[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.26 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk064-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk064-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk064.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.0 = GAGCAGATCAGGATCT-1

using 9941 reads

====================================================================================

graph has 5424 edges initially, 42 edges after simplification

total ucounts = 1105
nonsolo ucounts = 518[2^199, 3^112, 4^69, 5^44, 6^27, 7^17, 8^4, 9^8, 10^7, 11^4, 12, 15, 18^2, 24, 212, 218, 227, 234, 252, 254, 267, 268, 279, 311, 348, 367, 372^2, 373, 376, 378, 380, 382, 395, 465, 808]
surviving nonsolo ucounts = 22[212, 218, 227, 234, 252, 254, 267, 268, 279, 311, 348, 367, 372^2, 373, 376, 378, 380, 382, 395, 465, 808]
ids = [614, 937, 830, 800, 167, 540, 243, 221, 1088, 312, ...]

====================================================================================

UMI info for barcode GAGCAGATCAGGATCT-1 contig 1 = GAAGAGCTGC...
umi AACTTATAGC = 372 reads: +385 validated
umi AATCGATACC = 370 reads: +385 validated
umi ACATAGGTCG = 462 reads: +385 validated
umi ATCAATGGTC = 374 reads: +385 validated
umi ATCCCACAGC = 270 reads: +385 validated
umi ATTATGTGCT = 269 reads: +385 validated
umi CAGTTTTGCT = 318 reads: +385 validated
umi CATTTCCGCG = 377 reads: +385 validated
umi CTTTACCCTA = 338 reads: -17X +1 -2XX +1 -2XX +3 -5XX +1 -2XX +2 -1XX +1 -5XX +2 -1XX +339 invalidated
umi CTTTACGTGT = 251 reads: +385 validated
umi GAATACGCCT = 378 reads: +385 validated
umi GTTTAGCGTA = 233 reads: +385 validated
umi TACCTCGTTC = 227 reads: +385 validated
umi TACGGTGCAC = 371 reads: +385 validated
umi TACGTCGCCT = 353 reads: +385 validated
umi TCATGGTGCG = 377 reads: +385 validated
umi TGTCGGTGCC = 811 reads: -238X +147 invalidated
umi TTTCAATTTA = 386 reads: +385 validated
umi TTTCAGTTTA = 284 reads: +385 validated

UMI info for barcode GAGCAGATCAGGATCT-1 contig 2 = CTCCTCTGAA...
umi AGCCTCTTCG = 255 reads: +425 -1 +10 non-validated
umi GCAGCGGCTG = 205 reads: +430 -1 +5 non-validated
umi TCGTATCTTA = 194 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 19 umis using 1045 reads
cdr3 = CQQYGSSPYTF at 357, score = 9 + 8
umis assigned: [32, 62, 89, 215, 221, 243, 312, 325, 539, 540] and 9 others
of which 19 are surviving nonsolos
reads assigned: 6718
start codons at 33, 241, 367, 460
confident = true

TIG 2[bases=545]
0-38 ==> 23-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=0)
38-391 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=0)
423-474 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
474-545 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 33 reads
cdr3 = CARDVYCTGGVCYKGFGFDPW at 380, score = 9 + 7
umis assigned: [167, 614, 937]
of which 3 are surviving nonsolos
reads assigned: 647
start codons at 38, 189, 236, 335, 412
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGACGTTTATTGTACTGGTGGTGTATGCTATAAGGGATTCGGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.2 = GAGCAGATCATACGGT-1

using 396 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[5, 387]
surviving nonsolo ucounts = 1[387]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=587]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
0-79 ==> 5921-6000 on rc of segment after IGHV3-48 exon 1 [len=6000] (mis=0)
39-90 ==> 3150-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=9)
47-118 ==> 6506-6577 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
79-418 ==> 0-339 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=0)
433-485 ==> 0-52 on |50|IGHJ2|J-REGION| [len=52] (mis=5)
485-587 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 79, 230, 235, 382, 416, 503, 564
confident = false
full length transcript of length 587
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.3 = GAGCAGATCATCTGTT-1

using 412 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 404]
surviving nonsolo ucounts = 1[404]
ids = [3]

====================================================================================

UMI info for barcode GAGCAGATCATCTGTT-1 contig 1 = AGGAGTCAGA...
umi CTATTAGGTG = 403 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQANSFPYTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.10 = GAGCAGATCCAAGTAC-1

using 339 reads

====================================================================================

graph has 76 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 331]
surviving nonsolo ucounts = 1[331]
ids = [5]

====================================================================================

UMI info for barcode GAGCAGATCCAAGTAC-1 contig 1 = GCTCAGTTAG...
umi TTCTTTCGCT = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=505]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
25-373 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
381-413 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=0)
413-505 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYGSSPGKTF at 349, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 302
start codons at 25, 233, 359, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.19 = GAGCAGATCCTTCAAT-1

using 1053 reads

====================================================================================

graph has 412 edges initially, 6 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 148, 256, 638]
surviving nonsolo ucounts = 3[148, 256, 638]
ids = [6, 0, 7]

====================================================================================

UMI info for barcode GAGCAGATCCTTCAAT-1 contig 1 = GAGGAACTGC...
umi ACCGCTCTGT = 259 reads: +379 validated
umi TAGATGTCCT = 150 reads: +275 -1XX +103 invalidated

UMI info for barcode GAGCAGATCCTTCAAT-1 contig 2 = GATCAGGACT...
umi TAGCGATAAC = 645 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=548]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
33-366 ==> 0-333 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=14)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 68 reads
cdr3 = CQERGGWWTF at 354, score = 9 + 8
umis assigned: [0, 6]
of which 2 are surviving nonsolos
reads assigned: 401
start codons at 33, 241, 454
confident = true

TIG 2[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=8)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 83 reads
cdr3 = CMQALQIPPFTF at 366, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 630
start codons at 30, 63, 99, 181, 187, 349, 369, 472
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.24 = GAGCAGATCGTCACGG-1

using 574 reads

====================================================================================

graph has 186 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[7, 13, 273, 276]
surviving nonsolo ucounts = 2[273, 276]
ids = [3, 7]

====================================================================================

UMI info for barcode GAGCAGATCGTCACGG-1 contig 1 = GGGGAGGAAT...
umi AGCATGTTCG = 271 reads: +388 validated
umi TCTAGTTACG = 273 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 95 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [3, 7]
of which 2 are surviving nonsolos
reads assigned: 537
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.26 = GAGCAGATCGTTGCCT-1

using 561 reads

====================================================================================

graph has 266 edges initially, 22 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[244, 311]
surviving nonsolo ucounts = 2[244, 311]
ids = [5, 4]

====================================================================================

UMI info for barcode GAGCAGATCGTTGCCT-1 contig 1 = AGCTGTGGGC...
umi CCTACCTTCG = 297 reads: +382 validated

UMI info for barcode GAGCAGATCGTTGCCT-1 contig 2 = AGCTTCAGCT...
umi TATAACGATG = 240 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=525]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
422-525 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CNSRDSSGNHRVF at 355, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 294
start codons at 40, 159, 188, 239, 338
confident = false

TIG 2[bases=562]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=2)
400-438 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
438-562 ==> 0-124 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAAWDDSLNGFYVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 47, 351, 376, 381, 393, 402
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.27 = GAGCAGATCGTTTGCC-1

using 8992 reads

====================================================================================

graph has 2587 edges initially, 24 edges after simplification

total ucounts = 279
nonsolo ucounts = 109[2^31, 3^18, 4^14, 5^5, 6^5, 7^3, 8^2, 9, 37, 122, 161, 177, 213, 229, 246, 259, 261, 263, 268, 272, 276, 279, 289, 292, 304, 305, 314, 321, 322, 326, 335, 340^2, 341, 369, 381, 398, 509]
surviving nonsolo ucounts = 29[122, 161, 177, 213, 229, 246, 259, 261, 263, 268, 272, 276, 279, 289, 292, 304, 305, 314, 321, 322, 326, 335, 340^2, 341, 369, 381, 398, 509]
ids = [245, 161, 59, 143, 228, 58, 106, 205, 216, 151, ...]

====================================================================================

UMI info for barcode GAGCAGATCGTTTGCC-1 contig 1 = AGGTGTTTTC...
umi AAGCCCCTTA = 240 reads: +442 validated
umi TCGCGGGTAG = 204 reads: +442 validated

UMI info for barcode GAGCAGATCGTTTGCC-1 contig 2 = AGGAGTCAGA...
umi AAAATAACTC = 326 reads: +385 validated
umi AATCCATCCT = 292 reads: +385 validated
umi AATGACCCAT = 302 reads: +385 validated
umi AATTCGGTAA = 340 reads: +385 validated
umi ACTAGCCGAT = 375 reads: +385 validated
umi ATACCCAGTA = 250 reads: +385 validated
umi ATACTTTCAT = 179 reads: +385 validated
umi ATCGCAGGCA = 379 reads: +385 validated
umi CAAATCATCA = 307 reads: +385 validated
umi CATGATCCCG = 278 reads: +385 validated
umi CCTAAGTCCT = 269 reads: +56 -1XX +1 -1XX +2 -1XX +1 -5XX +4 -20XX +1 -3XX +3 -11XX +275 invalidated
umi CCTCCCTCAA = 319 reads: +385 validated
umi CCTTGTATCG = 326 reads: +385 validated
umi CGACCTTCGA = 325 reads: +385 validated
umi CTTCTGCTCA = 272 reads: +385 validated
umi GATTTCTCTC = 216 reads: +385 validated
umi GCCTTATCCG = 274 reads: +385 validated
umi GTCTCGACTA = 504 reads: +385 validated
umi TACGAGTTCA = 414 reads: +56 -1XX +1 -1XX +2 -1XX +1 -5XX +4 -20XX +1 -3XX +3 -11XX +275 invalidated
umi TAGCAGGGGG = 262 reads: +385 validated
umi TATTTTGGTG = 259 reads: +385 validated
umi TCCGACTTCG = 341 reads: +385 validated
umi TCGTCACAGT = 334 reads: +385 validated
umi TGGTCTGTCG = 118 reads: +357 -1XX +27 invalidated
umi TGTAACGGGA = 350 reads: +56 -1XX +1 -1XX +2 -1XX +1 -5XX +4 -20XX +1 -3XX +3 -11XX +275 invalidated

GOOD CONTIGS

TIG 1[bases=541]
0-42 ==> 35-77 on |149|IGHV3-64|5'UTR| [len=77] (mis=0)
42-398 ==> 0-356 on |150|IGHV3-64|L-REGION+V-REGION| [len=356] (mis=3)
404-435 ==> 0-31 on |14|IGHD2-2|D-REGION| [len=31] (mis=6)
423-484 ==> 0-61 on |58|IGHJ6|J-REGION| [len=61] (mis=5)
484-541 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 35 reads
cdr3 = CARDSERYCSSTSCFNYYMDVW at 387, score = 8 + 7
umis assigned: [13, 228]
of which 2 are surviving nonsolos
reads assigned: 439
start codons at 42, 196, 201, 241, 262, 280, 348, 372, 441, 502
confident = true

TIG 2[bases=548]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
374-412 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=2)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 1215 reads
cdr3 = CQQYNSYLTF at 354, score = 8 + 9
umis assigned: [0, 18, 19, 25, 40, 58, 59, 66, 83, 95] and 15 others
of which 25 are surviving nonsolos
reads assigned: 7474
start codons at 27, 33, 89, 102, 238, 241, 334, 454
confident = true
now this is a cell
paired!

TACTGTGCGAGAGATTCGGAGCGATATTGTAGTAGTACCAGCTGCTTCAACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.29 = GAGCAGATCTATCCTA-1

using 472 reads

====================================================================================

graph has 188 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[214, 256]
surviving nonsolo ucounts = 2[214, 256]
ids = [2, 1]

====================================================================================

UMI info for barcode GAGCAGATCTATCCTA-1 contig 1 = CAGCTGTGGG...
umi GCTATCGGCC = 210 reads: +388 validated

UMI info for barcode GAGCAGATCTATCCTA-1 contig 2 = GTCTCCCTCA...
umi AGCGGCTTCA = 251 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=536]
0-42 ==> 72-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
42-395 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-536 ==> 0-106 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CASWDDSLRGRVF at 363, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 42, 196, 346, 371, 376
confident = false

TIG 2[bases=548]
0-56 ==> 3-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
56-409 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=20)
428-474 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
474-548 ==> 0-74 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARPYNSYWLGFDYW at 398, score = 8 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 56, 230, 528
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.35 = GAGCAGATCTCTTATG-1

using 30 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 25]
surviving nonsolo ucounts = 1[25]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.37 = GAGCAGATCTGTCAAG-1

using 253 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3^2, 6, 239]
surviving nonsolo ucounts = 1[239]
ids = [2]

====================================================================================

UMI info for barcode GAGCAGATCTGTCAAG-1 contig 1 = AGCTTCAGCT...
umi CCGGGACTTA = 239 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=571]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-571 ==> 0-136 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 230
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.38 = GAGCAGATCTGTTTGT-1

using 175 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 6, 164]
surviving nonsolo ucounts = 1[164]
ids = [2]

====================================================================================

UMI info for barcode GAGCAGATCTGTTTGT-1 contig 1 = AGCATGGACA...
umi GGTAGAAGTA = 155 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=411]
3-354 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=9)
354-391 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
391-411 ==> 0-20 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYNSYPLTF at 330, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 149
start codons at 3, 9, 65, 78, 214, 217, 310
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.46 = GAGGTGAAGACGCTTT-1

using 1669 reads

====================================================================================

graph has 2226 edges initially, 68 edges after simplification

total ucounts = 708
nonsolo ucounts = 328[2^140, 3^80, 4^49, 5^21, 6^17, 7^4, 8^11, 9^3, 10^2, 203]
surviving nonsolo ucounts = 1[203]
ids = [204]

====================================================================================

UMI info for barcode GAGGTGAAGACGCTTT-1 contig 1 = GGGGTCACAA...
umi CACCCATAAA = 191 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=554]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
394-432 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
432-554 ==> 0-122 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CCSYAGSSTLGVVF at 362, score = 8 + 8
umis assigned: [204]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 38, 177, 239, 246, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.49 = GAGGTGAAGAGTGAGA-1

using 111 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 107]
surviving nonsolo ucounts = 1[107]
ids = [2]

====================================================================================

UMI info for barcode GAGGTGAAGAGTGAGA-1 contig 1 = GGTGATCAGG...
umi TTACATGCCC = 95 reads: +429 -1 +2 -1 +9 non-validated

GOOD CONTIGS

TIG 1[bases=474]
0-31 ==> 48-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
31-384 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=15)
425-473 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
junction support: 1 umis using 7 reads
cdr3 = CAKHLMSLGYCTGDSCHDYFDYW at 373, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 94
start codons at 31, 182, 187, 334, 388, 422
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.53 = GAGGTGAAGCCAGTTT-1

using 263 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[263]
surviving nonsolo ucounts = 1[263]
ids = [0]

====================================================================================

UMI info for barcode GAGGTGAAGCCAGTTT-1 contig 1 = AGGAATCAGA...
umi CTTATATGGG = 227 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=509]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=0)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-509 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNSYPTYTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 223
start codons at 27, 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.54 = GAGGTGAAGCGCCTTG-1

using 295 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 1[288]
surviving nonsolo ucounts = 1[288]
ids = [1]

====================================================================================

UMI info for barcode GAGGTGAAGCGCCTTG-1 contig 1 = AGCTTCAGCT...
umi AGCTGAATGC = 277 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-550 ==> 0-115 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.59 = GAGGTGAAGGACACCA-1

using 239 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode GAGGTGAAGGACACCA-1 contig 1 = AGTCCCACTC...
umi ATGAGCTGTA = 235 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 7-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
370-408 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CLQYSSSPWTF at 347, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 20, 26, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.66 = GAGGTGAAGTGGCACA-1

using 50 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 7[4, 5, 6, 7^2, 8, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.72 = GAGGTGACAACTTGAC-1

using 82 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 8[2, 3, 6, 7, 8, 9, 10, 35]
surviving nonsolo ucounts = 1[35]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.78 = GAGGTGACAATGAAAC-1

using 240 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[234]
surviving nonsolo ucounts = 1[234]
ids = [5]

====================================================================================

UMI info for barcode GAGGTGACAATGAAAC-1 contig 1 = AAAACCACAC...
umi GAAACTTCCT = 216 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=557]
0-49 ==> 10-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
49-402 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
451-485 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
485-557 ==> 0-72 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 391, score = 7 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 49, 247, 252, 269, 313, 346, 539
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.80 = GAGGTGACAATGTAAG-1

using 23 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[23]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.86 = GAGGTGACACGAAGCA-1

using 264 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode GAGGTGACACGAAGCA-1 contig 1 = GGGGAGGAAC...
umi AGCGTCTCTT = 264 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 61-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
36-381 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=18)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQYNYWPYTF at 357, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 36, 105, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.93 = GAGGTGACACTGTGTA-1

using 374 reads

====================================================================================

graph has 162 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2, 3, 365]
surviving nonsolo ucounts = 1[365]
ids = [5]

====================================================================================

UMI info for barcode GAGGTGACACTGTGTA-1 contig 1 = GATCAGGACT...
umi TGTACCCTGC = 369 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 359
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.100 = GAGGTGACAGCCTTTC-1

using 235 reads

====================================================================================

graph has 102 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2^2, 3, 5, 217]
surviving nonsolo ucounts = 1[217]
ids = [6]

====================================================================================

UMI info for barcode GAGGTGACAGCCTTTC-1 contig 1 = ATCATCCAAC...
umi GCGTGTGCTA = 187 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=542]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
434-485 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=3)
485-542 ==> 0-57 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDQPVYQLPRAWFDPW at 400, score = 9 + 7
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 186
start codons at 58, 214, 256, 322, 355, 503
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.102 = GAGGTGACAGCTCGCA-1

using 384 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 380]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.108 = GAGGTGACATGACGGA-1

using 339 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[14, 324]
surviving nonsolo ucounts = 1[324]
ids = [2]

====================================================================================

UMI info for barcode GAGGTGACATGACGGA-1 contig 1 = AGAGCTGCTC...
umi GTAAGCACTA = 327 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=549]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-367 ==> 0-336 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=17)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYRNSITF at 355, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 321
start codons at 31, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.111 = GAGGTGACATGTTCCC-1

using 287 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[4, 5, 276]
surviving nonsolo ucounts = 1[276]
ids = [0]

====================================================================================

UMI info for barcode GAGGTGACATGTTCCC-1 contig 1 = GATCAGGACT...
umi AATCCCACAG = 251 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=516]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
388-427 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
427-516 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CMQALQTPYTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 248
start codons at 30, 63, 99, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.122 = GAGGTGAGTACTTCTT-1

using 262 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2^2, 249]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GAGGTGAGTACTTCTT-1 contig 1 = TGGGGACTCA...
umi TGGCTCCCCT = 201 reads: +409 validated

GOOD CONTIGS

TIG 1[bases=477]
60-413 ==> 0-353 on |736|IGHV1-8|L-REGION+V-REGION| [len=353] (mis=12)
435-469 ==> 18-52 on |49|IGHJ1|J-REGION| [len=52] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CATGLLAGPIYW at 402, score = 9 + 7
umis assigned: [10]
of which 0 are surviving nonsolos
reads assigned: 196
start codons at 60, 211, 258, 263, 267, 295, 324, 342, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.124 = GAGGTGAGTATGAAAC-1

using 18011 reads

====================================================================================

graph has 5880 edges initially, 62 edges after simplification

total ucounts = 466
nonsolo ucounts = 172[2^49, 3^23, 4^15, 5^7, 6^3, 7^5, 8^3, 9, 10^3, 11, 12^2, 13, 17, 24, 31, 37, 112, 122, 138, 143, 150, 187, 207^2, 210, 219, 222^2, 250, 254, 258, 263^2, 266, 268, 272, 273, 279, 283, 289, 308, 312, 317^2, 320, 322, 329, 330, 331, 333, 337, 339^2, 340, 341, 342, 363, 370, 375, 380, 382, 396, 402, 406, 412, 415, 419^2, 458, 654, 717]
surviving nonsolo ucounts = 53[37, 112, 143, 187, 207^2, 210, 219, 222^2, 250, 254, 258, 263^2, 266, 268, 272, 273, 279, 283, 289, 308, 312, 317^2, 320, 322, 329, 330, 331, 333, 337, 339^2, 340, 341, 342, 363, 370, 375, 380, 382, 396, 402, 406, 412, 415, 419^2, 458, 654, 717]
ids = [188, 451, 350, 8, 16, 61, 317, 73, 111, 118, ...]

