GAGTCAGACC...
umi ATACCTTTTA = 330 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=474]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
413-474 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYNSYSNTF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 25, 31, 87, 100, 332, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.249 = GCAATCACAGCCTGTG-1

using 121 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 22
nonsolo ucounts = 17[2, 3^3, 4^2, 5, 6^3, 8^3, 10^2, 15^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.255 = GCAATCACAGCTGTTA-1

using 24 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.265 = GCAATCACATAACCTG-1

using 58 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 8[3^2, 6^2, 7^2, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.284 = GCAATCAGTACCGCTG-1

using 281 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode GCAATCAGTACCGCTG-1 contig 1 = GATCAGGACT...
umi TTGTAGGTCA = 261 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=502]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=8)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
427-502 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTLLTF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.287 = GCAATCAGTAGCCTCG-1

using 19 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.291 = GCAATCAGTCAAAGAT-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 1[15]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.320 = GCAATCAGTTTGACTG-1

using 305 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[7, 291]
surviving nonsolo ucounts = 1[291]
ids = [4]

====================================================================================

UMI info for barcode GCAATCAGTTTGACTG-1 contig 1 = AGCTCTGAGA...
umi GATAGATTCT = 284 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=524]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-524 ==> 0-21 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.324 = GCAATCATCAACACGT-1

using 605 reads

====================================================================================

graph has 216 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[598]
surviving nonsolo ucounts = 1[598]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=389]
27-133 ==> 247-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=3)
157-207 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
207-389 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
cdr3 = CTRVRTMIIVGDDAFDVW at 122, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 585
start codons at 44, 77, 140, 156, 159, 168, 188
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.336 = GCAATCATCAGCACAT-1

using 324 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2^2, 4, 315]
surviving nonsolo ucounts = 1[315]
ids = [2]

====================================================================================

UMI info for barcode GCAATCATCAGCACAT-1 contig 1 = GCTGGGGTCT...
umi GCAGCAGGCC = 303 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=595]
0-41 ==> 0-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
41-391 ==> 0-350 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=0)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-595 ==> 0-166 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CSSYTSSSTWVF at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 297
start codons at 41, 198, 242, 249
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.343 = GCAATCATCATGGTCA-1

using 66344 reads

====================================================================================

graph has 40048 edges initially, 448 edges after simplification

total ucounts = 9132
nonsolo ucounts = 4148[2^1706, 3^834, 4^564, 5^288, 6^187, 7^116, 8^72, 9^46, 10^26, 11^34, 12^10, 13^23, 14^4, 15^6, 16^7, 17^7, 18^4, 19^2, 20, 21^3, 22, 23^3, 24, 25^2, 26, 27^4, 29^2, 32, 33, 34, 35^3, 37, 39, 40, 41, 42^2, 50, 52, 53, 54^2, 55, 59, 61, 63, 64, 68, 74, 75, 76, 86^2, 95, 98, 100, 103, 111, 117^2, 121, 123, 124, 126, 131, 133, 136^2, 138, 141, 142, 148^2, 157, 160, 161, 167, 168^2, 175, 177, 179, 180, 183, 188, 189, 192, 200, 201, 202, 204, 205, 207^2, 208^2, 213, 215, 216^2, 217, 218, 220, 222^3, 223, 224, 227, 228, 230, 231, 235, 236, 238^2, 242, 243, 244, 247, 248, 250, 253^2, 255^2, 256^2, 257^2, 259, 261, 262^2, 263, 265, 266^2, 267, 268^2, 270, 271, 272, 273, 275^3, 277, 279, 280^3, 281, 282, 284, 285, 286, 287, 288, 289, 292, 293, 297, 298, 300, 302, 303^2, 304, 305, 306^2, 308, 309^3, 310^2, 311, 316, 317, 318, 320, 322, 323, 324^2, 325, 327, 328, 335, 336, 340, 348, 351, 355^3, 357, 365, 367, 373, 377, 379, 383^2, 392, 460, 514, 520, 533, 553, 573, 614, 632, 657, 765, 798]
surviving nonsolo ucounts = 192[2^3, 4^2, 16, 23^2, 25^2, 26, 27^2, 32, 33, 35^2, 37, 39, 40, 41, 50, 53, 55, 59, 61, 64, 68, 75, 86, 95, 100, 103, 111, 117^2, 121, 123, 124, 126, 131, 133, 136^2, 138, 141, 148, 157, 160, 161, 167, 168^2, 175, 177, 179, 180, 188, 189, 192, 200, 201, 202, 204, 205, 207^2, 208^2, 213, 215, 216^2, 217, 218, 220, 222^3, 223, 224, 227, 228, 230, 231, 235, 236, 238^2, 242, 243, 244, 247, 248, 250, 253^2, 255^2, 256^2, 257^2, 259, 261, 262^2, 263, 265, 266^2, 267, 268^2, 270, 271, 272, 273, 275^3, 277, 279, 280^3, 281, 282, 284, 285, 286, 287, 288, 289, 292, 293, 297, 298, 300, 302, 303^2, 304, 305, 306^2, 308, 309^3, 310^2, 311, 316, 317, 318, 320, 322, 323, 324^2, 325, 327, 328, 335, 336, 340, 348, 351, 355^3, 357, 365, 367, 373, 377, 379, 383^2, 392, 460, 514, 520, 533, 553, 573, 614, 632, 657, 765, 798]
ids = [286, 3161, 4355, 7428, 8391, 3533, 6136, 7554, 3787, 4851, ...]

====================================================================================

UMI info for barcode GCAATCATCATGGTCA-1 contig 1 = GGGGCGGGTG...
umi AAACCGGCAG = 272 reads: +397 validated
umi AACAATTGGT = 263 reads: +397 validated
umi AACCTTCACG = 310 reads: +397 validated
umi AACGGATCTG = 306 reads: +397 validated
umi AAGGGGGCGG = 183 reads: +22 -1 +1 -7XX +1 -2XX +1 -1XX +2 -1XX +1 -3XX +1 -2XX +351 invalidated
umi AAGTTCGGGG = 268 reads: +397 validated
umi AATAACATTC = 286 reads: +397 validated
umi AATAACGTAT = 247 reads: +397 validated
umi AATCACGGTA = 773 reads: +8 -9XX +1 -4XX +1 -264XX +1 -8XX +1 -12XX +88 invalidated
umi AATCTTCCAC = 171 reads: +397 validated
umi AATTCTGGTT = 223 reads: +397 validated
umi AATTTTCCAA = 239 reads: +397 validated
umi ACAACTATTC = 185 reads: +385 -1 +11 non-validated
umi ACACCTGGAC = 510 reads: -131X +1 -3XX +262 invalidated
umi ACAGGTCATC = 228 reads: +397 validated
umi ACATACACGC = 107 reads: +397 validated
umi ACATCGGATT = 305 reads: +397 validated
umi ACATCGGGCT = 264 reads: +397 validated
umi ACCCGGGGCG = 367 reads: +397 validated
umi ACCGCGGCAT = 281 reads: +397 validated
umi ACGAAGTTCT = 256 reads: +397 validated
umi ACGCAAGACG = 194 reads: -370 +2 -3X +14 -1XX +7 invalidated
umi ACGGCAGTCG = 244 reads: +397 validated
umi ACGGTGTGGC = 328 reads: +397 validated
umi ACGTTCCATT = 134 reads: +397 validated
umi ACTATTGTAG = 288 reads: +397 validated
umi AGATTGTTCA = 583 reads: -1XX +2 -139XX +1 -2X +1 -2XX +1 -4XX +1 -1XX +1 -2XX +1 -5XX +233 invalidated
umi AGCTATTGCA = 385 reads: -234 +163 non-validated
umi AGTTTCAATA = 262 reads: +397 validated
umi ATACGAGCGG = 278 reads: +397 validated
umi ATAGTCCAGC = 305 reads: +397 validated
umi ATCATGTTAG = 353 reads: +397 validated
umi ATCTTACTTC = 298 reads: +136 -1XX +1 -1XX +3 -6XX +1 -3XX +1 -2XX +1 -7XX +1 -3XX +49 -1 +1 -1XX +178 invalidated
umi ATGGTATACT = 232 reads: +397 validated
umi ATTCAATCTG = 306 reads: +397 validated
umi ATTCTTACAA = 283 reads: +397 validated
umi ATTTAGTGCG = 347 reads: +234 -1XX +162 invalidated
umi ATTTTATCCG = 373 reads: -344X +2 -10X +1 -5XX +12 -1XX +22 invalidated
umi CAATGTCCAT = 342 reads: +397 validated
umi CAGTGCGTCC = 307 reads: +397 validated
umi CATTCAGCTT = 164 reads: +397 validated
umi CCAACCTTCT = 319 reads: +397 validated
umi CCAATATGCG = 305 reads: +397 validated
umi CCACCTTTCG = 177 reads: +397 validated
umi CCAGCCTTTT = 248 reads: +397 validated
umi CCATAACCTA = 276 reads: +397 validated
umi CCCTATTCGC = 280 reads: +397 validated
umi CCTAAATCGC = 186 reads: +397 validated
umi CCTACTTCCT = 99 reads: -367 +30 non-validated
umi CCTCCCGCCC = 223 reads: +397 validated
umi CGACATAACA = 253 reads: +397 validated
umi CGACTGGCGG = 315 reads: +397 validated
umi CGATATTTCT = 222 reads: +178 -2XX +217 invalidated
umi CGCTGGGTCT = 413 reads: -363X +2 -1XX +1 -5XX +1 -10XX +1 -1XX +1 -6XX +1 -2XX +1 -1XX invalidated
umi CGGTGGATGG = 278 reads: +397 validated
umi CGTCATTGTC = 261 reads: +397 validated
umi CGTGTACTTT = 367 reads: -365X +1 -1XX +1 -3XX +1 -2XX +1 -10XX +1 -5XX +2 -2XX +1 -1XX invalidated
umi CGTTGTTTGC = 171 reads: -355 +1 -7X +3 -2XX +1 -1XX +4 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CGTTTCGGGC = 207 reads: +397 validated
umi CTATCCGGGC = 261 reads: +397 validated
umi CTCGGCTAAT = 115 reads: +397 validated
umi CTCTTCACTC = 292 reads: +397 validated
umi CTCTTTTGTA = 222 reads: +397 validated
umi CTGCCTTCAC = 213 reads: +397 validated
umi CTGGATGTCA = 264 reads: +397 validated
umi CTGGCTTCTT = 353 reads: +397 validated
umi CTTAGAGCCA = 132 reads: +397 validated
umi GAACCCTATC = 302 reads: +397 validated
umi GACCCTTTCC = 292 reads: +397 validated
umi GACCGATCCG = 239 reads: +397 validated
umi GCACTGCTCA = 269 reads: +397 validated
umi GCATAATCAT = 170 reads: +397 validated
umi GCATCTTCTC = 238 reads: +397 validated
umi GCCAAAATCA = 203 reads: -360X +1 -2XX +2 -1XX +6 -3XX +14 -1XX +7 invalidated
umi GCCCTTTATT = 237 reads: +397 validated
umi GGACGCTAGT = 341 reads: +397 validated
umi GGATGCACGC = 288 reads: +397 validated
umi GGCACATCGC = 218 reads: +397 validated
umi GGCCGGTATA = 304 reads: +397 validated
umi GGGATCTCGC = 302 reads: +397 validated
umi GGGCTGTCGA = 323 reads: +397 validated
umi GGGGTCTGGC = 279 reads: +397 validated
umi GTAATCTCAT = 168 reads: -356X +1 -5X +12 -1XX +22 invalidated
umi GTACTCTCTT = 278 reads: +397 validated
umi GTCTTTCTTA = 105 reads: +397 validated
umi GTGAGTCCAA = 799 reads: -182 +215 non-validated
umi GTGGGGTCGG = 207 reads: +397 validated
umi GTTTGAGTCG = 267 reads: +397 validated
umi TAAATCCATC = 608 reads: -290 +107 non-validated
umi TAAGCCCGAC = 272 reads: +397 validated
umi TACATTCTAT = 360 reads: +397 validated
umi TACGACAATC = 285 reads: +397 validated
umi TAGATGCCAG = 309 reads: +397 validated
umi TAGTTCCCTC = 203 reads: +397 validated
umi TATAGATCCT = 238 reads: +397 validated
umi TCAAGTTCCG = 226 reads: +397 validated
umi TCAGTATGCC = 262 reads: +397 validated
umi TCCCTTGTAT = 8 reads: +50 -5XX +2 -1XX +1 -4XX +1 -3XX +2 -2XX +1 -4XX +2 -2XX +1 -316XX invalidated
umi TCCGATGAGT = 530 reads: -178X +219 invalidated
umi TCCTAGGACG = 560 reads: -110X +287 invalidated
umi TCCTGATACA = 297 reads: +397 validated
umi TCGATTGGCA = 221 reads: +397 validated
umi TCGTCGAGTG = 280 reads: +397 validated
umi TCTAGCTCAG = 301 reads: +397 validated
umi TCTCATGTTT = 157 reads: +397 validated
umi TCTCCTAATC = 345 reads: +397 validated
umi TCTTTGTTAG = 284 reads: +397 validated
umi TGAAACTACA = 333 reads: +397 validated
umi TGAGGTCATG = 222 reads: +397 validated
umi TGATGTGCTG = 332 reads: +397 validated
umi TGCAAACCTA = 335 reads: +397 validated
umi TGCAATACAT = 326 reads: +397 validated
umi TGCAGCATCG = 329 reads: +397 validated
umi TGCGAGTTTA = 209 reads: +397 validated
umi TGCTAGCGTG = 285 reads: +397 validated
umi TGTCGCCCTC = 307 reads: +397 validated
umi TGTCGTTCGG = 141 reads: +397 validated
umi TTAAAACCTA = 354 reads: +397 validated
umi TTACCTATTC = 372 reads: +397 validated
umi TTACGTCTTA = 303 reads: +397 validated
umi TTCCGTCACG = 259 reads: +219 -1XX +177 invalidated
umi TTCCTCGGCT = 320 reads: +397 validated
umi TTCGAATTGT = 268 reads: +397 validated
umi TTCTGGTTCC = 272 reads: +397 validated
umi TTGAGCTTCT = 248 reads: +397 validated
umi TTGCAGCGCG = 376 reads: +126 -4XX +2 -1XX +264 invalidated
umi TTGCCCTTCG = 309 reads: +397 validated
umi TTGGTGTCTC = 222 reads: +397 validated
umi TTGTCTTCCC = 262 reads: +397 validated
umi TTTACGCCGA = 303 reads: +397 validated
umi TTTCGGCGGT = 251 reads: +397 validated

UMI info for barcode GCAATCATCATGGTCA-1 contig 2 = AGATCTCAGA...
umi AAACTTCGCG = 52 reads: +91 -1 +13 -1X +297 invalidated
umi AATACATCCA = 170 reads: +397 -6 non-validated
umi AATAGTCTCG = 137 reads: +403 validated
umi AATATAAGGC = 64 reads: +91 -1X +304 -7 invalidated
umi ACAAGAATCT = 262 reads: +403 validated
umi ACCTATATGG = 257 reads: +403 validated
umi ACGATACCTA = 203 reads: +403 validated
umi ACGCAACGTG = 120 reads: -375X +1 -1XX +1 -11XX +4 -7XX +3 invalidated
umi AGTCATTTGG = 26 reads: -2 +89 -1X +125 -1 +56 -9 +26 -1 +1 -1X +91 invalidated
umi ATCTCAAGTG = 206 reads: +403 validated
umi ATCTTAAGGC = 176 reads: +402 -1 non-validated
umi CACACCCTGC = 199 reads: +403 validated
umi CACGTACGTT = 121 reads: +403 validated
umi CATTTTACTC = 193 reads: +403 validated
umi CCATTTGGCT = 114 reads: +403 validated
umi CCCTGTCGGT = 105 reads: -18X +1 -2XX +1 -3XX +2 -2XX +3 -1XX +3 -1XX +1 -2XX +1 -1XX +1 -1XX +61 -1 +292 -5 invalidated
umi CCTCCTAACT = 135 reads: +403 validated
umi CCTGTGCTGG = 15 reads: +91 -1 +102 -5 +56 -108 +40 non-validated
umi CCTGTTCTAC = 86 reads: +403 validated
umi CCTTAACTCT = 229 reads: +403 validated
umi CGCCGACGCT = 40 reads: +28 -12 +321 -24 +7 -1 +10 non-validated
umi CGCTAATGCA = 25 reads: +94 -1 +265 -1 +29 -13 non-validated
umi CGGGTGACGC = 40 reads: +309 -8 +58 -1 +14 -1 +12 non-validated
umi CGTAGAGGCT = 61 reads: +403 validated
umi CTCAATGTAG = 50 reads: +358 -45 non-validated
umi CTCTGTACTC = 27 reads: +306 -6 +60 -31 non-validated
umi CTTTTGTCCT = 24 reads: +86 -3X +2 -1X +2 -1 +10 -1 +197 -1 +10 -6 +56 -27 invalidated
umi GACTCAGGTG = 69 reads: +388 -15 non-validated
umi GCATTACACA = 237 reads: +403 validated
umi GCGTCGGAAG = 120 reads: +403 validated
umi GCTCTTTGAA = 241 reads: +403 validated
umi GGAGTCTCGC = 256 reads: +403 validated
umi GTAGAAACTC = 56 reads: +283 -1XX +119 invalidated
umi GTCGGGACAA = 22 reads: +199 -1 +10 -55 +59 -10 +10 -1 +45 -10 +3 non-validated
umi GTTCAAAATC = 96 reads: +403 validated
umi TATCCGGCGG = 41 reads: +363 -1 +39 non-validated
umi TCACGAGTAA = 130 reads: +403 validated
umi TCCATGCGCA = 37 reads: +385 -1 +17 non-validated
umi TCCTACCGTC = 53 reads: +344 -2 +16 -1 +6 -1 +1 -1X +18 -1 +2 -1 +3 -2 +4 invalidated
umi TCGTTGTCAA = 34 reads: +287 -1 +18 -39 +3 -1 +54 non-validated
umi TCTAACCCAG = 20 reads: +103 -1X +1 -1 +87 -6 +128 -7 +5 -2 +3 -1 +8 -1 +12 -1 +1 -2 +20 -13 invalidated
umi TCTATAGGGG = 322 reads: +72 -1XX +330 invalidated
umi TCTCCCAAGG = 299 reads: +403 validated
umi TGAAAAGACT = 35 reads: +279 -53 +3 -1 +67 non-validated
umi TGGTCACCCT = 119 reads: +403 validated
umi TTCTAACATC = 215 reads: +403 validated
umi TTGCACGGAA = 27 reads: +56 -1 +1 -1 +16 -1 +15 -5X +9 -1 +238 -1 +17 -1 +40 invalidated
umi TTTGCATGGT = 69 reads: -293 +110 non-validated

GOOD CONTIGS

TIG 1[bases=584]
51-411 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=17)
410-448 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
448-584 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 120 umis using 5170 reads
cdr3 = CTQGTHWPPTF at 387, score = 8 + 8
umis assigned: [63, 182, 256, 271, 401, 436, 443, 446, 490, 529] and 121 others
of which 130 are surviving nonsolos
reads assigned: 36321
start codons at 51, 84, 112, 208, 370, 490
confident = true

TIG 2[bases=664]
0-79 ==> 0-79 on |156|IGHV3-7|5'UTR| [len=79] (mis=1)
79-395 ==> 0-316 on |157|IGHV3-7|L-REGION+V-REGION| [len=351] (mis=25)
446-482 ==> 13-49 on |56|IGHJ5|J-REGION| [len=49] (mis=1)
482-664 ==> 0-182 on |43|IGHG2|C-REGION| [len=977] (mis=1)
junction support: 28 umis using 421 reads
cdr3 = CARAQYSWTW at 421, score = 7 + 8
umis assigned: [96, 459, 471, 474, 629, 884, 936, 942, 1531, 1938] and 38 others
of which 48 are surviving nonsolos
reads assigned: 5477
start codons at 79, 235, 296, 314, 382, 412
confident = true

REJECT CONTIGS

TIG 1[bases=431]
20-68 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
389-431 ==> 0-42 on |3|IGHA2|C-REGION| [len=1019] (mis=0)
umis assigned: [1778, 2599, 2641, 2672, 4335, 7312, 7892]
of which 7 are surviving nonsolos
reads assigned: 669
start codons at 74, 171, 268, 322, 336, 344, 386
confident = false
did not find CDR3
now this is a cell
paired!

ATGAACAGCCTGACAGTCGACGATACGGCTATGTATTACTGTGCGAGGGCCCAATATAGTTGGACCTGGGGCCAGGGGACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGGGTGGAGGCTGAGGATGTTGGGATTTATTACTGCACACAAGGTACACACTGGCCTCCGACGTTCGGCCACGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.347 = GCAATCATCCAACCAA-1

using 937 reads

====================================================================================

graph has 254 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2, 3, 6, 410, 511]
surviving nonsolo ucounts = 2[410, 511]
ids = [4, 7]

====================================================================================

UMI info for barcode GCAATCATCCAACCAA-1 contig 1 = ACTTTCTGAG...
umi GTTCGTGCAG = 510 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=539]
0-35 ==> 66-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
35-391 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=12)
405-468 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=2)
468-539 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CAREAWAGGYYYYYYMDVW at 380, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 502
start codons at 35, 79, 425
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.350 = GCAATCATCCCTAATT-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.353 = GCAATCATCCGCGGTA-1

using 251 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 1[238]
surviving nonsolo ucounts = 1[238]
ids = [3]

====================================================================================

UMI info for barcode GCAATCATCCGCGGTA-1 contig 1 = GTCAGGACAC...
umi CACGTTGTCG = 226 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
13-364 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
363-401 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
401-484 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNSYPWTF at 340, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 13, 19, 75, 88, 320, 443
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.357 = GCAATCATCCTCTAGC-1

using 447 reads

====================================================================================

graph has 160 edges initially, 10 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[3^2, 4, 121, 308]
surviving nonsolo ucounts = 2[121, 308]
ids = [1, 11]

====================================================================================

UMI info for barcode GCAATCATCCTCTAGC-1 contig 1 = GCTACAACAG...
umi TTATCCTCCT = 310 reads: +400 validated

UMI info for barcode GCAATCATCCTCTAGC-1 contig 2 = AGGAGTCAGA...
umi AAGCTATTTG = 110 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYYSTPYTF at 367, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 28, 97, 350, 470
confident = false

TIG 2[bases=419]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=13)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
junction support: 1 umis using 11 reads
cdr3 = CQQTNGFPASF at 354, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 109
start codons at 27, 33, 89, 102, 238
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.362 = GCAATCATCCTTTACA-1

using 254 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 245]
surviving nonsolo ucounts = 1[245]
ids = [3]

====================================================================================

UMI info for barcode GCAATCATCCTTTACA-1 contig 1 = GGCTGGGGTC...
umi AGTGGCCTTA = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=490]
42-403 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=11)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
430-490 ==> 0-60 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CSSYTSSSTLVF at 366, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 233
start codons at 42, 199, 243, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.364 = GCAATCATCGCGATCG-1

using 375 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 366]
surviving nonsolo ucounts = 1[366]
ids = [5]

====================================================================================

UMI info for barcode GCAATCATCGCGATCG-1 contig 1 = GGGAGGAACT...
umi GTACGCTCGA = 360 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=559]
0-35 ==> 62-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
35-380 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNLWPPMCSF at 356, score = 9 + 6
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 35, 104, 177, 240, 383, 416, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.368 = GCAATCATCGTTTAGG-1

using 3405 reads

====================================================================================

graph has 2337 edges initially, 34 edges after simplification

total ucounts = 694
nonsolo ucounts = 327[2^141, 3^71, 4^45, 5^23, 6^16, 7^13, 8^6, 10, 11^2, 12, 13, 15, 28, 98, 110, 202, 688, 815]
surviving nonsolo ucounts = 5[28, 110, 202, 688, 815]
ids = [229, 477, 571, 593, 400]

====================================================================================

UMI info for barcode GCAATCATCGTTTAGG-1 contig 1 = TGAGCGCAGA...
umi TCTTAACAGT = 193 reads: +394 validated

UMI info for barcode GCAATCATCGTTTAGG-1 contig 2 = GGGCTTTCTG...
umi CCGGACTCCT = 26 reads: -53 +14 -1 +101 -4 +102 -1X +181 invalidated
umi TACTCAAATT = 98 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=447]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=13)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
junction support: 1 umis using 30 reads
cdr3 = CGTWDSSLSGGSYVF at 357, score = 7 + 8
umis assigned: [571]
of which 1 are surviving nonsolos
reads assigned: 193
start codons at 36, 190, 241, 365, 394
confident = true

TIG 2[bases=523]
16-387 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=24)
434-473 ==> 10-49 on |56|IGHJ5|J-REGION| [len=49] (mis=0)
473-523 ==> 0-50 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 13 reads
cdr3 = CARGRDNYGGYDLDDPGYFHPW at 376, score = 9 + 7
umis assigned: [229, 477]
of which 2 are surviving nonsolos
reads assigned: 122
start codons at 16, 37, 81, 167, 398, 416, 491
confident = true
now this is a cell
paired!

TACTGTGCGAGAGGCCGGGACAACTATGGTGGCTACGATCTCGATGACCCAGGGTACTTTCACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CAGACTGGGGACGAGGCCGATTATTTCTGCGGAACATGGGATAGCAGCCTGAGTGGTGGCTCTTATGTCTTCGGAACTGGGACCAAGCTCACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.382 = GCAATCATCTTGTACT-1

using 221 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 211]
surviving nonsolo ucounts = 1[211]
ids = [6]

====================================================================================

UMI info for barcode GCAATCATCTTGTACT-1 contig 1 = AGCTTCAGCT...
umi TTCTGCCATT = 206 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=604]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
435-604 ==> 0-169 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDSLNGWVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.385 = GCACATAAGAACAATC-1

using 92 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3^2, 8, 73]
surviving nonsolo ucounts = 1[73]
ids = [5]

====================================================================================

UMI info for barcode GCACATAAGAACAATC-1 contig 1 = GTCAGTCCCA...
umi CCGGGCACAG = 69 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=458]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=29)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
411-458 ==> 0-47 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CHQYESVPYTF at 350, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 66
start codons at 23, 29, 85, 98, 237, 333, 360, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.387 = GCACATAAGAATCTCC-1

using 462 reads

====================================================================================

graph has 209 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[3^2, 4, 10, 115, 324]
surviving nonsolo ucounts = 3[10, 115, 324]
ids = [5, 0, 2]

====================================================================================

UMI info for barcode GCACATAAGAATCTCC-1 contig 1 = AGTCTGGGCC...
umi ACCTTCCGCT = 313 reads: +379 validated

UMI info for barcode GCACATAAGAATCTCC-1 contig 2 = GGACACAGCA...
umi AATGATTGGC = 107 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=585]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-382 ==> 0-342 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
419-585 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 71 reads
cdr3 = CQVWDSSSDVVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 40, 101, 239, 242, 338, 380
confident = false

TIG 2[bases=490]
9-362 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
360-397 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
397-490 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQSYSTGVTF at 336, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 104
start codons at 9, 15, 71, 84, 220, 439
confident = false

REJECT CONTIGS

TIG 1[bases=319]
0-140 ==> 174-314 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=5)
189-226 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
226-319 ==> 0-93 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYSTGVTF at 165, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 6
start codons at 268
confident = false
not full
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.396 = GCACATAAGATCCCGC-1

using 142 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[137]
surviving nonsolo ucounts = 1[137]
ids = [4]

====================================================================================

UMI info for barcode GCACATAAGATCCCGC-1 contig 1 = AGGAGTCAGA...
umi TCTCATTTCC = 136 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-489 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 133
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.397 = GCACATAAGCACAGGT-1

using 1158 reads

====================================================================================

graph has 312 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[164, 289, 348, 355]
surviving nonsolo ucounts = 4[164, 289, 348, 355]
ids = [1, 4, 5, 2]

====================================================================================

UMI info for barcode GCACATAAGCACAGGT-1 contig 1 = AGGAGTCAGA...
umi TAAATTGGTA = 352 reads: +388 validated
umi TATAGTTGGT = 290 reads: +388 validated
umi TATAGTTTGT = 348 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 159 reads
cdr3 = CQQYDSFSWTF at 354, score = 8 + 8
umis assigned: [2, 4, 5]
of which 3 are surviving nonsolos
reads assigned: 981
start codons at 27, 33, 89, 102, 238, 241, 334, 364, 457
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.400 = GCACATAAGCCAGGAT-1

using 658 reads

====================================================================================

graph has 300 edges initially, 12 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[7, 10, 144, 198, 298]
surviving nonsolo ucounts = 2[144, 198]
ids = [4, 5]

====================================================================================

UMI info for barcode GCACATAAGCCAGGAT-1 contig 1 = GGAGTCAGAC...
umi TCGTCAACGA = 141 reads: +388 validated
umi TTCCCCTTGC = 201 reads: +388 validated

UMI info for barcode GCACATAAGCCAGGAT-1 contig 2 = TGGGAGGAAT...
umi AACCTACTCT = 215 reads: +22 -1XX +25 -1XX +12 -2XX +26 -1XX +3 -1XX +16 -1XX +13 -69X +8 -2XX +3 -1XX +3 -1XX +2 -3XX +2 -1XX +2 -1XX +5 -1XX +30 -2XX +27 -1XX +100 invalidated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 48 reads
cdr3 = CQQYNSYPLTF at 353, score = 8 + 9
umis assigned: [4, 5]
of which 2 are surviving nonsolos
reads assigned: 338
start codons at 26, 32, 88, 101, 333, 456
confident = false

TIG 2[bases=555]
31-360 ==> 0-329 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 188
start codons at 31, 37, 93, 106, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.403 = GCACATAAGCTCAACT-1

using 15 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.404 = GCACATAAGCTGTCTA-1

using 766 reads

====================================================================================

graph has 284 edges initially, 12 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 4, 334, 418]
surviving nonsolo ucounts = 2[334, 418]
ids = [8, 0]

====================================================================================

UMI info for barcode GCACATAAGCTGTCTA-1 contig 1 = GAGGAACTGC...
umi AAGATATCCA = 415 reads: +385 validated

UMI info for barcode GCACATAAGCTGTCTA-1 contig 2 = GTCAGTCTCA...
umi TCCATTTGGA = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=1)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYNNWPPITF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 33, 102, 238, 460
confident = false

TIG 2[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQSYTTLLTF at 350, score = 9 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.405 = GCACATAAGGACTGGT-1

using 187 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[187]
surviving nonsolo ucounts = 1[187]
ids = [0]

====================================================================================

UMI info for barcode GCACATAAGGACTGGT-1 contig 1 = GAGTGCTTTC...
umi AGTGTCGCAA = 187 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=568]
39-176 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
176-302 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
423-469 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
469-568 ==> 0-99 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 378, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 39, 83, 348
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_66.405_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.415 = GCACATAAGTACTTGC-1

using 514 reads

====================================================================================

graph has 200 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 4[5, 47, 217, 236]
surviving nonsolo ucounts = 3[47, 217, 236]
ids = [1, 5, 2]

====================================================================================

UMI info for barcode GCACATAAGTACTTGC-1 contig 1 = GAATCAGTCC...
umi ACCAATAATC = 2 reads: -258 +1 -1 +5 -1X +1 -2X +2 -1 +6 -1 +11 -1 +1 -2X +1 -3 +2 -3 +2 -1 +2 -5 +1 -74 invalidated
umi ACCACTATTC = 45 reads: +388 validated
umi ACCATTATTC = 221 reads: +388 validated

UMI info for barcode GCACATAAGTACTTGC-1 contig 2 = GGGCACAAGA...
umi CAGGGTCACA = 214 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=499]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-499 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 43 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0, 1, 2]
of which 2 are surviving nonsolos
reads assigned: 264
start codons at 25, 31, 100, 236, 455
confident = true

TIG 2[bases=550]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-391 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-426 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
426-550 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CQSYDSSLSGYVF at 359, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 212
start codons at 35, 189, 243, 342, 369, 390
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.417 = GCACATAAGTCACGCC-1

using 450 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[449]
surviving nonsolo ucounts = 1[449]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=391]
27-218 ==> 160-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=13)
217-255 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
255-391 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 194, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 445
start codons at 78, 297
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.419 = GCACATAAGTGAACAT-1

using 422 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^3, 3^2, 5, 399]
surviving nonsolo ucounts = 1[399]
ids = [9]

====================================================================================

UMI info for barcode GCACATAAGTGAACAT-1 contig 1 = GGAGAAGAGC...
umi TCGTGTCTTT = 365 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=458]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
421-458 ==> 0-37 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 70 reads
cdr3 = CQQYGSSPWTF at 360, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 36, 244, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.421 = GCACATAAGTGGGCTA-1

using 303 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2^2, 8, 286]
surviving nonsolo ucounts = 1[286]
ids = [5]

====================================================================================

UMI info for barcode GCACATAAGTGGGCTA-1 contig 1 = GGGGGAGTCA...
umi GGCGGCCAAT = 272 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
29-382 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=12)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
417-482 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQSYTTPWTF at 356, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.427 = GCACATACAAATCCGT-1

using 60 reads

====================================================================================

graph has 93 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2^2, 3, 4, 5, 7, 14, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.432 = GCACATACAATGGTCT-1

using 430 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[8, 15, 404]
surviving nonsolo ucounts = 1[404]
ids = [1]

====================================================================================

UMI info for barcode GCACATACAATGGTCT-1 contig 1 = GGGGAGGAAC...
umi ATATTAGTGA = 384 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=502]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=18)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-502 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CQQYYNWPPYTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 375
start codons at 36, 105, 241, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.434 = GCACATACACACCGAC-1

using 116 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[3^3, 4, 100]
surviving nonsolo ucounts = 1[100]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=507]
5-59 ==> 5946-6000 on segment before IGLVI-70 exon 1 [len=6000] (mis=0)
43-75 ==> 196-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
59-75 ==> 0-16 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=0)
59-83 ==> 0-24 on |353|IGLV3-12|L-REGION+V-REGION| [len=347] (mis=0)
59-84 ==> 0-25 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
102-181 ==> 43-122 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=16)
102-130 ==> 43-71 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=2)
272-379 ==> 219-326 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=16)
275-378 ==> 210-313 on |367|IGLV3-32|L-REGION+V-REGION| [len=344] (mis=20)
355-380 ==> 314-339 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=1)
409-447 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
447-507 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CSTGDYSLSAHWVF at 377, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 59, 210, 260
confident = false
not full
full length stopped transcript of length 507
frameshifted full length stopped transcript of length 507
VJ delta = 16
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.440 = GCACATACACCGATAT-1

using 395 reads

====================================================================================

graph has 116 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 5, 156, 226]
surviving nonsolo ucounts = 2[156, 226]
ids = [2, 7]

====================================================================================

UMI info for barcode GCACATACACCGATAT-1 contig 1 = GGAGTCTCCC...
umi TCGTGATTCC = 221 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=525]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
431-477 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
477-525 ==> 0-48 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARPYNSYWLGFDYW at 401, score = 8 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 59, 233
confident = false

REJECT CONTIGS

TIG 1[bases=466]
0-340 ==> 11-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=1)
339-377 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
377-466 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYDNLPITF at 316, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 150
start codons at 51, 64, 203, 326, 419
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.442 = GCACATACACCGTTGG-1

using 88 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 12[2^4, 4^2, 7, 9, 11^2, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.443 = GCACATACACCTCGGA-1

using 353 reads

====================================================================================

graph has 114 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 159, 186]
surviving nonsolo ucounts = 2[159, 186]
ids = [2, 0]

====================================================================================

UMI info for barcode GCACATACACCTCGGA-1 contig 1 = GGTGACTCCT...
umi CCGGCTCCTT = 157 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=520]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=1)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
403-453 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
453-520 ==> 0-67 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 365, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 20, 64, 243, 246, 249, 335, 405
confident = false

REJECT CONTIGS

TIG 1[bases=423]
0-75 ==> 5533-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-423 ==> 0-34 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 171
start codons at 30, 63, 99, 187, 349, 369
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.448 = GCACATACAGATAATG-1

using 432 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 425]
surviving nonsolo ucounts = 1[425]
ids = [2]

====================================================================================

UMI info for barcode GCACATACAGATAATG-1 contig 1 = AGCTTCAGCT...
umi CTCACCACCG = 425 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 418
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.451 = GCACATACAGCTCGCA-1

using 14 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.458 = GCACATACATCACGTA-1

using 482 reads

====================================================================================

graph has 204 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2, 3^3, 4^2, 7, 8, 53, 390]
surviving nonsolo ucounts = 2[53, 390]
ids = [13, 11]

====================================================================================

UMI info for barcode GCACATACATCACGTA-1 contig 1 = TGGGGAGGAA...
umi GGTCGTCGTA = 395 reads: +388 validated
umi TCTTTCTACG = 52 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 73 reads
cdr3 = CLQYSSSPWTF at 359, score = 9 + 8
umis assigned: [11, 13]
of which 2 are surviving nonsolos
reads assigned: 439
start codons at 32, 38, 107, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.466 = GCACATAGTAATCGTC-1

using 4484 reads

====================================================================================

graph has 2940 edges initially, 40 edges after simplification

total ucounts = 660
nonsolo ucounts = 336[2^132, 3^65, 4^54, 5^28, 6^14, 7^7, 8^8, 9^4, 10^5, 12, 16^2, 20, 21, 32, 38, 78, 139, 163, 200, 217, 249, 250, 285, 308, 329, 341, 347]
surviving nonsolo ucounts = 13[32, 38, 78, 163, 200, 217, 249, 250, 285, 308, 329, 341, 347]
ids = [606, 179, 610, 542, 316, 84, 447, 283, 268, 557, ...]

====================================================================================

UMI info for barcode GCACATAGTAATCGTC-1 contig 1 = AGACCCAGTC...
umi ATGAAGACCA = 323 reads: +388 validated
umi ATTCATACTC = 38 reads: +329 -15 +1 -2X +1 -1 +2 -1 +2 -3X +2 -1 +1 -1 +1 -3 +2 -1 +1 -1 +4 -1 +12 invalidated
umi CCTTTATGCC = 285 reads: +388 validated
umi CGGAGTCCTT = 251 reads: +388 validated
umi TACCATTCTT = 350 reads: +388 validated

UMI info for barcode GCACATAGTAATCGTC-1 contig 2 = ACGACCAGCT...
umi CTCCTTCTCC = 207 reads: +400 validated
umi GTTACTCGCT = 248 reads: +400 validated
umi TCTAGCACTA = 163 reads: +400 validated
umi TCTTTGCACC = 313 reads: +400 validated

UMI info for barcode GCACATAGTAATCGTC-1 contig 3 = GAGGAGCCCC...
umi ACGCGTCTGG = 214 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 197 reads
cdr3 = CQQYNSYLITF at 347, score = 9 + 8
umis assigned: [160, 179, 268, 283, 469]
of which 5 are surviving nonsolos
reads assigned: 1230
start codons at 20, 26, 82, 95, 231, 450
confident = true

TIG 2[bases=614]
0-78 ==> 97-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
78-441 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
441-478 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
478-614 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 98 reads
cdr3 = CQQYYSTPPTF at 417, score = 9 + 8
umis assigned: [316, 447, 542, 557]
of which 4 are surviving nonsolos
reads assigned: 913
start codons at 78, 147, 400, 520
confident = true

TIG 3[bases=550]
0-70 ==> 166-236 on |170|IGHV3-74|5'UTR| [len=236] (mis=1)
70-423 ==> 0-353 on |171|IGHV3-74|L-REGION+V-REGION| [len=353] (mis=13)
430-479 ==> 14-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CARGNYYGMDVW at 412, score = 9 + 7
umis assigned: [84]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 70, 226, 287, 373, 436
confident = true

REJECT CONTIGS

TIG 1[bases=428]
0-36 ==> 4707-4743 on rc of segment before IGHVII-28-1 exon 1 [len=4743] (mis=0)
0-36 ==> 4691-4727 on rc of segment before IGHVII-30-21 exon 1 [len=4727] (mis=0)
0-36 ==> 3480-3516 on rc of segment before IGHV3-60 exon 2 [len=3516] (mis=0)
0-36 ==> 3549-3585 on rc of segment before IGHV3-62 exon 2 [len=3585] (mis=0)
36-384 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
umis assigned: [610]
of which 1 are surviving nonsolos
reads assigned: 59
start codons at 36, 80, 417, 421
confident = false
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.467 = GCACATAGTACTCAAC-1

using 992 reads

====================================================================================

graph has 374 edges initially, 56 edges after simplification

total ucounts = 27
nonsolo ucounts = 9[2^3, 4^3, 299, 312, 345]
surviving nonsolo ucounts = 3[299, 312, 345]
ids = [14, 0, 22]

====================================================================================

UMI info for barcode GCACATAGTACTCAAC-1 contig 1 = GAGTCAGACT...
umi TCTAGCGCTC = 345 reads: +388 validated

UMI info for barcode GCACATAGTACTCAAC-1 contig 2 = GGGAATCAGA...
umi GCCCTGCCTG = 299 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYNSYPWTF at 352, score = 8 + 8
umis assigned: [22]
of which 1 are surviving nonsolos
reads assigned: 340
start codons at 25, 31, 87, 100, 236, 239, 332, 455
confident = false

TIG 2[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=1)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYNSYPRTF at 354, score = 9 + 8
umis assigned: [14]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.480 = GCACATAGTCTCAACA-1

using 336 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2^2, 5, 324]
surviving nonsolo ucounts = 1[324]
ids = [6]

====================================================================================

UMI info for barcode GCACATAGTCTCAACA-1 contig 1 = GAGCTACAAC...
umi TATGGCTCTA = 315 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=500]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=11)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-500 ==> 0-70 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQHYYSIPPTF at 369, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.485 = GCACATAGTGATAAAC-1

using 651 reads

====================================================================================

graph has 206 edges initially, 12 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[6, 8, 312, 321]
surviving nonsolo ucounts = 2[312, 321]
ids = [5, 2]

====================================================================================

UMI info for barcode GCACATAGTGATAAAC-1 contig 1 = AGTCTGGGCC...
umi TCATTCATTT = 313 reads: +382 validated

UMI info for barcode GCACATAGTGATAAAC-1 contig 2 = TCTGGTAACA...
umi CAATCGCTTA = 321 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-373 ==> 0-333 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=27)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=6)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQVWNSETEQKLF at 355, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 309
start codons at 40, 101, 338
confident = false

TIG 2[bases=630]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=2)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=7)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLLSYSGPWVF at 358, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 318
start codons at 34, 242, 341, 403
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.486 = GCACATAGTGGGTATG-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 1[27]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.488 = GCACATAGTGTTCTTT-1

using 716 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 6, 348, 360]
surviving nonsolo ucounts = 2[348, 360]
ids = [3, 1]

====================================================================================

UMI info for barcode GCACATAGTGTTCTTT-1 contig 1 = GAGGAATCAG...
umi CCATGTGGCG = 354 reads: +388 validated

UMI info for barcode GCACATAGTGTTCTTT-1 contig 2 = CTGGGCCTCA...
umi TGAATGTCGA = 327 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 349
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=574]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-377 ==> 0-340 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=0)
378-416 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
416-574 ==> 0-158 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQAWDSSTGVVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 37, 42, 98, 185, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.490 = GCACATAGTTACCAGT-1

using 902 reads

====================================================================================

graph has 330 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 204, 286, 404]
surviving nonsolo ucounts = 3[204, 286, 404]
ids = [1, 2, 9]

====================================================================================

UMI info for barcode GCACATAGTTACCAGT-1 contig 1 = ACACAACAGC...
umi AGCGATTGTA = 201 reads: +360 -2X +11 -3X +51 invalidated
umi TAAATGCGCC = 407 reads: +427 validated

UMI info for barcode GCACATAGTTACCAGT-1 contig 2 = GCTACAACAG...
umi AGGAGTAGTC = 271 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=552]
0-54 ==> 6-60 on |70|IGHV1-24|5'UTR| [len=60] (mis=0)
54-407 ==> 0-353 on |71|IGHV1-24|L-REGION+V-REGION| [len=353] (mis=2)
441-481 ==> 6-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CATRGVIAAAANQRGDYW at 396, score = 9 + 7
umis assigned: [1, 9]
of which 2 are surviving nonsolos
reads assigned: 600
start codons at 54, 210, 252, 274, 318, 351
confident = false

TIG 2[bases=523]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
390-428 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
428-523 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYYSTPRTF at 367, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.496 = GCACATAGTTCTCATT-1

using 312 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^3, 3, 4, 5, 289]
surviving nonsolo ucounts = 1[289]
ids = [2]

====================================================================================

UMI info for barcode GCACATAGTTCTCATT-1 contig 1 = GGGGTCTCAG...
umi ACTGAGCAGG = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=590]
0-38 ==> 3-41 on |338|IGLV2-14|5'UTR| [len=41] (mis=0)
38-383 ==> 0-345 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=7)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-590 ==> 0-164 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CSSYTSSDTVVF at 362, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 38, 195, 239, 246
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.498 = GCACATAGTTTGGCGC-1

using 846 reads

====================================================================================

graph has 304 edges initially, 40 edges after simplification

total ucounts = 8
nonsolo ucounts = 7[2^2, 6^2, 247, 290, 292]
surviving nonsolo ucounts = 3[247, 290, 292]
ids = [5, 4, 6]

====================================================================================

UMI info for barcode GCACATAGTTTGGCGC-1 contig 1 = AGTCCCACTC...
umi GAACTATCTT = 293 reads: +110 -1XX +13 -1XX +263 invalidated

UMI info for barcode GCACATAGTTTGGCGC-1 contig 2 = AGTCTCAGTC...
umi GTACAATGCG = 247 reads: +388 validated

UMI info for barcode GCACATAGTTTGGCGC-1 contig 3 = GAGCTGCTCA...
umi TACATGCAGC = 292 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 20, 26, 95, 231, 450
confident = false

TIG 2[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=0)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQSYSTPPTF at 347, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 20, 26, 82, 95, 231, 450
confident = false

TIG 3[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQHATSPFTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 30, 238, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.501 = GCACATATCAATACCG-1

using 194 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 7[2^5, 3, 175]
surviving nonsolo ucounts = 1[175]
ids = [10]

====================================================================================

UMI info for barcode GCACATATCAATACCG-1 contig 1 = CTGTGGGTAG...
umi GCGCTGCATC = 170 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=519]
0-39 ==> 75-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
39-392 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
427-519 ==> 0-92 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CAAWDDSLNGVVF at 360, score = 8 + 8
umis assigned: [10]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 39, 343, 368, 373, 385
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.504 = GCACATATCACATACG-1

using 437 reads

====================================================================================

graph has 161 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 7, 11, 411]
surviving nonsolo ucounts = 1[411]
ids = [5]

====================================================================================

UMI info for barcode GCACATATCACATACG-1 contig 1 = GATGCTTTCT...
umi TATTCGTTAG = 413 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=647]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=27)
417-465 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=3)
465-647 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 52 reads
cdr3 = CARRDYYGSERVDFDYW at 383, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 406
start codons at 1, 17, 26, 38, 82, 98, 186, 305, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.506 = GCACATATCAGCACAT-1

using 28 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 6, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.507 = GCACATATCATGTCCC-1

using 554 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 3^2, 542]
surviving nonsolo ucounts = 1[542]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=440]
6-197 ==> 162-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=14)
246-280 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
280-440 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 186, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 536
start codons at 42, 47, 64, 108, 141, 334
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.509 = GCACATATCATTGCGA-1

using 267 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 260]
surviving nonsolo ucounts = 1[260]
ids = [4]

====================================================================================

UMI info for barcode GCACATATCATTGCGA-1 contig 1 = GCAGGAGTCA...
umi CACCAACCAT = 252 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
0-29 ==> 0-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
29-380 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=3)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
417-478 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQDYNYPFTF at 356, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 29, 35, 91, 104, 186, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.515 = GCACATATCCATGCTC-1

using 24748 reads

====================================================================================

graph has 8262 edges initially, 58 edges after simplification

total ucounts = 1029
nonsolo ucounts = 501[2^173, 3^107, 4^52, 5^38, 6^17, 7^10, 8^9, 9^4, 10^4, 11^2, 12, 13, 14^4, 16, 46, 110, 123, 125, 126, 129, 150, 167, 174, 177, 184, 193, 209, 213, 214, 219^2, 228, 234, 246, 248, 252, 255, 258, 260, 264, 268, 271, 275^2, 277, 280, 281, 285, 287, 288, 289, 291, 295, 296, 298, 300^2, 307, 308, 309, 311^2, 314, 318^2, 320^2, 322, 323, 327, 335, 336, 338, 339, 348, 352, 354, 355^2, 363, 366^2, 374, 378, 379, 382, 386, 412, 417, 420, 606, 768]
surviving nonsolo ucounts = 76[46, 123, 126, 129, 150, 167, 174, 177, 184, 193, 209, 213, 214, 219^2, 228, 234, 246, 248, 252, 255, 258, 260, 264, 268, 271, 275^2, 277, 280, 281, 285, 287, 288, 289, 291, 295, 296, 298, 300^2, 307, 308, 309, 311^2, 314, 318^2, 320^2, 322, 323, 327, 335, 336, 338, 339, 348, 352, 354, 355^2, 363, 366^2, 374, 378, 379, 382, 386, 412, 417, 420, 606, 768]
ids = [517, 817, 945, 411, 763, 648, 711, 968, 238, 219, ...]

====================================================================================

UMI info for barcode GCACATATCCATGCTC-1 contig 1 = AGAGCTCTGG...
umi AAAGTACTCT = 265 reads: +388 validated
umi AACCAACAAC = 409 reads: +388 validated
umi AACTCCGTGC = 294 reads: +388 validated
umi AAGGATGTAC = 305 reads: +388 validated
umi ACATGCTTCA = 292 reads: +388 validated
umi ACCAGTATAC = 277 reads: +388 validated
umi ACTGGGATAC = 211 reads: +388 validated
umi AGCGGGGTCT = 280 reads: +388 validated
umi AGGGCTGGTG = 278 reads: +388 validated
umi ATAACCGGGA = 373 reads: +388 validated
umi ATCATGCTCC = 344 reads: +388 validated
umi CCCCTGTTTG = 352 reads: +388 validated
umi CCTCTCCCGT = 419 reads: +388 validated
umi CGGCTCCATG = 267 reads: +388 validated
umi CTGTCTGCCT = 356 reads: +388 validated
umi CTGTTATCGC = 364 reads: +388 validated
umi GACGTAATGT = 259 reads: +388 validated
umi GAGCACTCGG = 339 reads: +388 validated
umi GCCTACTCCC = 384 reads: +388 validated
umi GCGGGTCACC = 420 reads: +388 validated
umi GCGTCTGAAC = 339 reads: +388 validated
umi GCGTGAGACA = 310 reads: +388 validated
umi GGATTATTAA = 375 reads: +388 validated
umi GGCTCCCTCC = 352 reads: +388 validated
umi GGTACTCCGC = 322 reads: +388 validated
umi GGTATCTACT = 176 reads: +47 -1XX +340 invalidated
umi TAGCTCCAGC = 357 reads: +388 validated
umi TCAATCGCGG = 768 reads: +388 validated
umi TCATACCTCC = 282 reads: +388 validated
umi TCCAACTAAA = 121 reads: +388 validated
umi TGCTATGGGT = 248 reads: +388 validated
umi TGCTTCCTGC = 365 reads: +388 validated
umi TTACTTCTTG = 277 reads: +388 validated
umi TTCATTGCTA = 172 reads: -338 +50 non-validated
umi TTCGAATTCA = 244 reads: +388 validated
umi TTCGATCGCT = 218 reads: +388 validated

UMI info for barcode GCACATATCCATGCTC-1 contig 2 = GGGGAATCCT...
umi ACACGCCCTT = 247 reads: +442 validated
umi ACTGTTATCG = 266 reads: +442 validated
umi AGCACTTCCT = 273 reads: +442 validated
umi ATAGTCTCAT = 192 reads: +442 validated
umi ATCTCATTGC = 184 reads: +431 -11 non-validated
umi CACATGGTAG = 330 reads: +442 validated
umi CTAGCCTTCC = 318 reads: +442 validated
umi CTTTCTAGCA = 45 reads: +295 -3 +115 -1 +8 -1 +4 -2 +1 -1 +11 non-validated
umi GCACAGGATC = 366 reads: +442 validated
umi GCGGGTCGCC = 280 reads: +442 validated
umi GTCAACCTCT = 313 reads: +442 validated
umi GTGTCGCCTA = 227 reads: +442 validated
umi GTTTGGTCTA = 171 reads: +442 validated
umi TACGTACTAT = 229 reads: +427 -1X +14 invalidated
umi TATTCGCTAT = 216 reads: +442 validated
umi TGCTTCCCAA = 385 reads: +442 validated
umi TTAACATGCG = 121 reads: -434X +1 -3X +1 -2X +1 invalidated

GOOD CONTIGS

TIG 1[bases=568]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 34 umis using 1767 reads
cdr3 = CQQYGSSPKYTF at 368, score = 9 + 8
umis assigned: [6, 16, 24, 30, 69, 75, 123, 167, 177, 205] and 26 others
of which 36 are surviving nonsolos
reads assigned: 11253
start codons at 44, 252, 378, 474
confident = true

TIG 2[bases=533]
20-378 ==> 0-358 on |103|IGHV2-70D|L-REGION+V-REGION| [len=358] (mis=2)
379-406 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
412-462 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
462-533 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 349 reads
cdr3 = CARMVYYYGSGSYWADDAFDIW at 365, score = 7 + 8
umis assigned: [60, 128, 157, 219, 238, 293, 461, 517, 571, 606] and 7 others
of which 17 are surviving nonsolos
reads assigned: 4105
start codons at 20, 176, 243, 246, 326, 335, 374, 387, 411, 414, 443
confident = true

REJECT CONTIGS

TIG 1[bases=547]
3-78 ==> 5665-5740 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=1)
373-411 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2, 127, 148, 173, 176, 180, 184, 202, 321, 336] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6411
start codons at 27, 33, 89, 102, 334, 453
confident = false
did not find CDR3
now this is a cell
paired!

TACTGTGCACGGATGGTCTATTACTATGGTTCAGGGAGTTATTGGGCTGATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTAAGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.517 = GCACATATCCCTGACT-1

using 425 reads

====================================================================================

graph has 142 edges initially, 4 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^3, 4, 79, 331]
surviving nonsolo ucounts = 2[79, 331]
ids = [5, 3]

====================================================================================

UMI info for barcode GCACATATCCCTGACT-1 contig 1 = GAGTGCTTTC...
umi GCCATTATAC = 78 reads: +436 validated

UMI info for barcode GCACATATCCCTGACT-1 contig 2 = GAGCTACAAC...
umi CTCACCGGGT = 324 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=543]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=12)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
454-543 ==> 0-89 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARAHGDYYTLLDYW at 378, score = 8 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 78
start codons at 18, 39, 83, 169, 369
confident = false

TIG 2[bases=487]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-487 ==> 0-57 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYYSTPFTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.523 = GCACATATCGCCTGAG-1

using 294 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[287]
surviving nonsolo ucounts = 1[287]
ids = [7]

====================================================================================

UMI info for barcode GCACATATCGCCTGAG-1 contig 1 = ATCAGTCCCA...
umi TCCCTGTTTG = 291 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 284
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.524 = GCACATATCGGTTCGG-1

using 109 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 95]
surviving nonsolo ucounts = 1[95]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.526 = GCACATATCGTCCAGG-1

using 198 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 187]
surviving nonsolo ucounts = 1[187]
ids = [5]

====================================================================================

UMI info for barcode GCACATATCGTCCAGG-1 contig 1 = ACCCAAAAAC...
umi CAACACTCAC = 182 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=528]
0-54 ==> 5-59 on |62|IGHV1-18|5'UTR| [len=59] (mis=0)
54-332 ==> 0-278 on |63|IGHV1-18|L-REGION+V-REGION| [len=351] (mis=28)
427-475 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=7)
475-528 ==> 0-53 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARAGSSSWSAELDSW at 396, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 181
start codons at 54, 205, 257, 289, 318
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.528 = GCACATATCTCCGGTT-1

using 280 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^3, 4, 8, 258]
surviving nonsolo ucounts = 1[258]
ids = [0]

====================================================================================

UMI info for barcode GCACATATCTCCGGTT-1 contig 1 = GGGGAGGAAC...
umi AGACAAGGCG = 244 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=471]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-471 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CQQYNNWAWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 243
start codons at 36, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.537 = GCACTCTAGAAGGGTA-1

using 37 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 9, 20]
surviving nonsolo ucounts = 1[20]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.538 = GCACTCTAGAATAGGG-1

using 23 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.542 = GCACTCTAGACTTTCG-1

using 407 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 7[2^4, 3, 49, 340]
surviving nonsolo ucounts = 2[49, 340]
ids = [5, 6]

====================================================================================

UMI info for barcode GCACTCTAGACTTTCG-1 contig 1 = AGTCTGGGCC...
umi CTTGGTGCAT = 51 reads: +379 validated
umi GAATTCGCAA = 341 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=630]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-377 ==> 0-337 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
419-630 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 86 reads
cdr3 = CQVWDSSTFYVF at 355, score = 8 + 8
umis assigned: [5, 6]
of which 2 are surviving nonsolos
reads assigned: 387
start codons at 40, 101, 239, 242, 338, 383, 551
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.544 = GCACTCTAGAGCTGGT-1

using 963 reads

====================================================================================

graph has 380 edges initially, 38 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 7, 223, 282, 445]
surviving nonsolo ucounts = 3[223, 282, 445]
ids = [4, 1, 8]

====================================================================================

UMI info for barcode GCACTCTAGAGCTGGT-1 contig 1 = GAGGAATCAG...
umi CCAGAGCATG = 2 reads: -352 +1 -1 +1 -2 +3 -4 +5 -1 +2 -2X +2 -2 +2 -1 +3 -2X +1 -1 invalidated
umi CCAGCGGATG = 273 reads: +388 validated

UMI info for barcode GCACTCTAGAGCTGGT-1 contig 2 = TGAGCGCAGA...
umi TGGGTACTAG = 427 reads: +388 validated

UMI info for barcode GCACTCTAGAGCTGGT-1 contig 3 = GGGGGTCTCA...
umi CTTATGCGAC = 222 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=480]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-480 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [0, 1]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 28, 34, 103, 239, 458
confident = false

TIG 2[bases=590]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-590 ==> 0-166 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 421
start codons at 36, 241, 365
confident = false

TIG 3[bases=596]
39-393 ==> 0-354 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=10)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-596 ==> 0-166 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CSSYRSSTTLGVF at 363, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 39, 240, 247, 250
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.549 = GCACTCTAGATACACA-1

using 290 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 3, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

UMI info for barcode GCACTCTAGATACACA-1 contig 1 = TGAGCGCAGA...
umi CAGTGCCTTA = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=11)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-635 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CGTWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 36, 190, 197, 241, 250, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.550 = GCACTCTAGATAGTCA-1

using 68 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 65]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.552 = GCACTCTAGATCGATA-1

using 275 reads

====================================================================================

graph has 160 edges initially, 42 edges after simplification

total ucounts = 10
nonsolo ucounts = 6[2^2, 3, 4, 127, 133]
surviving nonsolo ucounts = 2[127, 133]
ids = [5, 1]

====================================================================================

UMI info for barcode GCACTCTAGATCGATA-1 contig 1 = AGAGCTCTGG...
umi GGGACTTCCG = 119 reads: +388 validated

UMI info for barcode GCACTCTAGATCGATA-1 contig 2 = GGAGGAACTG...
umi CAGCCCGAAG = 115 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=500]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-500 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQYGSSPRYTF at 368, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 119
start codons at 44, 252, 378, 474
confident = false

TIG 2[bases=487]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=13)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
419-487 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQYNTWPPGTF at 355, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 113
start codons at 34, 103, 239, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.554 = GCACTCTAGCAAATCA-1

using 293 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2^3, 3, 7, 271]
surviving nonsolo ucounts = 1[271]
ids = [2]

====================================================================================

UMI info for barcode GCACTCTAGCAAATCA-1 contig 1 = ATCAGTCCCA...
umi ATATGGCGGT = 250 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=412]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 36 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 23, 29, 98, 234
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.556 = GCACTCTAGCACGCCT-1

using 2086 reads

====================================================================================

graph has 2841 edges initially, 51 edges after simplification

total ucounts = 1046
nonsolo ucounts = 447[2^207, 3^102, 4^50, 5^44, 6^11, 7^13, 8^8, 9^6, 10^2, 11, 12, 14^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.560 = GCACTCTAGCATGGCA-1

using 181 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 173]
surviving nonsolo ucounts = 1[173]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.563 = GCACTCTAGCCATCGC-1

using 333 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[327]
surviving nonsolo ucounts = 1[327]
ids = [0]

====================================================================================

UMI info for barcode GCACTCTAGCCATCGC-1 contig 1 = AGGAGTCAGA...
umi CCCCTCCTCA = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.564 = GCACTCTAGCCCAATT-1

using 222 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [2]

====================================================================================

UMI info for barcode GCACTCTAGCCCAATT-1 contig 1 = GGGGGTGCTT...
umi TTAAAGCGGT = 208 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=537]
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
408-456 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
456-537 ==> 0-81 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARAHGDYYTLLDYW at 380, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 20, 41, 85, 171, 371
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.567 = GCACTCTAGCGAAGGG-1

using 293 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 285]
surviving nonsolo ucounts = 1[285]
ids = [1]

====================================================================================

UMI info for barcode GCACTCTAGCGAAGGG-1 contig 1 = GAGTGCTTTC...
umi CAAACCCTAC = 275 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=560]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=9)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-560 ==> 0-106 on |45|IGHG3|C-REGION| [len=1130] (mis=1)
junction support: 1 umis using 31 reads
cdr3 = CARAHGDYYTLLDCW at 378, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 18, 39, 83, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.572 = GCACTCTAGCGTCTAT-1

using 411 reads

====================================================================================

graph has 158 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[148, 259]
surviving nonsolo ucounts = 2[148, 259]
ids = [2, 3]

====================================================================================

UMI info for barcode GCACTCTAGCGTCTAT-1 contig 1 = CAGAGCTCTG...
umi GCTTAAACTG = 259 reads: +385 validated

UMI info for barcode GCACTCTAGCGTCTAT-1 contig 2 = TGAGCGCAGA...
umi CGGTTGGGGC = 144 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=566]
0-45 ==> 52-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
45-390 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNNWPPSTF at 366, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 45, 114, 250, 472
confident = false

TIG 2[bases=483]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-483 ==> 0-53 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.581 = GCACTCTAGGCCCTCA-1

using 642 reads

====================================================================================

graph has 240 edges initially, 10 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[316, 321]
surviving nonsolo ucounts = 2[316, 321]
ids = [4, 3]

====================================================================================

UMI info for barcode GCACTCTAGGCCCTCA-1 contig 1 = GTCAGTCTCA...
umi CGGGTATTCA = 304 reads: +388 validated

UMI info for barcode GCACTCTAGGCCCTCA-1 contig 2 = TGAGCGCAGA...
umi GCCTATACGG = 293 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-503 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQGYSIPLTF at 350, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 23, 29, 85, 234, 288, 453
confident = false

TIG 2[bases=543]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=8)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
424-543 ==> 0-119 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CGTWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.583 = GCACTCTAGGGTCTCC-1

using 627 reads

====================================================================================

graph has 206 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 620]
surviving nonsolo ucounts = 1[620]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=322]
4-102 ==> 5512-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
55-187 ==> 0-132 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=0)
186-322 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 613
start codons at 55, 88, 116, 124, 228
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.589 = GCACTCTAGTCAAGCG-1

using 13248 reads

====================================================================================

graph has 5632 edges initially, 88 edges after simplification

total ucounts = 710
nonsolo ucounts = 362[2^135, 3^67, 4^42, 5^25, 6^21, 7^14, 8^4, 9^3, 11, 12^2, 13, 14, 17, 26, 59, 71, 73, 93, 114, 115^2, 116, 122, 171, 185, 188, 197, 207, 217, 226, 227, 228, 236, 239, 241, 263, 270, 275^2, 276, 278, 291, 298, 304, 306, 309, 310, 311, 313, 341, 355, 358, 367, 399, 413, 522, 692, 782]
surviving nonsolo ucounts = 43[71, 73, 93, 114, 115^2, 116, 122, 171, 185, 188, 197, 207, 217, 226, 227, 228, 236, 239, 241, 263, 270, 275^2, 276, 278, 291, 298, 304, 306, 309, 310, 311, 313, 341, 355, 358, 367, 399, 413, 522, 692, 782]
ids = [80, 649, 21, 320, 164, 489, 15, 328, 499, 589, ...]