====================================================================================

UMI info for barcode GAGGTGAGTATGAAAC-1 contig 1 = AGTGCTTTCT...
umi AAAGAACTTC = 303 reads: -396X +1 -1XX +1 -20XX +2 -1XX +1 -6XX +1 invalidated
umi AAATCCTGCT = 191 reads: +430 validated
umi AACCAACACG = 339 reads: +430 validated
umi AATCGATTTT = 352 reads: +430 validated
umi ACGCTCAACC = 167 reads: +430 validated
umi ACTCTCGGGT = 173 reads: +430 validated
umi ATCGTACGAT = 220 reads: +430 validated
umi ATCTCCCACC = 312 reads: +430 validated
umi ATGCGCCTCT = 169 reads: +430 validated
umi CGATTATACA = 268 reads: +430 validated
umi CGTCGGGATA = 321 reads: +430 validated
umi CTACCCCCTT = 253 reads: +430 validated
umi CTTGTATTCT = 616 reads: -378X +2 -4X +1 -3XX +1 -1XX +2 -2XX +10 -1XX +2 -1XX +3 -2XX +17 invalidated
umi GACCAACTAC = 288 reads: +430 validated
umi GCTTCACCTC = 419 reads: +430 validated
umi GGCACTTGTT = 306 reads: +430 validated
umi GTGCCAGAGC = 384 reads: +430 validated
umi TCATGTTTAA = 300 reads: +430 validated
umi TCCGGCTCTT = 412 reads: +430 validated
umi TTACGCCACG = 383 reads: +430 validated
umi TTGATTTTCT = 81 reads: +430 validated
umi TTTAGACACA = 318 reads: +430 validated

UMI info for barcode GAGGTGAGTATGAAAC-1 contig 2 = GAGCTACAAC...
umi AACGCATTCT = 410 reads: +400 validated
umi AACGCCTTCG = 398 reads: +400 validated
umi AACGCTCGAT = 206 reads: +400 validated
umi ACACGACAAC = 420 reads: +400 validated
umi AGCACCAGCC = 323 reads: +400 validated
umi ATATAACCGC = 284 reads: +400 validated
umi ATTGGACCAT = 276 reads: +400 validated
umi CACGATTCTG = 248 reads: +400 validated
umi CGCGATACTA = 271 reads: +400 validated
umi CTAAATATTC = 663 reads: +400 validated
umi CTATTATCTC = 317 reads: +400 validated
umi CTCTGTATCC = 333 reads: +400 validated
umi CTTCGCGCTG = 289 reads: +400 validated
umi CTTGCCCATC = 248 reads: +400 validated
umi GAACCATAAC = 346 reads: +400 validated
umi GGAGCTCGAT = 275 reads: +16 -2X +1 -3XX +1 -3XX +2 -6XX +366 invalidated
umi GGTCTCACAC = 271 reads: +400 validated
umi GGTTATCACT = 335 reads: +400 validated
umi GTCATCTAGT = 330 reads: +400 validated
umi GTCATGAACC = 203 reads: +400 validated
umi TACATCTCCG = 380 reads: +400 validated
umi TACCCGCTAC = 277 reads: +400 validated
umi TCAAGGACTT = 338 reads: +400 validated
umi TCCTAGCCGA = 327 reads: +400 validated
umi TCCTCCTCTT = 341 reads: +400 validated
umi TGACATTGCA = 334 reads: +400 validated
umi TGGATATTCA = 400 reads: +400 validated
umi TTGGACCTCA = 266 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=518]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=2)
383-410 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=7)
412-447 ==> 11-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
447-518 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 20 umis using 567 reads
cdr3 = CARPLWFGELELW at 377, score = 9 + 7
umis assigned: [4, 8, 11, 29, 61, 73, 111, 114, 118, 207] and 12 others
of which 22 are surviving nonsolos
reads assigned: 6475
start codons at 17, 38, 82, 168, 391
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=2)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 28 umis using 1326 reads
cdr3 = CQQYYSTPYTF at 369, score = 9 + 8
umis assigned: [14, 15, 16, 37, 89, 105, 131, 155, 210, 222] and 18 others
of which 28 are surviving nonsolos
reads assigned: 8945
start codons at 30, 99, 352, 472
confident = true
now this is a cell
paired!

GTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGACCACTATGGTTCGGGGAGTTAGAGCTCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATAGTACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.129 = GAGGTGAGTCGCGGTT-1

using 529 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 524]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.136 = GAGGTGAGTTCAGACT-1

using 1107 reads

====================================================================================

graph has 278 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 1099]
surviving nonsolo ucounts = 1[1099]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=366]
3-117 ==> 242-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=3)
117-155 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
155-366 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CQSYDSSLSGLYVF at 85, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 1081
start codons at 68, 95, 119, 287
confident = false
not full
VJ delta = 22
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.137 = GAGGTGAGTTCATGGT-1

using 449 reads

====================================================================================

graph has 158 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 440]
surviving nonsolo ucounts = 1[440]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.138 = GAGGTGAGTTCCAACA-1

using 1032 reads

====================================================================================

graph has 342 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2, 3, 260, 760]
surviving nonsolo ucounts = 2[260, 760]
ids = [2, 9]

====================================================================================

UMI info for barcode GAGGTGAGTTCCAACA-1 contig 1 = GAAGAGCTGC...
umi CCTTTCTTTG = 263 reads: +385 validated
umi TGACCACCCC = 772 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=554]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 162 reads
cdr3 = CQQYGSSPYTF at 357, score = 9 + 8
umis assigned: [2, 9]
of which 2 are surviving nonsolos
reads assigned: 1016
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.140 = GAGGTGAGTTCCACGG-1

using 32 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[32]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.141 = GAGGTGAGTTCCTCCA-1

using 303 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[4, 6, 292]
surviving nonsolo ucounts = 1[292]
ids = [0]

====================================================================================

UMI info for barcode GAGGTGAGTTCCTCCA-1 contig 1 = GGAGTCAGAC...
umi CCCATTTGGG = 266 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=506]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-506 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDSFSWTF at 353, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 26, 32, 88, 101, 237, 240, 333, 363, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.143 = GAGGTGAGTTGTGGCC-1

using 607 reads

====================================================================================

graph has 200 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 600]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.146 = GAGGTGATCAACCATG-1

using 867 reads

====================================================================================

graph has 340 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[4, 5, 114, 249, 491]
surviving nonsolo ucounts = 3[114, 249, 491]
ids = [6, 5, 7]

====================================================================================

UMI info for barcode GAGGTGATCAACCATG-1 contig 1 = GTGGGCTCAG...
umi CTTTTCATTA = 233 reads: +385 validated
umi TGAACGTAAT = 458 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=580]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-580 ==> 0-160 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 130 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 680
start codons at 35, 96, 183, 230, 234, 333, 386
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.151 = GAGGTGATCACCGGGT-1

using 249 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[245]
surviving nonsolo ucounts = 1[245]
ids = [3]

====================================================================================

UMI info for barcode GAGGTGATCACCGGGT-1 contig 1 = TCAGGAGGCA...
umi TGTACCCGTT = 230 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=574]
32-385 ==> 0-353 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
382-420 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
420-574 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CSSYTSSSTLVF at 356, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 227
start codons at 32, 189, 233, 240, 243
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.158 = GAGGTGATCCATGAAC-1

using 65 reads

====================================================================================

graph has 52 edges initially, 6 edges after simplification

total ucounts = 15
nonsolo ucounts = 8[2, 3^2, 4, 7, 9, 13, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.159 = GAGGTGATCCCATTAT-1

using 708 reads

====================================================================================

graph has 286 edges initially, 42 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 311, 393]
surviving nonsolo ucounts = 2[311, 393]
ids = [0, 3]

====================================================================================

UMI info for barcode GAGGTGATCCCATTAT-1 contig 1 = GGAGTCAGTC...
umi ACATGACTCC = 308 reads: +61 -1XX +13 -1XX +13 -1XX +3 -2XX +52 -1XX +1 -1XX +5 -1XX +4 -2XX +2 -1XX +14 -1XX +34 -1XX +3 -1XX +9 -1XX +58 -1XX +20 -1XX +20 -1XX +6 -2XX +1 -1XX +6 -3XX +1 -2XX +25 -1XX +10 invalidated
umi GTATCTATAC = 390 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CQQLNSYPRTF at 353, score = 9 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 662
start codons at 26, 32, 88, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.166 = GAGGTGATCCTTCAAT-1

using 312 reads

====================================================================================

graph has 152 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode GAGGTGATCCTTCAAT-1 contig 1 = GAGCTCTGGG...
umi AGTACCGGAT = 313 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=557]
0-80 ==> 0-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=22)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=2)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CVKEEDAFDIW at 422, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 80, 231, 236, 297, 383, 438, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.167 = GAGGTGATCCTTGGTC-1

using 321 reads

====================================================================================

graph has 114 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3^2, 9, 300]
surviving nonsolo ucounts = 1[300]
ids = [3]

====================================================================================

UMI info for barcode GAGGTGATCCTTGGTC-1 contig 1 = AGCATCATCC...
umi GCGATCGGTT = 267 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=572]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
443-491 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
491-572 ==> 0-81 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 403, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 61, 217, 259, 325, 358, 448, 545
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.171 = GAGGTGATCGCTGATA-1

using 19 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.174 = GAGGTGATCGTAGATC-1

using 536 reads

====================================================================================

graph has 246 edges initially, 6 edges after simplification

total ucounts = 85
nonsolo ucounts = 55[2^6, 3^6, 4^4, 5^2, 6^3, 7^2, 8^5, 9, 10^2, 11^3, 12^5, 13^2, 14, 15^5, 16^2, 17^2, 18^2, 19, 20]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.178 = GAGGTGATCTAACTTC-1

using 323 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode GAGGTGATCTAACTTC-1 contig 1 = AGCTTCAGCT...
umi AAATTCTGTG = 317 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 312
start codons at 47, 351, 381, 393
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.185 = GAGGTGATCTGCTGTC-1

using 145 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3^2, 7, 12, 112]
surviving nonsolo ucounts = 1[112]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=493]
0-81 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
413-493 ==> 0-80 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 24, 30, 86, 99, 235, 455
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.190 = GAGGTGATCTTTACAC-1

using 116 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 3[5, 10, 89]
surviving nonsolo ucounts = 1[89]
ids = [11]

====================================================================================

UMI info for barcode GAGGTGATCTTTACAC-1 contig 1 = ACACAGCATG...
umi TCTCCTTCGG = 78 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=431]
7-358 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
357-395 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
395-431 ==> 0-36 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQSYRRPITF at 334, score = 8 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 78
start codons at 7, 13, 69, 82, 218, 317
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.200 = GAGTCCGAGCCAGGAT-1

using 248 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 242]
surviving nonsolo ucounts = 1[242]
ids = [5]

====================================================================================

UMI info for barcode GAGTCCGAGCCAGGAT-1 contig 1 = GAGAGAGGAG...
umi TTCTACGCGC = 239 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=583]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-583 ==> 0-86 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 236
start codons at 73, 224, 229, 376, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.202 = GAGTCCGAGCCGCCTA-1

using 468 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 6[2, 3, 4, 8, 136, 309]
surviving nonsolo ucounts = 2[136, 309]
ids = [5, 7]

====================================================================================

UMI info for barcode GAGTCCGAGCCGCCTA-1 contig 1 = GGGGAGGAAT...
umi GCATTCGGCG = 136 reads: +388 validated
umi TCCTCCGCGT = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 77 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 439
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.203 = GAGTCCGAGCCTATGT-1

using 832 reads

====================================================================================

graph has 310 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[2, 3, 285, 537]
surviving nonsolo ucounts = 2[285, 537]
ids = [8, 3]

====================================================================================

UMI info for barcode GAGTCCGAGCCTATGT-1 contig 1 = GGGGTCACAA...
umi GCCTAATGGA = 536 reads: +385 validated
umi TCATTAAGTC = 290 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=634]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=26)
385-423 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
423-634 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 2 umis using 129 reads
cdr3 = CFSYGNTGRVF at 362, score = 8 + 8
umis assigned: [3, 8]
of which 2 are surviving nonsolos
reads assigned: 811
start codons at 38, 249, 372, 555
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.206 = GAGTCCGAGCTAACTC-1

using 665 reads

====================================================================================

graph has 184 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[2, 657]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.212 = GAGTCCGAGGATCGCA-1

using 1812 reads

====================================================================================

graph has 652 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 10[2, 3, 5, 90, 126, 215, 236, 292, 303, 537]
surviving nonsolo ucounts = 7[90, 126, 215, 236, 292, 303, 537]
ids = [4, 1, 7, 2, 9, 3, 6]

====================================================================================

UMI info for barcode GAGTCCGAGGATCGCA-1 contig 1 = GAGAGAGGAG...
umi CCAGAATGTG = 121 reads: +424 validated
umi GGCATGCACA = 297 reads: +424 validated

UMI info for barcode GAGTCCGAGGATCGCA-1 contig 2 = AGCTTCAGCT...
umi CTAGGAAGGG = 236 reads: +388 validated
umi GGTTTGTTAC = 88 reads: +388 validated
umi TATGGACCCA = 533 reads: +388 validated
umi TCCTTTATAG = 215 reads: +388 validated
umi TCTGCCCCTT = 295 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=632]
0-73 ==> 6-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
73-426 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
450-497 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
497-632 ==> 0-135 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 2 umis using 51 reads
cdr3 = CARDRAATARLGGMDVW at 415, score = 9 + 7
umis assigned: [1, 3]
of which 2 are surviving nonsolos
reads assigned: 410
start codons at 73, 224, 229, 376, 454
confident = true

TIG 2[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 253 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2, 4, 6, 7, 9]
of which 5 are surviving nonsolos
reads assigned: 1349
start codons at 47, 201, 351, 376, 381
confident = true
now this is a cell
paired!

GACACGGCTGTGTATTACTGTGCGAGAGATCGGGCGGCGACAGCTCGTCTTGGCGGTATGGACGTCTGGGGCCAAGGGACCGCGGTCACCGTCTCCTCAG <==> GGGCTCCAGTCTGAGGATGAGGCTGCTTATTACTGTGCATCATGGGATGACAGCCTGCGTGGTCGGGTGTTTGGCGGTGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.213 = GAGTCCGAGGCGTACA-1

using 355 reads

====================================================================================

graph has 128 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[22, 333]
surviving nonsolo ucounts = 1[333]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=503]
0-84 ==> 11259-11343 on segment before IGLV3-6 exon 1 [len=11502] (mis=4)
38-172 ==> 0-134 on |365|IGLV3-27|L-REGION+V-REGION| [len=339] (mis=0)
254-292 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
292-503 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 332
start codons at 28, 38, 99, 168, 186, 210
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.218 = GAGTCCGAGGGTGTTG-1

using 340 reads

====================================================================================

graph has 148 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[3, 4, 328]
surviving nonsolo ucounts = 1[328]
ids = [3]

====================================================================================

UMI info for barcode GAGTCCGAGGGTGTTG-1 contig 1 = GAATCAGTCC...
umi GCCTAGATTG = 330 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.226 = GAGTCCGAGTGGGATC-1

using 7499 reads

====================================================================================

graph has 3850 edges initially, 44 edges after simplification

total ucounts = 885
nonsolo ucounts = 363[2^156, 3^67, 4^42, 5^32, 6^17, 7^14, 8^5, 9^5, 10^2, 13, 14, 15, 18, 187, 193, 210, 223, 239, 249, 253, 255, 271, 287, 293, 295^2, 331, 332, 382, 408, 520, 548]
surviving nonsolo ucounts = 18[187, 193, 210, 223, 249, 253, 255, 271, 287, 293, 295^2, 331, 332, 382, 408, 520, 548]
ids = [209, 692, 466, 381, 23, 190, 458, 674, 263, 103, ...]

====================================================================================

UMI info for barcode GAGTCCGAGTGGGATC-1 contig 1 = CTGGGCCTCA...
umi ACGCAATACC = 292 reads: +376 validated
umi ATCACACATC = 255 reads: +376 validated
umi CACAAAACAG = 342 reads: +376 validated
umi CACGCGCGAT = 293 reads: +376 validated
umi CTCCGCCTCT = 225 reads: +376 validated
umi CTTTTTGCAA = 298 reads: +376 validated
umi GACTTTATGG = 299 reads: +376 validated
umi GAGAGGAGTC = 256 reads: +376 validated
umi GAGCTATGTC = 212 reads: +270 -1 +105 non-validated
umi TATAGGCTGA = 265 reads: +376 validated
umi TCACGTTATG = 192 reads: +376 validated
umi TCTGGCCTAG = 333 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-350 ==> 0-313 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=6)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 12 umis using 585 reads
cdr3 = CQARDSDTVVF at 352, score = 6 + 8
umis assigned: [103, 190, 258, 263, 381, 433, 454, 458, 466, 674] and 2 others
of which 12 are surviving nonsolos
reads assigned: 3193
start codons at 37, 42, 98, 185, 232, 331, 335
confident = true

REJECT CONTIGS

TIG 1[bases=478]
1-48 ==> 5953-6000 on rc of segment after IGKV1-5 exon 1 [len=6000] (mis=1)
33-96 ==> 5674-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=0)
48-250 ==> 0-202 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=5)
250-305 ==> 296-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=1) [SHIFT!]
305-342 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
342-478 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CLQHNSYRLTF at 281, score = 9 + 9
umis assigned: [23, 54, 163, 651, 776, 842]
of which 5 are surviving nonsolos
reads assigned: 2180
start codons at 48, 54, 123, 205, 384
confident = false
not full
frameshifted full length transcript of length 478
VJ delta = 107
delta too large
not full
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.229 = GAGTCCGAGTTGTCGT-1

using 252 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 4[2, 4, 7, 239]
surviving nonsolo ucounts = 1[239]
ids = [1]

====================================================================================

UMI info for barcode GAGTCCGAGTTGTCGT-1 contig 1 = TGATCAGGAC...
umi CCAGCTACAG = 217 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=496]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=0)
391-428 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
428-496 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CMQALQTPLTF at 367, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 215
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.234 = GAGTCCGCAACTTGAC-1

using 12839 reads

====================================================================================

graph has 5006 edges initially, 76 edges after simplification

total ucounts = 944
nonsolo ucounts = 373[2^149, 3^64, 4^38, 5^22, 6^15, 7^10, 8^5, 9^4, 10^3, 11^4, 12^2, 13^3, 14, 18, 19, 22, 23, 24, 37, 44, 45, 72, 93, 134, 137, 143, 152, 171, 172, 175, 179, 183, 186, 191, 199^2, 201, 217^2, 225, 226, 232, 234, 238, 243, 245, 251, 255, 257, 261, 263^3, 265^2, 272, 276, 284, 302, 310^2, 311, 318, 331, 343, 832]
surviving nonsolo ucounts = 44[72, 93, 134, 137, 143, 171, 172, 175, 179, 183, 186, 191, 199^2, 201, 217^2, 225, 226, 232, 234, 238, 243, 245, 251, 255, 257, 261, 263^3, 265^2, 272, 276, 284, 302, 310^2, 311, 318, 331, 343, 832]
ids = [586, 40, 296, 216, 537, 209, 432, 561, 589, 189, ...]