====================================================================================

UMI info for barcode GCACTCTAGTCAAGCG-1 contig 1 = AGCTCTGAGA...
umi AACGTTACAT = 85 reads: +418 validated
umi AGATGCACGG = 216 reads: +410 -8 non-validated
umi CTAAAGCCAA = 113 reads: +414 -4 non-validated
umi GAAGAGTTCA = 258 reads: +418 validated
umi GCAGATTCTT = 252 reads: +409 -9 non-validated
umi GGTATATTAG = 225 reads: +398 -1 +4 -1 +13 -1 non-validated
umi GGTATCAGCC = 107 reads: +405 -13 non-validated
umi TGGTGATGCG = 64 reads: +398 -20 non-validated

UMI info for barcode GCACTCTAGTCAAGCG-1 contig 2 = GGGAGAGCCC...
umi AACATTGCCG = 116 reads: +385 validated
umi ACAGAAGGGA = 222 reads: +385 validated
umi ACAGTGCTAT = 298 reads: +385 validated
umi AGCGTTCCCT = 345 reads: +49 -5XX +1 -2XX +1 -6XX +1 -4XX +1 -2XX +1 -2X +2 -9X +1 -3XX +2 -4XX +1 -1XX +1 -3XX +283 invalidated
umi AGCTGCCGAA = 275 reads: +385 validated
umi ATAAGTGCAT = 356 reads: +385 validated
umi ATGCGTAACA = 118 reads: +385 validated
umi CCCGCAGTTC = 306 reads: +385 validated
umi CGGTTGGCAA = 113 reads: +385 validated
umi CTACCGAGGA = 309 reads: +385 validated
umi CTTTCATGAG = 277 reads: +385 validated
umi GCAGTAGTGT = 366 reads: +385 validated
umi GCATCATCAG = 269 reads: +385 validated
umi GCGGTTTTCA = 309 reads: +385 validated
umi GGAGGTTTCC = 352 reads: +385 validated
umi GGCCTGCTAC = 310 reads: +385 validated
umi GTAGCCCGTT = 416 reads: +385 validated
umi GTATACTGGG = 176 reads: +49 -5XX +1 -2XX +1 -6XX +1 -21XX +1 -3XX +2 -4XX +1 -1XX +1 -3XX +283 invalidated
umi TAATGGGGTT = 278 reads: +385 validated
umi TAGAGGGTCA = 193 reads: -355 +5 -3XX +8 -1XX +5 -1XX +7 invalidated
umi TATAAGGATT = 398 reads: +385 validated
umi TCATGTGTTC = 230 reads: +385 validated
umi TCCAGTACCA = 192 reads: +385 validated
umi TCCCCTCTTG = 240 reads: +385 validated
umi TCCTTGTCAT = 237 reads: +385 validated
umi TTATCTATGT = 294 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=27)
449-497 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
497-557 ==> 0-60 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 22 reads
cdr3 = CAKGGVRITTHFDCW at 421, score = 9 + 7
umis assigned: [21, 101, 328, 383, 424, 488, 489, 649]
of which 8 are surviving nonsolos
reads assigned: 1291
start codons at 79, 230, 235, 238, 382, 515
confident = true

TIG 2[bases=568]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=7)
394-432 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 1106 reads
cdr3 = CQQRSNWPPFTF at 368, score = 10 + 8
umis assigned: [15, 50, 53, 107, 110, 134, 164, 269, 320, 335] and 16 others
of which 26 are surviving nonsolos
reads assigned: 6871
start codons at 47, 252, 255, 474
confident = true

REJECT CONTIGS

TIG 1[bases=576]
0-73 ==> 6-79 on |152|IGHV3-66|5'UTR| [len=79] (mis=1)
0-73 ==> 6-79 on |154|IGHV3-66|5'UTR| [len=79] (mis=1)
0-73 ==> 5064-5137 on rc of segment before IGHV1-67 exon 2 [len=5137] (mis=1)
43-89 ==> 6508-6554 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
115-287 ==> 43-215 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=14)
287-411 ==> 226-350 on |155|IGHV3-66|L-REGION+V-REGION| [len=350] (mis=8)
442-505 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=6)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [87, 128, 706]
of which 3 are surviving nonsolos
reads assigned: 672
start codons at 73, 228, 293, 361, 462
confident = false
did not find CDR3
now this is a cell
paired!

GCCGAGGACACGGCCCTATATTACTGTGCGAAAGGGGGTGTGAGAATTACTACGCATTTTGACTGCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCAGCCTGGAGCCTGAAGATTCTGCAGTTTATTTCTGTCAGCAGCGTAGCAACTGGCCTCCATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.596 = GCACTCTAGTGGAGTC-1

using 60 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 24
nonsolo ucounts = 9[2, 3^2, 4^3, 5, 8, 12]
surviving nonsolo ucounts = 6[3, 4^2, 5, 8, 12]
ids = [7, 12, 19, 15, 16, 21]

====================================================================================

REJECT CONTIGS

TIG 1[bases=311]
0-200 ==> 122-322 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=6)
231-269 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
269-311 ==> 0-42 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CCSFTVNTRSYVF at 202, score = 7 + 8
umis assigned: [7, 8, 10, 12, 13, 15, 16, 18, 19, 21]
of which 6 are surviving nonsolos
reads assigned: 31
start codons at 35, 79, 89, 233
confident = false
not full
VJ delta = 27
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.602 = GCACTCTCAACAACCT-1

using 283 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 3, 269]
surviving nonsolo ucounts = 1[269]
ids = [9]

====================================================================================

UMI info for barcode GCACTCTCAACAACCT-1 contig 1 = AGTCTGGGCC...
umi TATGGCCCCT = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=539]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-372 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=36)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-539 ==> 0-117 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQVWDRSRDHVVF at 355, score = 6 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 259
start codons at 40, 89, 101, 124, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.605 = GCACTCTCAAGAAAGG-1

using 169 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2, 4, 162]
surviving nonsolo ucounts = 1[162]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=418]
14-366 ==> 0-352 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
379-418 ==> 0-39 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 132
start codons at 14, 58, 237, 240, 320, 329, 372, 410
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.619 = GCACTCTCACCACGTG-1

using 22 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.620 = GCACTCTCACCAGCAC-1

using 324 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 3, 4, 309]
surviving nonsolo ucounts = 1[309]
ids = [9]

====================================================================================

UMI info for barcode GCACTCTCACCAGCAC-1 contig 1 = CTCTGAGAGA...
umi TTTAGTTATT = 308 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=590]
0-77 ==> 2-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
77-430 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
454-501 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
501-590 ==> 0-89 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDRAATARLGGMDVW at 419, score = 9 + 7
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 77, 228, 233, 380, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.622 = GCACTCTCACCGTTGG-1

using 251 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 3, 240]
surviving nonsolo ucounts = 1[240]
ids = [1]

====================================================================================

UMI info for barcode GCACTCTCACCGTTGG-1 contig 1 = GGGAATCAGT...
umi CGTTGTCCTT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=492]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-492 ==> 0-77 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.624 = GCACTCTCACGAAAGC-1

using 30 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[10, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.627 = GCACTCTCACGGTGTC-1

using 662 reads

====================================================================================

graph has 796 edges initially, 14 edges after simplification

total ucounts = 265
nonsolo ucounts = 96[2^40, 3^19, 4^9, 5^12, 6^7, 7^5, 9, 14, 19, 141]
surviving nonsolo ucounts = 1[141]
ids = [255]

====================================================================================

UMI info for barcode GCACTCTCACGGTGTC-1 contig 1 = GTGGGCTCAG...
umi TTGTACGGAA = 140 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=506]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-506 ==> 0-86 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [255]
of which 1 are surviving nonsolos
reads assigned: 135
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.633 = GCACTCTCAGACACTT-1

using 313 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 6, 299]
surviving nonsolo ucounts = 1[299]
ids = [2]

====================================================================================

UMI info for barcode GCACTCTCAGACACTT-1 contig 1 = GTCAGACTCA...
umi AGCCACGTTC = 282 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-503 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.635 = GCACTCTCAGATCTGT-1

using 88 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2, 4, 6^2, 8, 9^2, 12, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.636 = GCACTCTCAGCATACT-1

using 8 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.656 = GCACTCTCATCTATGG-1

using 107 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 102]
surviving nonsolo ucounts = 1[102]
ids = [0]

====================================================================================

UMI info for barcode GCACTCTCATCTATGG-1 contig 1 = ACCCAAAAAC...
umi ACCTCAATGC = 100 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=470]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
412-463 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
junction support: 1 umis using 10 reads
cdr3 = CARGSTSWYDYW at 396, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 100
start codons at 54, 205, 252, 257, 289, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.659 = GCACTCTCATGGATGG-1

using 238 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^2, 3, 7, 21, 200]
surviving nonsolo ucounts = 2[21, 200]
ids = [3, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=476]
0-295 ==> 42-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=8)
302-340 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
340-476 ==> 0-136 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CNSRDSSGNHVVF at 273, score = 8 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 201
start codons at 77, 157, 256, 301
confident = false
not full
VJ delta = 12
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.667 = GCACTCTCATTTCACT-1

using 586 reads

====================================================================================

graph has 229 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 2[7, 567]
surviving nonsolo ucounts = 1[567]
ids = [8]

====================================================================================

UMI info for barcode GCACTCTCATTTCACT-1 contig 1 = GCAGGAGTCA...
umi TCATATAGGT = 575 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=553]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 90 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 562
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.674 = GCACTCTGTAATAGCA-1

using 313 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 304]
surviving nonsolo ucounts = 1[304]
ids = [2]

====================================================================================

UMI info for barcode GCACTCTGTAATAGCA-1 contig 1 = TCAGCTGTGG...
umi ATACAGACAG = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
0-43 ==> 71-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
43-396 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
431-529 ==> 0-98 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CASWDDSLRGRVF at 364, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 43, 197, 347, 372, 377
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.681 = GCACTCTGTAGCCTAT-1

using 15530 reads

====================================================================================

graph has 5559 edges initially, 70 edges after simplification

total ucounts = 740
nonsolo ucounts = 352[2^131, 3^58, 4^28, 5^23, 6^15, 7^13, 8^3, 9^4, 10^2, 11^2, 18, 39, 40, 41, 42, 52, 56, 58, 59, 75, 96, 104, 117, 121, 132^2, 144, 158, 159, 163, 165, 169, 184, 185, 186, 187, 192, 193, 196^2, 199, 202, 203, 204, 205, 206, 207, 208, 211^2, 213, 215, 216, 219, 223, 228, 229, 231^2, 235, 242, 246, 247, 248, 249, 250, 255, 258, 259^2, 262, 269, 270, 276, 277, 278, 283, 291, 292, 296^2, 315, 323]
surviving nonsolo ucounts = 66[58, 59, 75, 96, 104, 117, 121, 132^2, 144, 158, 159, 163, 165, 169, 184, 185, 186, 187, 192, 193, 196^2, 199, 202, 203, 204, 205, 206, 207, 208, 211^2, 213, 215, 216, 219, 223, 228, 229, 231^2, 235, 242, 246, 247, 248, 249, 250, 255, 258, 259^2, 262, 269, 270, 276, 277, 278, 283, 291, 292, 296^2, 315, 323]
ids = [371, 381, 543, 566, 506, 335, 664, 110, 697, 607, ...]

====================================================================================

UMI info for barcode GCACTCTGTAGCCTAT-1 contig 1 = AGCTTCAGCT...
umi AAAGCATCCG = 196 reads: +388 validated
umi AACTTTCTAT = 197 reads: +388 validated
umi ACAAGGATTC = 286 reads: +388 validated
umi ACCACGCACA = 189 reads: +388 validated
umi AGTTGGGACC = 134 reads: +388 validated
umi ATACTCTGGC = 184 reads: +388 validated
umi ATCGTATGCT = 189 reads: +388 validated
umi ATCTTATCGC = 167 reads: +388 validated
umi ATTCGTTGGT = 247 reads: +388 validated
umi CAATGGGGCT = 207 reads: +388 validated
umi CACGGCCCGT = 204 reads: +388 validated
umi CCACCATGCC = 221 reads: +388 validated
umi CGCTATAGGG = 217 reads: +388 validated
umi CGGCTTCAAT = 210 reads: +388 validated
umi CGTCAGTAGG = 263 reads: +388 validated
umi CTCATTGGTT = 185 reads: +388 validated
umi CTCCACTGGG = 225 reads: +7 -1XX +2 -2XX +1 -4XX +1 -7X +1 -4XX +1 -2XX +355 invalidated
umi CTGCAGGGCT = 244 reads: +388 validated
umi CTGTCATGGT = 117 reads: +388 validated
umi CTGTGGTGCG = 245 reads: +388 validated
umi CTGTTAACCT = 229 reads: +388 validated
umi GACCTTCTCA = 210 reads: +388 validated
umi GCTCCACGGT = 147 reads: +355 -33 non-validated
umi GGCGCTCGCC = 207 reads: +388 validated
umi GGGTTGCTGC = 159 reads: +388 validated
umi GTTCGAGGAT = 235 reads: +388 validated
umi TATCATCGGC = 156 reads: +388 validated
umi TCACCGTAAC = 209 reads: +388 validated
umi TCACGGGTGG = 98 reads: +371 -1 +16 non-validated
umi TCGGATCCAA = 215 reads: +388 validated
umi TCTATAGTCG = 144 reads: +388 validated
umi TCTTACGGCT = 288 reads: +388 validated
umi TGCCATATAT = 291 reads: +388 validated
umi TGGATAAAGG = 263 reads: +388 validated
umi TGTATATGGC = 233 reads: +388 validated
umi TGTTTATGAG = 125 reads: +388 validated
umi TTCAGATACG = 247 reads: +388 validated
umi TTCCGATCGG = 205 reads: +388 validated
umi TTCCTTCGGC = 132 reads: +388 validated
umi TTGGGAGGCA = 214 reads: +388 validated
umi TTTCAGGCTG = 272 reads: +388 validated

UMI info for barcode GCACTCTGTAGCCTAT-1 contig 2 = GGGGTCACAA...
umi AACACTCGGC = 218 reads: +388 validated
umi ACACCATAGG = 322 reads: +388 validated
umi AGTGTATGGG = 254 reads: +388 validated
umi AGTGTTCTCA = 326 reads: +388 validated
umi ATCTAATGGG = 256 reads: +388 validated
umi CACGAGCCCA = 197 reads: +388 validated
umi CACTGGTGGA = 168 reads: +388 validated
umi CAGGGGTCGA = 187 reads: +388 validated
umi CCAGGATCTA = 231 reads: +388 validated
umi CCCCCCCGGC = 230 reads: +388 validated
umi CCTCACGAGG = 263 reads: +388 validated
umi CGATACGTGG = 208 reads: +388 validated
umi CGTGGATCCG = 296 reads: +388 validated
umi CTAGATTGGC = 193 reads: +388 validated
umi CTTTGTATGG = 274 reads: +388 validated
umi GAGATTATCC = 58 reads: +373 -1 +4 -1X +9 invalidated
umi GATCACCTGC = 59 reads: +388 validated
umi GTTCAGTGAC = 104 reads: +388 validated
umi GTTTCGGCTT = 276 reads: +388 validated
umi TAGGCTCCTT = 77 reads: +388 validated
umi TCCTTACGGT = 294 reads: +388 validated
umi TCGTTGTGGA = 278 reads: +388 validated
umi TGCGATGCCG = 244 reads: +388 validated
umi TGGATATCGA = 270 reads: +3 -1 +384 non-validated
umi TTGCCTATGG = 258 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 38 umis using 1142 reads
cdr3 = CAAWDDSLNGRVF at 368, score = 8 + 8
umis assigned: [5, 22, 35, 45, 110, 116, 125, 129, 136, 155] and 31 others
of which 41 are surviving nonsolos
reads assigned: 8261
start codons at 47, 351, 376, 381, 393
confident = true

TIG 2[bases=637]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=0)
388-426 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
426-637 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 24 umis using 781 reads
cdr3 = CCSYAGSSTWVF at 362, score = 8 + 8
umis assigned: [12, 37, 107, 109, 127, 161, 171, 179, 220, 231] and 15 others
of which 25 are surviving nonsolos
reads assigned: 5450
start codons at 38, 177, 239, 246, 372
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.694 = GCACTCTGTCCGCTGA-1

using 202 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2^2, 189]
surviving nonsolo ucounts = 1[189]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=476]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
0-58 ==> 7988-8046 on rc of segment before IGHV2-70 exon 2 [len=8046] (mis=0)
7-76 ==> 10071-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=6)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=9)
431-476 ==> 0-45 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
cdr3 = CARSGVMIAIQRFDYW at 400, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 175
start codons at 58, 209, 256, 355, 418
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.696 = GCACTCTGTCCTGCTT-1

using 29 reads

====================================================================================

graph has 20 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[8, 21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.717 = GCACTCTGTGCAGGTA-1

using 12 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.719 = GCACTCTGTGGCAAAC-1

using 827 reads

====================================================================================

graph has 824 edges initially, 6 edges after simplification

total ucounts = 238
nonsolo ucounts = 79[2^33, 3^14, 4^7, 5^6, 6^6, 7^2, 8^4, 11, 12^2, 15^2, 18, 337]
surviving nonsolo ucounts = 1[337]
ids = [172]

====================================================================================

UMI info for barcode GCACTCTGTGGCAAAC-1 contig 1 = GGAGTCAGTC...
umi TAAGCGGCGA = 318 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=518]
0-26 ==> 21-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
26-377 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=4)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
408-518 ==> 0-110 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 59 reads
cdr3 = CQQSYSRTF at 353, score = 9 + 8
umis assigned: [172]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 26, 32, 88, 101, 237, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.723 = GCACTCTGTGTAACGG-1

using 513 reads

====================================================================================

graph has 166 edges initially, 2 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2^4, 3, 4, 6, 486]
surviving nonsolo ucounts = 1[486]
ids = [12]

====================================================================================

UMI info for barcode GCACTCTGTGTAACGG-1 contig 1 = CGAGCCCAGC...
umi TTGCGGTATC = 473 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=581]
0-67 ==> 0-67 on |127|IGHV3-33|5'UTR| [len=67] (mis=0)
67-420 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=25)
445-491 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=8)
491-581 ==> 0-90 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 39 reads
cdr3 = CARTTYHDYVWGPFDDW at 409, score = 9 + 6
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 471
start codons at 67, 218, 223, 265, 284, 370, 428, 434, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.732 = GCACTCTGTTCAGGCC-1

using 332 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 327]
surviving nonsolo ucounts = 1[327]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=5)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 320
start codons at 27, 33, 89, 102, 234, 238, 456
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.735 = GCACTCTGTTCGAATC-1

using 281 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[281]
surviving nonsolo ucounts = 1[281]
ids = [0]

====================================================================================

UMI info for barcode GCACTCTGTTCGAATC-1 contig 1 = TGGGCCTCAG...
umi CTGACGTTTC = 270 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=566]
0-36 ==> 16-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
36-370 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
374-412 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
412-566 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQAWDSTEVVF at 351, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 36, 41, 330, 334
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.740 = GCACTCTTCAAACAAG-1

using 180 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 171]
surviving nonsolo ucounts = 1[171]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=498]
1-71 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=2)
23-176 ==> 0-153 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=4)
177-375 ==> 153-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=15) [SHIFT!]
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
412-498 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQYSSSPWTF at 351, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 160
start codons at 23, 29, 98, 235, 454
confident = false
not full
frameshifted full length stopped transcript of length 498
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.749 = GCACTCTTCACATGCA-1

using 317 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[9, 304]
surviving nonsolo ucounts = 1[304]
ids = [4]

====================================================================================

UMI info for barcode GCACTCTTCACATGCA-1 contig 1 = GGGGTCTCAG...
umi CCCTCTTACT = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=581]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=6)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
426-581 ==> 0-155 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CSSYAGSSHVVF at 362, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 38, 195, 239, 246, 345, 372, 387
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.757 = GCACTCTTCAGGCGAA-1

using 882 reads

====================================================================================

graph has 1188 edges initially, 10 edges after simplification

total ucounts = 399
nonsolo ucounts = 161[2^57, 3^39, 4^19, 5^13, 6^14, 7^3, 8^3, 9^5, 10^3, 12^2, 13^2, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.758 = GCACTCTTCAGTCAGT-1

using 21 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 4, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.776 = GCACTCTTCCGTTGTC-1

using 2142 reads

====================================================================================

graph has 1240 edges initially, 63 edges after simplification

total ucounts = 465
nonsolo ucounts = 154[2^77, 3^30, 4^18, 5^13, 6^3, 7^5, 8, 9^2, 10, 11, 341, 503, 506]
surviving nonsolo ucounts = 4[10, 341, 503, 506]
ids = [351, 39, 58, 93]

====================================================================================

UMI info for barcode GCACTCTTCCGTTGTC-1 contig 1 = AGGAGTCAGA...
umi ACACTTTGGA = 339 reads: +382 validated
umi ATCATGCTCG = 516 reads: +350 -1XX +31 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 131 reads
cdr3 = CQQYYSYPWTF at 354, score = 9 + 8
umis assigned: [39, 93]
of which 2 are surviving nonsolos
reads assigned: 835
start codons at 33, 89, 102, 238, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.779 = GCACTCTTCCTTAATC-1

using 96 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 26
nonsolo ucounts = 15[2^3, 3^2, 4, 5^5, 9, 10, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.783 = GCACTCTTCGACGGAA-1

using 594 reads

====================================================================================

graph has 168 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 218, 370]
surviving nonsolo ucounts = 2[218, 370]
ids = [3, 6]

====================================================================================

UMI info for barcode GCACTCTTCGACGGAA-1 contig 1 = GAGGAACTGC...
umi CGTGCGGTAT = 204 reads: +379 validated

UMI info for barcode GCACTCTTCGACGGAA-1 contig 2 = GCAGGAGTCA...
umi TGTACCATAC = 355 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=496]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-366 ==> 0-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-496 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQERGGWWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 203
start codons at 33, 241, 454
confident = false

TIG 2[bases=501]
35-283 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
417-501 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CLHYDNRRRTF at 356, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 351
start codons at 35, 91, 104, 243, 366, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.785 = GCACTCTTCGGCCGAT-1

using 583 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[582]
surviving nonsolo ucounts = 1[582]
ids = [1]

====================================================================================

UMI info for barcode GCACTCTTCGGCCGAT-1 contig 1 = AGGAGTCAGA...
umi TTGTGTACGT = 559 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=517]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=25)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-517 ==> 0-102 on |212|IGKC|C-REGION| [len=320] (mis=1)
junction support: 1 umis using 114 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 551
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.812 = GCAGCCAAGACTAGGC-1

using 379 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[5, 369]
surviving nonsolo ucounts = 1[369]
ids = [2]

====================================================================================

UMI info for barcode GCAGCCAAGACTAGGC-1 contig 1 = GGGGAGGAAT...
umi ACCGGGTGTG = 372 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 65 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.814 = GCAGCCAAGATAGCAT-1

using 18 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.823 = GCAGCCAAGCTTATCG-1

using 246 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 6, 233]
surviving nonsolo ucounts = 1[233]
ids = [0]

====================================================================================

UMI info for barcode GCAGCCAAGCTTATCG-1 contig 1 = GTGGGCTCAG...
umi AACTCCACGC = 217 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=5)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
420-542 ==> 0-122 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CYSTDSSGNPSQVF at 350, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 35, 96, 165, 183, 234, 296, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.828 = GCAGCCAAGGATATAC-1

using 355 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 3, 340]
surviving nonsolo ucounts = 1[340]
ids = [11]

====================================================================================

UMI info for barcode GCAGCCAAGGATATAC-1 contig 1 = GGGAGGAACT...
umi TTTCTATGTT = 305 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=513]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
379-417 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=7)
417-513 ==> 0-96 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQRRTWPPAF at 356, score = 9 + 6
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 301
start codons at 35, 84, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.830 = GCAGCCAAGGCATTGG-1

using 375 reads

====================================================================================

graph has 172 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 366]
surviving nonsolo ucounts = 1[366]
ids = [2]

====================================================================================

UMI info for barcode GCAGCCAAGGCATTGG-1 contig 1 = AGACCCAGTC...
umi CAGGTTGTGG = 365 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=4)
370-408 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYPITF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.831 = GCAGCCAAGGCGATAC-1

using 4892 reads

====================================================================================

graph has 2250 edges initially, 26 edges after simplification

total ucounts = 232
nonsolo ucounts = 92[2^28, 3^19, 4^5, 5^7, 6^2, 7^5, 8^5, 9, 13, 14, 15, 81, 111, 119, 120, 177, 181, 268, 274, 278, 281, 332, 337, 339, 344, 373, 376, 455]
surviving nonsolo ucounts = 16[111, 119, 120, 177, 181, 268, 274, 278, 281, 332, 337, 339, 344, 373, 376, 455]
ids = [7, 89, 16, 125, 201, 69, 50, 115, 179, 151, ...]

====================================================================================

UMI info for barcode GCAGCCAAGGCGATAC-1 contig 1 = AGCTCTGGGA...
umi AAGCTAGGGC = 106 reads: +406 validated
umi CAGGAAACAA = 378 reads: +406 validated
umi CGTTAACGCT = 101 reads: +406 validated
umi TCCACCGCAC = 273 reads: +406 validated
umi TCCCACACAC = 67 reads: +29 -1XX +6 -1XX +2 -1XX +3 -1XX +43 -1XX +5 -1XX +7 -2XX +44 -2XX +3 -3XX +4 -2XX +4 -1XX +15 -44 +1 -2XX +1 -1XX +6 -1XX +8 -1XX +26 -1XX +5 -2XX +8 -1XX +1 -1XX +27 -1XX +1 -1XX +11 -1XX +4 -1XX +11 -2X +1 -2X +2 -4X +1 -2X +28 -15 invalidated
umi TGTATAGCTT = 180 reads: +406 validated

UMI info for barcode GCAGCCAAGGCGATAC-1 contig 2 = TGGGGGATCA...
umi ACAGCCTCGC = 122 reads: +397 validated
umi CACCACGCTC = 276 reads: +397 validated
umi CCTGATTATG = 269 reads: +397 validated
umi CTATGTGTCT = 334 reads: +397 validated
umi GAGCCTTAGA = 279 reads: +397 validated
umi GGGTTTGGCC = 458 reads: +397 validated
umi GTCCAAGGCA = 334 reads: +397 validated
umi TAAGTCTTCT = 376 reads: +397 validated
umi TCCCCTGGCA = 340 reads: +397 validated
umi TTCGCAGCAG = 335 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=557]
0-80 ==> 40-120 on |105|IGHV3-11|5'UTR| [len=120] (mis=0)
80-433 ==> 0-353 on |106|IGHV3-11|L-REGION+V-REGION| [len=353] (mis=8)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 5 umis using 95 reads
cdr3 = CARGGDYFDYW at 422, score = 9 + 7
umis assigned: [7, 57, 89, 179, 182, 201]
of which 5 are surviving nonsolos
reads assigned: 1091
start codons at 80, 236, 383
confident = true

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 455 reads
cdr3 = CMQALQTPPTF at 371, score = 9 + 8
umis assigned: [16, 50, 69, 98, 115, 142, 151, 162, 183, 216]
of which 10 are surviving nonsolos
reads assigned: 3062
start codons at 35, 68, 104, 192, 354, 374, 474
confident = true
now this is a cell
paired!

AACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGGGGGAGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.843 = GCAGCCAAGTATTGGA-1

using 314 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode GCAGCCAAGTATTGGA-1 contig 1 = CTGGGCCTCA...
umi CTTCCCCTAA = 307 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-369 ==> 0-332 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=16)
375-413 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
413-624 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQAWDRGTLVF at 352, score = 6 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 37, 42, 98, 185, 335, 545
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.844 = GCAGCCAAGTGGTCCC-1

using 120 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 111]
surviving nonsolo ucounts = 1[111]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=485]
0-53 ==> 6-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
0-53 ==> 11311-11364 on rc of segment before IGHV3-19 exon 1 [len=11364] (mis=1)
39-71 ==> 10108-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
53-406 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
455-485 ==> 12-42 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 395, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 97
start codons at 53, 251, 256, 273, 317, 350
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.852 = GCAGCCACAATAAGCA-1

using 71 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[67]
surviving nonsolo ucounts = 1[67]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.859 = GCAGCCACACATCCGG-1

using 261 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[13, 248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode GCAGCCACACATCCGG-1 contig 1 = GGGGGTGCTT...
umi ACATCGAGCG = 243 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=562]
20-391 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=42)
405-468 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=6)
468-562 ==> 0-94 on |40|IGHG1|C-REGION| [len=884] (mis=2)
junction support: 1 umis using 38 reads
cdr3 = CTRGLRLRYVHYYYGMDVW at 380, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 20, 41, 85, 235, 255, 344, 405, 420, 425
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.867 = GCAGCCACACTCAGGC-1

using 377 reads

====================================================================================

graph has 170 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 369]
surviving nonsolo ucounts = 1[369]
ids = [0]

====================================================================================

UMI info for barcode GCAGCCACACTCAGGC-1 contig 1 = GGGAGTCTCA...
umi CAGACATTAG = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQSYSTLWTF at 350, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.873 = GCAGCCACAGAGTGTG-1

using 369 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 361]
surviving nonsolo ucounts = 1[361]
ids = [2]

====================================================================================

UMI info for barcode GCAGCCACAGAGTGTG-1 contig 1 = ACAACAGGCA...
umi AGCTAACATC = 368 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=561]
0-25 ==> 150-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
25-388 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
387-425 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYYSTAWTF at 364, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 25, 94, 347, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.890 = GCAGCCACATTAGGCT-1

using 35 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.894 = GCAGCCAGTACGAAAT-1

using 304 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[302]
surviving nonsolo ucounts = 1[302]
ids = [1]

====================================================================================

UMI info for barcode GCAGCCAGTACGAAAT-1 contig 1 = GATCAGGACT...
umi GTACCCGGAC = 284 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=508]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-508 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.899 = GCAGCCAGTCAAACTC-1

using 1446 reads

====================================================================================

graph has 1737 edges initially, 10 edges after simplification

total ucounts = 643
nonsolo ucounts = 214[2^110, 3^47, 4^20, 5^13, 6^8, 7^8, 8^4, 10^2, 11, 344]
surviving nonsolo ucounts = 1[344]
ids = [98]

====================================================================================

UMI info for barcode GCAGCCAGTCAAACTC-1 contig 1 = GAGCTACAAC...
umi ACTGTCCATA = 320 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=522]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=3)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-522 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQYYSTPFTF at 369, score = 9 + 8
umis assigned: [98]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 30, 99, 352, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.903 = GCAGCCAGTCCAGTAT-1

using 92 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3^2, 82]
surviving nonsolo ucounts = 1[82]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.908 = GCAGCCAGTCGCCATG-1

using 481 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 135, 334]
surviving nonsolo ucounts = 2[135, 334]
ids = [3, 9]

====================================================================================

UMI info for barcode GCAGCCAGTCGCCATG-1 contig 1 = GTCAGACCCT...
umi TTTCATACTG = 335 reads: +382 validated

UMI info for barcode GCAGCCAGTCGCCATG-1 contig 2 = GTGATCAGCA...
umi AACGTCGTAC = 1 reads: -261X +2 -5X +1 -3X +3 -3 +2 -2 +2 -4 +3 -1 +13 -1 +2 -92 invalidated
umi ATCGTCGTAG = 98 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
29-374 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
383-411 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYYSYPRTF at 350, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 23, 29, 85, 98, 234, 453
confident = false

TIG 2[bases=475]
0-27 ==> 50-77 on |149|IGHV3-64|5'UTR| [len=77] (mis=0)
27-383 ==> 0-356 on |150|IGHV3-64|L-REGION+V-REGION| [len=356] (mis=5)
381-427 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
427-475 ==> 0-48 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARLPHYW at 372, score = 8 + 7
umis assigned: [0, 3]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 27, 181, 186, 226, 247, 265, 333, 357, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.909 = GCAGCCAGTCGCGTGT-1

using 223 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 214]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.911 = GCAGCCAGTCTACCTC-1

using 214 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 6, 202]
surviving nonsolo ucounts = 1[202]
ids = [0]

====================================================================================

UMI info for barcode GCAGCCAGTCTACCTC-1 contig 1 = ACCCAAAAAC...
umi CTCCCGATCG = 195 reads: +375 -1X +60 invalidated

GOOD CONTIGS

TIG 1[bases=536]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-536 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.927 = GCAGCCATCAAAGTAG-1

using 213 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 205]
surviving nonsolo ucounts = 1[205]
ids = [4]

====================================================================================

UMI info for barcode GCAGCCATCAAAGTAG-1 contig 1 = GGAGTCAGTC...
umi CGTATGATTT = 1 reads: -288 +3 -3 +1 -1X +3 -2X +1 -3 +2 -1 +7 -2 +8 -3 +3 -3X +3 -1 +5 -45 invalidated
umi CGTCTGATTG = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYTTLLTF at 353, score = 9 + 9
umis assigned: [3, 4]
of which 1 are surviving nonsolos
reads assigned: 204
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.930 = GCAGCCATCACTTCAT-1

using 464 reads

====================================================================================

graph has 232 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 10[2^5, 3^2, 5, 7, 429]
surviving nonsolo ucounts = 1[429]
ids = [2]

====================================================================================

UMI info for barcode GCAGCCATCACTTCAT-1 contig 1 = GCCCCTGGGA...
umi AGAGTGAGGT = 428 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=566]
0-25 ==> 33-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
25-378 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=3)
409-464 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
464-566 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CATAPGVLGLWFGGYYYGMDVW at 367, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 421
start codons at 25, 176, 223, 322, 396, 421, 482, 543
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.933 = GCAGCCATCATACGGT-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 1[13]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.940 = GCAGCCATCCACTGGG-1

using 317 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2, 4, 6, 297]
surviving nonsolo ucounts = 1[297]
ids = [0]

====================================================================================

UMI info for barcode GCAGCCATCCACTGGG-1 contig 1 = GCTACAACAG...
umi ACAGATAACC = 280 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=517]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
392-431 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
431-517 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYYSTPPYTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 277
start codons at 28, 97, 350, 473
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.947 = GCAGCCATCGCCCTTA-1

using 1226 reads

====================================================================================

graph has 1571 edges initially, 38 edges after simplification

total ucounts = 602
nonsolo ucounts = 237[2^106, 3^49, 4^26, 5^16, 6^16, 7^5, 8^9, 9^4, 10^2, 11, 13^2, 22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.949 = GCAGCCATCGGATGGA-1

using 287 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[2, 278]
surviving nonsolo ucounts = 1[278]
ids = [1]

====================================================================================

UMI info for barcode GCAGCCATCGGATGGA-1 contig 1 = AGGAGTCAGA...
umi GCCAACCCGT = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=26)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQGNSFPYTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 257
start codons at 27, 33, 89, 102, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.965 = GCAGTTAAGAAAGTGG-1

using 369 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[368]
surviving nonsolo ucounts = 1[368]
ids = [1]

====================================================================================

UMI info for barcode GCAGTTAAGAAAGTGG-1 contig 1 = ACTTTCTGAG...
umi CACGGAATTG = 369 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=524]
0-35 ==> 110-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
35-385 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=0)
411-453 ==> 19-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDGGSGSYYSLDVW at 374, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 362
start codons at 35, 79, 384
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.966 = GCAGTTAAGAAGCCCA-1

using 591 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[587]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.968 = GCAGTTAAGAATCTCC-1

using 154 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3, 4, 7, 134]
surviving nonsolo ucounts = 1[134]
ids = [5]

====================================================================================

UMI info for barcode GCAGTTAAGAATCTCC-1 contig 1 = ACCCAAAAAC...
umi TACGAATCCC = 128 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=520]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-520 ==> 0-30 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 126
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.969 = GCAGTTAAGAATGTGT-1

using 151 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3^2, 138]
surviving nonsolo ucounts = 1[138]
ids = [7]

====================================================================================

UMI info for barcode GCAGTTAAGAATGTGT-1 contig 1 = TCTCACAATG...
umi TACCCTAAGG = 120 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=457]
7-367 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
366-404 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
404-457 ==> 0-53 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CMQALQTRETF at 343, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 120
start codons at 7, 40, 76, 164, 326, 346, 446
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.981 = GCAGTTAAGCGCCTTG-1

using 485 reads

====================================================================================

graph has 236 edges initially, 30 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[6, 220, 256]
surviving nonsolo ucounts = 2[220, 256]
ids = [2, 0]

====================================================================================

UMI info for barcode GCAGTTAAGCGCCTTG-1 contig 1 = AGGCTGGACA...
umi ATGGAATGAG = 256 reads: +382 validated

UMI info for barcode GCAGTTAAGCGCCTTG-1 contig 2 = GAGTCAGACT...
umi CCAGGTGGAG = 220 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=571]
0-53 ==> 0-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
53-398 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=2)
397-435 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQYYSYTWTF at 374, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 16, 53, 109, 122, 258, 477
confident = false

TIG 2[bases=546]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=25)
373-410 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CHQYNSYSTF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 218
start codons at 25, 31, 87, 100, 236, 239, 332, 452
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.990 = GCAGTTAAGGCAGTCA-1

using 337 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[331]
surviving nonsolo ucounts = 1[331]
ids = [0]

====================================================================================

UMI info for barcode GCAGTTAAGGCAGTCA-1 contig 1 = GGAATCAGTC...
umi AAAATATACA = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 324
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.995 = GCAGTTAAGGTGACCA-1

using 213 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 207]
surviving nonsolo ucounts = 1[207]
ids = [1]

====================================================================================

UMI info for barcode GCAGTTAAGGTGACCA-1 contig 1 = GCTCTGCTTC...
umi CCTTAGGCAT = 188 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=543]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=19)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
442-543 ==> 0-101 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSRLSGSVF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 51, 205, 208, 259, 358, 385, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.997 = GCAGTTAAGTACGCGA-1

using 80 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 9, 64]
surviving nonsolo ucounts = 1[64]
ids = [4]

====================================================================================

UMI info for barcode GCAGTTAAGTACGCGA-1 contig 1 = TCACAGCTCC...
umi CTAAAAACTC = 63 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=510]
15-368 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=23)
373-424 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
424-510 ==> 0-86 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 9 reads
cdr3 = CARGSTSWYDYW at 357, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 63
start codons at 15, 166, 213, 218, 250, 312
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1008 = GCAGTTACAAGCCTAT-1

using 450 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 4, 436]
surviving nonsolo ucounts = 1[436]
ids = [3]

====================================================================================

UMI info for barcode GCAGTTACAAGCCTAT-1 contig 1 = GGAGAAGAGC...
umi AGTGTGTTGT = 439 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQYGSSPRVTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 432
start codons at 36, 244, 370, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1013 = GCAGTTACAATCACAC-1

using 33 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1019 = GCAGTTACACTCAGGC-1

using 95 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 88]
surviving nonsolo ucounts = 1[88]
ids = [2]

====================================================================================

UMI info for barcode GCAGTTACACTCAGGC-1 contig 1 = GTCAGACCCA...
umi ATACGTCGTT = 79 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-469 ==> 0-58 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CQQYNTYIWTF at 350, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 23, 29, 98, 236, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1020 = GCAGTTACACTGAAGG-1

using 255 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[8, 244]
surviving nonsolo ucounts = 1[244]
ids = [2]

====================================================================================

UMI info for barcode GCAGTTACACTGAAGG-1 contig 1 = ACCCAAAAAC...
umi GTGCGTCACA = 240 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=571]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-571 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=1)
junction support: 1 umis using 25 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1031 = GCAGTTACAGGGTTAG-1

using 7891 reads

====================================================================================

graph has 4461 edges initially, 44 edges after simplification

total ucounts = 746
nonsolo ucounts = 344[2^133, 3^76, 4^44, 5^30, 6^12, 7^9, 8^4, 9^4, 10, 12, 13^3, 14, 15, 31, 38, 91, 164, 219, 222, 234, 237, 241, 250, 252, 253, 274, 283, 285, 294, 298, 310, 315, 317, 328, 332, 334, 360, 414]
surviving nonsolo ucounts = 24[38, 91, 164, 219, 222, 234, 237, 241, 250, 252, 253, 274, 283, 285, 294, 298, 310, 315, 317, 328, 332, 334, 360, 414]
ids = [20, 133, 388, 84, 66, 38, 403, 180, 250, 228, ...]

====================================================================================

UMI info for barcode GCAGTTACAGGGTTAG-1 contig 1 = AGTCTGGGCC...
umi AACTACCGGT = 283 reads: +382 validated
umi AAGGCCGTCT = 34 reads: +382 validated
umi ACCTATACTA = 224 reads: +382 validated
umi ACTCCATTTC = 218 reads: +382 validated
umi ATACCCGCAT = 100 reads: -3XX +1 -1XX +2 -3XX +1 -1XX +1 -1XX +1 -1XX +1 -1XX +1 -2XX +1 -2XX +2 -1XX +1 -2XX +352 invalidated
umi ATAGTGTTCT = 269 reads: +382 validated
umi ATTCGGCTGT = 242 reads: +382 validated
umi CATATGATTC = 254 reads: +382 validated
umi CCCAGACACC = 249 reads: +382 validated
umi CGCCTCCTTC = 251 reads: +382 validated
umi CGGATTTTGC = 338 reads: +382 validated
umi CGTGTTTAGT = 302 reads: +382 validated
umi CTACAATGTA = 283 reads: +382 validated
umi GCAACCAGTA = 237 reads: +382 validated
umi TGATCTCCGT = 329 reads: +382 validated
umi TGGACGTTCC = 337 reads: +382 validated

UMI info for barcode GCAGTTACAGGGTTAG-1 contig 2 = ATCACATAAC...
umi ACAAATAGCC = 235 reads: +430 validated
umi ACGTTGGCCA = 295 reads: +430 validated
umi CCTTCCGTAT = 375 reads: +430 validated
umi CTACGTGCCC = 313 reads: +430 validated
umi GAGATACTTC = 137 reads: +415 -1 +14 non-validated
umi GATATGTTAC = 282 reads: +430 validated
umi TCACGGGGCT = 329 reads: +430 validated
umi TTCCTCCGAG = 278 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 16 umis using 642 reads
cdr3 = CQVWDSSSDHWVF at 355, score = 8 + 8
umis assigned: [11, 20, 66, 84, 133, 138, 180, 228, 250, 302] and 6 others
of which 16 are surviving nonsolos
reads assigned: 3879
start codons at 40, 101, 239, 242, 338
confident = true

TIG 2[bases=590]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
58-411 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=1)
442-488 ==> 17-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
488-590 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 8 umis using 171 reads
cdr3 = CARVNEGSRGVRSWGMDVW at 400, score = 9 + 7
umis assigned: [38, 77, 285, 324, 388, 395, 577, 688]
of which 8 are surviving nonsolos
reads assigned: 2200
start codons at 58, 209, 256, 355, 445, 506, 567
confident = true
now this is a cell
paired!

GCCGTGTATTACTGTGCGAGAGTGAACGAGGGCAGCAGGGGGGTACGGAGCTGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> AGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1033 = GCAGTTACAGTCACTA-1

using 6459 reads

====================================================================================

graph has 3456 edges initially, 32 edges after simplification

total ucounts = 608
nonsolo ucounts = 260[2^94, 3^43, 4^40, 5^22, 6^21, 7^4, 8^2, 9^4, 10^2, 11^3, 19, 32, 49^2, 65, 107, 122, 137, 144, 153, 164, 170, 228, 242, 255, 272, 278, 301, 335^3, 337, 352, 367, 417]
surviving nonsolo ucounts = 20[19, 49, 65, 107, 137, 153, 164, 228, 242, 255, 272, 278, 301, 335^3, 337, 352, 367, 417]
ids = [316, 574, 584, 328, 214, 495, 171, 600, 429, 24, ...]

====================================================================================

UMI info for barcode GCAGTTACAGTCACTA-1 contig 1 = CCACATCCCT...
umi AACTAATCCG = 254 reads: +397 -1 +14 non-validated
umi AAGTTTTCAC = 335 reads: +412 validated
umi AATGGATTAC = 350 reads: +412 validated
umi ATTATTGCCC = 423 reads: +412 validated
umi CACCTTTCGG = 163 reads: +411 -1 non-validated
umi CCATCCGGGG = 331 reads: +412 validated
umi CCCTTAGTCA = 138 reads: +412 validated
umi CGGTAGGCCT = 301 reads: +412 validated
umi GCACTACGCG = 106 reads: +402 -10 non-validated
umi GGCCAACTCG = 275 reads: +412 validated
umi TAACAGAGTA = 250 reads: +412 validated
umi TCCGCTTCTT = 155 reads: +383 -1 +28 non-validated
umi TTCGATTAGC = 50 reads: +407 -5 non-validated
umi TTTGCTCTGT = 191 reads: +412 validated

UMI info for barcode GCAGTTACAGTCACTA-1 contig 2 = GAGGAATCAG...
umi ACTCCATCGC = 335 reads: +391 validated
umi AGCCGTTCAA = 372 reads: +391 validated
umi ATGCAAGCCT = 334 reads: +391 validated
umi ATTCATACTT = 278 reads: +391 validated
umi GAGTTGTAAC = 18 reads: +53 -23 +23 -1 +33 -1 +2 -3 +7 -2 +1 -1 +241 non-validated
umi TTGCTTTTGC = 65 reads: +328 -1 +1 -1 +6 -1 +9 -3 +1 -3 +2 -1 +1 -1 +3 -1 +4 -2X +1 -1X +3 -1X +1 -2 +1 -1 +2 -9 invalidated

GOOD CONTIGS

TIG 1[bases=525]
0-42 ==> 0-42 on |72|IGHV1-3|5'UTR| [len=42] (mis=0)
42-389 ==> 0-347 on |73|IGHV1-3|L-REGION+V-REGION| [len=353] (mis=14)
406-454 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
454-525 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 11 umis using 275 reads
cdr3 = CASIVGAAQFDYW at 384, score = 9 + 7
umis assigned: [24, 34, 44, 145, 171, 202, 214, 255, 328, 375] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3261
start codons at 42, 198, 240, 245, 262, 339
confident = true

TIG 2[bases=555]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=9)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 216 reads
cdr3 = CLQHNSFPALTF at 355, score = 9 + 9
umis assigned: [77, 92, 137, 147, 316, 584]
of which 6 are surviving nonsolos
reads assigned: 1378
start codons at 28, 34, 103, 185, 239, 461
confident = true
now this is a cell
paired!

CTGAGATCTGAAGACACGGCTGTGTATTATTGTGCTTCTATAGTGGGAGCTGCACAGTTTGACTACTGGGGCCAGGGAACCCCGGTCACCGTCTCCTCAG <==> AGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTTCCCAGCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1035 = GCAGTTACATACGCCG-1

using 167 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 158]
surviving nonsolo ucounts = 1[158]
ids = [1]

====================================================================================

UMI info for barcode GCAGTTACATACGCCG-1 contig 1 = GAAGAGCTGC...
umi AGTACGTGTA = 155 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-348 ==> 0-315 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQYYGGSYWTF at 357, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 153
start codons at 33, 158, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1039 = GCAGTTACATCCAACA-1

using 11775 reads

====================================================================================

graph has 6662 edges initially, 82 edges after simplification

total ucounts = 1249
nonsolo ucounts = 572[2^224, 3^131, 4^68, 5^54, 6^22, 7^17, 8^11, 9^6, 11^4, 12, 15^2, 17^2, 18, 24, 39, 70, 112, 122, 132, 143, 151, 199, 207, 245, 277, 300, 301, 324, 328, 331, 339, 342, 343, 350, 358, 373, 387, 442, 501, 547, 773, 1124]
surviving nonsolo ucounts = 27[2, 39, 70, 112, 122, 143, 199, 207, 245, 277, 300, 301, 324, 328, 331, 339, 342, 343, 350, 358, 373, 387, 442, 501, 547, 773, 1124]
ids = [1046, 547, 1107, 1210, 840, 901, 255, 1150, 698, 414, ...]

====================================================================================

UMI info for barcode GCAGTTACATCCAACA-1 contig 1 = GGAGTGCTTT...
umi ATCTATTTCC = 544 reads: -31 +3 -7XX +2 -1XX +1 -1XX +384 invalidated
umi ATCTTTCATC = 200 reads: +430 validated
umi CATACGCCTT = 364 reads: +430 validated
umi CCCGCTCCTT = 420 reads: -20X +1 -3XX +2 -3XX +3 -2XX +1 -6XX +2 -1XX +1 -1XX +384 invalidated
umi CCTGAATGCT = 389 reads: +430 validated
umi CGAAGCTCTT = 261 reads: +40 -1X +2 -1XX +1 -1XX +384 invalidated
umi GTATATGACG = 123 reads: +430 validated
umi TAAAACGTTG = 147 reads: +430 validated
umi TCATTACCAA = 506 reads: -144X +286 invalidated
umi TTACTTACCA = 161 reads: +33 -1 +1 -6X +2 -1XX +1 -1XX +380 -1 +3 invalidated
umi TTGCCGTGTG = 115 reads: +430 validated

UMI info for barcode GCAGTTACATCCAACA-1 contig 2 = AGGAGTCAGA...
umi AACAATACGG = 327 reads: +388 validated
umi AATACAGTGG = 375 reads: +388 validated
umi CCAGCACGCG = 278 reads: +388 validated
umi CGCCCGCGCT = 347 reads: +388 validated
umi CTCTGATGTT = 339 reads: +388 validated
umi GAATATAGTC = 346 reads: +46 -2X +1 -7XX +332 invalidated
umi GAGAGGAGTT = 244 reads: +388 validated
umi GCAACTCATG = 302 reads: +388 validated
umi GTTTGGTAGG = 341 reads: +388 validated
umi TCCACCTCGT = 289 reads: +388 validated
umi TGCTCCGCAG = 64 reads: -367 +7 -1XX +5 -2XX +6 invalidated
umi TGGACCATGC = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
40-243 ==> 0-203 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=30)
433-470 ==> 26-63 on |737|IGHJ6|J-REGION| [len=63] (mis=2)
470-572 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 10 umis using 399 reads
cdr3 = CARGRTDYGDDHCSCGLEVW at 379, score = 8 + 7
umis assigned: [249, 255, 378, 445, 498, 512, 840, 901, 980, 1150] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3173
start codons at 40, 84, 257, 301, 488, 549
confident = true
>vscore_66.1039_80.3%
ATGAAACACCTGTGGGTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGGGTCCTGGCCCAGGTGCGACTACAGCAGTGGGGCGCAGGACTATTGAAGACCTCGGGGACCCTGTCCCTCACCTGCGGTGTCTCTGGTGGGTCTTTCAGTAGTCGATTTTGGACGTGGATCCGCCAGACCCCAGGGAAGGGGCTGGAGTGGATTGGCGAAATCAACCACAATGGACACACCAAGTATAATCGGTCTTTCGGCAGTCGAGTCGCCATGTCAATTGACACGTCCCAAAATCAGTTCTCGCTGAAGTTGACCTCTGTCACTGTCGCGGACACGGGTGTCTATTACTGTGCGAGGGG

TIG 2[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=33)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 596 reads
cdr3 = CQQTNSPPFGF at 354, score = 9 + 7
umis assigned: [14, 49, 414, 531, 621, 676, 698, 722, 898, 987] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3531
start codons at 27, 33, 89, 123, 406, 457
confident = true
now this is a cell
paired!

GTCTATTACTGTGCGAGGGGTCGCACCGACTACGGTGACGACCATTGTTCCTGTGGTCTGGAGGTCTGGGGCCAAGGGACCGCGGTCAGCGTCTCCTCAG <==> ATCAACAGCCTGCAGCCTGAAGATTTTGCCACTTATTATTGTCAACAGACTAACAGTCCCCCATTCGGTTTCGGCCCTGGGACCAAAGTGGATGTCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1041 = GCAGTTACATCGACGC-1

using 136 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[136]
surviving nonsolo ucounts = 1[136]
ids = [0]

====================================================================================

UMI info for barcode GCAGTTACATCGACGC-1 contig 1 = GCCTGGGCCT...
umi ATCTTATCTC = 126 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=497]
0-39 ==> 13-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
39-373 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
377-415 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
415-497 ==> 0-82 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CQAWDSTEVVF at 354, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 124
start codons at 39, 44, 333, 337
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1044 = GCAGTTACATGTCTCC-1

using 233 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 228]
surviving nonsolo ucounts = 1[228]
ids = [0]

====================================================================================

UMI info for barcode GCAGTTACATGTCTCC-1 contig 1 = AGGAGTCAGA...
umi AACTGCGTGC = 227 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=19)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQQSNSYWTF at 354, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 27, 33, 87, 102, 238, 241, 334, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1046 = GCAGTTACATTTCACT-1

using 253 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 248]
surviving nonsolo ucounts = 1[248]
ids = [3]

====================================================================================

UMI info for barcode GCAGTTACATTTCACT-1 contig 1 = GGAGTCAGTC...
umi TTGATTATCT = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=478]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=21)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
414-478 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYTTPRTF at 353, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 26, 32, 88, 101, 233, 258, 333, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1050 = GCAGTTAGTACATGTC-1

using 95 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 8, 80]
surviving nonsolo ucounts = 1[80]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1055 = GCAGTTAGTCAAAGCG-1

using 323 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 316]
surviving nonsolo ucounts = 1[316]
ids = [2]

====================================================================================

UMI info for barcode GCAGTTAGTCAAAGCG-1 contig 1 = GAATCAGTCC...
umi ACTCCTTGTT = 319 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 311
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1063 = GCAGTTAGTGAAATCA-1

using 434 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 426]
surviving nonsolo ucounts = 1[426]
ids = [3]

====================================================================================

UMI info for barcode GCAGTTAGTGAAATCA-1 contig 1 = GGAGAAGAGC...
umi TAACTTGTGT = 427 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 78 reads
cdr3 = CQQYGSSQYTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 419
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1080 = GCAGTTATCAAACGGG-1

using 17 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1088 = GCAGTTATCACTTATC-1

using 334 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3^3, 320]
surviving nonsolo ucounts = 1[320]
ids = [1]

====================================================================================

UMI info for barcode GCAGTTATCACTTATC-1 contig 1 = AGGAATCAGT...
umi AGTTCTTGGG = 324 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1091 = GCAGTTATCAGCTCGG-1

using 140 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 8[4, 5, 6^2, 8, 9, 11, 88]
surviving nonsolo ucounts = 1[88]
ids = [5]

====================================================================================

UMI info for barcode GCAGTTATCAGCTCGG-1 contig 1 = GGGAGTCAGT...
umi GTGGGTATTA = 85 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=461]
27-380 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=13)
380-412 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
412-461 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQTYSALTF at 354, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 27, 33, 89, 102, 238, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1092 = GCAGTTATCAGGCGAA-1

using 324 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 6[2^3, 4, 6, 305]
surviving nonsolo ucounts = 1[305]
ids = [3]

====================================================================================

UMI info for barcode GCAGTTATCAGGCGAA-1 contig 1 = GGAGTCAGAC...
umi CGTCACTACG = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNSYALSF at 353, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 26, 32, 88, 101, 237, 240, 333, 372, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1099 = GCAGTTATCCGAGCCA-1

using 638 reads

====================================================================================

graph has 214 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 273, 360]
surviving nonsolo ucounts = 2[273, 360]
ids = [4, 2]

====================================================================================

UMI info for barcode GCAGTTATCCGAGCCA-1 contig 1 = AGCTTCAGCT...
umi TCGTTACGAC = 260 reads: +388 validated

UMI info for barcode GCAGTTATCCGAGCCA-1 contig 2 = GGAGAAGAGC...
umi GGACCTCGCT = 358 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
434-554 ==> 0-120 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CAAWDDSLSGWVF at 367, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 46, 200, 350, 375, 380
confident = false

TIG 2[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYDSSPLTF at 360, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1101 = GCAGTTATCCGTTGCT-1

using 370 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 365]
surviving nonsolo ucounts = 1[365]
ids = [0]

====================================================================================

UMI info for barcode GCAGTTATCCGTTGCT-1 contig 1 = GGGCACAAGA...
umi AACTCATTTC = 373 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=637]
0-35 ==> 16-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
35-375 ==> 0-340 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=25)
388-426 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
426-637 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CQSYDKSLRGAVF at 359, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 364
start codons at 35, 119, 192, 342, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1107 = GCAGTTATCGCCAAAT-1

using 2299 reads

====================================================================================

graph has 1543 edges initially, 8 edges after simplification

total ucounts = 303
nonsolo ucounts = 138[2^61, 3^26, 4^19, 5^9, 6^6, 7^5, 8, 9, 11^2, 12, 13, 149, 207, 285, 296, 334, 407]
surviving nonsolo ucounts = 5[207, 285, 296, 334, 407]
ids = [28, 71, 101, 153, 111]

====================================================================================

UMI info for barcode GCAGTTATCGCCAAAT-1 contig 1 = AGGAGTCAGA...
umi ACTGCACGTA = 205 reads: +382 validated
umi CATAAACGGA = 282 reads: +382 validated
umi CGGAATGCTT = 297 reads: +382 validated
umi CGTGACCCTC = 408 reads: +382 validated
umi GATTTAATAG = 331 reads: +382 validated
umi TCTGGTGGAC = 61 reads: +16 -1XX +25 -1XX +13 -1XX +4 -1XX +5 -1XX +21 -2XX +1 -1XX +9 -3XX +13 -1XX +6 -15 +2 -2X +4 -2XX +1 -1XX +1 -1XX +6 -1XX +5 -1XX +6 -1XX +1 -1XX +20 -1XX +3 -1XX +3 -1XX +12 -1XX +4 -1XX +29 -2XX +15 -1XX +11 -1X +5 -61X +2 -1XX +2 -1XX +3 -2XX +15 -1XX +7 invalidated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=0)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 5 umis using 289 reads
cdr3 = CQQYYSYPLTF at 354, score = 9 + 9
umis assigned: [28, 71, 101, 111, 153, 249]
of which 5 are surviving nonsolos
reads assigned: 1562
start codons at 33, 89, 102, 238, 457
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1114 = GCAGTTATCTATCGCC-1

using 262 reads

====================================================================================

graph has 127 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 259]
surviving nonsolo ucounts = 1[259]
ids = [0]

====================================================================================

UMI info for barcode GCAGTTATCTATCGCC-1 contig 1 = CATTCGGTGA...
umi ATCATTACGT = 242 reads: +439 validated

GOOD CONTIGS

TIG 1[bases=475]
0-36 ==> 185-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=0)
36-386 ==> 0-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=0)
429-475 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
junction support: 1 umis using 24 reads
cdr3 = CARDPPSYYCTGGVCDRGGNDYW at 375, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 36, 192, 336, 416, 433
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1120 = GCAGTTATCTTCCTTC-1

using 284 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^3, 7, 268]
surviving nonsolo ucounts = 1[268]
ids = [2]

====================================================================================

UMI info for barcode GCAGTTATCTTCCTTC-1 contig 1 = GAATCAGTCC...
umi ATTCTGCTTC = 260 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=473]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-473 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1139 = GCATACAAGCTTATCG-1

using 363 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[362]
surviving nonsolo ucounts = 1[362]
ids = [0]

====================================================================================

UMI info for barcode GCATACAAGCTTATCG-1 contig 1 = AGGAGTCAGA...
umi ATCACTGGGC = 364 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=554]
0-27 ==> 154-181 on |256|IGKV1D-43|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |257|IGKV1D-43|L-REGION+V-REGION| [len=351] (mis=2)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYYSTPFFTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 357
start codons at 27, 33, 89, 102, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1142 = GCATACAAGGACTGGT-1

using 424 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[73, 350]
surviving nonsolo ucounts = 2[73, 350]
ids = [2, 0]

====================================================================================

UMI info for barcode GCATACAAGGACTGGT-1 contig 1 = AGTGCTTTCT...
umi ACATGCGTTC = 342 reads: +430 validated
umi TTGAGTGTGT = 69 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=558]
38-175 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
175-301 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
422-468 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
468-558 ==> 0-90 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 2 umis using 59 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 377, score = 8 + 6
umis assigned: [0, 2]
of which 2 are surviving nonsolos
reads assigned: 406
start codons at 38, 82, 347
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_66.1142_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1146 = GCATACAAGGGAAACA-1

using 32837 reads

====================================================================================

graph has 14089 edges initially, 132 edges after simplification

total ucounts = 2365
nonsolo ucounts = 1243[2^414, 3^252, 4^161, 5^110, 6^79, 7^34, 8^34, 9^18, 10^8, 11^5, 12^8, 13^5, 14^2, 15^2, 16, 19, 22^3, 23, 24, 28, 29, 38, 43, 49, 55, 56^2, 73, 78, 87, 94, 99, 130, 131, 144, 146, 151, 162, 182, 191, 192, 195, 196, 205, 209, 220, 228^2, 231, 238, 245, 252, 254, 255, 258^2, 262^2, 263, 266, 281^2, 282, 283, 285, 287^2, 288, 291, 292, 294, 298, 299, 300, 301, 302, 303^2, 304^2, 306^2, 307, 308, 309, 310, 311, 313^2, 314, 315^2, 316, 318^2, 319, 320, 322, 323, 325, 330^2, 336^4, 337, 338, 339, 340, 342, 348^2, 357, 366, 369, 375, 381, 387, 395, 413, 461, 497]
surviving nonsolo ucounts = 94[4, 5, 99, 130, 131, 144, 146, 151, 162, 182, 191, 192, 195, 196, 205, 209, 220, 228^2, 231, 238, 245, 252, 254, 255, 258^2, 262^2, 263, 266, 281^2, 282, 283, 285, 287^2, 288, 291, 292, 294, 298, 299, 300, 301, 302, 303^2, 304^2, 306^2, 307, 308, 309, 310, 311, 313^2, 314, 315^2, 316, 318^2, 319, 320, 322, 323, 325, 330^2, 336^4, 337, 338, 339, 340, 342, 348^2, 357, 366, 369, 375, 381, 387, 395, 413, 461, 497]
ids = [2037, 488, 1457, 830, 816, 697, 708, 2080, 1078, 2001, ...]