====================================================================================

UMI info for barcode GAGTCCGCAACTTGAC-1 contig 1 = AGCTGTGGGC...
umi AAACAGACGA = 304 reads: +382 validated
umi AATATCGTAC = 94 reads: +382 validated
umi ATCAGTACTA = 272 reads: +382 validated
umi ATCTTTTTCC = 185 reads: +382 validated
umi ATTGCGTGAA = 136 reads: +382 validated
umi CAATCATCCG = 313 reads: +382 validated
umi CATGGACCGT = 265 reads: +382 validated
umi CGGCCCTCGC = 322 reads: +382 validated
umi CTCCTTTGCA = 229 reads: +382 validated
umi GCCAGCTCGG = 192 reads: +382 validated
umi GCTGCATCCT = 143 reads: +382 validated
umi GGACCCGGTA = 256 reads: +382 validated
umi GGCACTACCC = 179 reads: +382 validated
umi GTAAATTTCG = 179 reads: +382 validated
umi TACGACGCGC = 184 reads: +382 validated
umi TAGCACATCC = 267 reads: +382 validated
umi TATCGCCCGT = 195 reads: +382 validated
umi TCATTTTGGT = 199 reads: +382 validated
umi TGACCAGCAC = 262 reads: +382 validated
umi TGACCATCCA = 231 reads: +382 validated
umi TTACGGGCAG = 272 reads: +382 validated
umi TTAGGATACA = 329 reads: +382 validated
umi TTTAGCGGCT = 276 reads: +382 validated

UMI info for barcode GAGTCCGCAACTTGAC-1 contig 2 = AGCTCTGAGA...
umi AACAGAGCTA = 311 reads: +406 validated
umi AACTACCCCT = 215 reads: +406 validated
umi AGGTATTTTA = 217 reads: +406 validated
umi ATTATTATTG = 174 reads: +406 validated
umi ATTGCGACCG = 264 reads: +406 validated
umi CGTTCCACAC = 233 reads: +406 validated
umi CTGTTAAAAA = 173 reads: +406 validated
umi CTTGGTGTGA = 254 reads: +406 validated
umi GACACGGGCC = 345 reads: +406 validated
umi GCTGCCTGCT = 202 reads: +406 validated
umi GGTCTTTCAT = 71 reads: +406 validated
umi TATCCCACCC = 242 reads: +406 validated
umi TCGTGCAACC = 264 reads: +406 validated
umi TTGCGTGATG = 224 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=633]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=20)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-633 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 23 umis using 923 reads
cdr3 = CHSRDSSGNRWVF at 355, score = 8 + 8
umis assigned: [3, 40, 171, 189, 216, 231, 270, 366, 412, 508] and 13 others
of which 23 are surviving nonsolos
reads assigned: 5210
start codons at 40, 239, 338
confident = true

TIG 2[bases=645]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=32)
439-485 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
485-645 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 14 umis using 383 reads
cdr3 = CTNLYSSSDYW at 421, score = 9 + 7
umis assigned: [18, 30, 138, 209, 215, 383, 432, 443, 469, 538] and 4 others
of which 14 are surviving nonsolos
reads assigned: 3138
start codons at 79, 230, 235, 382, 539
confident = true

REJECT CONTIGS

TIG 1[bases=608]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
0-20 ==> 1300-1320 on rc of segment before IGHVIII-5-1 exon 1 [len=1320] (mis=0)
0-20 ==> 7558-7578 on rc of segment before IGHVIII-26-1 exon 1 [len=7578] (mis=0)
20-357 ==> 0-337 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=24)
398-448 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
448-608 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
umis assigned: [31, 186, 296, 467, 915, 932]
of which 6 are surviving nonsolos
reads assigned: 1320
start codons at 20, 64, 176, 243, 246, 409, 429, 502
confident = false
frameshifted full length stopped transcript of length 608
did not find CDR3
now this is a cell
paired!

AACAGCCTGAGAGCCGAGGACACGGCCGTCTATTATTGTACGAATTTGTACAGTAGCTCGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTCATTCCCGGGACAGCAGTGGTAACCGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.239 = GAGTCCGCAATACGCT-1

using 500 reads

====================================================================================

graph has 174 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 4[2, 5, 185, 302]
surviving nonsolo ucounts = 2[185, 302]
ids = [5, 7]

====================================================================================

UMI info for barcode GAGTCCGCAATACGCT-1 contig 1 = GGGCCTCAGG...
umi GAAAAATGGC = 185 reads: +379 validated
umi GAGCAAACCG = 299 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=625]
0-35 ==> 17-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
35-381 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
376-414 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
414-625 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 89 reads
cdr3 = CQAWDSSTAVVF at 350, score = 6 + 8
umis assigned: [5, 7]
of which 2 are surviving nonsolos
reads assigned: 481
start codons at 35, 40, 96, 183, 329, 333
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.240 = GAGTCCGCAATCGGTT-1

using 253 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[5, 7, 237]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

UMI info for barcode GAGTCCGCAATCGGTT-1 contig 1 = GAGGGTCCTG...
umi CGCAATTTCA = 229 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=498]
59-407 ==> 0-348 on |740|IGHV4-30-4|L-REGION+V-REGION| [len=348] (mis=11)
436-486 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=4)
junction support: 1 umis using 24 reads
cdr3 = CARDLLWFGETRAFDIW at 404, score = 9 + 8
umis assigned: [3]
of which 0 are surviving nonsolos
reads assigned: 227
start codons at 15, 59, 103, 421, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.243 = GAGTCCGCACATCCGG-1

using 311 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[6, 300]
surviving nonsolo ucounts = 1[300]
ids = [0]

====================================================================================

UMI info for barcode GAGTCCGCACATCCGG-1 contig 1 = TGGAAACAGA...
umi AAAACTACAG = 297 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=639]
40-392 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=22)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
428-639 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CSSWDSSLSAWVF at 361, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 40, 179, 251, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.244 = GAGTCCGCACCAGCAC-1

using 351 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[3^2, 339]
surviving nonsolo ucounts = 1[339]
ids = [2]

====================================================================================

UMI info for barcode GAGTCCGCACCAGCAC-1 contig 1 = TGGAGAAGAG...
umi ATTGCCTCAC = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-37 ==> 15-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
37-385 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
387-425 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
425-479 ==> 0-54 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPLFTF at 361, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 37, 245, 371, 467
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.257 = GAGTCCGCAGGGAGAG-1

using 597 reads

====================================================================================

graph has 192 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[592]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.258 = GAGTCCGCAGGTCCAC-1

using 251 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2^3, 5^2, 234]
surviving nonsolo ucounts = 1[234]
ids = [4]

====================================================================================

UMI info for barcode GAGTCCGCAGGTCCAC-1 contig 1 = GCTGTGCTGT...
umi GGTACATTCA = 226 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=595]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
390-428 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
428-595 ==> 0-167 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQSADSSGTYSWVF at 358, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.259 = GAGTCCGCAGTGGGAT-1

using 359 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 354]
surviving nonsolo ucounts = 1[354]
ids = [0]

====================================================================================

UMI info for barcode GAGTCCGCAGTGGGAT-1 contig 1 = GTCAGTCTCA...
umi CGGCGTGGTC = 361 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=544]
0-23 ==> 0-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
23-376 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=19)
369-408 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 60 reads
cdr3 = CQQSYSTPSF at 350, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 353
start codons at 23, 29, 85, 98, 234, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.263 = GAGTCCGCATACTCTT-1

using 275 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 4, 266]
surviving nonsolo ucounts = 1[266]
ids = [0]

====================================================================================

UMI info for barcode GAGTCCGCATACTCTT-1 contig 1 = GGTGGTAGCT...
umi ACCGTCTTCA = 270 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=641]
0-39 ==> 47-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=1)
39-392 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=29)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQSYDTTNHWVF at 366, score = 5 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 39, 193, 244, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.264 = GAGTCCGCATCCAACA-1

using 71 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 62]
surviving nonsolo ucounts = 1[62]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.266 = GAGTCCGCATCTATGG-1

using 293 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 1[290]
ids = [1]

====================================================================================

UMI info for barcode GAGTCCGCATCTATGG-1 contig 1 = GGGGTCCCTT...
umi AGTAACCCAA = 281 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=578]
0-24 ==> 10-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=0)
24-375 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=2)
377-415 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
415-578 ==> 0-163 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CLLYYGGAQPWVF at 348, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 24, 361
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.268 = GAGTCCGCATTCACTT-1

using 543 reads

====================================================================================

graph has 294 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[5, 17, 225, 293]
surviving nonsolo ucounts = 2[225, 293]
ids = [6, 1]

====================================================================================

UMI info for barcode GAGTCCGCATTCACTT-1 contig 1 = GCTCTGCTTC...
umi TCGGCAACTC = 212 reads: +394 validated

UMI info for barcode GAGTCCGCATTCACTT-1 contig 2 = TGGGAGGAAT...
umi ACTTATTATA = 298 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=512]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-512 ==> 0-67 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 209
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false

TIG 2[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 31, 37, 106, 242, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.269 = GAGTCCGGTACCATCA-1

using 329 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[323]
surviving nonsolo ucounts = 1[323]
ids = [5]

====================================================================================

UMI info for barcode GAGTCCGGTACCATCA-1 contig 1 = GAAGAGCTGC...
umi TGTTCACTCT = 278 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=434]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=14)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
junction support: 1 umis using 52 reads
cdr3 = CHHYGVSPGWTF at 357, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 33, 241, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.279 = GAGTCCGGTCGACTGC-1

using 218 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 5, 208]
surviving nonsolo ucounts = 1[208]
ids = [3]

====================================================================================

UMI info for barcode GAGTCCGGTCGACTGC-1 contig 1 = TGAGCGCAGA...
umi TATCAATGGG = 207 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=635]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=12)
386-424 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=3)
424-635 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CGAWDSSLSAGVF at 357, score = 7 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 36, 190, 197, 241, 250, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.282 = GAGTCCGGTCTCTTAT-1

using 2399 reads

====================================================================================

graph has 2004 edges initially, 22 edges after simplification

total ucounts = 625
nonsolo ucounts = 244[2^116, 3^46, 4^30, 5^20, 6^10, 7^3, 8^5, 9^3, 10, 12, 17, 22, 51, 90, 143, 203, 219, 239, 274]
surviving nonsolo ucounts = 7[51, 90, 143, 203, 219, 239, 274]
ids = [460, 121, 52, 387, 526, 542, 80]

====================================================================================

UMI info for barcode GAGTCCGGTCTCTTAT-1 contig 1 = ATTCGGTGAT...
umi ACATACGTCC = 131 reads: +436 validated
umi ATATTGGCTG = 87 reads: +373 -63 non-validated
umi TCTTGGCCGT = 192 reads: +436 validated

UMI info for barcode GAGTCCGGTCTCTTAT-1 contig 2 = GCTCTGCTTC...
umi ACTCACTTAG = 262 reads: +391 validated
umi TATTTCGGGC = 50 reads: +346 -45 non-validated
umi TGCTTGGGCT = 230 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=519]
0-35 ==> 45-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
35-386 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=0)
421-471 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
471-519 ==> 0-48 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 2 umis using 29 reads
cdr3 = CAKDSPLPIYGSGADDAFDIW at 377, score = 9 + 8
umis assigned: [52, 121, 526]
of which 3 are surviving nonsolos
reads assigned: 405
start codons at 35, 186, 191, 249, 252, 270, 338, 405, 420, 423, 452, 489
confident = true

TIG 2[bases=540]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=1)
404-442 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
442-540 ==> 0-98 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 2 umis using 90 reads
cdr3 = CQSYDSSLSGWVF at 375, score = 8 + 8
umis assigned: [80, 460, 542]
of which 3 are surviving nonsolos
reads assigned: 536
start codons at 51, 205, 208, 259, 358, 385
confident = true
now this is a cell
paired!

TATTACTGTGCGAAAGATTCCCCCCTCCCGATTTATGGTTCAGGGGCAGATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> GGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.283 = GAGTCCGGTCTTCTCG-1

using 2476 reads

====================================================================================

graph has 460 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[3, 448, 2021]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.286 = GAGTCCGGTGCTGTAT-1

using 444 reads

====================================================================================

graph has 724 edges initially, 2 edges after simplification

total ucounts = 225
nonsolo ucounts = 82[2^25, 3^30, 4^10, 5^7, 6^4, 7^2, 9, 10, 12, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.295 = GAGTCCGGTTCCCGAG-1

using 499 reads

====================================================================================

graph has 176 edges initially, 4 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[3, 5, 6, 185, 295]
surviving nonsolo ucounts = 2[185, 295]
ids = [3, 4]

====================================================================================

UMI info for barcode GAGTCCGGTTCCCGAG-1 contig 1 = CTCAGGAGGC...
umi CCGCACTCGC = 167 reads: +388 validated

UMI info for barcode GAGTCCGGTTCCCGAG-1 contig 2 = CCAGCTGGGA...
umi CTCAGTTCGG = 296 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=549]
0-33 ==> 9-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
33-377 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=20)
383-421 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
421-549 ==> 0-128 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CCSHAGSYIWVF at 357, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 166
start codons at 33, 169, 172, 190, 244, 340, 367
confident = false

TIG 2[bases=531]
0-42 ==> 17-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=0)
42-395 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=2)
410-460 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=1)
460-531 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CARLSSGWYNAFDIW at 384, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 42, 216, 240, 375, 412, 441
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.313 = GAGTCCGTCCGCATCT-1

using 97 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 93]
surviving nonsolo ucounts = 1[93]
ids = [1]

====================================================================================

UMI info for barcode GAGTCCGTCCGCATCT-1 contig 1 = AGCTTCAGCT...
umi CATAGGTTTA = 87 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-509 ==> 0-74 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 84
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.316 = GAGTCCGTCCTGCTTG-1

using 234 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 3[2^2, 226]
surviving nonsolo ucounts = 1[226]
ids = [1]

====================================================================================

UMI info for barcode GAGTCCGTCCTGCTTG-1 contig 1 = GGGGTCACAA...
umi CCAGCCATGC = 220 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=539]
0-38 ==> 124-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
38-378 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
426-539 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CCSYAGSSTYVF at 362, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 214
start codons at 38, 177, 239, 246, 372, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.317 = GAGTCCGTCCTTAATC-1

using 315 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[3, 307]
surviving nonsolo ucounts = 1[307]
ids = [2]

====================================================================================

UMI info for barcode GAGTCCGTCCTTAATC-1 contig 1 = TTGGGGAGGA...
umi AACGCCCGTG = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=557]
33-384 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
383-421 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 360, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 304
start codons at 33, 39, 108, 244, 463
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.320 = GAGTCCGTCGTCTGCT-1

using 62 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 25, 29]
surviving nonsolo ucounts = 1[25]
ids = [4]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.323 = GAGTCCGTCTCTGCTG-1

using 299 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 6[2^2, 3^2, 4, 280]
surviving nonsolo ucounts = 1[280]
ids = [0]

====================================================================================

UMI info for barcode GAGTCCGTCTCTGCTG-1 contig 1 = ACAGCATGGA...
umi AAAGCGGGGC = 283 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=529]
5-356 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
355-393 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
393-529 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CQQSYRRPITF at 332, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 278
start codons at 5, 11, 67, 80, 216, 315, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.329 = GAGTCCGTCTTCGAGA-1

using 1072 reads

====================================================================================

graph has 400 edges initially, 4 edges after simplification

total ucounts = 15
nonsolo ucounts = 4[2, 4, 232, 823]
surviving nonsolo ucounts = 2[232, 823]
ids = [9, 13]

====================================================================================

UMI info for barcode GAGTCCGTCTTCGAGA-1 contig 1 = ACATGGGAAG...
umi TCGGTCTTCA = 228 reads: +463 validated

GOOD CONTIGS

TIG 1[bases=579]
0-25 ==> 6-31 on |185|IGHV4-34|5'UTR| [len=31] (mis=0)
25-396 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
399-426 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=3)
438-488 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
488-579 ==> 0-91 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 21 reads
cdr3 = CATSSTYYGSGSYYNVPVDAFDIW at 385, score = 9 + 8
umis assigned: [9]
of which 1 are surviving nonsolos
reads assigned: 224
start codons at 2, 25, 46, 90, 176, 319, 407, 428, 440, 469
confident = false

REJECT CONTIGS

TIG 1[bases=340]
11-45 ==> 3116-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=3)
91-129 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
129-340 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 810
start codons at 5, 72
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.336 = GATCAGTAGACCACGA-1

using 1067 reads

====================================================================================

graph has 240 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[13, 1050]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================

REJECT CONTIGS

TIG 1[bases=374]
5-79 ==> 3076-3150 on segment before IGLJ5 exon 1 [len=3161] (mis=7)
125-163 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
163-374 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [2]
of which 0 are surviving nonsolos
reads assigned: 1039
start codons at 13, 21, 106
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.338 = GATCAGTAGACTACAA-1

using 861 reads

====================================================================================

graph has 1254 edges initially, 4 edges after simplification

total ucounts = 331
nonsolo ucounts = 156[2^48, 3^37, 4^19, 5^15, 6^5, 7^8, 8^9, 9^6, 10^2, 11, 12^3, 16^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.344 = GATCAGTAGCAATATG-1

using 1785 reads

====================================================================================

graph has 2586 edges initially, 40 edges after simplification

total ucounts = 879
nonsolo ucounts = 355[2^139, 3^100, 4^48, 5^27, 6^13, 7^11, 8^5, 9^2, 10^3, 11^2, 14, 16^2, 18, 27]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.349 = GATCAGTAGGAGCGAG-1

using 35 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[35]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.356 = GATCAGTAGGCAGTCA-1

using 39 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[39]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.357 = GATCAGTAGGCATGTG-1

using 124 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[119]
surviving nonsolo ucounts = 1[119]
ids = [5]

====================================================================================

UMI info for barcode GATCAGTAGGCATGTG-1 contig 1 = AGGAGTCAGA...
umi TTTGGCTTCG = 112 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=510]
0-33 ==> 20-53 on |236|IGKV1-8|5'UTR| [len=53] (mis=0)
33-378 ==> 0-345 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=1)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-510 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQQYYSYPLVTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 33, 89, 102, 238, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.361 = GATCAGTAGGCTATCT-1

using 2980 reads

====================================================================================

graph has 1852 edges initially, 18 edges after simplification

total ucounts = 424
nonsolo ucounts = 181[2^80, 3^37, 4^20, 5^10, 6^12, 7^3, 8^3, 9^2, 10, 11, 12, 13, 20, 103, 138, 158, 167, 229, 268, 319, 375, 378]
surviving nonsolo ucounts = 7[138, 167, 229, 268, 319, 375, 378]
ids = [249, 230, 260, 336, 36, 186, 344]

====================================================================================

UMI info for barcode GATCAGTAGGCTATCT-1 contig 1 = TGGGGATGCT...
umi ACCGGAATAG = 270 reads: +460 validated
umi CTATGAGTCA = 373 reads: +460 validated
umi GCATACCTTC = 169 reads: +460 validated
umi GCTGTTGGCT = 138 reads: +441 -7 +12 non-validated
umi GGCGTCTCGG = 196 reads: +460 validated
umi TCAGGACCTA = 268 reads: +460 validated
umi TCCGTAGCAG = 328 reads: +460 validated

GOOD CONTIGS

TIG 1[bases=583]
21-398 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=1)
418-481 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=5)
481-583 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 5 umis using 106 reads
cdr3 = CARRSRWFGELLYDYYYMDVW at 387, score = 9 + 7
umis assigned: [36, 186, 230, 249, 260, 336, 344]
of which 7 are surviving nonsolos
reads assigned: 1723
start codons at 5, 21, 30, 42, 86, 438, 499, 560
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.364 = GATCAGTAGGGTATCG-1

using 189 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[185]
surviving nonsolo ucounts = 1[185]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=474]
0-33 ==> 14-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-33 ==> 5967-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
6-58 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
33-354 ==> 0-321 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
351-388 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
388-474 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 33, 238, 241, 430
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.366 = GATCAGTAGGTAAACT-1

using 272 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 269]
surviving nonsolo ucounts = 1[269]
ids = [2]

====================================================================================

UMI info for barcode GATCAGTAGGTAAACT-1 contig 1 = AGTGCTTTCT...
umi TTAGAAGCTT = 271 reads: +469 validated

GOOD CONTIGS

TIG 1[bases=557]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=1)
412-430 ==> 0-18 on |35|IGHD6-6|D-REGION| [len=18] (mis=2)
433-486 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=3)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CAREKGWSKARASIAARRENRYFDLW at 377, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 266
start codons at 17, 38, 82, 168
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.367 = GATCAGTAGTACTTGC-1

using 14 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.372 = GATCAGTAGTGTGAAT-1

using 432 reads

====================================================================================

graph has 124 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 426]
surviving nonsolo ucounts = 1[426]
ids = [2]

====================================================================================

UMI info for barcode GATCAGTAGTGTGAAT-1 contig 1 = GCTCTGCTTC...
umi ATGGCGTAAC = 424 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=606]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-606 ==> 0-161 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 69 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 418
start codons at 51, 205, 208, 259, 358, 385, 409, 577
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.374 = GATCAGTAGTTGTAGA-1

using 180 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2^2, 3, 4, 166]
surviving nonsolo ucounts = 1[166]
ids = [6]

====================================================================================

UMI info for barcode GATCAGTAGTTGTAGA-1 contig 1 = GGAGTCAGTC...
umi TGACCAGCCC = 168 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=550]
26-379 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=3)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQSYSTPWTF at 353, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 26, 32, 88, 101, 237, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.377 = GATCAGTCAACCGCCA-1

using 246 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTCAACCGCCA-1 contig 1 = AGTCTGGGCC...
umi CGTTCACCAG = 229 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=555]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-369 ==> 0-329 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=38)
384-422 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
422-555 ==> 0-133 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CQVWDSGSQHVVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 226
start codons at 40, 101, 154, 242, 338, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.383 = GATCAGTCACAGATTC-1

using 10070 reads

====================================================================================

graph has 4822 edges initially, 42 edges after simplification

total ucounts = 863
nonsolo ucounts = 415[2^151, 3^82, 4^46, 5^44, 6^21, 7^13, 8^5, 9^9, 10^3, 11^3, 12, 13, 14, 15, 18^2, 27, 34, 37, 70, 123, 132, 146, 177, 191, 228, 242, 259, 265, 282, 287, 289, 290, 294^2, 300, 304, 313, 321, 325, 337, 339, 349, 369, 380, 384^2, 407]
surviving nonsolo ucounts = 24[177, 228, 242, 259, 265, 282, 287, 289, 290, 294^2, 300, 304, 313, 321, 325, 337, 339, 349, 369, 380, 384^2, 407]
ids = [33, 187, 284, 604, 290, 38, 441, 122, 761, 97, ...]

====================================================================================

UMI info for barcode GATCAGTCACAGATTC-1 contig 1 = AGTGATCAGC...
umi CATAAACCGC = 268 reads: +439 validated

UMI info for barcode GATCAGTCACAGATTC-1 contig 2 = GGGAGAGCCC...
umi AAATATTACG = 316 reads: +388 validated
umi AACTAATATG = 176 reads: +388 validated
umi AACTTTTACA = 283 reads: +388 validated
umi ACATGCACCA = 294 reads: +388 validated
umi ACATTTTGCG = 369 reads: +388 validated
umi ACGCGTTTCG = 287 reads: +388 validated
umi ACGTCTCTCG = 322 reads: +388 validated
umi ATAAAATTCC = 228 reads: +388 validated
umi ATTGGGACCC = 383 reads: +388 validated
umi CAGATGGCGC = 241 reads: +388 validated
umi CATGCATGGG = 293 reads: +388 validated
umi CTATGTGGAC = 351 reads: +388 validated
umi CTGATAACAA = 335 reads: +388 validated
umi CTTACCTGCT = 280 reads: +388 validated
umi GAAGCCACGC = 380 reads: +388 validated
umi GACAAGGCAT = 404 reads: +388 validated
umi GGCCGACTTA = 275 reads: -355 +1 -1X +6 -2XX +15 -1XX +7 invalidated
umi GTGTTCACTC = 255 reads: +388 validated
umi TATTTATCAT = 307 reads: +388 validated
umi TCCGTCGGTT = 338 reads: +388 validated
umi TCGCTTTGTT = 323 reads: +388 validated
umi TGAGTTTTGA = 291 reads: +388 validated
umi TTCGGTAAAA = 377 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=572]
31-386 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=29)
397-418 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=1)
424-470 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
470-572 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAKGETYTGYSSGWYMGVGDYW at 373, score = 9 + 7
umis assigned: [290]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 31, 176, 182, 187, 266, 334, 418, 488, 549
confident = true

TIG 2[bases=571]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=1)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 22 umis using 1057 reads
cdr3 = CQQRSNWPPRLTF at 368, score = 9 + 9
umis assigned: [11, 33, 38, 97, 102, 122, 129, 187, 243, 284] and 13 others
of which 23 are surviving nonsolos
reads assigned: 7024
start codons at 47, 252, 255, 477
confident = true
now this is a cell
paired!

TACTGTGCAAAAGGGGAAACGTACACCGGGTATAGCAGTGGCTGGTATATGGGGGTTGGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> AGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCCCCGAGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.392 = GATCAGTCACGTGAGA-1

using 164 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[164]
surviving nonsolo ucounts = 1[164]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTCACGTGAGA-1 contig 1 = GAGCTCTGGG...
umi ATTGAAATTA = 168 reads: +457 validated

GOOD CONTIGS

TIG 1[bases=543]
0-80 ==> 0-80 on |125|IGHV3-33|5'UTR| [len=80] (mis=1)
80-431 ==> 0-351 on |126|IGHV3-33|L-REGION+V-REGION| [len=351] (mis=8)
495-537 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
junction support: 1 umis using 11 reads
cdr3 = CARDRGRDPRFIVSTIGASHYYYALDVW at 422, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 163
start codons at 80, 231, 236, 294, 297, 315, 383
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.394 = GATCAGTCACTTGGAT-1

using 1704 reads

====================================================================================

graph has 2468 edges initially, 10 edges after simplification

total ucounts = 798
nonsolo ucounts = 339[2^138, 3^72, 4^43, 5^37, 6^16, 7^13, 8^4, 9^9, 10, 11, 12^2, 15, 17, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.397 = GATCAGTCAGCTGCTG-1

using 498 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[100, 394]
surviving nonsolo ucounts = 2[100, 394]
ids = [3, 2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.398 = GATCAGTCAGGAACGT-1

using 480 reads

====================================================================================

graph has 210 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[188, 287]
surviving nonsolo ucounts = 2[188, 287]
ids = [0, 2]

====================================================================================

UMI info for barcode GATCAGTCAGGAACGT-1 contig 1 = GGAGTCAGAC...
umi CCTCACATGA = 277 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=512]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=3)
382-420 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=1)
420-512 ==> 0-92 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 47 reads
cdr3 = CQQYKSYSPLFTF at 353, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 271
start codons at 26, 32, 88, 101, 333, 462
confident = false

REJECT CONTIGS

TIG 1[bases=560]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=0)
0-79 ==> 5921-6000 on rc of segment after IGHV3-48 exon 1 [len=6000] (mis=0)
39-90 ==> 3150-3201 on rc of segment before IGHV3-33 exon 2 [len=3201] (mis=9)
47-115 ==> 6506-6574 on segment before IGHV3OR16-9 exon 1 [len=6692] (mis=3)
79-114 ==> 0-35 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=0)
114-430 ==> 37-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=11) [SHIFT!]
438-489 ==> 10-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
489-560 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
cdr3 = CAIIPSHYYMDVW at 419, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 187
start codons at 79, 233, 354, 380, 446
confident = false
frameshifted full length stopped transcript of length 560
VJ delta = 23
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.400 = GATCAGTCAGGAATGC-1

using 321 reads

====================================================================================

graph has 40 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 314]
surviving nonsolo ucounts = 1[314]
ids = [2]

====================================================================================

UMI info for barcode GATCAGTCAGGAATGC-1 contig 1 = AGGAGTCAGA...
umi GAATTCGGCG = 310 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQYNGQSRAF at 354, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 310
start codons at 27, 33, 102, 238, 241, 334, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.401 = GATCAGTCAGGCGATA-1

using 309 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[308]
surviving nonsolo ucounts = 1[308]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.404 = GATCAGTCAGTGGGAT-1

using 169 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[166]
surviving nonsolo ucounts = 1[166]
ids = [3]

====================================================================================

UMI info for barcode GATCAGTCAGTGGGAT-1 contig 1 = ACCCAAAAAC...
umi TTGTTAGGCG = 157 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=513]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=44)
432-481 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=8)
481-513 ==> 0-32 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 24 reads
cdr3 = CARDLFENAITSRWFDSW at 396, score = 8 + 7
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 155
start codons at 54, 141, 190, 274, 289, 360, 418, 434
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.408 = GATCAGTCATCATCCC-1

using 71 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[71]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.411 = GATCAGTCATGCCTTC-1

using 273 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 267]
surviving nonsolo ucounts = 1[267]
ids = [4]

====================================================================================

UMI info for barcode GATCAGTCATGCCTTC-1 contig 1 = GCTCTGCTTC...
umi TTCCAGGGTT = 260 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=564]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-564 ==> 0-119 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 255
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.416 = GATCAGTCATTCTCAT-1

using 275 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTCATTCTCAT-1 contig 1 = TGAGCGCAGA...
umi AAAGGTCCTC = 268 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=532]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-361 ==> 0-325 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=10)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
430-532 ==> 0-102 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAVWDDSLDTGRGVF at 357, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 262
start codons at 36, 190, 241, 370
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.420 = GATCAGTGTACAAGTA-1

using 756 reads

====================================================================================

graph has 236 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[6, 357, 387]
surviving nonsolo ucounts = 2[357, 387]
ids = [3, 2]

====================================================================================

UMI info for barcode GATCAGTGTACAAGTA-1 contig 1 = AGGAATCAGT...
umi CCAAACAATC = 355 reads: +388 validated

UMI info for barcode GATCAGTGTACAAGTA-1 contig 2 = TGGGGGATCA...
umi CACACGCATG = 392 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 27, 33, 102, 238, 457
confident = false

TIG 2[bases=568]
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
394-432 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 62 reads
cdr3 = CMQALQIRETF at 371, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 380
start codons at 35, 68, 104, 192, 354, 374, 474
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.423 = GATCAGTGTAGAAGGA-1

using 147 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 141]
surviving nonsolo ucounts = 1[141]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTGTAGAAGGA-1 contig 1 = AGCTCTGAGA...
umi CCCAGGGGTA = 142 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=544]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-544 ==> 0-41 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 139
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.425 = GATCAGTGTAGAGGAA-1

using 193 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2, 3, 5, 181]
surviving nonsolo ucounts = 1[181]
ids = [5]

====================================================================================

UMI info for barcode GATCAGTGTAGAGGAA-1 contig 1 = GGGTAGAGAA...
umi TCCCCAACCT = 171 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=496]
0-35 ==> 79-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
35-388 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
423-496 ==> 0-73 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CASWDDSLRGRVF at 356, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 168
start codons at 35, 189, 339, 364, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.427 = GATCAGTGTAGCGCTC-1

using 21 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.433 = GATCAGTGTCCAACTA-1

using 764 reads

====================================================================================

graph has 214 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[3, 228, 237, 289]
surviving nonsolo ucounts = 3[228, 237, 289]
ids = [7, 9, 8]

====================================================================================

UMI info for barcode GATCAGTGTCCAACTA-1 contig 1 = GGGGTCTCAG...
umi TGACCTTTTG = 223 reads: +394 validated
umi TGCACATTTC = 279 reads: +394 validated
umi TGCCGTTATC = 237 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=573]
0-38 ==> 125-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
38-392 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=0)
394-432 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
432-573 ==> 0-141 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 119 reads
cdr3 = CSSYAGSNNFGGVF at 362, score = 8 + 8
umis assigned: [7, 8, 9]
of which 3 are surviving nonsolos
reads assigned: 724
start codons at 38, 195, 239, 246, 345, 372
confident = true
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.440 = GATCAGTGTCTGCCAG-1

using 286 reads

====================================================================================

graph has 130 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[284]
surviving nonsolo ucounts = 1[284]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTGTCTGCCAG-1 contig 1 = GTGGGCTCAG...
umi CCGAGTGGTA = 283 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=547]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-547 ==> 0-127 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 274
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.444 = GATCAGTGTGCACGAA-1

using 273 reads

====================================================================================

graph has 75 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2, 4, 262]
surviving nonsolo ucounts = 1[262]
ids = [4]

====================================================================================

UMI info for barcode GATCAGTGTGCACGAA-1 contig 1 = GAGCTACAAC...
umi TCCTAGTATC = 263 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
390-427 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CHQYYSLLSF at 369, score = 9 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 260
start codons at 30, 352, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.446 = GATCAGTGTGTGCCTG-1

using 397 reads

====================================================================================

graph has 138 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[173, 221]
surviving nonsolo ucounts = 2[173, 221]
ids = [1, 0]

====================================================================================

UMI info for barcode GATCAGTGTGTGCCTG-1 contig 1 = ACCCAAAAAC...
umi AGGCCTCTCT = 165 reads: +436 validated

UMI info for barcode GATCAGTGTGTGCCTG-1 contig 2 = AGACCCAGTC...
umi ACCGCGCGTG = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=515]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-515 ==> 0-25 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 15 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 54, 252, 257, 274, 318, 351
confident = false

TIG 2[bases=476]
0-20 ==> 7-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
20-371 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
376-408 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
408-476 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYPPTF at 347, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.447 = GATCAGTGTGTTGAGG-1

using 319 reads

====================================================================================

graph has 86 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[316]
surviving nonsolo ucounts = 1[316]
ids = [0]

====================================================================================

UMI info for barcode GATCAGTGTGTTGAGG-1 contig 1 = GAAGAGCTGC...
umi ATTGGCCGCG = 294 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=505]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-370 ==> 0-337 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=9)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-505 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CQQYDRSWTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 289
start codons at 33, 367, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.455 = GATCAGTGTTGGTGGA-1

using 1015 reads

====================================================================================

graph has 1397 edges initially, 14 edges after simplification

total ucounts = 545
nonsolo ucounts = 192[2^86, 3^47, 4^24, 5^11, 6^8, 7^6, 8, 9^2, 10^2, 11^2, 13^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.458 = GATCAGTTCAAACGGG-1

using 164 reads

====================================================================================

graph has 242 edges initially, 2 edges after simplification

total ucounts = 77
nonsolo ucounts = 27[2^10, 3^8, 4, 5^3, 8, 9, 10^2, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.469 = GATCAGTTCATGTCCC-1

using 372 reads

====================================================================================

graph has 162 edges initially, 4 edges after simplification

total ucounts = 7
nonsolo ucounts = 6[2, 4, 5, 14, 149, 197]
surviving nonsolo ucounts = 2[149, 197]
ids = [0, 3]

====================================================================================

UMI info for barcode GATCAGTTCATGTCCC-1 contig 1 = AACCACATTC...
umi CATCGCATAC = 146 reads: +448 validated

UMI info for barcode GATCAGTTCATGTCCC-1 contig 2 = AGGCTGGTCA...
umi GAACCGACGC = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=537]
0-48 ==> 10-58 on |87|IGHV1-69D|5'UTR| [len=58] (mis=0)
48-401 ==> 0-353 on |88|IGHV1-69D|L-REGION+V-REGION| [len=353] (mis=5)
433-496 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=4)
496-537 ==> 0-41 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARGGWATGTTGLEKGYYYYAMDVW at 390, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 48, 108, 199, 246, 283, 345, 453
confident = false

TIG 2[bases=484]
0-47 ==> 134-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
47-398 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=8)
398-435 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
435-484 ==> 0-49 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CQQYNSYPLTF at 374, score = 8 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 47, 53, 109, 122, 258, 261, 354, 477
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.473 = GATCAGTTCCTAGGGC-1

using 383 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 5[2, 3, 4^2, 364]
surviving nonsolo ucounts = 1[364]
ids = [8]

====================================================================================

UMI info for barcode GATCAGTTCCTAGGGC-1 contig 1 = AGGAATCAGT...
umi TGGGCAATTC = 318 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=493]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-493 ==> 0-78 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [8]
of which 1 are surviving nonsolos
reads assigned: 315
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.476 = GATCAGTTCGCCATAA-1

using 1590 reads

====================================================================================

graph has 638 edges initially, 34 edges after simplification

total ucounts = 22
nonsolo ucounts = 12[2, 3^3, 4, 5^2, 7, 185, 229, 364, 770]
surviving nonsolo ucounts = 4[185, 229, 364, 770]
ids = [13, 19, 18, 1]

====================================================================================

UMI info for barcode GATCAGTTCGCCATAA-1 contig 1 = AGCTTCAGCT...
umi CCGTTAGCTG = 179 reads: +388 validated

UMI info for barcode GATCAGTTCGCCATAA-1 contig 2 = GGGGAGGAAT...
umi TATCTTATTA = 367 reads: +110 -1XX +13 -1XX +263 invalidated

UMI info for barcode GATCAGTTCGCCATAA-1 contig 3 = GGGGCTGGTC...
umi TATCTTTACC = 232 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=489]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-489 ==> 0-54 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [13]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 47, 201, 351, 376, 381
confident = false

TIG 2[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=17)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 58 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [18]
of which 1 are surviving nonsolos
reads assigned: 360
start codons at 31, 37, 106, 242, 461
confident = false

TIG 3[bases=572]
48-401 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=1)
397-436 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
436-572 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQSYSTPHTF at 375, score = 9 + 8
umis assigned: [19]
of which 1 are surviving nonsolos
reads assigned: 229
start codons at 48, 54, 110, 123, 259, 478
confident = false

REJECT CONTIGS

TIG 1[bases=443]
0-200 ==> 153-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=15)
249-283 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
283-443 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDKHFRDPYYHYSGALDHW at 189, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 763
start codons at 45, 50, 67, 111, 144, 337
confident = false
VJ delta = 6
not full
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.481 = GATCAGTTCTACCTGC-1

using 7687 reads

====================================================================================

graph has 4464 edges initially, 100 edges after simplification

total ucounts = 1171
nonsolo ucounts = 658[2^218, 3^120, 4^81, 5^60, 6^45, 7^36, 8^30, 9^16, 10^9, 11^11, 12^6, 13^6, 14^3, 15, 17^2, 21, 45, 58, 181, 208, 211, 214, 226, 236, 240, 286, 287, 298, 1885]
surviving nonsolo ucounts = 14[9, 45, 58, 181, 208, 211, 214, 226, 236, 240, 286, 287, 298, 1885]
ids = [491, 844, 61, 1065, 835, 857, 529, 481, 887, 1083, ...]