====================================================================================

UMI info for barcode GCATACAAGGGAAACA-1 contig 1 = TGGGGGAGGA...
umi AAAGGGTAGC = 279 reads: +388 validated
umi AACTGCCTCT = 301 reads: +388 validated
umi AAGTGCGCAT = 330 reads: +388 validated
umi AATACTCGAG = 284 reads: +388 validated
umi AATATCGGGA = 380 reads: +388 validated
umi AATCCTAATA = 293 reads: +388 validated
umi AATTAGGCAA = 229 reads: +388 validated
umi ACACGCACTA = 329 reads: +388 validated
umi AGAAGACCTC = 304 reads: +388 validated
umi AGACAATCAC = 308 reads: +388 validated
umi AGCCCTACAG = 7 reads: -211 +2 -3XX +1 -2XX +2 -1XX +1 -1XX +1 -2XX +1 -6XX +8 -4XX +20 -1XX +1 -2XX +2 -116 invalidated
umi AGGCCCTAGA = 326 reads: +388 validated
umi AGTCCGTTCT = 372 reads: +388 validated
umi AGTCTTCGTA = 307 reads: +388 validated
umi ATACACTTTA = 314 reads: +388 validated
umi ATACCCGGCA = 311 reads: +388 validated
umi ATCCGTAGGC = 190 reads: +388 validated
umi ATCCTCACGC = 256 reads: +388 validated
umi ATCGTCGGAA = 310 reads: +388 validated
umi ATCTTTATCC = 313 reads: +388 validated
umi CACTCTTATC = 144 reads: +388 validated
umi CACTGTCCCT = 331 reads: +388 validated
umi CACTTGTCAT = 416 reads: +388 validated
umi CAGATAAACC = 143 reads: +388 validated
umi CAGCGGACCT = 260 reads: +388 validated
umi CAGTCAGGCA = 315 reads: +388 validated
umi CATACAGCTC = 308 reads: +388 validated
umi CATGCACATA = 314 reads: +388 validated
umi CATTACGACG = 311 reads: +388 validated
umi CCAATCCTCA = 133 reads: +388 validated
umi CCACCAACAC = 128 reads: +388 validated
umi CCCTGTACAC = 473 reads: +139 -1XX +1 -5XX +1 -7XX +1 -2XX +1 -1XX +1 -1XX +2 -198XX +1 -3XX +1 -2XX +2 -3XX +1 -5XX +1 -2XX +1 -5XX invalidated
umi CCTATCGGGC = 255 reads: +388 validated
umi CGATCAGTCC = 313 reads: +388 validated
umi CGCCCCGGCA = 162 reads: +388 validated
umi CGCGCCCCAG = 297 reads: +388 validated
umi CGTATAGGGT = 351 reads: +388 validated
umi CTATCGTCAG = 245 reads: +388 validated
umi CTATCTTCGC = 304 reads: +388 validated
umi CTATGATCCC = 344 reads: +388 validated
umi CTCAATAGCC = 294 reads: +388 validated
umi CTCCTTTCTA = 264 reads: +388 validated
umi CTCGGCGGCC = 272 reads: +388 validated
umi CTGCATCTCC = 287 reads: +388 validated
umi GAAACCCGAC = 317 reads: +388 validated
umi GAAATTCGGG = 300 reads: +388 validated
umi GACATCCTAC = 321 reads: +388 validated
umi GATCAAACAC = 216 reads: +388 validated
umi GATTCGCTCA = 369 reads: +388 validated
umi GCACATCCAC = 101 reads: +350 -1X +37 invalidated
umi GCCCCTAAGT = 195 reads: +388 validated
umi GCGAATTAAC = 326 reads: +388 validated
umi GCTTATATCA = 203 reads: +388 validated
umi GGACCGTCAG = 194 reads: +388 validated
umi GTAGGAGTCT = 284 reads: +388 validated
umi GTCCATCTTC = 196 reads: +388 validated
umi GTGCCATCTA = 301 reads: +388 validated
umi GTGTCTATCA = 310 reads: +388 validated
umi GTTACATCTC = 250 reads: +388 validated
umi GTTATTCACC = 504 reads: -137 +251 non-validated
umi TAAACCCTCT = 336 reads: +388 validated
umi TAAGGTCAAC = 259 reads: +388 validated
umi TAATGTCCAC = 301 reads: +388 validated
umi TACGATTGCC = 333 reads: +388 validated
umi TACTCGTCCG = 284 reads: +388 validated
umi TAGCTCAGCC = 255 reads: +388 validated
umi TAGCTGGTCC = 335 reads: +388 validated
umi TCAATAGTTA = 321 reads: +388 validated
umi TCCATCTTAA = 345 reads: +388 validated
umi TCCATGGGAG = 358 reads: +388 validated
umi TCCTCGCGCC = 286 reads: +388 validated
umi TCCTTGCGCA = 181 reads: +388 validated
umi TCGCCTTACC = 393 reads: +388 validated
umi TCTCAAACAC = 388 reads: +388 validated
umi TCTTTCCATA = 152 reads: +388 validated
umi TGCATTTCCC = 283 reads: +388 validated
umi TGCTTACGGT = 297 reads: +388 validated
umi TGGATAAACC = 296 reads: +388 validated
umi TGGGTGTCCT = 336 reads: +388 validated
umi TGGTACCGGA = 315 reads: +388 validated
umi TTCAATGGCT = 332 reads: +388 validated
umi TTCAGTATCC = 285 reads: +388 validated
umi TTCATAACCA = 344 reads: +388 validated
umi TTCCCCGTGG = 338 reads: +388 validated
umi TTCGACCTTA = 234 reads: +388 validated
umi TTCGTATCAC = 323 reads: +388 validated
umi TTGATACTAC = 262 reads: +388 validated
umi TTTAGCTCCG = 204 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-386 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 86 umis using 4039 reads
cdr3 = CQQNYSTPWQF at 360, score = 8 + 7
umis assigned: [29, 77, 107, 115, 120, 131, 144, 180, 336, 342] and 78 others
of which 88 are surviving nonsolos
reads assigned: 24809
start codons at 33, 39, 95, 108, 244, 463
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1152 = GCATACAAGTAATCCC-1

using 5803 reads

====================================================================================

graph has 5079 edges initially, 78 edges after simplification

total ucounts = 1019
nonsolo ucounts = 764[2^128, 3^100, 4^64, 5^58, 6^51, 7^53, 8^54, 9^42, 10^31, 11^33, 12^24, 13^26, 14^23, 15^16, 16^17, 17^15, 18^9, 19^7, 20^7, 21^2, 22^2, 24, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1158 = GCATACAAGTCCATAC-1

using 1166 reads

====================================================================================

graph has 400 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[339, 823]
surviving nonsolo ucounts = 2[339, 823]
ids = [1, 5]

====================================================================================

UMI info for barcode GCATACAAGTCCATAC-1 contig 1 = GAGAAGAGCT...
umi CAAACGAGAC = 341 reads: +385 validated
umi TTATCGATCT = 862 reads: +115 -1XX +1 -2XX +1 -3XX +1 -2XX +5 -1XX +1 -7XX +1 -134X +1 -2XX +2 -6XX +2 -4XX +1 -4XX +88 invalidated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=19)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQYGSSPWTF at 359, score = 8 + 8
umis assigned: [1, 5]
of which 2 are surviving nonsolos
reads assigned: 1150
start codons at 35, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1167 = GCATACAAGTTAACGA-1

using 265 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [2]

====================================================================================

UMI info for barcode GCATACAAGTTAACGA-1 contig 1 = GGAGGAATCA...
umi CGCGCGCTCT = 257 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=491]
29-380 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
379-417 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
417-491 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 356, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 29, 35, 104, 240, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1171 = GCATACACAAACTGCT-1

using 20 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[3, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1179 = GCATACACAAGCTGAG-1

using 1019 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[1014]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1181 = GCATACACAAGTCTAC-1

using 20333 reads

====================================================================================

graph has 8305 edges initially, 80 edges after simplification

total ucounts = 1146
nonsolo ucounts = 617[2^216, 3^136, 4^80, 5^40, 6^32, 7^14, 8^13, 9^7, 10^8, 11^4, 12, 13, 15, 17, 18^2, 20, 21, 26, 42, 63, 64, 73, 101, 154, 161, 167, 171, 184, 225, 227^2, 230, 231, 234, 235, 237^2, 241, 247, 251, 254, 255, 258, 260, 261, 274, 278, 281, 283, 285, 287, 291, 296, 298, 299, 300^3, 302, 313, 314, 319, 325, 329, 333, 343, 349, 381, 415, 466, 526, 551, 574, 810, 885, 1106]
surviving nonsolo ucounts = 53[73, 154, 161, 167, 171, 184, 225, 227, 230, 231, 234, 235, 237^2, 241, 247, 251, 254, 255, 258, 260, 261, 274, 278, 281, 283, 285, 287, 291, 296, 298, 299, 300^3, 302, 313, 314, 319, 325, 329, 333, 343, 349, 381, 415, 466, 526, 551, 574, 810, 885, 1106]
ids = [882, 767, 1100, 216, 1040, 405, 167, 977, 90, 483, ...]

====================================================================================

UMI info for barcode GCATACACAAGTCTAC-1 contig 1 = ATACTTTCTG...
umi AATCACTATC = 235 reads: +433 validated
umi AGGCTTACGG = 159 reads: +433 validated
umi ATCCCTTTAT = 298 reads: +433 validated
umi ATGTCACTTT = 287 reads: +13 -1X +2 -2XX +3 -1XX +411 invalidated
umi ATTATCCTAT = 414 reads: +433 validated
umi CATAATACAG = 237 reads: +433 validated
umi CCGCATTACG = 238 reads: +433 validated
umi CCTTACGGTC = 277 reads: +433 validated
umi CGCGGCGGAT = 252 reads: +433 validated
umi CTATTTAGCG = 280 reads: +433 validated
umi GCAGACCCAA = 268 reads: +433 validated
umi TATCCCACTT = 75 reads: +394 -1 +38 non-validated
umi TCTTACTCCA = 234 reads: +433 validated
umi TGTCCCGCCT = 251 reads: +433 validated
umi TTTTTAACGC = 303 reads: +433 validated

UMI info for barcode GCATACACAAGTCTAC-1 contig 2 = GCTCTGCTTC...
umi AACATCTGTC = 525 reads: +385 validated
umi AACTTCGGTA = 553 reads: -108 +1 -2X +274 invalidated
umi AATGACTCGC = 227 reads: +385 validated
umi ACTTATATCG = 224 reads: +385 validated
umi AGTTACTTCT = 276 reads: +385 validated
umi ATGCCAGTAC = 258 reads: +385 validated
umi ATGCTCAGGA = 461 reads: +385 validated
umi CCACTTCGGG = 192 reads: +347 -2XX +1 -1XX +1 -1XX +1 -3XX +2 -2XX +1 -3XX +1 -1 +18 invalidated
umi CCTTTTCTCT = 286 reads: +385 validated
umi CGCAGATCTT = 347 reads: +385 validated
umi CGCGTCTTAC = 231 reads: +385 validated
umi CGTACCTCCG = 994 reads: -351 +9 -1XX +1 -1XX +2 -1XX +6 -1XX +10 -1XX +1 invalidated
umi CTATAACGGC = 247 reads: +385 validated
umi CTATAGTAGA = 302 reads: +385 validated
umi CTCTATCCGT = 1912 reads: -351X +9 -1XX +1 -1XX +2 -1XX +6 -1XX +10 -1XX +1 invalidated
umi CTGTATCGTA = 1515 reads: -351 +9 -1XX +1 -1XX +2 -1XX +6 -1XX +10 -1XX +1 invalidated
umi CTTTATAGTG = 337 reads: +385 validated
umi GCCCAGACTA = 281 reads: +385 validated
umi GGTTATAATC = 299 reads: +385 validated
umi GTATGCCAGT = 826 reads: -281X +104 invalidated
umi GTCCAGATTA = 257 reads: +385 validated
umi GTCCCCCGCC = 153 reads: +385 validated
umi TACGTTTGTT = 283 reads: +385 validated
umi TAGAACTCCT = 311 reads: +385 validated
umi TATACACTGT = 239 reads: +385 validated
umi TATCAAGACC = 240 reads: +385 validated
umi TCACCTAGTC = 300 reads: +385 validated
umi TCGGAGTCCT = 229 reads: +385 validated
umi TGGGTTCGCC = 169 reads: +385 validated
umi TTCATTCCGA = 377 reads: +385 validated
umi TTCTTGCTGG = 165 reads: +385 validated
umi TTTCTTCTGT = 242 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=541]
0-37 ==> 27-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
37-390 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
393-416 ==> 0-23 on |20|IGHD3-22|D-REGION| [len=31] (mis=1)
422-470 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
470-541 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 337 reads
cdr3 = CARHPYYYDSSGSRGYFDYW at 379, score = 9 + 7
umis assigned: [81, 216, 266, 300, 311, 369, 422, 444, 481, 528] and 5 others
of which 15 are surviving nonsolos
reads assigned: 3755
start codons at 16, 37, 81, 401
confident = true

TIG 2[bases=647]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-398 ==> 0-347 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
398-436 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
436-647 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 28 umis using 1343 reads
cdr3 = CQSYDSSLWVF at 375, score = 8 + 8
umis assigned: [30, 49, 90, 167, 229, 290, 293, 405, 453, 474] and 22 others
of which 32 are surviving nonsolos
reads assigned: 11110
start codons at 51, 205, 208, 259, 358, 385
confident = true

REJECT CONTIGS

TIG 1[bases=558]
8-89 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
384-422 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [105, 284, 460, 573, 1064, 1082, 1083]
of which 6 are surviving nonsolos
reads assigned: 1877
start codons at 32, 38, 94, 107, 243, 464
confident = false
did not find CDR3
now this is a cell
paired!

GTGTATTACTGTGCGAGACACCCCTATTACTATGATAGTAGTGGTTCAAGGGGGTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1183 = GCATACACAATCGAAA-1

using 180 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2^2, 174]
surviving nonsolo ucounts = 1[174]
ids = [3]

====================================================================================

UMI info for barcode GCATACACAATCGAAA-1 contig 1 = TGGGGAGTCC...
umi GGAGTCACCA = 164 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
31-279 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
413-498 ==> 0-85 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CLHYDNRRRTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 31, 87, 100, 239, 362, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1186 = GCATACACAATGGTCT-1

using 88 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 3[3, 4, 71]
surviving nonsolo ucounts = 1[71]
ids = [2]

====================================================================================

UMI info for barcode GCATACACAATGGTCT-1 contig 1 = GAGGAACTGC...
umi AAATGAATGT = 68 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=498]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-378 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-498 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CQQRSNWPLTF at 354, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 68
start codons at 33, 241, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1190 = GCATACACACAGACTT-1

using 206 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 7, 192]
surviving nonsolo ucounts = 1[192]
ids = [4]

====================================================================================

UMI info for barcode GCATACACACAGACTT-1 contig 1 = GCTCTGCTTC...
umi TTCAACCGCA = 187 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=473]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-473 ==> 0-28 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 184
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1192 = GCATACACACATGTGT-1

using 498 reads

====================================================================================

graph has 216 edges initially, 36 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2, 5, 159, 328]
surviving nonsolo ucounts = 2[159, 328]
ids = [5, 2]

====================================================================================

UMI info for barcode GCATACACACATGTGT-1 contig 1 = GGCTGGGGTC...
umi TCCAGATCGA = 156 reads: +388 validated

UMI info for barcode GCATACACACATGTGT-1 contig 2 = TGAGCGCAGA...
umi CATGTAATCA = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=578]
42-393 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
430-578 ==> 0-148 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CSSYTSSSTYVF at 366, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 154
start codons at 42, 199, 243, 250, 253, 394, 562
confident = false

TIG 2[bases=572]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=1)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-572 ==> 0-148 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 39 reads
cdr3 = CGTWDSSLSAVVF at 357, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 36, 190, 241, 365, 556
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1195 = GCATACACACCTCGTT-1

using 387 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[384]
surviving nonsolo ucounts = 1[384]
ids = [3]

====================================================================================

UMI info for barcode GCATACACACCTCGTT-1 contig 1 = AGACCCAGTC...
umi TGTTCACGAC = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=481]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
408-481 ==> 0-73 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQYNSYQYTF at 347, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 365
start codons at 20, 26, 82, 95, 327, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1206 = GCATACACAGCTGTTA-1

using 627 reads

====================================================================================

graph has 248 edges initially, 6 edges after simplification

total ucounts = 14
nonsolo ucounts = 8[2, 3, 6^3, 14, 228, 356]
surviving nonsolo ucounts = 2[228, 356]
ids = [13, 8]

====================================================================================

UMI info for barcode GCATACACAGCTGTTA-1 contig 1 = CAGCAAGATG...
umi CCCGCGCTAT = 357 reads: +400 validated

UMI info for barcode GCATACACAGCTGTTA-1 contig 2 = GGAGTCAGTC...
umi TTGTACGTCG = 227 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=543]
7-370 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=10)
369-407 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
407-543 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CHQYFGTPFTF at 346, score = 9 + 7
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 7, 76, 329, 449
confident = false

TIG 2[bases=550]
32-280 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
376-414 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CLHYDNRRRTF at 353, score = 9 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 32, 88, 101, 240, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1209 = GCATACACAGTCCTTC-1

using 101 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 96]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1217 = GCATACACATCAGTCA-1

using 242 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 236]
surviving nonsolo ucounts = 1[236]
ids = [3]

====================================================================================

UMI info for barcode GCATACACATCAGTCA-1 contig 1 = AGCTTCAGCT...
umi TCCCGTCACG = 238 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=577]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
438-577 ==> 0-139 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CAAWDDSLNGLYVF at 368, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 234
start codons at 47, 351, 376, 381, 393, 402, 570
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1221 = GCATACACATTATCTC-1

using 352 reads

====================================================================================

graph has 164 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[170, 180]
surviving nonsolo ucounts = 2[170, 180]
ids = [3, 1]

====================================================================================

UMI info for barcode GCATACACATTATCTC-1 contig 1 = CTGGGCCTAA...
umi CATTGTTTCA = 171 reads: +382 validated

UMI info for barcode GCATACACATTATCTC-1 contig 2 = GTCAGACCCA...
umi TTTATGGTCG = 159 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=524]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-381 ==> 0-344 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=0)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
419-524 ==> 0-105 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CQVWDSSSDQGVF at 352, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 170
start codons at 37, 98, 236, 239, 335
confident = false

TIG 2[bases=463]
0-23 ==> 158-181 on |260|IGKV1D-8|5'UTR| [len=181] (mis=0)
23-376 ==> 0-353 on |261|IGKV1D-8|L-REGION+V-REGION| [len=353] (mis=1)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
411-463 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYYSFPRTF at 350, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 23, 29, 85, 98, 161, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1227 = GCATACAGTAAGCACG-1

using 297 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[292]
surviving nonsolo ucounts = 1[292]
ids = [2]

====================================================================================

UMI info for barcode GCATACAGTAAGCACG-1 contig 1 = GGGAGCTTCA...
umi TACTCCTCTG = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=534]
34-386 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=19)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
422-534 ==> 0-112 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CSAWDSSLNVWVF at 355, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 34, 173, 363, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1233 = GCATACAGTAGGACAC-1

using 75 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 13[2, 3^2, 4^3, 5, 6^3, 9, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1234 = GCATACAGTAGGGTAC-1

using 398 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[398]
surviving nonsolo ucounts = 1[398]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1235 = GCATACAGTATTCGTG-1

using 716 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 707]
surviving nonsolo ucounts = 1[707]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1239 = GCATACAGTCCAGTGC-1

using 361 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 356]
surviving nonsolo ucounts = 1[356]
ids = [4]

====================================================================================

UMI info for barcode GCATACAGTCCAGTGC-1 contig 1 = GGAGTCTCCC...
umi TTGGGCGGCC = 356 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=554]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=4)
409-440 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=7)
435-483 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARQFCISTSCYYFDYW at 401, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 59, 233, 257, 392
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1243 = GCATACAGTCCTCCAT-1

using 337 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 7, 322]
surviving nonsolo ucounts = 1[322]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=479]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
49-116 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=21)
436-479 ==> 0-43 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 80, 231, 236, 297, 306, 383, 438, 467
confident = false
VJ delta = 8
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1249 = GCATACAGTCTAGAGG-1

using 24684 reads

====================================================================================

graph has 11601 edges initially, 102 edges after simplification

total ucounts = 2171
nonsolo ucounts = 1013[2^355, 3^219, 4^118, 5^91, 6^52, 7^27, 8^22, 9^12, 10^7, 11^6, 12^4, 13, 15^2, 16, 17, 28^2, 34, 45, 56, 57, 62, 65, 69, 72^2, 79, 84, 86, 88^2, 94, 107, 116, 117, 119, 131^2, 137, 141, 147, 150, 151, 156, 159, 165, 172, 173, 184, 189, 191, 192^2, 194^2, 196, 197, 203, 205, 207^2, 215, 217, 221^3, 223, 226, 229, 230, 235^2, 236, 237, 243, 244, 247, 249, 255, 259^2, 260, 265, 269, 271, 275, 279, 282, 283, 286, 287^2, 291, 292, 301, 302, 311, 312, 323, 324, 326, 343, 360, 377, 378, 386^2, 420, 456, 623]
surviving nonsolo ucounts = 81[65, 69, 72^2, 84, 86, 88, 94, 107, 117, 119, 131^2, 141, 147, 150, 151, 159, 165, 172, 173, 184, 191, 192^2, 194, 196, 197, 203, 205, 207^2, 215, 217, 221^3, 223, 226, 229, 230, 235^2, 236, 237, 243, 244, 247, 249, 255, 259^2, 260, 265, 269, 271, 275, 279, 282, 283, 286, 287^2, 291, 292, 301, 302, 311, 312, 323, 324, 326, 343, 360, 377, 378, 386^2, 420, 456, 623]
ids = [40, 430, 242, 1079, 11, 671, 568, 1652, 32, 290, ...]

====================================================================================

UMI info for barcode GCATACAGTCTAGAGG-1 contig 1 = GTGGGTCCAG...
umi AACCATCTTA = 279 reads: +379 validated
umi AAGGTAGCTT = 213 reads: +379 validated
umi ACCCGAGTGT = 268 reads: +379 validated
umi ACTCGCCGAT = 193 reads: +379 validated
umi AGGGCAAAAC = 33 reads: -368X +1 -3X +1 -4X +2 invalidated
umi CATAGGATCA = 328 reads: +379 validated
umi CCAAGTCCTC = 275 reads: +379 validated
umi CCACAAATTA = 147 reads: +379 validated
umi CTAACTTCCC = 266 reads: +379 validated
umi CTCGAACGGC = 378 reads: +379 validated
umi GAAAGTAGGG = 289 reads: +379 validated
umi GACTGATAGG = 235 reads: +379 validated
umi GCATCTTTGT = 16 reads: -350 +2 -3XX +1 -1XX +1 -4XX +1 -3XX +1 -1XX +1 -3XX +1 -4XX +2 invalidated
umi GGTCTCATAA = 222 reads: +379 validated
umi GTAATACCAC = 134 reads: +379 validated
umi TAAGAGGCCT = 303 reads: +379 validated
umi TACGTATTAT = 392 reads: -351 +2 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TATGGATACC = 252 reads: +379 validated
umi TGCTTTTTGG = 242 reads: -86X +293 invalidated
umi TTACAGCCGA = 641 reads: -341X +1 -3X +2 -1X +5 -4XX +9 -1XX +1 -1XX +10 invalidated
umi TTCCTTAAGG = 282 reads: +379 validated
umi TTCGTAGGTT = 146 reads: +379 validated

UMI info for barcode GCATACAGTCTAGAGG-1 contig 2 = GGGGGACCCA...
umi AACAGCGGTT = 115 reads: +396 -28 non-validated
umi AACCACGGGT = 85 reads: +385 -23 +16 non-validated
umi AACTTGGAGT = 108 reads: +424 validated
umi AAGCGCCCGT = 67 reads: +424 validated
umi ACATAAGGCT = 260 reads: +424 validated
umi ACCGCTCGAA = 174 reads: +424 validated
umi ACCGGCAGCT = 459 reads: -265 +1 -10X +1 -2XX +145 invalidated
umi ACGTTGCGTT = 388 reads: +424 validated
umi AGTAAGGATC = 60 reads: -347 +36 -1 +9 -1 +30 non-validated
umi ATATACTCGT = 112 reads: +424 validated
umi ATATCACACT = 381 reads: +424 validated
umi ATCTATTCCT = 275 reads: +424 validated
umi ATTGCAGTGT = 191 reads: +424 validated
umi CAAAGACTGG = 69 reads: +424 validated
umi CAACAGTAAG = 196 reads: +387 -1 +36 non-validated
umi CAAGGGTCAC = 285 reads: +424 validated
umi CAAGTTGACC = 286 reads: +424 validated
umi CACGGGCGTC = 237 reads: +424 validated
umi CAGGGTCACT = 204 reads: +422 -2 non-validated
umi CATGTTATTA = 224 reads: +424 validated
umi CATTACTCCT = 87 reads: +399 -1 +24 non-validated
umi CCGCGTCGTA = 85 reads: +363 -1 +8 -1 +1 -1 +49 non-validated
umi CCGGACCCCT = 212 reads: +420 -1 +3 non-validated
umi CGGTGACCTG = 188 reads: +408 -1 +3 -1 +7 -1 +3 non-validated
umi CGTTTCGTTC = 230 reads: +424 validated
umi CTCAAATCTT = 244 reads: +424 validated
umi CTCATGCGGC = 289 reads: +424 validated
umi CTGGTATATC = 138 reads: +424 validated
umi CTTTAACTCT = 209 reads: +424 validated
umi GAAAACATGC = 306 reads: +424 validated
umi GAACCCTTGA = 286 reads: +424 validated
umi GCAGGTCCTT = 299 reads: +424 validated
umi GCAGGTTGGG = 196 reads: +400 -1 +8 -15 non-validated
umi GCATGGGTCA = 190 reads: +424 validated
umi GCGCAACGCG = 322 reads: +424 validated
umi GGGTGTCGCA = 224 reads: +424 validated
umi GGTATGTTTC = 303 reads: +424 validated
umi GTTGTATCTC = 227 reads: +424 validated
umi TAAAGCGGCA = 263 reads: +424 validated
umi TACAAATCCT = 227 reads: +424 validated
umi TACAACCGAT = 217 reads: +424 validated
umi TACTGTAAGG = 185 reads: +413 -11 non-validated
umi TCAATCGCGT = 238 reads: +424 validated
umi TCAGATTAGT = 317 reads: +424 validated
umi TCATAGCGCA = 90 reads: +373 -51 non-validated
umi TCATATGACT = 361 reads: +424 validated
umi TCTCAATGGC = 272 reads: +424 validated
umi TCTCTACTAC = 174 reads: +424 validated
umi TCTGTTAATG = 242 reads: +424 validated
umi TGTCCGTATA = 197 reads: +424 validated
umi TTCGAACAAG = 272 reads: +424 validated
umi TTCTTTGTCC = 123 reads: +412 -1 +11 non-validated
umi TTGCGTCTGT = 149 reads: +398 -2X +2 -22 invalidated
umi TTGCTATTCA = 339 reads: +424 validated
umi TTGGTGCGTT = 166 reads: +424 validated
umi TTGTTACCCG = 235 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=5)
376-414 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
414-625 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 18 umis using 739 reads
cdr3 = CQSTDSSGTYVF at 350, score = 8 + 8
umis assigned: [12, 45, 121, 174, 235, 528, 590, 593, 869, 929] and 12 others
of which 22 are surviving nonsolos
reads assigned: 5400
start codons at 35, 165, 183, 378, 546
confident = true

TIG 2[bases=554]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=4)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=13)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 46 umis using 851 reads
cdr3 = CARNFDLVTYGDSLDMW at 401, score = 8 + 7
umis assigned: [8, 11, 32, 40, 102, 124, 125, 158, 242, 290] and 46 others
of which 56 are surviving nonsolos
reads assigned: 12065
start codons at 59, 182, 210, 257, 262, 294, 323, 356, 429, 446, 464
confident = true

REJECT CONTIGS

TIG 1[bases=358]
2-185 ==> 2462-2645 on rc of segment before IGHD1-1 exon 1 [len=2645] (mis=0)
224-287 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=1)
287-358 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [1232, 1847]
of which 2 are surviving nonsolos
reads assigned: 628
start codons at 244
confident = false
did not find CDR3
now this is a cell
paired!