====================================================================================

UMI info for barcode GATCAGTTCTACCTGC-1 contig 1 = GGAGTCTCCC...
umi TACGTTTTCA = 41 reads: -81 +331 non-validated
umi TAGCTCTACA = 213 reads: +384 -1 +27 non-validated
umi TTCAGGCTTA = 237 reads: +370 -1 +10 -1 +1 -1 +7 -21 non-validated

UMI info for barcode GATCAGTTCTACCTGC-1 contig 2 = TGGGGGCTGG...
umi AATGCGCCTC = 60 reads: +391 validated
umi AATTGCCTTG = 289 reads: +391 validated
umi CGCTTATCGT = 226 reads: +391 validated
umi CTAGGCACAT = 156 reads: -15X +2 -6XX +2 -6XX +2 -1XX +1 -1XX +1 -6XX +348 invalidated
umi TACCAACCTA = 207 reads: +391 validated
umi TTACATATAA = 1873 reads: -325 +1 -3X +2 -2XX +1 -1XX +1 -20XX +3 -1XX +30 -1XX invalidated
umi TTACTCCTGG = 122 reads: +21 -2X +2 -6XX +2 -1XX +1 -1XX +1 -6XX +335 -1 +1 -3X +1 -1 +1 -1 +2 -1 +1 invalidated

GOOD CONTIGS

TIG 1[bases=542]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=11)
433-471 ==> 8-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 27 reads
cdr3 = CARHAGGGGVIYW at 401, score = 8 + 7
umis assigned: [844, 857, 1083]
of which 3 are surviving nonsolos
reads assigned: 486
start codons at 59, 233, 257, 392, 411
confident = true

TIG 2[bases=648]
46-407 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=14)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
437-648 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 125 reads
cdr3 = CSSFTSSSTLEVF at 370, score = 8 + 8
umis assigned: [61, 69, 481, 529, 835, 1060, 1065]
of which 7 are surviving nonsolos
reads assigned: 2883
start codons at 46, 203, 247, 254, 257
confident = true

REJECT CONTIGS

TIG 1[bases=557]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=3)
20-83 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
31-342 ==> 0-311 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=17)
383-421 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [450, 491, 887, 1131]
of which 4 are surviving nonsolos
reads assigned: 816
start codons at 31, 37, 93, 106, 369, 381, 463
confident = false
did not find CDR3
now this is a cell
paired!

CTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACATGCAGGGGGGGGAGGGGTGATCTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GGGCTCCAGGCTGAAGACGAGGCTGATTATTACTGCAGTTCATTTACAAGCAGCAGCACTCTCGAGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAA

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.485 = GATCAGTTCTGGCGAC-1

using 37 reads

====================================================================================

graph has 34 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 5[3, 4, 5, 9, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.486 = GATCAGTTCTGTCCGT-1

using 956 reads

====================================================================================

graph has 280 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[6^2, 11, 297, 632]
surviving nonsolo ucounts = 2[297, 632]
ids = [8, 7]

====================================================================================

UMI info for barcode GATCAGTTCTGTCCGT-1 contig 1 = GATCAGGACT...
umi TTGAAAAAGA = 637 reads: +400 validated
umi TTGGTAGCGG = 295 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=0)
392-430 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 128 reads
cdr3 = CMQALQTPPWTF at 366, score = 9 + 8
umis assigned: [7, 8]
of which 2 are surviving nonsolos
reads assigned: 922
start codons at 30, 63, 99, 187, 349, 369, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.487 = GATCAGTTCTTCGAGA-1

using 631 reads

====================================================================================

graph has 456 edges initially, 10 edges after simplification

total ucounts = 166
nonsolo ucounts = 60[2^22, 3^12, 4^12, 5^2, 7^2, 10, 11^2, 12^3, 14, 15, 19, 257]
surviving nonsolo ucounts = 1[257]
ids = [163]

====================================================================================

UMI info for barcode GATCAGTTCTTCGAGA-1 contig 1 = TGAGCGCAGA...
umi TTTCCGGCTA = 251 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=583]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=23)
386-424 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
424-583 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CGTWDNSLSAWVF at 357, score = 7 + 8
umis assigned: [163]
of which 1 are surviving nonsolos
reads assigned: 242
start codons at 36, 241, 365
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.492 = GATCGATAGAACTGTA-1

using 664 reads

====================================================================================

graph has 236 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[131, 247, 280]
surviving nonsolo ucounts = 3[131, 247, 280]
ids = [3, 7, 6]

====================================================================================

UMI info for barcode GATCGATAGAACTGTA-1 contig 1 = TGGGAGGAAT...
umi GACATCATGA = 133 reads: +388 validated
umi TCCCAGTCGA = 280 reads: +388 validated
umi TCTAAAGGCC = 259 reads: +247 -1XX +140 invalidated

GOOD CONTIGS

TIG 1[bases=555]
31-382 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
381-419 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 106 reads
cdr3 = CLQYSSSPWTF at 358, score = 9 + 8
umis assigned: [3, 6, 7]
of which 3 are surviving nonsolos
reads assigned: 647
start codons at 31, 37, 106, 242, 461
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.503 = GATCGATAGCTACCGC-1

using 251 reads

====================================================================================

graph has 104 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[36, 213]
surviving nonsolo ucounts = 1[213]
ids = [2]

====================================================================================

UMI info for barcode GATCGATAGCTACCGC-1 contig 1 = GCTGTGCTGT...
umi TAAGTTAACA = 205 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=568]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=1)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
425-568 ==> 0-143 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSADSSGTSVVF at 358, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 43, 104, 173, 191
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.504 = GATCGATAGCTAGTGG-1

using 2427 reads

====================================================================================

graph has 1967 edges initially, 38 edges after simplification

total ucounts = 500
nonsolo ucounts = 210[2^89, 3^55, 4^26, 5^13, 6^9, 7^3, 8, 9, 10, 11^2, 14, 15, 40, 93, 114, 154, 156, 229, 252, 433]
surviving nonsolo ucounts = 8[40, 93, 114, 154, 156, 229, 252, 433]
ids = [284, 116, 168, 48, 355, 274, 159, 29]

====================================================================================

UMI info for barcode GATCGATAGCTAGTGG-1 contig 1 = AGCTCTGAGA...
umi ATTTCGTAGC = 66 reads: -403X +2 -2XX +1 -10XX +1 -1XX +1 -3XX +1 -5XX +1 -2XX +2 -1XX invalidated
umi GCAATCAGGC = 221 reads: +91 -1XX +2 -2XX +1 -2XX +337 invalidated
umi GCCCTTCGCT = 17 reads: -9X +5 -3XX +25 -1XX +15 -1XX +18 -20 +51 -1XX +3 -2XX +1 -1X +3 -1X +3 -49 +1 -1X +2 -2X +1 -1X +1 -2X +1 -3X +1 -5X +4 -1X +1 -1X +5 -1X +42 -1XX +1 -1XX +4 -1XX +9 -2XX +4 -1XX +11 -1XX +21 -1X +1 -1X +4 -4X +1 -7X +1 -71X invalidated

UMI info for barcode GATCGATAGCTAGTGG-1 contig 2 = CTCTGACTCT...
umi AATCAACCAG = 436 reads: +379 validated
umi ACGCGCCTCA = 156 reads: +379 validated
umi CCACCCCGGA = 253 reads: +379 validated
umi CCCAATCCCC = 116 reads: +379 validated
umi TAACACGGTC = 159 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=697]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=5)
465-515 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
515-697 ==> 0-182 on |40|IGHG1|C-REGION| [len=884] (mis=1)
junction support: 1 umis using 24 reads
cdr3 = CARDAMGGSDDILTIYGMDVW at 421, score = 9 + 7
umis assigned: [116, 274, 284]
of which 3 are surviving nonsolos
reads assigned: 301
start codons at 79, 235, 431, 436, 472
confident = true

TIG 2[bases=706]
0-116 ==> 135-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
116-456 ==> 0-340 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=13)
457-495 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
495-706 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 5 umis using 107 reads
cdr3 = CQVWESSSGGVF at 431, score = 8 + 8
umis assigned: [29, 48, 159, 168, 355]
of which 5 are surviving nonsolos
reads assigned: 1097
start codons at 23, 116, 177, 318, 414
confident = true
now this is a cell
paired!

TATTACTGTGCGAGAGATGCGATGGGGGGCTCGGACGATATTTTGACCATCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAA <==> AGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGAGAGTAGTAGTGGTGGAGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.533 = GATCGATCAATGGATA-1

using 333 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[2^2, 3, 324]
surviving nonsolo ucounts = 1[324]
ids = [3]

====================================================================================

UMI info for barcode GATCGATCAATGGATA-1 contig 1 = AGGAGTCAGA...
umi CGCAACCGGC = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=501]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-378 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=4)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
415-501 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CQQYNSYPYTF at 354, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 27, 33, 89, 102, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.534 = GATCGATCACAACGCC-1

using 405 reads

====================================================================================

graph has 160 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 397]
surviving nonsolo ucounts = 1[397]
ids = [1]

====================================================================================

UMI info for barcode GATCGATCACAACGCC-1 contig 1 = ATCCAACAAC...
umi CCCAAGTTAA = 394 reads: +457 validated
umi GTCACTTAAT = 3 reads: -127 +1 -1X +6 -2X +8 -1X +6 -3X +3 -3X +22 -46 +3 -1X +30 -1X +2 -1X +3 -2X +5 -2X +6 -172 invalidated

GOOD CONTIGS

TIG 1[bases=583]
0-55 ==> 249-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
55-408 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=1)
405-436 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=5)
438-458 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=0)
464-512 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CAREECSGGSCYPTWIQLWLHPKDFDYW at 397, score = 9 + 7
umis assigned: [1, 4]
of which 1 are surviving nonsolos
reads assigned: 394
start codons at 55, 211, 253, 319, 352, 411, 450
confident = false
funny annotation
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.535 = GATCGATCACAAGCCC-1

using 322 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[2, 315]
surviving nonsolo ucounts = 1[315]
ids = [2]

====================================================================================

UMI info for barcode GATCGATCACAAGCCC-1 contig 1 = AGGAGTCAGA...
umi CAATCTTCAT = 294 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=510]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-366 ==> 0-339 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=12)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
415-510 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYYRSPITF at 354, score = 8 + 6
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 27, 33, 89, 102, 238, 259, 334, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.538 = GATCGATCACCGTTGG-1

using 79 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 74]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.541 = GATCGATCACGCGAAA-1

using 747 reads

====================================================================================

graph has 285 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[162, 582]
surviving nonsolo ucounts = 2[162, 582]
ids = [3, 4]

====================================================================================

UMI info for barcode GATCGATCACGCGAAA-1 contig 1 = GCAGGAGTCA...
umi CTTTAATATT = 523 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=498]
0-29 ==> 18-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
29-380 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
379-417 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
417-498 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 94 reads
cdr3 = CQQSYRRPITF at 356, score = 8 + 8
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 514
start codons at 29, 35, 91, 104, 240, 339, 459
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.547 = GATCGATCAGACGTAG-1

using 114 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[110]
surviving nonsolo ucounts = 1[110]
ids = [1]

====================================================================================

UMI info for barcode GATCGATCAGACGTAG-1 contig 1 = GCAGCACTCA...
umi CGCTTTTAGT = 100 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=504]
0-24 ==> 27-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
24-380 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
396-415 ==> 19-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
415-504 ==> 0-89 on |305|IGLC1|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 20 reads
cdr3 = CQSYDSSLSGYVF at 348, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 100
start codons at 24, 178, 232, 331, 358, 379
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.551 = GATCGATCAGGGTACA-1

using 400 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 396]
surviving nonsolo ucounts = 1[396]
ids = [0]

====================================================================================

UMI info for barcode GATCGATCAGGGTACA-1 contig 1 = GAGGAAAGTT...
umi CGACCGTCTA = 394 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=524]
17-370 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=0)
369-400 ==> 0-31 on |13|IGHD2-15|D-REGION| [len=31] (mis=6)
398-453 ==> 8-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
453-524 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CARDKIVVVVAAIYYYGMDVW at 359, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 391
start codons at 17, 173, 215, 281, 314, 410
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.561 = GATCGATCATGTCTCC-1

using 197 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[5, 189]
surviving nonsolo ucounts = 1[189]
ids = [2]

====================================================================================

UMI info for barcode GATCGATCATGTCTCC-1 contig 1 = GGGAGAGGAG...
umi CCCAGAGCCG = 180 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=534]
0-73 ==> 148-221 on |145|IGHV3-53|5'UTR| [len=221] (mis=3)
73-135 ==> 0-62 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=2)
135-420 ==> 65-350 on |146|IGHV3-53|L-REGION+V-REGION| [len=350] (mis=29)
442-488 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
488-534 ==> 0-46 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CARARFVITFGELDHW at 409, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 177
start codons at 73, 287, 302, 370
confident = false
see deletion of 3 bases at pos 62 on |146|IGHV3-53|L-REGION+V-REGION|
>vscore_64.561_60.5%
ATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTCCTATTTTAAAAGGTGTCCAGTGTGAGGTGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCGGGGGGGTCCCTAAGACTCTCCTGTGTAGCCTCTGGGTTGGCCGTCAGTAGCGCCTACGTGACCTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAGTGGGTCTCAATCATTTATAGCGATGGAAGGACCCACTATGCAGAGTCCGTGAAGGGCCGAGTCACCATCTCCAGAGACACTGCCAAGAACACGGTGTATCTCCAAATGGACAACCTGAGAGTCGAGGACACGGCCGTGTATTACTGTGCGAGAGCCA
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.567 = GATCGATGTACTTAGC-1

using 389 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 380]
surviving nonsolo ucounts = 1[380]
ids = [2]

====================================================================================

UMI info for barcode GATCGATGTACTTAGC-1 contig 1 = AGCATCATCC...
umi AGTTTGTCTA = 376 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=590]
0-61 ==> 243-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
61-414 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=2)
438-488 ==> 11-61 on |58|IGHJ6|J-REGION| [len=61] (mis=0)
488-590 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CARGTLTMVRGLYYMDVW at 403, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 374
start codons at 61, 217, 259, 325, 358, 424, 445, 506, 567
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.568 = GATCGATGTATGAATG-1

using 363 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[3, 4, 355]
surviving nonsolo ucounts = 1[355]
ids = [0]

====================================================================================

UMI info for barcode GATCGATGTATGAATG-1 contig 1 = AGGAATCAGA...
umi CTTCATATAG = 353 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |220|IGKV1-16|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |221|IGKV1-16|L-REGION+V-REGION| [len=351] (mis=6)
383-415 ==> 7-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 59 reads
cdr3 = CQQYNSYPPTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 350
start codons at 27, 33, 89, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.569 = GATCGATGTCAAACTC-1

using 75 reads

====================================================================================

graph has 36 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[4, 68]
surviving nonsolo ucounts = 1[68]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.572 = GATCGATGTCAGATAA-1

using 292 reads

====================================================================================

graph has 126 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 5[2^2, 4^2, 279]
surviving nonsolo ucounts = 1[279]
ids = [2]

====================================================================================

UMI info for barcode GATCGATGTCAGATAA-1 contig 1 = ACCCAAAAAC...
umi TACCTGAGAA = 281 reads: +427 validated

GOOD CONTIGS

TIG 1[bases=552]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=0)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=1)
413-440 ==> 0-27 on |18|IGHD3-10|D-REGION| [len=27] (mis=6)
435-481 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
481-552 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 23 reads
cdr3 = CARDPFDYYGSGSSIDYW at 396, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 275
start codons at 54, 205, 252, 257, 274, 289, 318, 351, 421
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.573 = GATCGATGTCATGCCG-1

using 643 reads

====================================================================================

graph has 198 edges initially, 4 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[299, 344]
surviving nonsolo ucounts = 2[299, 344]
ids = [0, 1]

====================================================================================

UMI info for barcode GATCGATGTCATGCCG-1 contig 1 = AGACCCAGTC...
umi CCTGAGACTG = 348 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=538]
0-20 ==> 27-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
20-371 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=11)
365-402 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
402-538 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQAKSFSF at 347, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 342
start codons at 20, 26, 82, 95, 231, 444
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.578 = GATCGATGTCGCTTTC-1

using 568 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 561]
surviving nonsolo ucounts = 1[561]
ids = [5]

====================================================================================

UMI info for barcode GATCGATGTCGCTTTC-1 contig 1 = GGGGAGGAAC...
umi TAAGCCAATC = 561 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=11)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=4)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 87 reads
cdr3 = CQHRSGWLITF at 357, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 555
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.583 = GATCGATGTGCAGTAG-1

using 10026 reads

====================================================================================

graph has 4868 edges initially, 58 edges after simplification

total ucounts = 688
nonsolo ucounts = 300[2^108, 3^63, 4^36, 5^26, 6^8, 7^7, 8, 9^5, 11, 12, 13, 14, 27, 36, 66, 118^3, 123, 125, 128, 156, 162, 163, 168, 170, 174, 184, 187, 191, 200, 207, 216, 217, 221, 231, 234, 235, 237, 242, 243, 246, 247, 267, 271, 272, 273, 276, 286, 295, 302, 329, 332, 466]
surviving nonsolo ucounts = 39[118^3, 123, 125, 128, 156, 162, 163, 168, 170, 174, 184, 187, 191, 200, 207, 216, 217, 221, 231, 234, 235, 237, 242, 243, 246, 247, 267, 271, 272, 273, 276, 286, 295, 302, 329, 332, 466]
ids = [102, 637, 682, 477, 81, 514, 658, 295, 553, 566, ...]

====================================================================================

UMI info for barcode GATCGATGTGCAGTAG-1 contig 1 = AGCTCTGAGA...
umi AAAAACGGCT = 232 reads: +439 validated
umi AATAGTGCCT = 222 reads: +439 validated
umi AGCTACAGTC = 115 reads: +415 -1 +8 -1 +14 non-validated
umi AGGAGCTCGC = 187 reads: +439 validated
umi AGTAATCGAT = 244 reads: +439 validated
umi CTCGTGTCAG = 186 reads: +439 validated
umi GCTCACTGTG = 176 reads: +439 validated
umi GTGCCATGTA = 164 reads: +439 validated
umi TCGACTCGGC = 170 reads: +411 -1 +2 -1 +2 -22 non-validated

UMI info for barcode GATCGATGTGCAGTAG-1 contig 2 = AGGAGTCAGA...
umi AAAATGGTTA = 243 reads: +388 validated
umi AATTTGCGGC = 220 reads: +388 validated
umi ACTCATCATG = 128 reads: +388 validated
umi AGCACATATA = 268 reads: +388 validated
umi ATTTTAGGCA = 217 reads: +388 validated
umi CAATTTGTTT = 294 reads: +388 validated
umi CACAGATGCC = 3 reads: -381 +2 -1X +4 invalidated
umi CCCACTTCAC = 213 reads: +388 validated
umi CGACAAGCGG = 240 reads: +388 validated
umi CGATTAGATA = 273 reads: +388 validated
umi CGTGCCTTTT = 162 reads: +388 validated
umi CTAAGGGGCT = 243 reads: +388 validated
umi CTGCTTCCGT = 334 reads: +388 validated
umi GACTCGTACT = 234 reads: +388 validated
umi GATCCGACGA = 301 reads: +388 validated
umi GGGTCGTACT = 272 reads: +388 validated
umi TAAAGACCGG = 277 reads: +388 validated
umi TAAATAACGG = 124 reads: +388 validated
umi TAACAATGAG = 240 reads: +388 validated
umi TAGTCACCCT = 126 reads: -349X +2 -1X +1 -1X +2 -1XX +14 -5XX +4 -1XX +2 -1XX +4 invalidated
umi TAGTTTACGC = 124 reads: +388 validated
umi TCCGTGGGAC = 164 reads: +388 validated
umi TCGCCGGGAT = 200 reads: +388 validated
umi TGCTGTTCAG = 284 reads: +388 validated
umi TGGCAATGTC = 266 reads: +388 validated
umi TTTGGTACTA = 337 reads: +388 validated
umi TTTTCAGCCT = 110 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=589]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=1)
437-461 ==> 0-24 on |21|IGHD3-3|D-REGION| [len=31] (mis=0)
468-518 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
518-589 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 7 umis using 119 reads
cdr3 = CARAAGITIFGVVTDDDAFDIW at 421, score = 9 + 8
umis assigned: [0, 26, 102, 108, 115, 318, 407, 453, 566]
of which 9 are surviving nonsolos
reads assigned: 1660
start codons at 79, 235, 382, 464, 467, 470, 499
confident = true

TIG 2[bases=551]
0-27 ==> 154-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
27-372 ==> 0-345 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=0)
377-415 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 25 umis using 856 reads
cdr3 = CQQYNSIRSTF at 354, score = 8 + 8
umis assigned: [4, 35, 81, 96, 168, 180, 181, 231, 270, 276] and 17 others
of which 27 are surviving nonsolos
reads assigned: 5797
start codons at 27, 33, 89, 102, 334, 457
confident = true
now this is a cell
paired!

TACTGTGCGAGAGCGGCGGGTATTACGATTTTTGGAGTGGTTACCGATGATGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG <==> ATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTATCAGGAGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.586 = GATCGATGTGTAAGTA-1

using 845 reads

====================================================================================

graph has 1154 edges initially, 10 edges after simplification

total ucounts = 410
nonsolo ucounts = 173[2^71, 3^38, 4^31, 5^13, 6^7, 7^4, 8^3, 9, 10, 12^2, 13^2]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.587 = GATCGATGTGTGAAAT-1

using 79 reads

====================================================================================

graph has 52 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 68]
surviving nonsolo ucounts = 1[68]
ids = [2]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.593 = GATCGATGTTCAGCGC-1

using 248 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 243]
surviving nonsolo ucounts = 1[243]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=550]
0-25 ==> 6-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
0-25 ==> 6797-6822 on rc of segment before IGKV3-34 exon 2 [len=6822] (mis=0)
14-77 ==> 5678-5741 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
25-376 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=6)
376-414 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 241
start codons at 25, 31, 87, 100, 239, 456
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.600 = GATCGATTCAACCAAC-1

using 270 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 9, 255]
surviving nonsolo ucounts = 1[255]
ids = [1]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.607 = GATCGATTCAGCTTAG-1

using 217 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[215]
surviving nonsolo ucounts = 1[215]
ids = [0]

====================================================================================

UMI info for barcode GATCGATTCAGCTTAG-1 contig 1 = GTGGGTCCAG...
umi CACCTCTGGC = 211 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=530]
0-35 ==> 8-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
35-372 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
379-417 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
417-530 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQSADSSGTYVVF at 350, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 35, 96, 165, 183, 378
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.608 = GATCGATTCAGGCGAA-1

using 16225 reads

====================================================================================

graph has 5414 edges initially, 90 edges after simplification

total ucounts = 435
nonsolo ucounts = 199[2^66, 3^36, 4^16, 5^12, 6^6, 7^3, 8^4, 9^5, 10, 17^2, 20, 34, 51, 67, 70, 86, 98, 105, 106, 132, 147, 150, 154, 158, 176, 197, 207, 209, 242, 245, 248, 252, 253, 256, 266, 267, 269, 272, 274, 275, 293, 295, 306, 308, 309, 319, 323, 333, 336, 339^2, 431, 462, 692, 727, 1048, 1115, 2186]
surviving nonsolo ucounts = 46[17, 34, 51, 67, 70, 86, 98, 106, 132, 147, 150, 154, 158, 176, 197, 207, 209, 242, 245, 248, 252, 253, 256, 266, 267, 269, 272, 274, 275, 293, 295, 306, 308, 309, 319, 323, 333, 336, 339^2, 462, 692, 727, 1048, 1115, 2186]
ids = [313, 231, 270, 299, 415, 417, 201, 4, 298, 69, ...]

====================================================================================

UMI info for barcode GATCGATTCAGGCGAA-1 contig 1 = AATTAGGACT...
umi ACAGTCGTAC = 291 reads: +397 validated
umi ACATTTGCTT = 207 reads: +397 validated
umi ATCGAGATCC = 295 reads: +397 validated
umi CAATTAACCC = 340 reads: +397 validated
umi CACGCACCTT = 326 reads: +397 validated
umi CCCTCTCGGG = 46 reads: -363X +2 -1X +8 -1XX +5 -5XX +4 -1XX +2 -1XX +4 invalidated
umi CTTGAATGGA = 279 reads: +397 validated
umi TAAACCGTCG = 268 reads: +397 validated
umi TAATGGCTGG = 310 reads: +397 validated
umi TATCATTGGA = 268 reads: +397 validated
umi TGGCTCCGTA = 327 reads: +397 validated

UMI info for barcode GATCGATTCAGGCGAA-1 contig 2 = AGCTCTGGGA...
umi AAAGTTGAAC = 108 reads: +366 -21 +14 -1 +9 -1 +18 -2 +1 non-validated
umi AATCGCTGTA = 342 reads: +433 validated
umi ACCATCTGAC = 322 reads: +433 validated
umi ACCATTCGTC = 150 reads: +433 validated
umi ATCCAAGGTC = 147 reads: +392 -1 +4 -2 +1 -1 +1 -1 +30 non-validated
umi CAGGCTCCAC = 233 reads: +433 validated
umi CGCTCAAGCT = 258 reads: +433 validated
umi CGGGTTTCTT = 256 reads: +426 -7 non-validated
umi CTCGGCTCGA = 246 reads: +418 -1 +14 non-validated
umi CTCTAACTCC = 99 reads: +88 -1XX +334 -10 invalidated
umi GTAGGGTTCT = 49 reads: +13 -1 +3 -4 +290 -2 +2 -1 +3 -1 +2 -1 +3 -1 +4 -1 +2 -1 +8 -1 +6 -3 +2 -1 +4 -1X +57 -15 invalidated
umi TAAGTCTTGG = 130 reads: +408 -1X +24 invalidated
umi TAATAATACC = 69 reads: +279 -1 +139 -14 non-validated
umi TAATGATGGG = 154 reads: +433 validated
umi TAGACACATA = 265 reads: +433 validated
umi TATTGCCTCC = 146 reads: +433 validated
umi TCAGTTCTAT = 198 reads: +433 validated
umi TCGAGATCGT = 213 reads: +433 validated
umi TCGGGTCTTC = 174 reads: +433 validated
umi TGGTGATACG = 309 reads: +433 validated
umi TTCATAGGCT = 71 reads: +359 -2 +2 -2 +68 non-validated
umi TTCGTTCATG = 88 reads: +360 -8 +7 -1 +48 -9 non-validated
umi TTGCGCTTTT = 252 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |262|IGKV2-24|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |263|IGKV2-24|L-REGION+V-REGION| [len=360] (mis=3)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 10 umis using 414 reads
cdr3 = CMQATQFSWTF at 366, score = 9 + 8
umis assigned: [33, 35, 74, 103, 111, 142, 217, 290, 302, 325] and 1 others
of which 10 are surviving nonsolos
reads assigned: 2914
start codons at 30, 63, 99, 187, 349, 369, 469
confident = true

TIG 2[bases=584]
0-80 ==> 0-80 on |139|IGHV3-43|5'UTR| [len=80] (mis=3)
80-435 ==> 0-355 on |140|IGHV3-43|L-REGION+V-REGION| [len=355] (mis=32)
467-513 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
513-584 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 17 umis using 217 reads
cdr3 = CAKDGRRRGSSWYLSSGDYW at 422, score = 8 + 7
umis assigned: [4, 23, 38, 39, 69, 118, 167, 177, 197, 201] and 13 others
of which 23 are surviving nonsolos
reads assigned: 4203
start codons at 80, 225, 231, 236, 315, 383, 432
confident = true

REJECT CONTIGS

TIG 1[bases=326]
57-86 ==> 4604-4633 on segment before IGLCOR22-1 exon 1 [len=6000] (mis=1)
77-115 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
115-326 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3, 185, 383, 405]
of which 4 are surviving nonsolos
reads assigned: 2943
start codons at 58
confident = false
did not find CDR3

TIG 2[bases=654]
15-39 ==> 5788-5812 on segment before IGLV2-34 exon 1 [len=6000] (mis=0)
34-100 ==> 5809-5875 on segment before IGLV2-34 exon 1 [len=6000] (mis=3)
53-414 ==> 0-361 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=15)
405-443 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=3)
443-654 ==> 0-211 on |305|IGLC1|C-REGION| [len=317] (mis=0)
cdr3 = CSSYTSSSTLESSELGP at 377, score = 7 + 4
umis assigned: [8, 55, 57, 183, 266, 379]
of which 6 are surviving nonsolos
reads assigned: 4016
start codons at 9, 53, 254, 261, 264, 372, 575
confident = false
not full
frameshifted full length transcript of length 654
VJ delta = 40
delta too large
not full
now this is a cell
paired!

TTCTATTACTGTGCAAAAGATGGACGAAGGAGGGGCAGCAGCTGGTACTTATCCTCAGGGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTATTGCATGCAAGCTACACAATTTTCGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.611 = GATCGATTCATCTGTT-1

using 37 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 1[32]
surviving nonsolo ucounts = 1[32]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.618 = GATCGATTCCATTCTA-1

using 269 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[266]
surviving nonsolo ucounts = 1[266]
ids = [1]

====================================================================================

UMI info for barcode GATCGATTCCATTCTA-1 contig 1 = TGATCAGGAC...
umi AGGATTCTTC = 248 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=519]
0-31 ==> 5-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
31-391 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=3)
390-428 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
428-519 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CMQALQTRETF at 367, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 31, 64, 100, 188, 350, 370, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.622 = GATCGATTCCTCCTAG-1

using 147 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [1]

====================================================================================

UMI info for barcode GATCGATTCCTCCTAG-1 contig 1 = TCTGAGGATA...
umi TTAAACGGCT = 142 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-86 ==> 0-86 on |732|IGLV6-57|5'UTR| [len=86] (mis=0)
86-439 ==> 0-353 on |384|IGLV6-57|L-REGION+V-REGION| [len=353] (mis=2)
436-474 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
474-549 ==> 0-75 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQSYDSSNVVF at 413, score = 6 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 140
start codons at 86, 149, 240, 291, 423, 435
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.626 = GATCGATTCGCGTAGC-1

using 8 reads

====================================================================================

graph has 4 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[8]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.632 = GATCGATTCTGTCCGT-1

using 18 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.638 = GATCGCGAGACTACAA-1

using 30032 reads

====================================================================================

graph has 8546 edges initially, 76 edges after simplification

total ucounts = 395
nonsolo ucounts = 212[2^55, 3^20, 4^14, 5^8, 6^5, 7^4, 8, 9^3, 10, 12, 15, 24, 26, 27, 32, 45, 46, 49, 53, 67, 101, 111, 112, 127^2, 139^2, 141, 154, 164, 178, 189, 191, 205, 209, 214, 218, 219, 220, 221, 222, 223, 224, 225, 228, 237, 242, 243^2, 244, 248, 250, 251, 254, 261, 268, 275, 279^2, 280, 288, 301^2, 306^2, 308, 309, 316, 321, 324, 325, 331, 334, 340^2, 343, 346, 347, 351, 352, 355, 357, 363, 365, 366, 368, 369, 372, 373, 377, 379, 390^2, 391, 395, 405^2, 407, 418, 423, 449, 452, 467, 479, 507, 556, 659, 660, 729, 1614]
surviving nonsolo ucounts = 90[24, 49, 53, 101, 111, 112, 127, 139^2, 141, 154, 164, 178, 189, 191, 205, 209, 214, 218, 219, 220, 221, 222, 223, 224, 225, 228, 237, 242, 243^2, 244, 248, 250, 251, 254, 261, 268, 275, 279^2, 280, 288, 301^2, 306^2, 308, 309, 316, 321, 324, 325, 331, 334, 340^2, 343, 346, 347, 351, 352, 357, 363, 365, 366, 368, 369, 372, 373, 377, 379, 390^2, 391, 395, 405^2, 407, 418, 423, 449, 452, 467, 507, 556, 659, 660, 729, 1614]
ids = [307, 231, 329, 41, 24, 92, 235, 258, 279, 379, ...]

====================================================================================

UMI info for barcode GATCGCGAGACTACAA-1 contig 1 = GGGAGAGCCC...
umi AAAAATGGGA = 469 reads: +382 validated
umi AAGTGCGTTG = 109 reads: +382 validated
umi ACCCGTACCG = 332 reads: +382 validated
umi AGACGTCCGC = 344 reads: +382 validated
umi AGGTACGGGT = 382 reads: +188 -1XX +193 invalidated
umi AGTAATCCTA = 224 reads: +382 validated
umi AGTTCTGGGA = 222 reads: +382 validated
umi ATCATCCCGT = 380 reads: +382 validated
umi ATGCTCCGGT = 111 reads: +382 validated
umi ATTGTGCGGG = 242 reads: +382 validated
umi ATTTGAGTAT = 318 reads: +382 validated
umi CAACGTCATT = 475 reads: +14 -1XX +41 -1XX +8 -1XX +3 -1XX +4 -1XX +21 -1XX +45 -2XX +7 -1XX +1 -1XX +16 -1XX +37 -1XX +8 -1XX +12 -1XX +38 -1XX +23 -2XX +2 -1XX +32 -2XX +2 -2XX +9 -2XX +1 -1XX +1 -6XX +1 -1X +1 -1XX +5 -4XX +8 -1XX +4 invalidated
umi CACAAATGAC = 333 reads: +382 validated
umi CACGGCCGCT = 306 reads: +382 validated
umi CAGATAAGAT = 379 reads: +382 validated
umi CATCCACCCG = 273 reads: +382 validated
umi CATCCTAGTA = 405 reads: +382 validated
umi CATTAACGGA = 283 reads: +382 validated
umi CATTGGGTAT = 370 reads: +382 validated
umi CCGATATTAA = 351 reads: +382 validated
umi CCTCCACCAT = 425 reads: +382 validated
umi CCTCTCTCCT = 365 reads: +382 validated
umi CGACTGATGA = 339 reads: +382 validated
umi CGGGGTTATG = 285 reads: +382 validated
umi CTACTTCATT = 287 reads: +382 validated
umi CTATACTTGT = 391 reads: +382 validated
umi CTATTTCAAC = 243 reads: +382 validated
umi CTCAGCAGCA = 555 reads: +382 validated
umi CTCGACCCTT = 453 reads: +382 validated
umi CTTACTCCCA = 345 reads: +382 validated
umi GATCCACTAT = 249 reads: +382 validated
umi GCGTTCACCT = 139 reads: +382 validated
umi GCTACTCGTG = 371 reads: +382 validated
umi GCTATCGTTG = 192 reads: +382 validated
umi GCTCCAATCA = 327 reads: +382 validated
umi GGCAATGAGT = 394 reads: +382 validated
umi GGTGGACGGT = 277 reads: +382 validated
umi GTTCAATATC = 222 reads: +382 validated
umi GTTTACTTCT = 299 reads: +382 validated
umi TAGCGTCGGG = 177 reads: +382 validated
umi TAGTTAACAG = 183 reads: +382 validated
umi TCACAAGTAC = 356 reads: +6 -1XX +7 -1XX +59 -1XX +10 -1XX +56 -2XX +7 -1XX +1 -2XX +2 -3XX +10 -1XX +37 -1XX +8 -1XX +20 -1XX +51 -1XX +2 -1XX +20 -1XX +15 -2XX +1 -1XX +1 -1XX +1 -1XX +2 -2XX +2 -1XX +2 -1XX +34 invalidated
umi TCGAGCAGGG = 237 reads: +382 validated
umi TCGGTCAGCA = 417 reads: +382 validated
umi TTACAGTTCC = 404 reads: +382 validated
umi TTATTAGCTC = 375 reads: +382 validated
umi TTCGGCGGGA = 249 reads: +382 validated
umi TTGGCCCCCA = 313 reads: +382 validated
umi TTGTAATCTA = 362 reads: +382 validated
umi TTTGTCATAA = 407 reads: +382 validated

UMI info for barcode GATCGCGAGACTACAA-1 contig 2 = AGCTCTGAGA...
umi ACCTGCAAAG = 78 reads: -394X +1 -3X +8 -2X +14 -1X +10 invalidated
umi ATTTAATCAG = 209 reads: +433 validated
umi CAACTCGAGA = 269 reads: +433 validated
umi CGTCTTTGTG = 157 reads: +433 validated
umi CGTTAGAGGG = 321 reads: +433 validated
umi CTATTCCATC = 264 reads: +433 validated
umi CTTGTAATTG = 41 reads: -433 non-validated
umi CTTTTTTACC = 128 reads: +432 -1 non-validated
umi GGGTACTCTT = 257 reads: +427 -1 +5 non-validated
umi GTGATCGTAC = 141 reads: +415 -18 non-validated
umi TCCTCTCTTT = 52 reads: +18 -1 +306 -1 +1 -1 +2 -2X +1 -1 +3 -1 +3 -1 +2 -3X +71 -1 +5 -9 invalidated
umi TCGGCACATT = 224 reads: +433 validated

GOOD CONTIGS

TIG 1[bases=565]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
390-429 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 48 umis using 2401 reads
cdr3 = CQQRSNWPGTF at 368, score = 9 + 8
umis assigned: [2, 24, 37, 57, 64, 65, 70, 81, 92, 103] and 40 others
of which 48 are surviving nonsolos
reads assigned: 15575
start codons at 47, 188, 252, 255, 471
confident = true

TIG 2[bases=583]
0-79 ==> 0-79 on |121|IGHV3-23|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |122|IGHV3-23|L-REGION+V-REGION| [len=353] (mis=4)
460-512 ==> 0-52 on |49|IGHJ1|J-REGION| [len=52] (mis=4)
512-583 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 118 reads
cdr3 = CAKDRSDSGSYYNARYFQHW at 421, score = 9 + 7
umis assigned: [41, 104, 111, 191, 192, 201, 231, 235, 272, 279] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2093
start codons at 79, 230, 235, 382
confident = true

REJECT CONTIGS

TIG 1[bases=718]
0-114 ==> 0-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
114-467 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=4)
469-507 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
507-718 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [3, 28, 66, 82, 160, 213, 216, 280, 309, 325] and 3 others
of which 13 are surviving nonsolos
reads assigned: 5146
start codons at 9, 13, 36, 114, 418, 443, 448, 460
confident = false
did not find CDR3

TIG 2[bases=396]
5-28 ==> 323-346 on rc of segment before IGHJ2 exon 1 [len=346] (mis=0)
88-245 ==> 0-157 on rc of segment before IGHJ2P exon 1 [len=157] (mis=0)
244-294 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=0)
294-396 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [17, 31]
of which 2 are surviving nonsolos
reads assigned: 618
start codons at 172, 210, 246, 275, 312, 373
confident = false
did not find CDR3

TIG 3[bases=557]
7-88 ==> 5665-5746 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=3)
31-384 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=8)
384-421 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
421-557 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [20, 59, 60, 79, 90, 145, 151, 203, 210, 357] and 2 others
of which 12 are surviving nonsolos
reads assigned: 4292
start codons at 31, 37, 93, 106, 242, 463
confident = false
did not find CDR3
now this is a cell
paired!