GACACGGCCGTTTATTACTGTGCGAGAAATTTTGATTTAGTGACTTATGGAGATTCTCTTGATATGTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> AGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAGTCAACAGACAGCAGTGGTACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1257 = GCATACAGTGCAACGA-1

using 2200 reads

====================================================================================

graph has 3298 edges initially, 22 edges after simplification

total ucounts = 847
nonsolo ucounts = 441[2^157, 3^84, 4^63, 5^50, 6^28, 7^16, 8^10, 9^12, 10^8, 11^3, 12^4, 13, 14, 16, 17, 18, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1281 = GCATACATCAAACCAC-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1282 = GCATACATCAAACCGT-1

using 188 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[184]
surviving nonsolo ucounts = 1[184]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=467]
4-76 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
28-381 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=3)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
416-467 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 173
start codons at 28, 34, 90, 338, 371, 458
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1304 = GCATACATCCTCAACC-1

using 250 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 13, 230]
surviving nonsolo ucounts = 1[230]
ids = [4]

====================================================================================

UMI info for barcode GCATACATCCTCAACC-1 contig 1 = AGAGTATGAA...
umi TGACACGTGC = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=624]
0-83 ==> 31-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
83-436 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=12)
433-471 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
471-624 ==> 0-153 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CAAWDDSLNGRVF at 404, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 5, 83, 288, 387, 412, 417, 429
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1311 = GCATACATCGGCATCG-1

using 266 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[7, 256]
surviving nonsolo ucounts = 1[256]
ids = [1]

====================================================================================

UMI info for barcode GCATACATCGGCATCG-1 contig 1 = GGGAGTCTCA...
umi ATACTGTTTA = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=2)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQSYSTPLTF at 350, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1312 = GCATACATCGGTCCGA-1

using 237 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 13, 220]
surviving nonsolo ucounts = 1[220]
ids = [4]

====================================================================================

UMI info for barcode GCATACATCGGTCCGA-1 contig 1 = AGTGCTTTCT...
umi TTTATTACGT = 217 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=562]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=40)
405-453 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
453-562 ==> 0-109 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 32 reads
cdr3 = CARYFAFVNYYFDKW at 377, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 17, 38, 82
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1313 = GCATACATCGTACGGC-1

using 219 reads

====================================================================================

graph has 98 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[46, 171]
surviving nonsolo ucounts = 2[46, 171]
ids = [2, 3]

====================================================================================

UMI info for barcode GCATACATCGTACGGC-1 contig 1 = GATCAGGACT...
umi TTAAAACGGC = 171 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=513]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-356 ==> 0-326 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=11)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-513 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CMNTLPGGFTF at 366, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false

REJECT CONTIGS

TIG 1[bases=411]
0-290 ==> 63-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
288-325 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
325-411 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQSYTTLLTF at 264, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 41
start codons at 12, 148, 367
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1318 = GCATACATCTCTGAGA-1

using 10 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1326 = GCATGATAGAAGAAGC-1

using 138 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[133]
surviving nonsolo ucounts = 1[133]
ids = [1]

====================================================================================

UMI info for barcode GCATGATAGAAGAAGC-1 contig 1 = GAGAGGGAAC...
umi CCCCTCCTGC = 133 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=535]
11-356 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
361-399 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
399-535 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQRSNWPQVFTF at 332, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 131
start codons at 11, 216, 219, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1328 = GCATGATAGACCTAGG-1

using 120 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 9, 101]
surviving nonsolo ucounts = 1[101]
ids = [2]

====================================================================================

UMI info for barcode GCATGATAGACCTAGG-1 contig 1 = AGCTCTGAGA...
umi GATAGTATTG = 97 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=556]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-556 ==> 0-53 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 96
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1329 = GCATGATAGACGACGT-1

using 301 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[10, 289]
surviving nonsolo ucounts = 1[289]
ids = [1]

====================================================================================

UMI info for barcode GCATGATAGACGACGT-1 contig 1 = ATCAGTCCCA...
umi CATGGCACTC = 288 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1332 = GCATGATAGAGGTAGA-1

using 315 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 311]
surviving nonsolo ucounts = 1[311]
ids = [0]

====================================================================================

UMI info for barcode GCATGATAGAGGTAGA-1 contig 1 = GTCAGACCCA...
umi TATTAGTCAG = 306 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=547]
0-29 ==> 24-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=3)
29-358 ==> 0-329 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=40)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CQQYHSFPWTF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 29, 85, 98, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1334 = GCATGATAGAGTGACC-1

using 568 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[170, 397]
surviving nonsolo ucounts = 2[170, 397]
ids = [1, 0]

====================================================================================

UMI info for barcode GCATGATAGAGTGACC-1 contig 1 = GAGGAGTCAG...
umi TCTGTAGTGT = 167 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=17)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSHSIPYTF at 355, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 167
start codons at 28, 34, 90, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1343 = GCATGATAGCCAGTAG-1

using 544 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^2, 3, 239, 293]
surviving nonsolo ucounts = 2[239, 293]
ids = [3, 0]

====================================================================================

UMI info for barcode GCATGATAGCCAGTAG-1 contig 1 = GAGCTCTGGG...
umi AGCCAGCACA = 291 reads: +406 validated
umi CAGTTTTGTC = 236 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=557]
80-433 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=28)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 34 reads
cdr3 = CARENDAFDIW at 422, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 522
start codons at 80, 140, 231, 236, 294, 297, 383, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1345 = GCATGATAGCCCAGCT-1

using 797 reads

====================================================================================

graph has 1168 edges initially, 10 edges after simplification

total ucounts = 384
nonsolo ucounts = 156[2^62, 3^34, 4^26, 5^12, 6^3, 7^8, 8^5, 9^3, 10, 12, 16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1356 = GCATGATAGGTGGGTT-1

using 836 reads

====================================================================================

graph has 262 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[279, 551]
surviving nonsolo ucounts = 2[279, 551]
ids = [6, 2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=554]
3-91 ==> 5658-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=4)
34-387 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2, 6]
of which 2 are surviving nonsolos
reads assigned: 820
start codons at 34, 40, 96, 109, 245, 460
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1359 = GCATGATAGTCGTTTG-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1368 = GCATGATAGTTGCAGG-1

using 297 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[293]
surviving nonsolo ucounts = 1[293]
ids = [2]

====================================================================================

UMI info for barcode GCATGATAGTTGCAGG-1 contig 1 = TGGGAGGAAT...
umi CCACTTCGCC = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1369 = GCATGATAGTTGTAGA-1

using 75 reads

====================================================================================

graph has 102 edges initially, 4 edges after simplification

total ucounts = 17
nonsolo ucounts = 11[2^2, 3, 4, 5^2, 7, 8, 11^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1382 = GCATGATCACACGCTG-1

using 14243 reads

====================================================================================

graph has 9185 edges initially, 168 edges after simplification

total ucounts = 1766
nonsolo ucounts = 1337[2^226, 3^200, 4^162, 5^137, 6^116, 7^103, 8^82, 9^62, 10^60, 11^34, 12^34, 13^26, 14^24, 15^17, 16^12, 17^5, 18^6, 19^4, 20^2, 21, 22, 48, 54, 164, 169, 182, 195, 249, 262, 266, 273, 274, 284, 293, 296, 298, 304, 305, 307, 337, 339, 341, 349, 353]
surviving nonsolo ucounts = 21[54, 164, 169, 182, 195, 249, 262, 266, 273, 274, 284, 293, 296, 304, 305, 307, 337, 339, 341, 349, 353]
ids = [1225, 632, 366, 1093, 1580, 84, 136, 241, 1563, 318, ...]

====================================================================================

UMI info for barcode GCATGATCACACGCTG-1 contig 1 = GGGGAGGAGT...
umi AATCGGCGTA = 244 reads: +394 validated
umi ACCATACCTA = 268 reads: -38X +356 invalidated
umi ACTTGCACGG = 283 reads: +394 validated
umi AGCCTAAGCT = 273 reads: +394 validated
umi ATATCTCAAG = 274 reads: +394 validated
umi CAGATATCTT = 352 reads: +394 validated
umi CCGACACAAT = 165 reads: +394 validated
umi CGCTTGTCAG = 32 reads: -357X +1 -2XX +2 -1XX +7 -2XX +8 -1XX +5 -1XX +7 invalidated
umi CTTGAAGGTA = 337 reads: +394 validated
umi GAGACAGTCA = 331 reads: +394 validated
umi GCACTTGGTC = 302 reads: +394 validated
umi GCCTACGACC = 296 reads: +394 validated
umi GCTTATTTCA = 309 reads: +394 validated
umi GTCGCCCCTA = 357 reads: +394 validated
umi TCGGGTCTGT = 339 reads: +394 validated
umi TGACTACCTC = 272 reads: +394 validated
umi TGCTAATGAG = 196 reads: +394 validated

UMI info for barcode GCATGATCACACGCTG-1 contig 2 = ACATAACAAC...
umi ATGCCACTAT = 128 reads: +421 validated
umi CTATCGTCCT = 223 reads: +421 validated
umi GAATGTGGCT = 243 reads: +421 validated
umi GGAAGCAAGA = 153 reads: +421 validated
umi GTCGCTTCTA = 42 reads: +406 -1 +2 -12 non-validated

GOOD CONTIGS

TIG 1[bases=561]
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
387-425 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
425-561 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 16 umis using 748 reads
cdr3 = CQQSYSTLRPWTF at 358, score = 9 + 8
umis assigned: [84, 136, 208, 241, 318, 498, 632, 749, 900, 970] and 7 others
of which 16 are surviving nonsolos
reads assigned: 4556
start codons at 31, 37, 93, 106, 242, 467
confident = true

TIG 2[bases=501]
0-55 ==> 6-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
55-408 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=5)
428-476 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
476-501 ==> 0-25 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 65 reads
cdr3 = CAVRVSGITGTLLDYW at 397, score = 9 + 7
umis assigned: [366, 805, 941, 1093, 1225]
of which 5 are surviving nonsolos
reads assigned: 780
start codons at 55, 206, 253, 352
confident = true
now this is a cell
paired!

GAGGACACGGCCGTGTATTACTGTGCGGTGAGGGTCTCGGGGATAACTGGAACCCTATTAGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCTACGGCCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1383 = GCATGATCACCAGGCT-1

using 16 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1386 = GCATGATCACTATCTT-1

using 384 reads

====================================================================================

graph has 266 edges initially, 2 edges after simplification

total ucounts = 20
nonsolo ucounts = 15[2^4, 3, 6^2, 7, 8^2, 13^2, 16, 17, 274]
surviving nonsolo ucounts = 1[274]
ids = [8]

====================================================================================

UMI info for barcode GCATGATCACTATCTT-1 contig 1 = AGCTTCAGCT...
umi ATTTCCATAC = 279 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1391 = GCATGATCAGCGTCCA-1

using 95 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[4, 7, 84]
surviving nonsolo ucounts = 1[84]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1402 = GCATGATCATACCATG-1

using 14201 reads

====================================================================================

graph has 5587 edges initially, 58 edges after simplification

total ucounts = 713
nonsolo ucounts = 335[2^99, 3^72, 4^46, 5^32, 6^16, 7^11, 8^2, 9, 10^2, 11, 13, 16, 44, 52, 93, 101, 102, 108^2, 116, 128, 134, 149, 163, 165, 169, 175, 185, 212, 214, 225, 226, 230, 234, 247, 253, 261, 264^2, 267, 269, 271^2, 273, 275, 278, 280, 281, 282, 285, 295, 306, 311, 317, 348, 350, 351, 366, 370, 387, 391, 636, 725]
surviving nonsolo ucounts = 48[52, 93, 101, 108^2, 116, 128, 134, 149, 163, 165, 169, 175, 185, 212, 214, 225, 226, 230, 234, 247, 253, 261, 264^2, 267, 269, 271^2, 273, 275, 278, 280, 281, 282, 285, 295, 306, 311, 317, 348, 350, 351, 366, 387, 391, 636, 725]
ids = [706, 162, 126, 227, 412, 212, 354, 95, 534, 476, ...]

====================================================================================

UMI info for barcode GCATGATCATACCATG-1 contig 1 = GAGCTCTGGG...
umi ACTCGGCCTC = 168 reads: +414 -7 non-validated
umi AGATTGGCAT = 223 reads: +421 validated
umi AGCTTCGGCA = 307 reads: +421 validated
umi ATATATAATC = 102 reads: +421 validated
umi ATCCAGATTA = 292 reads: +421 validated
umi ATTACGGCGC = 290 reads: +421 validated
umi ATTGATGGCT = 263 reads: +421 validated
umi CATTGATTTT = 106 reads: -343X +1 -4XX +1 -3XX +3 -5XX +1 -3XX +1 -4XX +1 -2XX +1 -1XX +47 invalidated
umi CCTATCCCTT = 217 reads: -348X +1 -3X +3 -5XX +1 -3XX +1 -4XX +1 -2XX +1 -1XX +47 invalidated
umi CTAGGGTCGG = 251 reads: +421 validated
umi CTCTAAACCC = 120 reads: -369X +1 -2X +1 -1X +47 invalidated
umi CTTCGGCCTA = 592 reads: -343X +1 -4XX +1 -3XX +3 -5XX +1 -3XX +1 -4XX +1 -2XX +1 -1XX +47 invalidated
umi CTTCTCTGTC = 184 reads: +421 validated
umi GCCCCTCTCT = 213 reads: +421 validated
umi GCCCGGTGCG = 248 reads: +413 -8 non-validated
umi GGAATTCTCA = 165 reads: +408 -9 +3 -1 non-validated
umi TAACCTCTCA = 140 reads: +421 validated
umi TATCAACCCG = 16 reads: -343X +1 -4XX +1 -3XX +3 -5XX +1 -3XX +1 -4XX +1 -2XX +1 -1XX +47 invalidated
umi TGTAGGTGCA = 274 reads: +421 validated
umi TTCATACCTA = 346 reads: +421 validated
umi TTTGTCTCGC = 50 reads: +334 -87 non-validated
umi TTTTATCCGT = 158 reads: +421 validated

UMI info for barcode GCATGATCATACCATG-1 contig 2 = GAGCTACAAC...
umi AATCACCTCT = 223 reads: +400 validated
umi AGCTCTGCAG = 218 reads: +400 validated
umi AGGCAGCCCT = 126 reads: -379X +1 -6XX +1 -1XX +2 -2XX +1 -1XX +1 -5XX invalidated
umi ATACAGACCC = 279 reads: +400 validated
umi ATCTTCCCTT = 395 reads: +400 validated
umi ATTATTTGCC = 92 reads: +390 -5 +5 non-validated
umi CAAGGAGCAA = 234 reads: +400 validated
umi CAAGTCCTCT = 271 reads: +400 validated
umi CCCTATTTTG = 268 reads: +400 validated
umi CCGGGCGCGT = 1 reads: -400 non-validated
umi CCTATCTTTC = 270 reads: +400 validated
umi CGCTATCTCC = 271 reads: +400 validated
umi CGTGTCCGTA = 62 reads: -337 +6 -2X +7 -1XX +4 -1XX +1 -1XX +2 -3XX +6 -1XX +28 invalidated
umi CTCGTTGCCT = 271 reads: +400 validated
umi CTTCTTTGTG = 259 reads: +400 validated
umi GAGTAGCACC = 106 reads: +400 validated
umi TCCCCCCTAC = 167 reads: +400 validated
umi TCGTGACCCC = 255 reads: +400 validated
umi TCTCCGTCGT = 276 reads: +400 validated
umi TTATAGTCCG = 351 reads: +400 validated
umi TTTTTATGCT = 366 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=572]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=0)
453-501 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
501-572 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 13 umis using 240 reads
cdr3 = CARGIPAAISYYFDYW at 422, score = 9 + 7
umis assigned: [73, 84, 94, 126, 138, 161, 165, 227, 276, 335] and 12 others
of which 22 are surviving nonsolos
reads assigned: 4667
start codons at 80, 231, 236, 289, 294, 297, 315, 383
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 17 umis using 623 reads
cdr3 = CQQYYSTPPTF at 369, score = 9 + 8
umis assigned: [20, 92, 95, 118, 150, 162, 180, 182, 255, 267] and 11 others
of which 20 are surviving nonsolos
reads assigned: 4696
start codons at 30, 99, 352, 472
confident = true
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGGGATACCAGCTGCTATCTCATACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATAGTACTCCTCCGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1412 = GCATGATCATGACATC-1

using 99 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[96]
surviving nonsolo ucounts = 1[96]
ids = [3]

====================================================================================

REJECT CONTIGS

TIG 1[bases=508]
0-348 ==> 5-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=13)
375-425 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
425-508 ==> 0-83 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARPGYSGAWSRRDTFNIW at 337, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 90
start codons at 169, 193, 328, 406, 479
confident = false
VJ delta = 10
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1414 = GCATGATCATGGGACA-1

using 661 reads

====================================================================================

graph has 198 edges initially, 6 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[324, 333]
surviving nonsolo ucounts = 2[324, 333]
ids = [2, 3]

====================================================================================

UMI info for barcode GCATGATCATGGGACA-1 contig 1 = GAAGAGCTGC...
umi CCAACCTCAG = 306 reads: -350X +1 -1XX +2 -15XX +2 -5XX +2 -2XX +1 -1XX invalidated
umi CGTAGGCGCC = 338 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-370 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYDRSWTF at 357, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 634
start codons at 33, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1419 = GCATGATCATTAGGCT-1

using 310 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3^2, 300]
surviving nonsolo ucounts = 1[300]
ids = [1]

====================================================================================

UMI info for barcode GCATGATCATTAGGCT-1 contig 1 = GGGAGGAGTC...
umi CATTACGCGG = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=11)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 296
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1426 = GCATGATGTAAGGGCT-1

using 56127 reads

====================================================================================

graph has 18753 edges initially, 140 edges after simplification

total ucounts = 2206
nonsolo ucounts = 1045[2^351, 3^195, 4^104, 5^75, 6^47, 7^19, 8^15, 9^13, 10^5, 11^10, 12^8, 13^6, 14^3, 16^4, 18, 22, 25, 36^2, 37, 39, 44, 45, 49, 62, 70, 76, 77, 86, 91, 99^2, 119, 123, 125, 129, 130, 132, 134, 136, 143, 146, 148, 149, 152^2, 156, 158, 159, 161, 165, 167, 170, 172, 175, 182, 183, 184, 189, 190, 195, 197^3, 201, 206, 208^2, 211, 212, 217^2, 218, 220, 223^3, 227, 228, 231^3, 235, 236, 237, 239^2, 241, 245, 246^3, 247, 248, 249, 250, 253, 254, 255^2, 256, 257^3, 260^3, 264, 266^2, 267^2, 271^2, 272, 275, 276, 278, 280, 281^2, 282^2, 283, 284, 285^2, 287, 291^2, 294^2, 295^3, 296^2, 297, 302, 303, 305^2, 306, 308, 310, 311, 312, 313, 314^3, 315^2, 316, 317, 318, 319, 321^2, 324, 325, 329, 330^2, 334, 336^2, 337, 338, 339, 340, 348, 351, 353, 358, 371, 374, 383, 388, 389, 411, 414, 415, 443, 445, 447, 448, 454, 455, 462, 468, 493, 503, 574, 579, 586, 611, 616, 642, 656, 657, 676, 681, 752]
surviving nonsolo ucounts = 176[12, 86, 91, 99^2, 119, 123, 125, 129, 130, 132, 134, 136, 146, 148, 149, 152^2, 156, 158, 159, 161, 165, 167, 170, 172, 175, 182, 183, 184, 189, 190, 195, 197^3, 201, 206, 208^2, 211, 212, 217^2, 218, 220, 223^3, 227, 228, 231^3, 235, 236, 237, 239^2, 241, 245, 246^3, 247, 248, 249, 250, 253, 254, 255^2, 256, 257^3, 260^3, 264, 266^2, 267^2, 271^2, 272, 275, 276, 278, 280, 281^2, 282^2, 283, 284, 285^2, 287, 291^2, 294^2, 295^3, 296^2, 297, 302, 303, 305^2, 306, 308, 310, 311, 312, 313, 314^3, 315^2, 316, 317, 318, 319, 321^2, 324, 325, 329, 330^2, 334, 336^2, 337, 338, 339, 340, 348, 351, 353, 358, 371, 374, 383, 388, 389, 411, 414, 415, 443, 445, 447, 448, 454, 455, 462, 468, 493, 503, 574, 579, 586, 611, 616, 642, 656, 657, 676, 681, 752]
ids = [1364, 723, 699, 563, 1001, 1086, 1250, 1780, 995, 2106, ...]

====================================================================================

UMI info for barcode GCATGATGTAAGGGCT-1 contig 1 = TGGGGCTCCA...
umi AAATGCACCA = 229 reads: +388 validated
umi AAATTTCCCT = 248 reads: +43 -1XX +344 invalidated
umi AACCGGGTTT = 261 reads: +388 validated
umi AAGATCATCC = 28 reads: -388 non-validated
umi AAGGGTGCCC = 220 reads: +195 -3XX +1 -3XX +186 invalidated
umi ACGACGGTTC = 299 reads: +388 validated
umi ACGCCTCGGG = 39 reads: -354X +1 -4XX +2 -4XX +2 -4XX +1 -2XX +1 -6XX +1 -4XX +2 invalidated
umi AGTATCTTTC = 262 reads: +388 validated
umi ATCAGTGGGG = 213 reads: +388 validated
umi ATGAGTCGTG = 253 reads: +43 -6XX +1 -6XX +1 -9XX +322 invalidated
umi ATGTCTGTCA = 310 reads: +388 validated
umi ATGTTTTCTG = 30 reads: -388 non-validated
umi ATTACTTGGT = 27 reads: -388 non-validated
umi ATTCGGGACA = 244 reads: +388 validated
umi ATTTCGGGCT = 238 reads: +388 validated
umi CAATCGTCCT = 248 reads: +388 validated
umi CACAAAGGTC = 255 reads: +388 validated
umi CAGGGATCTC = 232 reads: +388 validated
umi CATAGGCCAT = 176 reads: +388 validated
umi CATCTTAGTA = 249 reads: +388 validated
umi CCAATTATAC = 295 reads: +388 validated
umi CCAGTTTGCC = 318 reads: +388 validated
umi CCATAGCGCC = 298 reads: +388 validated
umi CCATCAGTTC = 247 reads: +388 validated
umi CCTAGCCTTG = 298 reads: +388 validated
umi CCTCTACTCT = 262 reads: +388 validated
umi CTGATGGTCG = 243 reads: +388 validated
umi CTGGCTAACC = 311 reads: +388 validated
umi CTGTCGTGTA = 199 reads: +388 validated
umi CTTGTTCATC = 222 reads: +388 validated
umi CTTTACCATA = 24 reads: -388 non-validated
umi GAACTCACTG = 285 reads: +388 validated
umi GACAGGATCG = 119 reads: +388 validated
umi GACTTGTTAG = 240 reads: +388 validated
umi GAGAAGAGTT = 259 reads: +388 validated
umi GAGAGTACTG = 285 reads: +388 validated
umi GAGCCTCTTT = 316 reads: +388 validated
umi GATCAAACTG = 171 reads: +388 validated
umi GATCAGCCCA = 82 reads: -388 non-validated
umi GATGACAGGC = 129 reads: +388 validated
umi GCACGGGACG = 308 reads: +388 validated
umi GCCACGGTCC = 195 reads: +388 validated
umi GCTACAGCCG = 285 reads: +388 validated
umi GCTGGTTGCT = 305 reads: +388 validated
umi GGCAATGCTC = 251 reads: +388 validated
umi GGTGGTCCCT = 37 reads: -388 non-validated
umi GTGCCATTCA = 214 reads: +388 validated
umi GTGCGTTCCC = 381 reads: +338 -1XX +49 invalidated
umi GTGGTTTATT = 255 reads: +388 validated
umi GTGTCTAGCG = 297 reads: +388 validated
umi TAAGGTAGCT = 255 reads: +388 validated
umi TAATATATCC = 202 reads: +388 validated
umi TACCTTTTTC = 265 reads: +388 validated
umi TACTAGGTTC = 273 reads: +388 validated
umi TAGCTCGCCT = 179 reads: +388 validated
umi TATCATGGTC = 278 reads: +388 validated
umi TATCTTCCGA = 257 reads: +388 validated
umi TCAAGGAACA = 214 reads: +388 validated
umi TCCTAAGTCA = 126 reads: +388 validated
umi TCCTCAGGCT = 280 reads: +388 validated
umi TCGTGATCAC = 151 reads: +388 validated
umi TCTTCTTCTG = 149 reads: +388 validated
umi TGACAGTCTG = 305 reads: +388 validated
umi TGATACGGCC = 223 reads: +388 validated
umi TGATTGTTGC = 263 reads: +388 validated
umi TGCGCCATTC = 313 reads: +388 validated
umi TTCGGATGGG = 223 reads: +388 validated
umi TTCTCCGTGG = 213 reads: +388 validated
umi TTGCGCTCAG = 266 reads: +388 validated
umi TTGTAATAGG = 132 reads: +388 validated

UMI info for barcode GCATGATGTAAGGGCT-1 contig 2 = CAGCTCTGGG...
umi AACCCGAGGC = 316 reads: +406 validated
umi AATGTATTCT = 448 reads: -131X +275 invalidated
umi ACAATTTCTT = 411 reads: -172X +234 invalidated
umi AGTGTATTCT = 652 reads: -131X +275 invalidated
umi ATCCCTTGGA = 346 reads: -99X +307 invalidated
umi ATTCTTGCAT = 183 reads: -118 +288 non-validated
umi CAAGTGGCCC = 94 reads: +399 -7 non-validated
umi CACGGGTTCC = 754 reads: -126 +1 -4XX +275 invalidated
umi CCAGAGTCCT = 88 reads: +406 validated
umi CCCCAGTCAC = 85 reads: +367 -23 +16 non-validated
umi CGTCTCGCCT = 678 reads: -132X +274 invalidated
umi GCGTTGTCCG = 181 reads: +406 validated
umi GCTATGGGGG = 126 reads: -129X +277 invalidated
umi GGGCTGCACA = 582 reads: -133 +273 non-validated
umi GGGTGATCAG = 211 reads: +382 -16 +8 non-validated
umi GTGCATCGGT = 266 reads: +406 validated
umi GTTAATTGCT = 475 reads: -123X +283 invalidated
umi TACTATTGGT = 506 reads: -153X +1 -2XX +250 invalidated
umi TAGGGCAGTG = 232 reads: -94X +56 -1X +255 invalidated
umi TAGGGCGGTG = 339 reads: -94X +312 invalidated
umi TCAAAGTGCT = 170 reads: +201 -1XX +204 invalidated
umi TCAGCGTTCT = 613 reads: -139X +267 invalidated
umi TCATGTTCGT = 616 reads: -132X +33 -3XX +1 -9XX +1 -1XX +1 -37XX +1 -14XX +1 -6XX +166 invalidated
umi TCCGGCTCAT = 274 reads: +406 validated
umi TCGTGATCTT = 168 reads: +406 validated
umi TCTCTTCATC = 458 reads: -129 +1 -2X +274 invalidated
umi TCTGTTTCCT = 190 reads: +310 -29 +1 -1 +9 -1 +33 -1 +10 -11 non-validated
umi TGAGGACCTT = 640 reads: -132X +274 invalidated
umi TTCTCCACAC = 294 reads: +59 -1XX +307 -39 invalidated

GOOD CONTIGS

TIG 1[bases=645]
46-398 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
396-434 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
434-645 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 63 umis using 2594 reads
cdr3 = CSAWDSSLNVWVF at 367, score = 7 + 8
umis assigned: [24, 27, 39, 59, 69, 196, 201, 335, 406, 449] and 60 others
of which 70 are surviving nonsolos
reads assigned: 15458
start codons at 46, 185, 375, 392
confident = true

TIG 2[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=21)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 24 umis using 1234 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [37, 115, 139, 347, 412, 507, 563, 603, 699, 723] and 19 others
of which 29 are surviving nonsolos
reads assigned: 10221
start codons at 80, 231, 236, 297, 383, 438, 467
confident = true

REJECT CONTIGS

TIG 1[bases=442]
11-103 ==> 256-348 on rc of segment before IGHJ5 exon 1 [len=348] (mis=0)
153-310 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
308-371 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
371-442 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [12, 183, 223, 763, 1461, 1500]
of which 6 are surviving nonsolos
reads assigned: 2831
start codons at 1, 160, 194, 233, 288, 328
confident = false
did not find CDR3

TIG 2[bases=599]
0-450 ==> 2200-2650 on rc of segment before IGHD1-14 exon 1 [len=2650] (mis=0)
477-528 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=1)
528-599 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [50, 58, 446, 1547, 2045, 2156]
of which 5 are surviving nonsolos
reads assigned: 1692
start codons at 62, 226, 351
confident = false
did not find CDR3

TIG 3[bases=571]
2-81 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
36-396 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=4)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWDLLLHASSTNSSITF at 356, score = 4 + 8
umis assigned: [5, 14, 17, 84, 114, 165, 205, 276, 393, 470] and 52 others
of which 62 are surviving nonsolos
reads assigned: 16774
start codons at 36, 69, 105, 193, 355, 375, 477
confident = false
not full
frameshifted full length transcript of length 571
VJ delta = 30
not full
now this is a cell
paired!

AGCAGTCTGAGAGCTGAGGACACGGCTCTTTATTACTGTGTTAAAGAGGAGGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGACTCCAGCCTGACGACGAGGGTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1427 = GCATGATGTAAGTGGC-1

using 4004 reads

====================================================================================

graph has 2578 edges initially, 50 edges after simplification

total ucounts = 510
nonsolo ucounts = 223[2^75, 3^52, 4^28, 5^20, 6^12, 7^6, 8^8, 9^4, 10^2, 11, 12^2, 15, 78, 89, 123, 139, 192, 202, 309, 335, 356, 358, 364, 370]
surviving nonsolo ucounts = 12[78, 89, 123, 139, 192, 202, 309, 335, 356, 358, 364, 370]
ids = [242, 122, 268, 137, 13, 6, 433, 126, 304, 98, ...]

====================================================================================

UMI info for barcode GCATGATGTAAGTGGC-1 contig 1 = ATTCGGTGAT...
umi ATGCGATTAT = 1 reads: -392 +29 non-validated
umi CTGTGACACA = 65 reads: +5 -1XX +2 -1XX +20 -1XX +6 -1XX +5 -2XX +13 -1XX +7 -1XX +21 -1XX +9 -2X +3 -2XX +127 -1 +189 invalidated
umi GAGGAAGGTT = 81 reads: -68 +2 -1X +2 -1X +1 -3X +5 -1XX +3 -2XX +2 -1XX +2 -1X +2 -2XX +3 -2XX +317 invalidated

UMI info for barcode GCATGATGTAAGTGGC-1 contig 2 = AGAGCTCTGG...
umi AACATTATTA = 187 reads: +388 validated
umi ATACGCATAG = 361 reads: +388 validated
umi ATGGGGTCTT = 332 reads: +388 validated
umi GGACCTACCT = 361 reads: +388 validated
umi TGAGCACTCC = 307 reads: +388 validated
umi TTGGTGTGAA = 367 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=472]
35-388 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=20)
410-456 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
junction support: 2 umis using 24 reads
cdr3 = CAREINTGFDSGIDYW at 377, score = 9 + 7
umis assigned: [122, 242, 268]
of which 3 are surviving nonsolos
reads assigned: 141
start codons at 35, 182, 191, 252, 258, 270, 338
confident = true

TIG 2[bases=568]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=5)
393-432 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 309 reads
cdr3 = CQQYNNWPPEYTF at 365, score = 9 + 8
umis assigned: [13, 98, 126, 304, 433, 486]
of which 6 are surviving nonsolos
reads assigned: 1894
start codons at 44, 113, 245, 474
confident = true

REJECT CONTIGS

TIG 1[bases=529]
0-59 ==> 21-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
0-59 ==> 7087-7146 on rc of segment before IGHVII-30-1 exon 1 [len=7146] (mis=0)
0-59 ==> 7081-7140 on rc of segment before IGHVII-33-1 exon 1 [len=7140] (mis=0)
28-95 ==> 6507-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=2)
59-194 ==> 0-135 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=2)
213-257 ==> 205-249 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=6)
257-358 ==> 250-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=7) [SHIFT!]
410-458 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
458-529 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [6, 7, 137]
of which 3 are surviving nonsolos
reads assigned: 692
start codons at 59, 222, 225, 310, 329
confident = false
frameshifted full length stopped transcript of length 529
did not find CDR3
now this is a cell
paired!