GTATATTACTGTGCGAAAGATCGCAGTGATTCAGGGAGTTATTATAACGCAAGGTACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTGGGACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.642 = GATCGCGAGAGCTGCA-1

using 309 reads

====================================================================================

graph has 146 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[306]
surviving nonsolo ucounts = 1[306]
ids = [1]

====================================================================================

UMI info for barcode GATCGCGAGAGCTGCA-1 contig 1 = AGTCTCAGTC...
umi ATGGAACTGG = 306 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=544]
0-20 ==> 3-23 on |252|IGKV1D-39|5'UTR| [len=23] (mis=0)
20-373 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=16)
371-408 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
408-544 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQSYNIPLTF at 347, score = 7 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 300
start codons at 20, 26, 82, 95, 231, 450
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.649 = GATCGCGAGCTAGGCA-1

using 332 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 3, 325]
surviving nonsolo ucounts = 1[325]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGAGCTAGGCA-1 contig 1 = GCTACAACAG...
umi CCGCAGATGC = 327 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=564]
0-28 ==> 147-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
28-391 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=1)
389-428 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
428-564 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 63 reads
cdr3 = CQQYYSTPYTF at 367, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 322
start codons at 28, 97, 350, 470
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.651 = GATCGCGAGCTCCTTC-1

using 254 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 249]
surviving nonsolo ucounts = 1[249]
ids = [2]

====================================================================================

UMI info for barcode GATCGCGAGCTCCTTC-1 contig 1 = AGCTCTGAGA...
umi CCAAAACTCT = 241 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=628]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-628 ==> 0-125 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 25 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 237
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.659 = GATCGCGAGTACTTGC-1

using 210 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 207]
surviving nonsolo ucounts = 1[207]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGAGTACTTGC-1 contig 1 = GGGGGTCTCA...
umi AGCAGAGGGA = 197 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=540]
39-390 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=4)
389-427 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
427-540 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CSSYTSSSTYVF at 363, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 39, 196, 240, 247, 250, 391
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.663 = GATCGCGAGTGGTAAT-1

using 614 reads

====================================================================================

graph has 210 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[240, 372]
surviving nonsolo ucounts = 2[240, 372]
ids = [2, 3]

====================================================================================

UMI info for barcode GATCGCGAGTGGTAAT-1 contig 1 = GGGAGGAACT...
umi GGGGCCTGCC = 240 reads: +385 validated
umi TTTCTGTGGA = 377 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=556]
0-35 ==> 12-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
35-380 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
381-420 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 2 umis using 107 reads
cdr3 = CQQRSNWPPYTF at 356, score = 9 + 8
umis assigned: [2, 3]
of which 2 are surviving nonsolos
reads assigned: 606
start codons at 35, 240, 243, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.665 = GATCGCGAGTTCCACA-1

using 242 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[242]
surviving nonsolo ucounts = 1[242]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGAGTTCCACA-1 contig 1 = ATCATCCAAC...
umi TAATCTTCGG = 234 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=525]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=41)
430-476 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=5)
476-525 ==> 0-49 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 26 reads
cdr3 = CALVSTLSALPFDFW at 400, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 232
start codons at 58, 256, 262, 355
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.670 = GATCGCGCAAGACGTG-1

using 207 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[203]
surviving nonsolo ucounts = 1[203]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGCAAGACGTG-1 contig 1 = GATCAGGACT...
umi AAGATGAGGA = 184 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=502]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=5)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
427-502 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CMQVLQPPQTF at 366, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 183
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.672 = GATCGCGCAATTCCTT-1

using 275 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[271]
surviving nonsolo ucounts = 1[271]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGCAATTCCTT-1 contig 1 = TGGGGAGGAG...
umi AGAGCTAGGT = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=556]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQQGYSIPLTF at 359, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 263
start codons at 32, 38, 94, 243, 297, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.676 = GATCGCGCACTTAAGC-1

using 435 reads

====================================================================================

graph has 202 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2, 3^3, 4, 5, 6, 8, 397]
surviving nonsolo ucounts = 1[397]
ids = [11]

====================================================================================

UMI info for barcode GATCGCGCACTTAAGC-1 contig 1 = GGGGAGGAAC...
umi TGCACGAATA = 400 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=554]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=3)
380-418 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
418-554 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSNWIFTF at 357, score = 9 + 8
umis assigned: [11]
of which 1 are surviving nonsolos
reads assigned: 394
start codons at 36, 241, 244, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.677 = GATCGCGCAGACGTAG-1

using 635 reads

====================================================================================

graph has 164 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 631]
surviving nonsolo ucounts = 1[631]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.679 = GATCGCGCAGGCTGAA-1

using 678 reads

====================================================================================

graph has 298 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[678]
surviving nonsolo ucounts = 1[678]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGCAGGCTGAA-1 contig 1 = GGGGAGGAGT...
umi TGGTCATAGT = 689 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=552]
0-31 ==> 0-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=2)
31-382 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=2)
378-416 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 117 reads
cdr3 = CQQYDNLPTF at 358, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 669
start codons at 31, 37, 93, 106, 245, 368, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.681 = GATCGCGCAGTCAGCC-1

using 268 reads

====================================================================================

graph has 218 edges initially, 2 edges after simplification

total ucounts = 19
nonsolo ucounts = 11[2, 3^2, 4, 5^2, 8^2, 9^2, 204]
surviving nonsolo ucounts = 1[204]
ids = [5]

====================================================================================

UMI info for barcode GATCGCGCAGTCAGCC-1 contig 1 = GGCTGGGGTC...
umi CAGGTGGTCA = 189 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=517]
0-42 ==> 0-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=1)
42-400 ==> 0-358 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=5)
395-433 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
433-517 ==> 0-84 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CCSYAGSYTSVVF at 366, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 185
start codons at 42, 181, 199, 243, 250, 253, 349, 376
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.692 = GATCGCGGTAACGACG-1

using 385 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[10, 369]
surviving nonsolo ucounts = 2[10, 369]
ids = [7, 2]

====================================================================================

UMI info for barcode GATCGCGGTAACGACG-1 contig 1 = GAGGAATCAG...
umi AATCTTTTTA = 373 reads: +388 validated
umi TACAATCCCG = 8 reads: -388 non-validated

GOOD CONTIGS

TIG 1[bases=552]
28-379 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
416-552 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 64 reads
cdr3 = CLQYSSSPWTF at 355, score = 9 + 8
umis assigned: [2, 7]
of which 2 are surviving nonsolos
reads assigned: 376
start codons at 28, 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.697 = GATCGCGGTATCTGCA-1

using 282 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 4[2, 3, 7, 269]
surviving nonsolo ucounts = 2[7, 269]
ids = [4, 1]

====================================================================================

UMI info for barcode GATCGCGGTATCTGCA-1 contig 1 = GGAGTCAGAC...
umi CCCAAACGTA = 237 reads: +388 validated
umi TAGCTCTCGC = 6 reads: -24 +56 -60 +24 -1 +112 -65 +46 non-validated

GOOD CONTIGS

TIG 1[bases=500]
0-26 ==> 3-29 on |234|IGKV1-6|5'UTR| [len=29] (mis=0)
26-377 ==> 0-351 on |235|IGKV1-6|L-REGION+V-REGION| [len=351] (mis=21)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-500 ==> 0-86 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CLQDYHYPYTF at 353, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 242
start codons at 26, 32, 88, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.698 = GATCGCGGTCAAAGAT-1

using 259 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGGTCAAAGAT-1 contig 1 = GATCAGGACT...
umi CGGTCGGTAC = 250 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=475]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
396-433 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
433-475 ==> 0-42 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CMQALQSPRGLTF at 366, score = 9 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 30, 63, 99, 187, 349, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.699 = GATCGCGGTCAGTGGA-1

using 22581 reads

====================================================================================

graph has 7220 edges initially, 76 edges after simplification

total ucounts = 608
nonsolo ucounts = 252[2^65, 3^38, 4^23, 5^16, 6^5, 7^4, 8^5, 9, 11^3, 12, 16, 30, 42, 52, 66, 68, 74, 76, 88, 101, 129, 137, 138, 144, 148, 151, 154^2, 155, 157, 165, 171, 186, 187, 188, 189, 191, 198, 206^2, 207, 209, 212, 214, 217, 218, 225^2, 227, 229^2, 233, 236, 238, 240^2, 250, 251, 257, 260^2, 261^2, 264, 265^3, 267^2, 268, 269, 270, 279, 280, 283, 289, 298, 299^2, 304, 306, 310^2, 314, 317^2, 319, 320, 321, 323, 336^2, 339, 347, 358, 365, 387, 435^2, 515, 550]
surviving nonsolo ucounts = 87[42, 52, 66, 68, 88, 101, 129, 137, 138, 144, 148, 151, 154^2, 155, 157, 165, 171, 186, 187, 188, 189, 191, 198, 206^2, 207, 209, 212, 214, 217, 218, 225^2, 227, 229^2, 233, 236, 238, 240^2, 250, 251, 257, 260^2, 261^2, 264, 265^3, 267^2, 268, 269, 270, 279, 280, 283, 289, 298, 299^2, 304, 306, 310^2, 314, 317^2, 319, 320, 321, 323, 336^2, 339, 347, 358, 365, 387, 435^2, 515, 550]
ids = [535, 149, 226, 85, 568, 111, 381, 468, 349, 546, ...]

====================================================================================

UMI info for barcode GATCGCGGTCAGTGGA-1 contig 1 = AGCCCTCAGA...
umi ACGTATCGCT = 223 reads: +430 validated
umi AGATCTTCAG = 149 reads: +412 -18 non-validated
umi AGCCGCGGGG = 230 reads: +430 validated
umi AGGGTCATCG = 67 reads: +430 validated
umi ATGCGATGTA = 189 reads: +430 validated
umi CAACGGCTGT = 51 reads: +378 -19 +18 -1 +14 non-validated
umi CCATGGCCTT = 228 reads: +430 validated
umi CTAATAAGGA = 153 reads: +430 validated
umi CTTTAGCTCT = 232 reads: +430 validated
umi GAACTCTTCA = 216 reads: +430 validated
umi GCCCCTTCAG = 150 reads: +430 validated
umi GCTTTTCTCC = 158 reads: +430 validated
umi TAATACTATG = 206 reads: +430 validated
umi TAATATTCCT = 229 reads: +430 validated
umi TATGATCCGA = 278 reads: +430 validated
umi TCACCAGTTA = 136 reads: +430 validated
umi TGAGCTAATC = 194 reads: +430 validated
umi TGCCATTATG = 43 reads: +337 -91 +2 non-validated
umi TGTAATCGGG = 148 reads: +430 validated
umi TTACTAGCAG = 158 reads: +430 validated
umi TTCATCAAGT = 85 reads: +424 -1 +5 non-validated

UMI info for barcode GATCGCGGTCAGTGGA-1 contig 2 = GGGGGAGGAG...
umi AAGCTTACCG = 317 reads: +382 validated
umi ACAACCGGTA = 262 reads: +382 validated
umi ACACACCGAG = 303 reads: +382 validated
umi ACGATTGGTT = 414 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2X +1 -50X +1 -6XX +1 -1XX +2 -7XX +156 invalidated
umi ACTTATGGTC = 323 reads: +382 validated
umi AGAATAGTCC = 259 reads: +382 validated
umi AGGACCTATC = 271 reads: +382 validated
umi AGTCACCTTC = 186 reads: +382 validated
umi ATCATTATGG = 102 reads: -3 +379 non-validated
umi ATCCCTCCAC = 312 reads: +382 validated
umi ATCGTCGCCT = 210 reads: +382 validated
umi ATCGTTAGAG = 288 reads: +382 validated
umi ATTCAGTCCG = 217 reads: +382 validated
umi CAAAGCCGTC = 207 reads: +382 validated
umi CACAGGCAGA = 320 reads: +382 validated
umi CACCGCGTGC = 157 reads: +382 validated
umi CACGTGTCGG = 300 reads: +382 validated
umi CCCACACCCT = 249 reads: +382 validated
umi CCGACTATCA = 433 reads: +382 validated
umi CCGATTGTTG = 354 reads: +382 validated
umi CCTATCCATT = 457 reads: +133 -1XX +1 -3XX +2 -6XX +1 -7XX +1 -2XX +1 -50X +1 -6XX +1 -1XX +2 -7XX +156 invalidated
umi CCTCGCGGTG = 314 reads: +382 validated
umi CGATATACCT = 316 reads: +382 validated
umi CGCCCTTCCA = 166 reads: +382 validated
umi CGGAACCGCT = 263 reads: +382 validated
umi CGTCGTACCG = 263 reads: +382 validated
umi CTAAAACGGG = 309 reads: +382 validated
umi CTCCGGCGAT = 340 reads: +382 validated
umi CTTAGTTCGA = 265 reads: +382 validated
umi GACCGGGATG = 271 reads: +382 validated
umi GAGCGCAGTG = 239 reads: +382 validated
umi GCCACGGGGG = 244 reads: +382 validated
umi GCCTATTACG = 347 reads: +382 validated
umi GCCTGCTGGC = 217 reads: +382 validated
umi GCGTCTTGCG = 186 reads: +382 validated
umi GCTACTTGGC = 143 reads: +382 validated
umi GCTCAAGTAT = 304 reads: +382 validated
umi GCTCATGGCT = 263 reads: +382 validated
umi GGCTGGTCCT = 305 reads: +382 validated
umi GGTGGGATAC = 518 reads: -276 +106 non-validated
umi GGTGTATTAC = 554 reads: +382 validated
umi GTAAAGGGGG = 130 reads: +382 validated
umi GTAGTGGGCG = 209 reads: +382 validated
umi GTCTACGCCA = 268 reads: +382 validated
umi TAAAGGGAAA = 250 reads: +382 validated
umi TACGTCCCGC = 264 reads: +382 validated
umi TATACCAGCT = 339 reads: +382 validated
umi TCAGCGAGGG = 238 reads: +382 validated
umi TCCATGTCCT = 333 reads: +382 validated
umi TCCCCGTCTG = 265 reads: +382 validated
umi TCTTTTAGTG = 318 reads: +382 validated
umi TGTCAGTTTC = 183 reads: +382 validated
umi TTAAGGGGCG = 309 reads: +382 validated
umi TTATATTCCG = 287 reads: +382 validated
umi TTATTTAGGG = 233 reads: +382 validated
umi TTCTTGATGG = 238 reads: +382 validated
umi TTTCACAATA = 268 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=669]
0-79 ==> 0-79 on |141|IGHV3-48|5'UTR| [len=79] (mis=2)
79-432 ==> 0-353 on |142|IGHV3-48|L-REGION+V-REGION| [len=353] (mis=33)
461-509 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
509-669 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 15 umis using 294 reads
cdr3 = CARESYVGLYSSTSYPDYW at 421, score = 8 + 7
umis assigned: [46, 59, 69, 85, 127, 149, 193, 266, 298, 301] and 11 others
of which 21 are surviving nonsolos
reads assigned: 3471
start codons at 79, 228, 235, 314, 356, 382, 437, 563
confident = true

TIG 2[bases=556]
38-284 ==> 0-246 on |237|IGKV1-8|L-REGION+V-REGION| [len=345] (mis=33)
382-420 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
420-556 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 57 umis using 2558 reads
cdr3 = CLHYDNRRRTF at 359, score = 9 + 8
umis assigned: [14, 21, 22, 41, 53, 54, 77, 88, 111, 114] and 47 others
of which 57 are surviving nonsolos
reads assigned: 15565
start codons at 38, 94, 107, 246, 369, 462
confident = true
now this is a cell
paired!

GCTGTGTATTACTGTGCGAGAGAATCTTATGTCGGGCTCTATTCTTCAACCAGTTACCCCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> GTCTCCAGCCTGCAACCTGAAGATTTTGCCACCTATTATTGTCTACACTATGATAATCGCCGTCGCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.704 = GATCGCGGTCCGAGTC-1

using 16956 reads

====================================================================================

graph has 4534 edges initially, 36 edges after simplification

total ucounts = 586
nonsolo ucounts = 237[2^71, 3^40, 4^18, 5^13, 6^7, 7^3, 8^4, 9, 10, 11, 12^2, 13, 15^3, 20, 23, 26, 42^3, 44, 47, 48, 63, 65, 67, 76, 93, 99, 119, 136, 144, 181, 184, 190, 198, 206, 207, 213, 215, 220, 227, 228, 237, 239^2, 242^2, 245^2, 246, 247, 248, 250, 255, 256, 270, 271, 277^2, 278, 280^2, 289, 290, 291, 292, 293^3, 295, 299, 306, 310, 311, 312, 313, 318, 324, 331, 332^2, 360, 361, 386, 480]
surviving nonsolo ucounts = 70[15^2, 20, 23, 42, 44, 48, 63, 65, 67, 76, 93, 99, 119, 136, 144, 181, 184, 190, 198, 206, 207, 213, 215, 220, 227, 228, 237, 239^2, 242^2, 245^2, 246, 247, 248, 250, 255, 256, 270, 271, 277^2, 278, 280^2, 289, 290, 291, 292, 293^3, 295, 299, 306, 310, 311, 312, 313, 318, 324, 331, 332^2, 360, 361, 386, 480]
ids = [346, 515, 397, 403, 390, 344, 299, 217, 463, 319, ...]