GAGGACACGGCTGTGTATTACTGTGCGAGAGAGATAAATACGGGGTTCGATTCAGGGATTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAATTGGCCTCCGGAGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1437 = GCATGATGTCAAAGAT-1

using 341 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[340]
surviving nonsolo ucounts = 1[340]
ids = [1]

====================================================================================

UMI info for barcode GCATGATGTCAAAGAT-1 contig 1 = GACTGATCAG...
umi CCGTTACGCG = 345 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=573]
0-34 ==> 2-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
34-394 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=2)
400-437 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
437-573 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQALQSPRGLTF at 370, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 34, 67, 103, 191, 353, 373, 479
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1439 = GCATGATGTCACTGGC-1

using 58 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 2[4, 47]
surviving nonsolo ucounts = 1[47]
ids = [8]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1444 = GCATGATGTCCAACTA-1

using 626 reads

====================================================================================

graph has 251 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 9, 235, 377]
surviving nonsolo ucounts = 2[235, 377]
ids = [2, 1]

====================================================================================

UMI info for barcode GCATGATGTCCAACTA-1 contig 1 = GAAGAGCTGC...
umi CCGTGACTCG = 375 reads: +388 validated
umi GAGGATACCG = 236 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 94 reads
cdr3 = CHHYGVSPGWTF at 357, score = 9 + 8
umis assigned: [1, 2]
of which 2 are surviving nonsolos
reads assigned: 604
start codons at 33, 241, 367, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1467 = GCATGATGTGTTGGGA-1

using 572 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 7, 243, 313]
surviving nonsolo ucounts = 2[243, 313]
ids = [9, 2]

====================================================================================

UMI info for barcode GCATGATGTGTTGGGA-1 contig 1 = ATGGCCTGGT...
umi CCCGACTCAT = 313 reads: -154X +240 invalidated
umi GTCTCCCAGG = 244 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=605]
0-356 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
356-394 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
394-605 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 113 reads
cdr3 = CQSYDSSLSGLYVF at 324, score = 7 + 8
umis assigned: [2, 9]
of which 2 are surviving nonsolos
reads assigned: 548
start codons at 0, 154, 157, 208, 307, 334, 358, 526
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1468 = GCATGATGTTAAAGAC-1

using 585 reads

====================================================================================

graph has 222 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 253, 323]
surviving nonsolo ucounts = 2[253, 323]
ids = [7, 2]

====================================================================================

UMI info for barcode GCATGATGTTAAAGAC-1 contig 1 = GAGGAATCAG...
umi GATTGCAAAC = 323 reads: +388 validated
umi TTTTGTATGG = 253 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 93 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 568
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1474 = GCATGATGTTTGACTG-1

using 372 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[9, 359]
surviving nonsolo ucounts = 1[359]
ids = [1]

====================================================================================

UMI info for barcode GCATGATGTTTGACTG-1 contig 1 = GGAATCAGTC...
umi CCTCGTCGGA = 359 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 1-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
26-377 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 26, 32, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1480 = GCATGATTCACTTATC-1

using 340 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 337]
surviving nonsolo ucounts = 1[337]
ids = [2]

====================================================================================

UMI info for barcode GCATGATTCACTTATC-1 contig 1 = GGAGGAACTG...
umi TGTACTTTCC = 343 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=9)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQFNKWPPTF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 336
start codons at 34, 103, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1506 = GCATGATTCGTGACAT-1

using 272 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 267]
surviving nonsolo ucounts = 1[267]
ids = [3]

====================================================================================

UMI info for barcode GCATGATTCGTGACAT-1 contig 1 = AGCATCATCC...
umi TTCCGGCCGT = 268 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=544]
0-61 ==> 0-61 on |80|IGHV1-58|5'UTR| [len=61] (mis=0)
61-414 ==> 0-353 on |81|IGHV1-58|L-REGION+V-REGION| [len=353] (mis=0)
423-473 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
473-544 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CAADAGNDAFDIW at 403, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 61, 121, 264, 337, 358, 422, 425, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1513 = GCATGATTCTGCTTGC-1

using 6898 reads

====================================================================================

graph has 3272 edges initially, 42 edges after simplification

total ucounts = 493
nonsolo ucounts = 205[2^74, 3^45, 4^22, 5^13, 6^10, 7^7, 8^5, 9, 12^2, 13, 14, 16, 28, 78, 103, 172, 208, 215, 217, 221, 229, 236, 248, 250, 255^2, 258^2, 262, 286, 298, 322, 385, 525, 640]
surviving nonsolo ucounts = 23[28, 78, 103, 172, 208, 215, 217, 221, 229, 236, 248, 250, 255^2, 258^2, 262, 286, 298, 322, 385, 525, 640]
ids = [461, 190, 169, 353, 53, 456, 106, 270, 49, 385, ...]

====================================================================================

UMI info for barcode GCATGATTCTGCTTGC-1 contig 1 = ATGGGAAATA...
umi AACCAGTGGC = 263 reads: +439 validated
umi CATTTACTCT = 104 reads: +404 -1 +7 -1 +2 -1 +4 -1 +8 -10 non-validated
umi CCTCGTGTAC = 76 reads: +325 -2X +83 -10 +3 -1 +15 invalidated
umi GATAGTCCAT = 205 reads: +437 -2 non-validated
umi TCACATTCTG = 212 reads: +439 validated
umi TTCTAGCCCC = 28 reads: -14 +218 -1 +2 -1 +15 -2 +1 -1 +1 -18 +134 -31 non-validated

UMI info for barcode GCATGATTCTGCTTGC-1 contig 2 = AGCTTCAGCT...
umi AATATGAGCG = 256 reads: +388 validated
umi ACGGGTTCCG = 209 reads: +388 validated
umi ATCCTACCCA = 217 reads: +388 validated
umi ATGTTGTCAG = 320 reads: +388 validated
umi CATTTCCCGT = 286 reads: +388 validated
umi GCAGCCTTCG = 646 reads: -153 +235 non-validated
umi GGCACAGTCT = 245 reads: +388 validated
umi TAGAGGAAGT = 255 reads: +388 validated
umi TTCCGCTGTT = 215 reads: +388 validated
umi TTCTTGTGGT = 254 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=554]
0-44 ==> 101-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=0)
44-394 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=1)
408-428 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=1)
433-483 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
483-554 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 38 reads
cdr3 = CARVFLDKLGYSYGYRGFAFDIW at 383, score = 9 + 8
umis assigned: [8, 169, 190, 270, 385, 461]
of which 6 are surviving nonsolos
reads assigned: 875
start codons at 0, 44, 88, 420, 464
confident = true

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=1)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 509 reads
cdr3 = CAAWDDSLNGRVF at 368, score = 8 + 8
umis assigned: [25, 53, 106, 125, 172, 275, 309, 367, 456, 464]
of which 10 are surviving nonsolos
reads assigned: 2869
start codons at 47, 351, 376, 381, 393
confident = true

REJECT CONTIGS

TIG 1[bases=557]
0-34 ==> 18-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-20 exon 1 [len=6000] (mis=0)
34-382 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
383-421 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [350]
of which 1 are surviving nonsolos
reads assigned: 517
start codons at 34, 242, 368, 463
confident = false
did not find CDR3

TIG 2[bases=638]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
1-53 ==> 2818-2870 on segment before IGLV3-13 exon 1 [len=3075] (mis=4)
15-90 ==> 11269-11344 on segment before IGLV3-6 exon 1 [len=11502] (mis=3)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
427-638 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [41, 49, 214, 256, 353, 431]
of which 6 are surviving nonsolos
reads assigned: 1572
start codons at 43, 104, 173, 191, 386
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGTTTTCTTGGATAAACTTGGATACAGCTATGGTTACCGAGGCTTTGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1531 = GCATGCGAGATGAGAG-1

using 368 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[363]
surviving nonsolo ucounts = 1[363]
ids = [2]

====================================================================================

UMI info for barcode GCATGCGAGATGAGAG-1 contig 1 = CAGTCCCAAC...
umi CAGAAATATT = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-21 ==> 10-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
409-493 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYDNLPLTF at 348, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 21, 27, 83, 96, 235, 358, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1534 = GCATGCGAGCACCGTC-1

using 219 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[219]
surviving nonsolo ucounts = 1[219]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGAGCACCGTC-1 contig 1 = GGGCCTCAGG...
umi TGTACCTATA = 221 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=622]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-369 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
373-411 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
411-622 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQAWDSTEVVF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 35, 40, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1541 = GCATGCGAGCTCTCGG-1

using 17677 reads

====================================================================================

graph has 6942 edges initially, 60 edges after simplification

total ucounts = 1233
nonsolo ucounts = 487[2^199, 3^101, 4^54, 5^25, 6^14, 7^8, 8^10, 9^3, 10^5, 11^3, 12^3, 13^2, 14, 17, 20^2, 21, 22, 25, 45, 56, 68, 79, 143, 158, 198^2, 204, 212, 233, 238, 240, 241, 243, 246, 250, 257, 259, 261, 264, 269, 270, 275, 277, 287, 296, 303, 310, 315, 317, 318, 327, 331, 334, 335, 338, 340^2, 348^2, 349, 352, 354, 355, 356, 362, 365, 369, 382, 405, 498, 839]
surviving nonsolo ucounts = 50[56, 143, 158, 198^2, 204, 212, 233, 238, 240, 241, 243, 246, 250, 257, 259, 261, 264, 269, 270, 275, 277, 287, 296, 303, 310, 315, 317, 318, 327, 331, 334, 335, 338, 340^2, 348^2, 349, 352, 354, 355, 356, 362, 365, 369, 382, 405, 498, 839]
ids = [333, 697, 85, 168, 321, 1207, 1164, 1120, 220, 319, ...]

====================================================================================

UMI info for barcode GCATGCGAGCTCTCGG-1 contig 1 = ATACTTTCTG...
umi ATAAGAGCCG = 175 reads: +424 validated
umi ATCTTCGTAG = 307 reads: +424 validated
umi CAATGTACTT = 44 reads: +321 -1 +63 -13 +6 -1 +19 non-validated
umi CCCAAAGTCC = 361 reads: +424 validated
umi CGAGGTGGGT = 501 reads: -120X +304 invalidated
umi GCAAGTCCAC = 278 reads: +424 validated
umi TATGCGTATC = 337 reads: +424 validated
umi TATTCGGCCT = 341 reads: +424 validated
umi TGCTCGGTCC = 242 reads: +424 validated
umi TTAACCACGC = 260 reads: +424 validated
umi TTTGTTGTGC = 660 reads: -390X +1 -1XX +1 -20XX +2 -1XX +1 -6XX +1 invalidated

UMI info for barcode GCATGCGAGCTCTCGG-1 contig 2 = TGGGGAGGAG...
umi AATACGTGAG = 317 reads: +388 validated
umi AATTTAGGAC = 157 reads: +388 validated
umi ACAACAGGCA = 334 reads: +388 validated
umi ACCACACCCT = 253 reads: +388 validated
umi ACCTGCGCCA = 282 reads: +388 validated
umi ACTACTAATA = 356 reads: +388 validated
umi ACTATGTGGT = 240 reads: +388 validated
umi ACTTCGTGTC = 195 reads: +388 validated
umi AGTTAACTGG = 332 reads: +388 validated
umi ATAGATGGTC = 254 reads: +388 validated
umi ATCGCTGAGT = 386 reads: +388 validated
umi CAACATTCGA = 241 reads: +388 validated
umi CAACGTTGCA = 196 reads: +388 validated
umi CAATTCGCAC = 417 reads: +388 validated
umi CCAATGGCTT = 255 reads: +388 validated
umi CCCAGTTTCA = 337 reads: +388 validated
umi CCGCATATTC = 297 reads: +388 validated
umi CCGCTGCTTG = 276 reads: +388 validated
umi CCTGAACTCA = 346 reads: +388 validated
umi CGCGGGTTCG = 321 reads: +388 validated
umi CTGGCTGGGT = 353 reads: +388 validated
umi CTTATCATTA = 241 reads: +388 validated
umi CTTCAATTCC = 244 reads: +388 validated
umi GAATGGCCAC = 350 reads: +388 validated
umi GATCCTGGGT = 143 reads: +2 -1 +385 non-validated
umi GCCTGCGCTT = 304 reads: +388 validated
umi TATAGTCCGG = 250 reads: +388 validated
umi TATCTTAACA = 293 reads: +388 validated
umi TCGCACGGCG = 362 reads: +388 validated
umi TCGCACTTTA = 366 reads: +388 validated
umi TCTCGCATCC = 354 reads: +388 validated
umi TCTGTTCTGT = 274 reads: +388 validated
umi TGCCGTATCG = 261 reads: +388 validated
umi TGTCAGAGCC = 238 reads: +388 validated
umi TTATTCACGA = 213 reads: +388 validated
umi TTCGATTACT = 271 reads: +388 validated
umi TTTAACCCCC = 205 reads: +388 validated
umi TTTCGCTCGA = 350 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=563]
0-37 ==> 64-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=0)
37-393 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=13)
413-461 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
461-563 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 9 umis using 330 reads
cdr3 = CARGIADTAMAPFDYW at 382, score = 9 + 7
umis assigned: [220, 268, 333, 430, 506, 719, 931, 935, 1096, 1144] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3463
start codons at 37, 81, 409, 479, 540
confident = true

TIG 2[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=5)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 38 umis using 1750 reads
cdr3 = CQQSYSTGVTF at 359, score = 9 + 8
umis assigned: [66, 85, 88, 111, 129, 154, 155, 168, 212, 232] and 28 others
of which 38 are surviving nonsolos
reads assigned: 10691
start codons at 32, 38, 94, 107, 243, 462
confident = true
now this is a cell
paired!

GCAGACACGGCCGTGTATTACTGTGCGAGAGGGATAGCGGATACAGCTATGGCACCCTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCGGAGTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1542 = GCATGCGAGCTTATCG-1

using 272 reads

====================================================================================

graph has 150 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[10, 258]
surviving nonsolo ucounts = 1[258]
ids = [4]

====================================================================================

UMI info for barcode GCATGCGAGCTTATCG-1 contig 1 = ACCCAAAAAC...
umi GGAAAACAGT = 1 reads: -267 +1 -3X +2 -1X +6 -1 +2 -2X +1 -1 +1 -4 +3 -5 +1 -1 +1 -2 +3 -6X +3 -1 +3 -115 invalidated
umi GTGAAAACAG = 242 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=564]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-564 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2, 4]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 54, 252, 257, 274, 318, 351, 544
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1543 = GCATGCGAGGACAGAA-1

using 286 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 277]
surviving nonsolo ucounts = 1[277]
ids = [6]

====================================================================================

UMI info for barcode GCATGCGAGGACAGAA-1 contig 1 = ACTTTCTGAG...
umi TCGCATCGTA = 278 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=641]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=1)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=9)
411-459 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
459-641 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 38 reads
cdr3 = CARGAGITTRAYYFDYW at 377, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 14, 35, 79
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1546 = GCATGCGAGGCCGAAT-1

using 690 reads

====================================================================================

graph has 192 edges initially, 12 edges after simplification

total ucounts = 5
nonsolo ucounts = 5[3, 4, 6, 332, 345]
surviving nonsolo ucounts = 2[332, 345]
ids = [1, 3]

====================================================================================

UMI info for barcode GCATGCGAGGCCGAAT-1 contig 1 = GGGAGTCTCA...
umi CTATATGGGT = 331 reads: +384 -1XX invalidated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=2)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 0 umis using 0 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 23, 29, 85, 98, 234, 450
confident = false

REJECT CONTIGS

TIG 1[bases=547]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-381 ==> 0-351 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
388-411 ==> 16-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 30, 99, 352, 379, 453
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1553 = GCATGCGAGTATGACA-1

using 275 reads

====================================================================================

graph has 133 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 5, 25, 240]
surviving nonsolo ucounts = 1[240]
ids = [4]

====================================================================================

UMI info for barcode GCATGCGAGTATGACA-1 contig 1 = GAGAGAGGAG...
umi TACTTAATCC = 227 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=564]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-564 ==> 0-67 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1557 = GCATGCGAGTCTCAAC-1

using 414 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 408]
surviving nonsolo ucounts = 1[408]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGAGTCTCAAC-1 contig 1 = GATCAGGACT...
umi CTGCAACATG = 386 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=501]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=3)
389-427 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
427-501 ==> 0-74 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CMQALQTPVTF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 376
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1558 = GCATGCGAGTGATCGG-1

using 324 reads

====================================================================================

graph has 538 edges initially, 2 edges after simplification

total ucounts = 187
nonsolo ucounts = 44[2^21, 3^8, 4^2, 5, 6^3, 7^2, 8^3, 9, 11, 12, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1559 = GCATGCGAGTGTCCAT-1

using 265 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGAGTGTCCAT-1 contig 1 = GGGGAGTCAG...
umi GGACGGCTTG = 262 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
34-282 ==> 0-248 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=34)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLHYDNRRRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 34, 90, 103, 242, 365, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1561 = GCATGCGCAAACTGTC-1

using 432 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 427]
surviving nonsolo ucounts = 1[427]
ids = [1]

====================================================================================

UMI info for barcode GCATGCGCAAACTGTC-1 contig 1 = GTCAGTCTCA...
umi GCACATGCCC = 432 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=4)
372-411 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 82 reads
cdr3 = CQQSYSTLDTF at 350, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 424
start codons at 23, 29, 85, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1564 = GCATGCGCAAGCCGCT-1

using 374 reads

====================================================================================

graph has 190 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2, 5, 360]
surviving nonsolo ucounts = 1[360]
ids = [8]

====================================================================================

UMI info for barcode GCATGCGCAAGCCGCT-1 contig 1 = CTGCTTCAGC...
umi TTTCTTTGGA = 359 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=650]
0-48 ==> 3-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
48-404 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=10)
401-439 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
439-650 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 55 reads
cdr3 = CQSYDINLIGVIF at 372, score = 7 + 9
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 355
start codons at 48, 111, 202, 205, 256, 355, 382
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1582 = GCATGCGCAGACGTAG-1

using 190 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 183]
surviving nonsolo ucounts = 1[183]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGCAGACGTAG-1 contig 1 = AGCTTCAGCT...
umi ACGGGATCGG = 180 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=549]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
438-549 ==> 0-111 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CAAWDDSLNGFWVF at 368, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 47, 351, 376, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1583 = GCATGCGCAGATAATG-1

using 285 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[285]
surviving nonsolo ucounts = 1[285]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGCAGATAATG-1 contig 1 = GGAGGAACTG...
umi CGTCCACACC = 287 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=552]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 38 reads
cdr3 = CLQYSDWPRTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 283
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1585 = GCATGCGCAGCATGAG-1

using 341 reads

====================================================================================

graph has 182 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[335]
surviving nonsolo ucounts = 1[335]
ids = [6]

====================================================================================

UMI info for barcode GCATGCGCAGCATGAG-1 contig 1 = GGGGTCACAA...
umi TTCCACTACA = 294 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=577]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=23)
395-423 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
423-577 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 63 reads
cdr3 = CFSYGSSGRTF at 362, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 286
start codons at 38, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1586 = GCATGCGCAGCCTATA-1

using 351 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[348]
surviving nonsolo ucounts = 1[348]
ids = [1]

====================================================================================

UMI info for barcode GCATGCGCAGCCTATA-1 contig 1 = GAGTCAGACT...
umi CCCATTATCC = 347 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 343
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1588 = GCATGCGCAGCTGTGC-1

using 515 reads

====================================================================================

graph has 216 edges initially, 4 edges after simplification

total ucounts = 18
nonsolo ucounts = 12[2, 3^2, 4^2, 6^2, 7, 11, 16, 23, 424]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1597 = GCATGCGCATCCTTGC-1

using 9663 reads

====================================================================================

graph has 3717 edges initially, 108 edges after simplification

total ucounts = 503
nonsolo ucounts = 201[2^82, 3^40, 4^16, 5^9, 6^10, 7^6, 8^2, 9^2, 11^2, 13, 30, 65, 74, 115, 152, 181, 219, 229, 234, 254, 266, 273, 280, 285, 287, 292, 308^2, 316, 319, 322, 331, 338, 346, 347, 350, 375, 389, 396, 400, 716]
surviving nonsolo ucounts = 28[74, 152, 181, 219, 229, 234, 254, 266, 273, 280, 285, 287, 292, 308^2, 316, 319, 322, 331, 338, 346, 347, 350, 375, 389, 396, 400, 716]
ids = [393, 163, 90, 477, 333, 495, 442, 122, 240, 436, ...]

====================================================================================

UMI info for barcode GCATGCGCATCCTTGC-1 contig 1 = AGGAGTCAGA...
umi AATAAATCCG = 384 reads: +388 validated
umi ATAGGTCAGT = 183 reads: +388 validated
umi CACTCATGAC = 292 reads: +388 validated
umi CCACACGTCC = 347 reads: +388 validated
umi CCCCGTAGCG = 294 reads: +388 validated
umi CTCACATCTG = 318 reads: +388 validated
umi CTTGTTCCTG = 276 reads: +388 validated
umi GTCTAAGGGT = 231 reads: +388 validated
umi TCGTAAAGGG = 287 reads: +388 validated
umi TGACTTCTAC = 351 reads: +388 validated
umi TGCCCGGGGC = 404 reads: +388 validated

UMI info for barcode GCATGCGCATCCTTGC-1 contig 2 = AGCTCTCAGA...
umi CCCACTCTTC = 152 reads: +391 -40 +14 non-validated
umi GAGTTATGGC = 512 reads: -417X +1 -2XX +1 -2XX +1 -11XX +1 -3XX +1 -1XX +1 -2XX +1 invalidated
umi TCCCGCTCGT = 63 reads: -445 non-validated
umi TTTGCAGTTT = 241 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=3)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 11 umis using 558 reads
cdr3 = CQQANNFPPTF at 354, score = 9 + 8
umis assigned: [19, 90, 135, 159, 165, 216, 240, 333, 405, 429] and 1 others
of which 11 are surviving nonsolos
reads assigned: 3311
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=595]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=14)
461-524 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=3)
524-595 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 17 reads
cdr3 = CARSGVVRGVGQGSLYYYYYMDVW at 421, score = 9 + 7
umis assigned: [163, 260, 393, 495]
of which 4 are surviving nonsolos
reads assigned: 947
start codons at 79, 235, 356, 382, 481
confident = true

REJECT CONTIGS

TIG 1[bases=558]
10-80 ==> 5667-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
32-383 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=4)
383-422 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
422-558 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [3, 20, 26, 122, 177, 258, 282, 285, 436, 442] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3671
start codons at 32, 38, 107, 189, 243, 464
confident = false
did not find CDR3
now this is a cell
paired!

GCGAGAAGTGGAGTGGTTCGGGGAGTTGGGCAGGGGTCTTTGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAATTTCCCTCCCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1606 = GCATGCGGTACAAGTA-1

using 374 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 5, 358]
surviving nonsolo ucounts = 1[358]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGGTACAAGTA-1 contig 1 = GAAGAGCTGC...
umi AAGCACCCAG = 368 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 52 reads
cdr3 = CQQYGSSRMYTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 356
start codons at 33, 241, 367, 381, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1607 = GCATGCGGTAGGACAC-1

using 232 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 228]
surviving nonsolo ucounts = 1[228]
ids = [3]

====================================================================================

UMI info for barcode GCATGCGGTAGGACAC-1 contig 1 = ACCCAAAAAC...
umi CCCTAGTCAT = 217 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=500]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1609 = GCATGCGGTCAAAGAT-1

using 300 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGGTCAAAGAT-1 contig 1 = GAGGAATCAG...
umi GTCCTCGTGC = 285 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
378-416 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
416-506 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQHKSYPFTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 282
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1611 = GCATGCGGTCATATCG-1

using 152 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[151]
surviving nonsolo ucounts = 1[151]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGGTCATATCG-1 contig 1 = GAGATCACAG...
umi ATATTTCGAC = 137 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=545]
19-372 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
421-455 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
455-545 ==> 0-90 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 361, score = 7 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 136
start codons at 19, 217, 222, 239, 283, 316, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1625 = GCATGCGGTGGTTTCA-1

using 198 reads

====================================================================================

graph has 74 edges initially, 6 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[9, 184]
surviving nonsolo ucounts = 2[9, 184]
ids = [1, 0]

====================================================================================

UMI info for barcode GCATGCGGTGGTTTCA-1 contig 1 = CCCAGTCAGG...
umi AATTTCTTGC = 171 reads: +388 validated
umi ACATTCTCTA = 4 reads: -26 +25 -1XX +11 -1XX +11 -1XX +8 -136 +3 -1X +3 -1X +1 -3X +1 -1X +2 -1X +9 -1X +7 -1X +20 -113X invalidated

GOOD CONTIGS

TIG 1[bases=464]
17-349 ==> 0-332 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=24)
367-405 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
405-464 ==> 0-59 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQHLVTHPISF at 344, score = 9 + 7
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 175
start codons at 17, 23, 228, 231, 447
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1628 = GCATGCGGTTCAGGCC-1

using 267 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[267]
surviving nonsolo ucounts = 1[267]
ids = [0]

====================================================================================

UMI info for barcode GCATGCGGTTCAGGCC-1 contig 1 = GGCTGGGGTC...
umi ATATTGTTTG = 263 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=531]
42-386 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
392-430 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
430-531 ==> 0-101 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYISSTTLGF at 366, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 261
start codons at 42, 250, 253
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1635 = GCATGCGGTTGGTGGA-1

using 433 reads

====================================================================================

graph has 96 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 186, 243]
surviving nonsolo ucounts = 2[186, 243]
ids = [1, 0]

====================================================================================

UMI info for barcode GCATGCGGTTGGTGGA-1 contig 1 = GAATCAGTCC...
umi AATTTAACGG = 241 reads: +388 validated

UMI info for barcode GCATGCGGTTGGTGGA-1 contig 2 = AGAGTTCTGG...
umi CTTTAGGGTT = 183 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 240
start codons at 25, 31, 100, 236, 455
confident = false

TIG 2[bases=543]
0-22 ==> 18-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
22-359 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=13)
366-404 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
404-543 ==> 0-139 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 42 reads
cdr3 = CNSRDSAGYHWVF at 337, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 182
start codons at 22, 141, 170, 320
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1641 = GCATGCGTCAACGCTA-1

using 476 reads

====================================================================================

graph has 152 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[12, 462]
surviving nonsolo ucounts = 1[462]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=397]
2-224 ==> 129-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=0)
222-261 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
261-397 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQANSFPHTF at 200, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 452
start codons at 84, 303
confident = false
not full
VJ delta = 15
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1648 = GCATGCGTCACGCGGT-1

using 238 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 230]
surviving nonsolo ucounts = 1[230]
ids = [2]

====================================================================================

UMI info for barcode GCATGCGTCACGCGGT-1 contig 1 = GGTAGCTCAG...
umi AGACAGTTTA = 198 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=455]
0-36 ==> 50-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
36-389 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=26)
389-427 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
427-455 ==> 0-28 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQSYDTSNPVVF at 363, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 36, 190, 241, 373
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1650 = GCATGCGTCAGCGATT-1

using 51 reads

====================================================================================

graph has 42 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3^2, 7, 33]
surviving nonsolo ucounts = 1[33]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1655 = GCATGCGTCCCGGATG-1

using 166 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 159]
surviving nonsolo ucounts = 1[159]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1658 = GCATGCGTCCCTTGCA-1

using 10 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1664 = GCATGCGTCGCAGGCT-1

using 10 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1666 = GCATGCGTCGCCTGTT-1

using 69 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[64]
surviving nonsolo ucounts = 1[64]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1676 = GCATGCGTCTGGGCCA-1

using 348 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[6, 148, 188]
surviving nonsolo ucounts = 2[148, 188]
ids = [1, 3]

====================================================================================

UMI info for barcode GCATGCGTCTGGGCCA-1 contig 1 = GAAGAGCTGC...
umi ATGCCGAGCT = 146 reads: +385 validated
umi CCCGTGGGAG = 188 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=604]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-342 ==> 0-309 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=28)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
junction support: 2 umis using 69 reads
cdr3 = CQQYSNSPWTF at 357, score = 9 + 8
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 328
start codons at 33, 82, 394, 432, 476, 517
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1680 = GCATGTAAGAACAACT-1

using 255 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[251]
surviving nonsolo ucounts = 1[251]
ids = [1]

====================================================================================

UMI info for barcode GCATGTAAGAACAACT-1 contig 1 = GCTCTGCTTC...
umi GCGCTCTCAT = 243 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=579]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=21)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
442-579 ==> 0-137 on |307|IGLC3|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 35 reads
cdr3 = CQCYDNSLTGWGF at 375, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 51, 205, 358, 385, 521
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1686 = GCATGTAAGATGTCGG-1

using 167 reads

====================================================================================

graph has 94 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2, 4, 9, 10, 12, 125]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1691 = GCATGTAAGCGCCTCA-1

using 631 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[628]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=355]
1-179 ==> 5551-5729 on rc of segment before IGKV3-7 exon 2 [len=11729] (mis=2)
180-219 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
219-355 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [0]
of which 0 are surviving nonsolos
reads assigned: 619
start codons at 161, 261
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1692 = GCATGTAAGCGCTTAT-1

using 313 reads

====================================================================================

graph has 167 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 307]
surviving nonsolo ucounts = 1[307]
ids = [0]

====================================================================================

UMI info for barcode GCATGTAAGCGCTTAT-1 contig 1 = GAGTCAGTCT...
umi CCAGCATCAG = 311 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 22-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
25-376 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
375-413 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQSYRRPITF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 25, 31, 87, 100, 236, 335, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1697 = GCATGTAAGCGTTGCC-1

using 253 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[250]
surviving nonsolo ucounts = 1[250]
ids = [2]

====================================================================================

UMI info for barcode GCATGTAAGCGTTGCC-1 contig 1 = GGGAATCAGT...
umi CAATCCCCGC = 256 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1698 = GCATGTAAGGAATTAC-1

using 270 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[265]
surviving nonsolo ucounts = 1[265]
ids = [4]

====================================================================================

UMI info for barcode GCATGTAAGGAATTAC-1 contig 1 = TGAGCGCAGA...
umi TAAGATGCGT = 249 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=552]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=7)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
424-552 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CATWDSSLSAVVF at 357, score = 6 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 36, 190, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1700 = GCATGTAAGGAGTAGA-1

using 519 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[516]
surviving nonsolo ucounts = 1[516]
ids = [1]

====================================================================================

UMI info for barcode GCATGTAAGGAGTAGA-1 contig 1 = GTCAGTCTCA...
umi CCGTCCAATA = 518 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 24-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
23-334 ==> 0-311 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=27)
389-411 ==> 15-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 74 reads
cdr3 = CQQTYITPYTF at 350, score = 9 + 6
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 511
start codons at 23, 29, 85, 98, 234, 237, 252, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1701 = GCATGTAAGGATGGAA-1

using 238 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [1]

====================================================================================

UMI info for barcode GCATGTAAGGATGGAA-1 contig 1 = TGGGGGAGGA...
umi TATGTGCTTC = 223 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=504]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=0)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
421-504 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CLQHNSYPRTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 221
start codons at 33, 39, 108, 190, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1705 = GCATGTAAGGCCGAAT-1

using 457 reads

====================================================================================

graph has 176 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[2^2, 446]
surviving nonsolo ucounts = 1[446]
ids = [7]

====================================================================================

UMI info for barcode GCATGTAAGGCCGAAT-1 contig 1 = GAATCAGTCC...
umi GCAATCTAAC = 446 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 77 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 438
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1711 = GCATGTAAGGTGCAAC-1

using 260 reads

====================================================================================

graph has 408 edges initially, 2 edges after simplification

total ucounts = 146
nonsolo ucounts = 48[2^20, 3^12, 4^8, 5^4, 6, 7, 10, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1724 = GCATGTACAATAACGA-1

using 927 reads

====================================================================================

graph has 302 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[235, 689]
surviving nonsolo ucounts = 2[235, 689]
ids = [4, 2]

====================================================================================

UMI info for barcode GCATGTACAATAACGA-1 contig 1 = AGCTCTGAGA...
umi TTCATTTCGC = 230 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=642]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-642 ==> 0-139 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1734 = GCATGTACACAGGAGT-1

using 598 reads

====================================================================================

graph has 230 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[3^2, 262, 327]
surviving nonsolo ucounts = 2[262, 327]
ids = [6, 1]

====================================================================================

UMI info for barcode GCATGTACACAGGAGT-1 contig 1 = AGCTTCAGCT...
umi TAATTGGTCT = 249 reads: +388 validated

UMI info for barcode GCATGTACACAGGAGT-1 contig 2 = GGAGAAGAGC...
umi CCAATCGCAG = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-557 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=476]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=1)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=26)
385-424 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
424-476 ==> 0-52 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYGSSPMYTF at 360, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 293
start codons at 36, 85, 244, 343, 384, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1737 = GCATGTACACATGTGT-1

using 597 reads

====================================================================================

graph has 922 edges initially, 2 edges after simplification

total ucounts = 328
nonsolo ucounts = 113[2^49, 3^24, 4^20, 5^6, 6^4, 7^5, 8^3, 9, 10]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1738 = GCATGTACACATTCGA-1

using 281 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[278]
surviving nonsolo ucounts = 1[278]
ids = [1]

====================================================================================

UMI info for barcode GCATGTACACATTCGA-1 contig 1 = ATCCAACAAC...
umi CCCCGACCCT = 267 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=580]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
437-485 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
485-580 ==> 0-95 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 397, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 55, 211, 253, 319, 352, 442, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1744 = GCATGTACACTTCGAA-1

using 221 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 1[213]
surviving nonsolo ucounts = 1[213]
ids = [1]

====================================================================================

UMI info for barcode GCATGTACACTTCGAA-1 contig 1 = ACAAGAGGCA...
umi AGAAATCGGT = 196 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=571]
0-31 ==> 20-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
31-387 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=9)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
425-571 ==> 0-146 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDTSLSGSNVF at 355, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 31, 185, 188, 239, 338, 365, 389, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1745 = GCATGTACACTTCTGC-1

using 310 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 3, 305]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1749 = GCATGTACATAACCTG-1

using 240 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 231]
surviving nonsolo ucounts = 1[231]
ids = [2]

====================================================================================

UMI info for barcode GCATGTACATAACCTG-1 contig 1 = GAGTGCTTTC...
umi TAACTCTCCC = 227 reads: +463 validated

GOOD CONTIGS

TIG 1[bases=543]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=7)
392-419 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
431-481 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
481-543 ==> 0-62 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CATSSTYYGSGSYYNVPVDAFDIW at 378, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 18, 39, 83, 169, 312, 400, 421, 433, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1751 = GCATGTACATATACGC-1

using 51 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 7[2, 6^3, 7, 8, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1753 = GCATGTACATCCCATC-1

using 556 reads

====================================================================================

graph has 242 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[188, 364]
surviving nonsolo ucounts = 2[188, 364]
ids = [0, 5]

====================================================================================

UMI info for barcode GCATGTACATCCCATC-1 contig 1 = GAAGAGCTGC...
umi TTTCATTTCA = 339 reads: +382 validated

UMI info for barcode GCATGTACATCCCATC-1 contig 2 = GGTGTTTCCA...
umi CACCTTGTAT = 160 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=507]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-369 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
415-507 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQQYRNSITF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 33, 457
confident = false

TIG 2[bases=479]
0-44 ==> 36-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
44-395 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
418-471 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=1)
junction support: 1 umis using 9 reads
cdr3 = CAKQFSEQWLAYWYFDLW at 386, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 44, 195, 200, 258, 261, 279, 347
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1759 = GCATGTAGTACCAGTT-1

using 83 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[81]
surviving nonsolo ucounts = 1[81]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1770 = GCATGTAGTCTTGCGG-1

using 28 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[27]
surviving nonsolo ucounts = 1[27]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1771 = GCATGTAGTGGTAACG-1

using 22 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[22]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1778 = GCATGTAGTTTCCACC-1

using 95 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 91]
surviving nonsolo ucounts = 1[91]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=431]
17-367 ==> 0-350 on |94|IGHV2-26|L-REGION+V-REGION| [len=357] (mis=24)
384-431 ==> 0-47 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
cdr3 = CASAAAPGDWFDPW at 362, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 76
start codons at 17, 173, 240, 332
confident = false
VJ delta = 12
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1780 = GCATGTATCAACCATG-1

using 271 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 263]
surviving nonsolo ucounts = 1[263]
ids = [4]

====================================================================================

UMI info for barcode GCATGTATCAACCATG-1 contig 1 = TGGGGACCCA...
umi GTATACGACC = 249 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=533]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=6)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-533 ==> 0-38 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 245
start codons at 59, 257, 262, 279, 323, 356
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1787 = GCATGTATCAGTTGAC-1

using 215 reads

====================================================================================

graph has 116 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3, 6, 201]
surviving nonsolo ucounts = 1[201]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1788 = GCATGTATCCAAACTG-1

using 62 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 9[3, 5^4, 6, 7, 9, 11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1797 = GCATGTATCCTTTCGG-1

using 337 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 7[2^2, 3^2, 5^2, 312]
surviving nonsolo ucounts = 1[312]
ids = [6]

====================================================================================

UMI info for barcode GCATGTATCCTTTCGG-1 contig 1 = GAATCAGTCC...
umi CGAACGGCGC = 312 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1801 = GCATGTATCGGAAACG-1

using 161 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[161]
surviving nonsolo ucounts = 1[161]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1802 = GCATGTATCGGAGGTA-1

using 243 reads

====================================================================================

graph has 86 edges initially, 8 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 4, 17, 215]
surviving nonsolo ucounts = 2[4, 215]
ids = [0, 4]

====================================================================================

UMI info for barcode GCATGTATCGGAGGTA-1 contig 1 = GAGCATCACC...
umi ATACTAACTA = 2 reads: -103 +32 -1X +7 -1X +1 -1X +1 -3X +2 -3X +1 -1X +1 -213X +2 -1X +1 -1X +1 -4X +1 -2X +18 -1X +21 invalidated
umi CTGATCTGAG = 213 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=592]
0-62 ==> 2-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
62-415 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=5)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
486-592 ==> 0-106 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARSLVSYSSSWIFDYW at 404, score = 8 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 212
start codons at 62, 260, 265, 297, 326, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1812 = GCATGTATCTCTGCTG-1

using 299 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 291]
surviving nonsolo ucounts = 1[291]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=508]
0-63 ==> 5937-6000 on segment before IGKV2D-40 exon 1 [len=6000] (mis=2)
23-69 ==> 3411-3457 on segment before IGKV2OR2-2 exon 1 [len=3837] (mis=2)
30-390 ==> 0-360 on |275|IGKV2D-29|L-REGION+V-REGION| [len=360] (mis=10)
387-425 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
425-508 ==> 0-83 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 272
start codons at 30, 63, 99, 187, 250, 349, 369, 467
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1819 = GCATGTATCTTTAGGG-1

using 181 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 174]
surviving nonsolo ucounts = 1[174]
ids = [1]

====================================================================================

UMI info for barcode GCATGTATCTTTAGGG-1 contig 1 = GGGGGGAGTC...
umi ATTAGGTCCT = 163 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=486]
30-383 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=9)
381-418 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
418-486 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CQQSYTTLLTF at 357, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 161
start codons at 30, 36, 92, 105, 241, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1824 = GCCAAATAGAGGTTAT-1

using 271 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 4, 255]
surviving nonsolo ucounts = 1[255]
ids = [7]

====================================================================================

UMI info for barcode GCCAAATAGAGGTTAT-1 contig 1 = GTCAGTCCCA...
umi GACACCCGGG = 254 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=550]
0-23 ==> 8-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
23-374 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CQQYDNLPPSSF at 350, score = 9 + 7
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 23, 29, 85, 98, 237, 360, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1826 = GCCAAATAGCAAATCA-1

using 372 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[372]
surviving nonsolo ucounts = 1[372]
ids = [0]

====================================================================================

UMI info for barcode GCCAAATAGCAAATCA-1 contig 1 = TGGGGAGGAA...
umi CATTCGAGTT = 378 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-37 ==> 10-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
37-382 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 61 reads
cdr3 = CQQRSNWPLTF at 358, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 369
start codons at 37, 245, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1827 = GCCAAATAGCCAGAAC-1

using 1581 reads

====================================================================================

graph has 2434 edges initially, 10 edges after simplification

total ucounts = 730
nonsolo ucounts = 319[2^116, 3^79, 4^53, 5^28, 6^15, 7^12, 8^4, 9^2, 10^2, 11^4, 14^2, 16, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1830 = GCCAAATAGCGCCTCA-1

using 745 reads

====================================================================================

graph has 256 edges initially, 6 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[132, 265, 347]
surviving nonsolo ucounts = 3[132, 265, 347]
ids = [2, 1, 0]

====================================================================================

UMI info for barcode GCCAAATAGCGCCTCA-1 contig 1 = GAGCTACAAC...
umi CAGTCACACA = 332 reads: -366 +2 -1X +1 -1 +4 -2X +6 -2XX +1 -2XX +7 -1XX +2 -1XX +1 invalidated
umi CCGCGAGCTG = 273 reads: +400 validated
umi CGATGTATCG = 122 reads: -373X +1 -3X +2 -1 +3 -2XX +1 -2XX +7 -1XX +2 -1XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=15)
392-430 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYYTTPVTF at 369, score = 9 + 8
umis assigned: [0, 1, 2]
of which 3 are surviving nonsolos
reads assigned: 711
start codons at 30, 172, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1835 = GCCAAATAGGAATGGA-1

using 275 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 265]
surviving nonsolo ucounts = 1[265]
ids = [3]

====================================================================================

UMI info for barcode GCCAAATAGGAATGGA-1 contig 1 = ATCACATAAC...
umi ATCTCCGTAT = 256 reads: +421 validated

GOOD CONTIGS

TIG 1[bases=563]
0-58 ==> 0-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=1)
58-336 ==> 0-278 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=22)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
479-563 ==> 0-84 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 23 reads
cdr3 = CARDGGTEARQYSAYW at 400, score = 9 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 251
start codons at 16, 58, 209, 256, 278, 322, 355, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1839 = GCCAAATAGGCACATG-1

using 183 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 10, 162]
surviving nonsolo ucounts = 1[162]
ids = [5]

====================================================================================

UMI info for barcode GCCAAATAGGCACATG-1 contig 1 = GAGGAATCAG...
umi CGACGTTCTG = 149 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=476]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=20)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-476 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1840 = GCCAAATAGGCATTGG-1

using 21 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1841 = GCCAAATAGGCCCTCA-1

using 25806 reads

====================================================================================

graph has 8001 edges initially, 52 edges after simplification

total ucounts = 786
nonsolo ucounts = 373[2^124, 3^71, 4^40, 5^20, 6^9, 7^3, 8^9, 9^2, 10^3, 11, 12^3, 14, 15, 16^2, 18, 20, 21, 25, 34, 37, 40^2, 52, 109, 121, 125, 133, 147^2, 155, 161, 168, 172, 191, 194, 199, 203, 211, 220, 231, 232, 244, 248, 254, 255, 256, 274, 279^2, 280, 281, 287, 288, 289, 294, 295, 299, 307, 308, 313, 317^2, 325, 326, 327^2, 328, 331, 333, 335, 336, 347, 350, 353, 358, 359, 365, 367^2, 370^2, 376^2, 377, 389, 390^2, 399, 402, 404, 426, 439, 457, 483, 668, 735, 764, 950]
surviving nonsolo ucounts = 70[52, 121, 155, 161, 168, 172, 191, 194, 199, 203, 211, 220, 231, 232, 244, 248, 254, 255, 256, 274, 279^2, 280, 281, 287, 288, 289, 294, 295, 299, 307, 308, 313, 317^2, 325, 326, 327^2, 328, 331, 333, 335, 336, 347, 350, 353, 358, 359, 365, 367^2, 370^2, 376^2, 377, 389, 390^2, 399, 402, 404, 426, 457, 483, 668, 735, 764, 950]
ids = [624, 245, 438, 287, 686, 73, 168, 37, 247, 21, ...]

====================================================================================

UMI info for barcode GCCAAATAGGCCCTCA-1 contig 1 = GAAGAGCTGC...
umi AACAGACAAT = 282 reads: +385 validated
umi AACATCCATC = 329 reads: +385 validated
umi AAGCCAACGC = 392 reads: +385 validated
umi AATTTTTTCC = 311 reads: +385 validated
umi ACACGAATAT = 194 reads: +385 validated
umi ACCAGTATTT = 258 reads: +385 validated
umi ACGGTTTTAG = 334 reads: +385 validated
umi ACTCAATTCC = 169 reads: +385 validated
umi ACTCCCTCCG = 742 reads: +385 validated
umi AGATCGAGAG = 319 reads: +385 validated
umi AGGGCGTCGG = 283 reads: +385 validated
umi AGTTCACTAT = 333 reads: +385 validated
umi ATCTACTTAC = 496 reads: +385 validated
umi ATGTTAACTA = 293 reads: +385 validated
umi ATGTTATAAG = 408 reads: +385 validated
umi ATTATAGTAC = 190 reads: +385 validated
umi CACACTCATT = 306 reads: +385 validated
umi CATTAAAAAG = 346 reads: +385 validated
umi CATTAAGTGA = 200 reads: +385 validated
umi CCAAGTTTCT = 188 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +339 invalidated
umi CCCATCTCAC = 332 reads: +385 validated
umi CCCTTATCCT = 309 reads: +385 validated
umi CGCACAGTTC = 294 reads: +385 validated
umi CGCGGTGTTC = 364 reads: +385 validated
umi CGTCTCCTCG = 287 reads: +385 validated
umi CTGCCATTCA = 361 reads: +385 validated
umi GACCAAATCA = 321 reads: +385 validated
umi GACGCAAATA = 226 reads: +385 validated
umi GCAACCAGTT = 212 reads: +385 validated
umi GCAACCATAC = 371 reads: +385 validated
umi GCACCATTAT = 21 reads: -316 +1 -2X +1 -2XX +1 -5XX +1 -5XX +1 -15XX +35 invalidated
umi GCATTTGATT = 329 reads: +385 validated
umi GCTCTCTGTA = 323 reads: +385 validated
umi GGACAGATGG = 319 reads: +385 validated
umi GGCAACTCGT = 362 reads: +385 validated
umi GGGATTAGGA = 280 reads: +385 validated
umi GGTGTTGACA = 221 reads: +385 validated
umi GTCTATGCGA = 421 reads: +385 validated
umi GTGCATTTGC = 377 reads: +385 validated
umi GTGTAGGTCT = 276 reads: +385 validated
umi GTTGCATATG = 329 reads: +385 validated
umi TAAATACCGC = 377 reads: +385 validated
umi TACAACTCTG = 228 reads: -348X +1 -2X +2 -1XX +6 -2XX +15 -1XX +7 invalidated
umi TACGTCTCCA = 335 reads: +385 validated
umi TCAGTAATTA = 356 reads: +385 validated
umi TGGCGTGCGG = 229 reads: +385 validated
umi TTGTATTTTG = 373 reads: +385 validated

UMI info for barcode GCCAAATAGGCCCTCA-1 contig 2 = TGGGGAGGGT...
umi AAGCTCTCTC = 209 reads: +301 -1XX +119 invalidated
umi ACTGGCTTCA = 317 reads: +421 validated
umi ATTCCACGCT = 262 reads: +421 validated
umi CATGTTCTCT = 99 reads: +421 validated
umi CCACACTCGA = 383 reads: +421 validated
umi CCCCCCCGAT = 164 reads: +421 validated
umi CCGACCTTCA = 691 reads: +17 -2XX +1 -1XX +2 -3XX +5 -3XX +1 -2XX +1 -2XX +1 -88XX +1 -1XX +2 -3XX +1 -2XX +1 -4XX +1 -1XX +2 -3XX +270 invalidated
umi CGCCGAGCCT = 226 reads: +421 validated
umi GCTCGATTTG = 405 reads: +421 validated
umi GTAGCGCTAT = 296 reads: +421 validated
umi TAATCATGCT = 208 reads: +421 validated
umi TACATTGCCG = 398 reads: +421 validated
umi TCGTACACTG = 403 reads: +421 validated
umi TCGTTTTTGA = 253 reads: +421 validated
umi TCTTTTCATA = 289 reads: +421 validated
umi TTTTTGCAAT = 388 reads: +421 validated

UMI info for barcode GCCAAATAGGCCCTCA-1 contig 3 = GAGAGAGGAG...
umi ATTCCATACG = 757 reads: -235X +1 -1X +1 -2X +199 invalidated
umi CACCAACCTC = 320 reads: +439 validated
umi CTTTAGTCCC = 325 reads: +439 validated
umi GAATACCCGT = 144 reads: +439 validated
umi GTACGGTACT = 356 reads: +439 validated
umi TCACAGTTAC = 52 reads: +360 -1X +24 -25 +9 -1 +4 -1 +14 invalidated
umi TCCAGCCGGG = 946 reads: -194X +1 -1X +243 invalidated
umi TGAAATGGTC = 174 reads: +394 -1 +44 non-validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=0)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 44 umis using 2154 reads
cdr3 = CQQYGSSPQTF at 357, score = 9 + 8
umis assigned: [7, 8, 17, 35, 37, 47, 69, 73, 74, 93] and 37 others
of which 46 are surviving nonsolos
reads assigned: 14407
start codons at 33, 241, 367, 460
confident = true

TIG 2[bases=555]
63-411 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=5)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 15 umis using 467 reads
cdr3 = CARARYDILTSFDYW at 408, score = 9 + 7
umis assigned: [21, 83, 172, 245, 260, 287, 302, 343, 497, 529] and 6 others
of which 16 are surviving nonsolos
reads assigned: 4891
start codons at 19, 63, 107
confident = true

TIG 3[bases=614]
0-73 ==> 6-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=1)
427-447 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=3)
455-512 ==> 6-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
512-614 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 7 umis using 406 reads
cdr3 = CAKDRVTAMVTIPDYYYGMDVW at 415, score = 9 + 7
umis assigned: [173, 209, 431, 438, 528, 624, 639, 686]
of which 8 are surviving nonsolos
reads assigned: 3019
start codons at 73, 224, 229, 376, 439, 469, 530, 591
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1848 = GCCAAATAGTGCGATG-1

using 137 reads

====================================================================================

graph has 54 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[135]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1850 = GCCAAATAGTGTACGG-1

using 305 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[305]
surviving nonsolo ucounts = 1[305]
ids = [0]

====================================================================================

UMI info for barcode GCCAAATAGTGTACGG-1 contig 1 = GGCTTTCTGA...
umi TGAATCGGGG = 295 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=535]
36-173 ==> 0-137 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=25)
173-299 ==> 140-266 on |197|IGHV4/OR15-8|L-REGION+V-REGION| [len=353] (mis=30)
420-466 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=12)
466-535 ==> 0-69 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARGPLVRGILGKGYYLDLW at 375, score = 8 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 36, 80, 345
confident = false
see deletion of 3 bases at pos 137 on |197|IGHV4/OR15-8|L-REGION+V-REGION|
>vscore_66.1850_77.1%
ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGCGTCCTGTCGCAGGGACAGCTGCGAGAGTGGGGCGGAGGCCTGTTGGAGACCTCGCAGACGCTGTCACTCACCTGTTCTGTTTACGGTCGAGTCTTCGCTGGCTCCTTCTGGACTTGGATCCGCCAATCCCCAGGCAAGGGGCCGGAGTGGATTGGAGAAATTGCTCAGGGTGGAAGACCCAACTACAACCCGGCCCTCCAGAGTCGCGTCACCATTTCAACTGACACGTCGCAGATCCAGTTCTCCCTGACTGTGAGGTCTATGACCGCCGCGGACTCGGCTACATATTACTGTGCCAGGGG
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1851 = GCCAAATCAACAACCT-1

using 275 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[3, 4^2, 5, 7^2, 13, 228]
surviving nonsolo ucounts = 1[228]
ids = [6]

====================================================================================

UMI info for barcode GCCAAATCAACAACCT-1 contig 1 = ATACTTTCTG...
umi TATACTATCG = 230 reads: +442 validated

GOOD CONTIGS

TIG 1[bases=612]
0-37 ==> 108-145 on |193|IGHV4-59|5'UTR| [len=145] (mis=1)
37-387 ==> 0-350 on |194|IGHV4-59|L-REGION+V-REGION| [len=350] (mis=30)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=9)
479-612 ==> 0-133 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 30 reads
cdr3 = CARDRGGYYDPLTGFSQRTGFDSW at 376, score = 8 + 5
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 37, 81, 182, 349
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1855 = GCCAAATCAAGCGAGT-1

using 267 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[264]
surviving nonsolo ucounts = 1[264]
ids = [1]

====================================================================================

UMI info for barcode GCCAAATCAAGCGAGT-1 contig 1 = GAAGAGCTGC...
umi ATTTCTCCCT = 233 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=452]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=15)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
418-452 ==> 0-34 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQHYGSPRFTF at 357, score = 10 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 33, 241, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1872 = GCCAAATCAGTAACGG-1

using 52 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^2, 3, 4, 33]
surviving nonsolo ucounts = 1[33]
ids = [3]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1874 = GCCAAATCATAAAGGT-1

using 403 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[4^2, 391]
surviving nonsolo ucounts = 1[391]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1881 = GCCAAATCATCGGGTC-1

using 75 reads

====================================================================================

graph has 84 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 10[2^3, 3^2, 4, 9, 10, 11, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1883 = GCCAAATCATGCCTAA-1

using 421 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[416]
surviving nonsolo ucounts = 1[416]
ids = [0]

====================================================================================

UMI info for barcode GCCAAATCATGCCTAA-1 contig 1 = GGAGAAGAGC...
umi ACCAGACCCC = 415 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=557]
0-36 ==> 16-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
36-384 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=3)
382-421 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYGSSPYTF at 360, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 411
start codons at 36, 244, 370, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1902 = GCCAAATGTCCGTGAC-1

using 131 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [0]

====================================================================================

UMI info for barcode GCCAAATGTCCGTGAC-1 contig 1 = GGGGGTCTCA...
umi TCATTCAACA = 125 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=497]
39-387 ==> 0-348 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
427-497 ==> 0-70 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 19 reads
cdr3 = CSSYTSSSSYVF at 363, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 39, 196, 240, 247, 250, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1904 = GCCAAATGTCGCGGTT-1

using 355 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 350]
surviving nonsolo ucounts = 1[350]
ids = [4]

====================================================================================

UMI info for barcode GCCAAATGTCGCGGTT-1 contig 1 = GAGTGCTTTC...
umi TGTGAACTCG = 352 reads: +412 validated

GOOD CONTIGS

TIG 1[bases=532]
18-389 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
393-430 ==> 9-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
430-532 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CARGRYW at 378, score = 9 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 347
start codons at 18, 39, 83, 169, 448, 509
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1907 = GCCAAATGTGACGCCT-1

using 244 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [3]

====================================================================================

UMI info for barcode GCCAAATGTGACGCCT-1 contig 1 = TATGTGAGGA...
umi GTTAACGCAG = 240 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLQYSSSPWTF at 360, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 1, 33, 39, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1913 = GCCAAATGTTATGTGC-1

using 185 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2, 3^2, 8, 161]
surviving nonsolo ucounts = 1[161]
ids = [3]

====================================================================================

UMI info for barcode GCCAAATGTTATGTGC-1 contig 1 = TGGGGACTCC...
umi AGGTTCCTGG = 159 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=549]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=19)
404-454 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
454-549 ==> 0-95 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 26 reads
cdr3 = CAHQLAIVTGYYENAFDIW at 366, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 21, 65, 244, 247, 250, 336, 406
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1915 = GCCAAATGTTCATGGT-1

using 15 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1916 = GCCAAATGTTCCACTC-1

using 269 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 17
nonsolo ucounts = 5[2^3, 3, 248]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1924 = GCCAAATTCAAGCCTA-1

using 70 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 5[2^3, 3, 53]
surviving nonsolo ucounts = 1[53]
ids = [11]

====================================================================================

UMI info for barcode GCCAAATTCAAGCCTA-1 contig 1 = CATGGACATG...
umi TCACTTAGTA = 47 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=401]
1-354 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=22)
347-386 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
junction support: 1 umis using 7 reads
cdr3 = CQQSYSNPSF at 328, score = 9 + 7
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 45
start codons at 1, 7, 63, 76, 212, 215
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1926 = GCCAAATTCACATGCA-1

using 635 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 260, 366]
surviving nonsolo ucounts = 2[260, 366]
ids = [4, 0]

====================================================================================

UMI info for barcode GCCAAATTCACATGCA-1 contig 1 = GAGTCAGTCC...
umi AACGAGTATG = 367 reads: +391 validated
umi TGTGCGTCGC = 261 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=552]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
25-357 ==> 0-332 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=16)
377-416 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 109 reads
cdr3 = CQNNDNFPLYTF at 352, score = 9 + 7
umis assigned: [0, 4]
of which 2 are surviving nonsolos
reads assigned: 618
start codons at 25, 31, 87, 100, 185, 239, 362, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1930 = GCCAAATTCAGTGCAT-1

using 233 reads

====================================================================================

graph has 212 edges initially, 2 edges after simplification

total ucounts = 45
nonsolo ucounts = 20[2^6, 3^5, 4^3, 5, 8, 9, 11^2, 125]
surviving nonsolo ucounts = 1[125]
ids = [7]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1934 = GCCAAATTCATTGCCC-1

using 30 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[30]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1937 = GCCAAATTCCACTGGG-1

using 679 reads

====================================================================================

graph has 172 edges initially, 18 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 318, 357]
surviving nonsolo ucounts = 2[318, 357]
ids = [0, 4]

====================================================================================

UMI info for barcode GCCAAATTCCACTGGG-1 contig 1 = AGGAGTCAGA...
umi TTATAAGGGT = 355 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=551]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=1)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=22)
387-415 ==> 11-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQQYYSYPRTF at 354, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 27, 33, 89, 102, 238, 457
confident = false

REJECT CONTIGS

TIG 1[bases=490]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
0-23 ==> 5977-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
0-23 ==> 5273-5296 on rc of segment before IGKV1-13 exon 2 [len=5296] (mis=1)
0-23 ==> 786-809 on rc of segment before IGKV2-23 exon 2 [len=809] (mis=1)
0-23 ==> 9987-10010 on rc of segment before IGKV2-40 exon 1 [len=10010] (mis=1)
0-23 ==> 790-813 on segment before IGKV1D-22 exon 1 [len=813] (mis=1)
8-79 ==> 8895-8966 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=6)
8-79 ==> 8904-8975 on rc of segment before IGKV2OR2-10 exon 1 [len=9109] (mis=6)
8-79 ==> 8903-8974 on segment before IGKV1OR2-11 exon 1 [len=9108] (mis=6)
23-76 ==> 0-53 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
76-317 ==> 110-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
317-354 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
354-490 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQQYNSYPLTF at 293, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 23, 29, 177, 180, 273, 396
confident = false
not full
full length transcript of length 490
VJ delta = 70
delta too large
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1938 = GCCAAATTCCAGAAGG-1

using 615 reads

====================================================================================

graph has 202 edges initially, 6 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 256, 349]
surviving nonsolo ucounts = 2[256, 349]
ids = [8, 4]

====================================================================================

UMI info for barcode GCCAAATTCCAGAAGG-1 contig 1 = AGGAGTCAGA...
umi CGCTGGGGGA = 336 reads: -358X +2 -2X +1 -12XX +2 -3XX +1 -1XX +2 -4XX invalidated
umi TATGTTTCTC = 255 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 2-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
27-378 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=28)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CLQDYTYPFSF at 354, score = 9 + 7
umis assigned: [4, 8]
of which 2 are surviving nonsolos
reads assigned: 583
start codons at 27, 33, 89, 102, 184, 187, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1944 = GCCAAATTCCCTAACC-1

using 13 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1946 = GCCAAATTCCTAGGGC-1

using 321 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[5, 6, 308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================

UMI info for barcode GCCAAATTCCTAGGGC-1 contig 1 = GCTCTGCTTC...
umi TCGGAGTACT = 293 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=549]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-549 ==> 0-104 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 291
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1950 = GCCAAATTCGAATGGG-1

using 347 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 342]
surviving nonsolo ucounts = 1[342]
ids = [1]

====================================================================================

UMI info for barcode GCCAAATTCGAATGGG-1 contig 1 = GCTGGCACCA...
umi CCATGTGCGG = 323 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=1)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=20)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
422-551 ==> 0-129 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CLLSFSAARRVF at 358, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 317
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1957 = GCCAAATTCGTATCAG-1

using 285 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[3^2, 5^2, 6, 257]
surviving nonsolo ucounts = 1[257]
ids = [1]

====================================================================================

UMI info for barcode GCCAAATTCGTATCAG-1 contig 1 = GAGTCAGACT...
umi AGGACAAACG = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=484]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
413-484 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQYNSYALSF at 352, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 25, 31, 87, 100, 236, 239, 332, 371, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1974 = GCCTCTAAGAAGAAGC-1

using 149 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[2^2, 3, 4, 136]
surviving nonsolo ucounts = 1[136]
ids = [2]

====================================================================================

UMI info for barcode GCCTCTAAGAAGAAGC-1 contig 1 = GCAGCGCTCT...
umi TACTTCGCCC = 1 reads: -165 +4 -1X +8 -1X +3 -1X +3 -1 +4 -1 +6 -1 +6 -1 +3 -3 +1 -1 +1 -1X +1 -1 +1 -169X invalidated
umi TACTTCGCGG = 129 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=469]
0-25 ==> 137-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
25-365 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=20)
375-413 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
413-469 ==> 0-56 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CCAYAGTTTWVF at 349, score = 8 + 8
umis assigned: [1, 2]
of which 1 are surviving nonsolos
reads assigned: 130
start codons at 25, 164, 359
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.1993 = GCCTCTAAGCCGGTAA-1

using 558 reads

====================================================================================

graph has 562 edges initially, 8 edges after simplification

total ucounts = 105
nonsolo ucounts = 81[2^10, 3^8, 4^13, 5^11, 6^12, 7^4, 8^5, 9^4, 10^3, 11, 12, 14, 15^3, 16^2, 17, 21, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.2029 = GCCTCTAAGTTAGGTA-1

using 403 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2^2, 6, 387]
surviving nonsolo ucounts = 1[387]
ids = [7]

====================================================================================

REJECT CONTIGS

TIG 1[bases=527]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
32-56 ==> 204-228 on segment before IGLV3-31 exon 2 [len=424] (mis=0)
40-80 ==> 0-40 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
89-271 ==> 155-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=6) [SHIFT!]
278-316 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
316-527 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CNSRDSSGNHVVF at 249, score = 8 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 382
start codons at 40, 133, 232, 277
confident = false
not full
frameshifted full length stopped transcript of length 527
VJ delta = 118
delta too large
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 66.2043 = GCCTCTACACCACCAG-1

using 1135 reads

====================================================================================

graph has 1546 edges initially, 10 edges after simplification

total ucounts = 559
nonsolo ucounts = 230[2^105, 3^44, 4^34, 5^19, 6^6, 7^5, 8^8, 9^3, 10, 11^3, 13, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.15
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk066-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk066-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

110.381 seconds used processing barcodes, peak mem = 0.34