====================================================================================

UMI info for barcode GATCGCGGTCCGAGTC-1 contig 1 = AGGAGTCAGA...
umi AGCATCATAC = 292 reads: +388 validated
umi AGCTAGCTCT = 296 reads: +388 validated
umi AGGCGTTCAG = 270 reads: +388 validated
umi AGTTCGCAAC = 94 reads: +388 validated
umi CAACTATGCT = 277 reads: +388 validated
umi CATGAATGGA = 256 reads: +388 validated
umi CCTTGTATGA = 294 reads: +388 validated
umi CGACTGAAGG = 249 reads: +388 validated
umi CGATTAATCA = 61 reads: +388 validated
umi CGCGGGGTCA = 318 reads: +388 validated
umi CGGCCTCACG = 236 reads: +388 validated
umi CGTATGTATT = 210 reads: +388 validated
umi CGTGTTCCTT = 295 reads: +388 validated
umi CTGCTGTTGT = 332 reads: +388 validated
umi CTGTGTCACC = 139 reads: +388 validated
umi GAATTCATGC = 334 reads: +388 validated
umi GAGTCGTGTG = 75 reads: +388 validated
umi GAGTCGTTTG = 49 reads: -29 +359 non-validated
umi GCAATTTTAC = 232 reads: +388 validated
umi GTAAGCTCAC = 274 reads: +388 validated
umi GTACCCCGGG = 257 reads: +388 validated
umi GTATTACAGC = 368 reads: +388 validated
umi GTCAAATCTA = 196 reads: +388 validated
umi GTGCTTCACA = 245 reads: +388 validated
umi GTTGTATGCG = 306 reads: +388 validated
umi TACCATATTG = 312 reads: +388 validated
umi TATTTGGCGG = 290 reads: +388 validated
umi TCACCAGCGC = 291 reads: +388 validated
umi TCAGGGGATG = 211 reads: +388 validated
umi TCATGCGTAG = 181 reads: +388 validated
umi TCCCCACCGT = 314 reads: +388 validated
umi TCGGCAAAGT = 326 reads: +388 validated
umi TGATTCGCGA = 99 reads: +388 validated
umi TGCCGTTACG = 360 reads: +388 validated
umi TGTTAACGGC = 387 reads: +388 validated
umi TTCCCCTTAC = 295 reads: +388 validated
umi TTGTTTTCGG = 314 reads: +388 validated
umi TTTTACCCCT = 228 reads: +388 validated
umi TTTTGTGCGA = 249 reads: +388 validated
umi TTTTTCGTTG = 332 reads: +388 validated

UMI info for barcode GATCGCGGTCCGAGTC-1 contig 2 = GGCTTATATG...
umi AATCTCTTAT = 245 reads: +445 validated
umi ACCCGATGAT = 323 reads: +445 validated
umi ACGCTTTGTA = 283 reads: +445 validated
umi AGCCCAACGG = 205 reads: +445 validated
umi AGTCACCCTT = 248 reads: +445 validated
umi ATTCTGATCT = 243 reads: +445 validated
umi CCAATTGGCT = 246 reads: +445 validated
umi CGAATAACTT = 303 reads: +445 validated
umi GATTCGCCGC = 223 reads: +445 validated
umi GCGAGCTGCT = 68 reads: +445 validated
umi GCGCACGTCC = 183 reads: +445 validated
umi GCGGTATGTT = 43 reads: -33 +132 -2 +278 non-validated
umi GCGGTTTGTT = 15 reads: -58 +17 -1 +167 -1 +3 -1 +4 -2X +7 -1 +8 -34 +66 -29 +46 invalidated
umi GCTACTCAAG = 284 reads: +445 validated
umi GGATGGACGG = 276 reads: +445 validated
umi GTACTACTGG = 280 reads: +445 validated
umi GTCTTGGCGG = 42 reads: +70 -8 +1 -1 +365 non-validated
umi GTGCCTCGTT = 20 reads: -2 +303 -1 +9 -3 +112 -15 non-validated
umi GTGGCGCGGT = 23 reads: +78 -7 +254 -1 +4 -77 +24 non-validated
umi TACAAATGCG = 203 reads: +445 validated
umi TATAAGCCCT = 489 reads: +143 -2XX +1 -2XX +1 -1XX +3 -2XX +1 -8XX +1 -1X +1 -5X +2 -230X +1 -20XX +20 invalidated
umi TATTGTCTGC = 63 reads: +422 -7 +4 -1 +11 non-validated
umi TCGTATCTTG = 244 reads: -2XX +443 invalidated
umi TCTATTCTCC = 237 reads: +445 validated
umi TGCTGCTTCC = 16 reads: -48 +67 -1 +1 -18 +59 -1 +11 -1 +166 -72 non-validated
umi TGTTTTACCG = 297 reads: +445 validated
umi TTCAGGCCGT = 144 reads: +445 validated
umi TTCCCTGCCG = 218 reads: +445 validated
umi TTGGGCTTAT = 122 reads: +445 validated
umi TTTCTATCTG = 246 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 20-47 on |218|IGKV1-12|5'UTR| [len=47] (mis=0)
27-378 ==> 0-351 on |219|IGKV1-12|L-REGION+V-REGION| [len=351] (mis=1)
378-415 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 40 umis using 1514 reads
cdr3 = CQQANSFPLTF at 354, score = 9 + 9
umis assigned: [76, 81, 83, 100, 144, 178, 212, 215, 217, 223] and 30 others
of which 40 are surviving nonsolos
reads assigned: 9992
start codons at 27, 33, 89, 102, 238, 457
confident = true

TIG 2[bases=634]
29-404 ==> 0-375 on |188|IGHV4-39|L-REGION+V-REGION| [len=375] (mis=7)
421-474 ==> 0-53 on |51|IGHJ2|J-REGION| [len=53] (mis=0)
474-634 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 24 umis using 590 reads
cdr3 = CAPSGVAQGYWYFDLW at 395, score = 9 + 7
umis assigned: [25, 35, 46, 77, 91, 135, 184, 213, 308, 319] and 20 others
of which 30 are surviving nonsolos
reads assigned: 5707
start codons at 7, 13, 29, 38, 50, 94, 528
confident = true
now this is a cell
paired!

GCAGACACGGCTGTGTATTACTGTGCACCTTCTGGAGTGGCTCAGGGCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG <==> ATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCCCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.706 = GATCGCGGTCGCTTCT-1

using 120 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[120]
surviving nonsolo ucounts = 1[120]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGGTCGCTTCT-1 contig 1 = GCTCTGCTTC...
umi CCGCTATACA = 110 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=534]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-534 ==> 0-89 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 108
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.707 = GATCGCGGTCTGGAGA-1

using 338 reads

====================================================================================

graph has 108 edges initially, 4 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[23, 313]
surviving nonsolo ucounts = 2[23, 313]
ids = [3, 2]

====================================================================================

UMI info for barcode GATCGCGGTCTGGAGA-1 contig 1 = GAGAAGAGCT...
umi TCTTTTACCA = 284 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=518]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=6)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=1)
423-518 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQYGSSPMCIF at 359, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 35, 243, 369, 383, 465
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.708 = GATCGCGGTGAGGGAG-1

using 28 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[28]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.722 = GATCGCGTCAAACAAG-1

using 124 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[124]
surviving nonsolo ucounts = 1[124]
ids = [0]

====================================================================================

UMI info for barcode GATCGCGTCAAACAAG-1 contig 1 = ATGCTTTCTG...
umi AGCGTGCGCT = 124 reads: +463 validated

GOOD CONTIGS

TIG 1[bases=550]
16-393 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=0)
396-426 ==> 0-30 on |19|IGHD3-16|D-REGION| [len=37] (mis=2)
431-479 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
479-550 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CARHVGYDYVWGSYRPWYFDYW at 382, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 123
start codons at 0, 16, 25, 37, 81, 401
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.724 = GATCGCGTCACCACCT-1

using 57 reads

====================================================================================

graph has 24 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[56]
surviving nonsolo ucounts = 1[56]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=400]
0-337 ==> 23-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=1)
336-374 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
374-400 ==> 0-26 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CMQALQTPWTF at 313, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 52
start codons at 10, 46, 134, 296, 316
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.732 = GATCGCGTCCAGAAGG-1

using 5663 reads

====================================================================================

graph has 3048 edges initially, 48 edges after simplification

total ucounts = 385
nonsolo ucounts = 165[2^71, 3^28, 4^6, 5^5, 6^4, 7^2, 8^2, 9, 10^2, 11, 12, 13^2, 16, 19, 28^2, 29, 57, 62, 66, 73, 75, 76, 85^2, 89, 90, 91, 94, 95, 108^2, 109, 112^2, 116, 122, 125^2, 129^2, 131, 138, 147, 154, 164, 170, 192, 223, 278, 427, 559]
surviving nonsolo ucounts = 39[2, 16, 28^2, 29, 62, 66, 73, 75, 76, 85^2, 89, 90, 91, 94, 95, 108^2, 109, 112^2, 116, 122, 125^2, 129^2, 131, 138, 147, 154, 164, 170, 192, 223, 278, 427, 559]
ids = [116, 226, 106, 151, 33, 358, 288, 65, 218, 286, ...]

====================================================================================

UMI info for barcode GATCGCGTCCAGAAGG-1 contig 1 = TGGGGAGCAG...
umi ACCATCTTTC = 152 reads: +397 validated
umi ACTCGCATGG = 195 reads: +397 validated
umi ACTGGTGTTC = 292 reads: +310 -5XX +1 -1XX +2 -1XX +1 -7XX +1 -2XX +1 -65XX invalidated
umi AGTAATCGTC = 129 reads: +397 validated
umi ATACGATCAT = 430 reads: -176X +1 -2XX +218 invalidated
umi GTATATTCGC = 113 reads: +397 validated
umi TCCTGCTTCG = 113 reads: +397 validated
umi TCCTGGTTCC = 121 reads: +397 validated
umi TTATCCCAGT = 126 reads: +397 validated
umi TTCAATATCT = 130 reads: +397 validated
umi TTCACGTCGG = 62 reads: +364 -1 +32 non-validated

GOOD CONTIGS

TIG 1[bases=638]
30-382 ==> 0-352 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=26)
389-427 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
427-638 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 316 reads
cdr3 = CETWDNNNWVF at 366, score = 7 + 8
umis assigned: [21, 36, 37, 61, 74, 261, 319, 320, 353, 355] and 1 others
of which 11 are surviving nonsolos
reads assigned: 1818
start codons at 30, 194, 349
confident = true

REJECT CONTIGS

TIG 1[bases=522]
0-19 ==> 1879-1898 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
3-24 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
4-25 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
5-26 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
6-27 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
10-31 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
11-32 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
12-33 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
13-34 ==> 1876-1897 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=1)
17-38 ==> 1874-1895 on segment before IGHVIII-67-4 exon 1 [len=2213] (mis=0)
35-282 ==> 106-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=28)
328-362 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
362-522 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
cdr3 = CARDWDHLTVVRGGMGSGYW at 271, score = 10 + 7
umis assigned: [4, 6, 20, 33, 53, 65, 84, 106, 108, 130] and 10 others
of which 20 are surviving nonsolos
reads assigned: 1410
start codons at 85, 123, 146, 164, 232, 313, 416
confident = false
VJ delta = 6
not full
not full

TIG 2[bases=497]
0-76 ==> 10064-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=3)
58-96 ==> 0-38 on |75|IGHV1-45|L-REGION+V-REGION| [len=353] (mis=2)
104-189 ==> 0-85 on rc of segment before IGHV1-17 exon 1 [len=85] (mis=5)
392-426 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=1)
426-497 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
umis assigned: [79, 118, 182, 185, 226, 326]
of which 6 are surviving nonsolos
reads assigned: 1147
start codons at 58, 128, 189, 304, 308, 329, 345, 353, 387
confident = false
frameshifted full length stopped transcript of length 497
did not find CDR3
now this is a cell
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.745 = GATCGCGTCTCTAAGG-1

using 46 reads

====================================================================================

graph has 12 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[45]
surviving nonsolo ucounts = 1[45]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=369]
0-335 ==> 13-348 on |292|IGKV3D-20|L-REGION+V-REGION| [len=348] (mis=3)
331-369 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
cdr3 = CQQYGSSRTF at 311, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 40
start codons at 195, 198, 321
confident = false
not full
VJ delta = 14
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.746 = GATCGCGTCTGCAAGT-1

using 156 reads

====================================================================================

graph has 54 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[63, 90]
surviving nonsolo ucounts = 2[63, 90]
ids = [1, 0]

====================================================================================

UMI info for barcode GATCGCGTCTGCAAGT-1 contig 1 = AGTCTGGGCC...
umi AATATTTGAT = 80 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=538]
0-40 ==> 211-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
40-391 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=3)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
425-538 ==> 0-113 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQVWDSSSDHPGVF at 355, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 79
start codons at 40, 101, 239, 242, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.748 = GATCGTAAGACTTGAA-1

using 543 reads

====================================================================================

graph has 232 edges initially, 6 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[4, 267^2]
surviving nonsolo ucounts = 2[267^2]
ids = [0, 6]

====================================================================================

UMI info for barcode GATCGTAAGACTTGAA-1 contig 1 = GAGTCAGACT...
umi CACCACCCCG = 269 reads: +388 validated

UMI info for barcode GATCGTAAGACTTGAA-1 contig 2 = GTTCACCTTC...
umi TCCCTTCTGG = 272 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYDSFSWTF at 352, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 25, 31, 87, 100, 236, 239, 332, 362, 455
confident = false

TIG 2[bases=548]
15-375 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
374-412 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
412-548 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CMQALQTRETF at 351, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 264
start codons at 15, 48, 84, 172, 334, 354, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.752 = GATCGTAAGATAGCAT-1

using 77 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 70]
surviving nonsolo ucounts = 1[70]
ids = [3]

====================================================================================

UMI info for barcode GATCGTAAGATAGCAT-1 contig 1 = GAGCTACAAC...
umi CTATCATTAA = 65 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=518]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-518 ==> 0-88 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 9 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 65
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.753 = GATCGTAAGATAGGAG-1

using 609 reads

====================================================================================

graph has 222 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 604]
surviving nonsolo ucounts = 1[604]
ids = [4]

====================================================================================

REJECT CONTIGS

TIG 1[bases=462]
0-22 ==> 38-60 on |373|IGLV4-69|5'UTR| [len=60] (mis=0)
0-22 ==> 5978-6000 on segment before IGLV4-60 exon 1 [len=6000] (mis=0)
22-252 ==> 0-230 on |374|IGLV4-69|L-REGION+V-REGION| [len=359] (mis=9)
251-462 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 597
start codons at 22, 183, 223, 239
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.765 = GATCGTAAGGAGTACC-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.766 = GATCGTAAGGCCCTTG-1

using 65 reads

====================================================================================

graph has 30 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[63]
surviving nonsolo ucounts = 1[63]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=395]
5-64 ==> 5638-5697 on segment before IGLV3-29 exon 1 [len=6000] (mis=4)
17-368 ==> 0-351 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=6)
361-395 ==> 0-34 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
cdr3 = CQVWDSSSDHWVF at 332, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 56
start codons at 17, 78, 216, 219, 315
confident = false
not full
VJ delta = 26
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.772 = GATCGTAAGTACTTGC-1

using 260 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[259]
surviving nonsolo ucounts = 1[259]
ids = [0]

====================================================================================

UMI info for barcode GATCGTAAGTACTTGC-1 contig 1 = GCTGGGGTCA...
umi AGGATAACAA = 240 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=560]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=2)
397-435 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
435-560 ==> 0-125 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CCSYAGSSTLGVVF at 365, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 239
start codons at 41, 180, 242, 249, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.783 = GATCGTACAAGTTGTC-1

using 112 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[112]
surviving nonsolo ucounts = 1[112]
ids = [0]

====================================================================================

UMI info for barcode GATCGTACAAGTTGTC-1 contig 1 = GTCAGACTCA...
umi CCCGCATGTT = 106 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=482]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
411-482 ==> 0-71 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 13 reads
cdr3 = CQQYNGQSRAF at 350, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 106
start codons at 23, 29, 98, 234, 237, 330, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.787 = GATCGTACACCAACCG-1

using 1468 reads

====================================================================================

graph has 440 edges initially, 42 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[276, 306, 884]
surviving nonsolo ucounts = 3[276, 306, 884]
ids = [2, 0, 4]

====================================================================================

UMI info for barcode GATCGTACACCAACCG-1 contig 1 = AGCTTCAGCT...
umi CCTCTCGCTT = 275 reads: +388 validated

UMI info for barcode GATCGTACACCAACCG-1 contig 2 = GAGGCAGAGG...
umi AGTGGGAAGT = 300 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=564]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-355 ==> 0-308 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=14)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-564 ==> 0-129 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CVAWDDSLYAWVF at 368, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 270
start codons at 47, 351, 381, 393
confident = false

TIG 2[bases=623]
0-80 ==> 82-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=2)
80-420 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=11)
427-465 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
465-623 ==> 0-158 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CCSKAGRSYVF at 404, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 80, 219, 288, 429, 597
confident = false

REJECT CONTIGS

TIG 1[bases=301]
3-75 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
27-153 ==> 0-126 on |229|IGKV1-37|L-REGION+V-REGION| [len=351] (mis=1)
165-301 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 870
start codons at 27, 33, 89, 207
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.789 = GATCGTACACCGCTAG-1

using 258 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 254]
surviving nonsolo ucounts = 1[254]
ids = [2]

====================================================================================

UMI info for barcode GATCGTACACCGCTAG-1 contig 1 = CAGTCCCAAC...
umi CTGCCGTGGA = 225 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=496]
0-21 ==> 10-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
21-372 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=0)
368-406 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=4)
406-496 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYDNLPTF at 348, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 225
start codons at 21, 27, 83, 96, 235, 358, 448
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.792 = GATCGTACACGAGAGT-1

using 171 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[168]
surviving nonsolo ucounts = 1[168]
ids = [2]

====================================================================================

UMI info for barcode GATCGTACACGAGAGT-1 contig 1 = GATCAGGACT...
umi CGGATAGCCT = 150 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=487]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-487 ==> 0-60 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 148
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.798 = GATCGTACAGATCGGA-1

using 7837 reads

====================================================================================

graph has 3402 edges initially, 90 edges after simplification

total ucounts = 513
nonsolo ucounts = 206[2^66, 3^47, 4^19, 5^10, 6^12, 7^5, 8^3, 9^2, 10^3, 11^2, 13^2, 14^2, 15, 16, 18, 21, 23, 28, 38, 49, 121, 141, 164, 184, 213, 219, 220, 223, 238, 243, 248, 250, 259^2, 262, 269^2, 274, 275, 282, 286, 307, 337, 488, 637]
surviving nonsolo ucounts = 28[13, 28, 38, 49, 121, 164, 184, 213, 219, 220, 223, 238, 243, 248, 250, 259^2, 262, 269^2, 274, 275, 282, 286, 307, 337, 488, 637]
ids = [343, 454, 149, 344, 446, 100, 117, 319, 246, 190, ...]

====================================================================================

UMI info for barcode GATCGTACAGATCGGA-1 contig 1 = GGGGAAACAG...
umi ATCTATCCAC = 167 reads: +388 validated
umi CCGGGGGGGC = 270 reads: +388 validated
umi CCTGCTCATT = 213 reads: +388 validated
umi CTATCATTCC = 241 reads: +388 validated
umi CTTCCTGCCC = 215 reads: +388 validated
umi GCCATCTCCT = 237 reads: +388 validated
umi GTCATCAGTT = 12 reads: -217 +10 -3XX +3 -1XX +5 -2XX +2 -1XX +1 -1XX +1 -1XX +2 -2XX +20 -1XX +3 -1XX +7 -1XX +1 -1XX +3 -4XX +3 -1XX +1 -1XX +2 -86X invalidated
umi TAGGCTGTTC = 252 reads: +388 validated
umi TCGGGTACAC = 276 reads: +388 validated
umi TGGGCCTGGT = 120 reads: +388 validated
umi TGTCCAAGCA = 29 reads: +353 -35 non-validated
umi TTCCTTAGTG = 284 reads: +388 validated

UMI info for barcode GATCGTACAGATCGGA-1 contig 2 = GGGAGAGGAG...
umi TTTTCACTTC = 251 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=640]
41-393 ==> 0-352 on |333|IGLV10-54|L-REGION+V-REGION| [len=352] (mis=18)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
429-640 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 10 umis using 380 reads
cdr3 = CSAWDSSLNVWVF at 362, score = 7 + 8
umis assigned: [100, 182, 190, 224, 246, 285, 319, 365, 416, 446] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2290
start codons at 41, 180, 370, 387
confident = true

TIG 2[bases=505]
0-73 ==> 7-80 on |123|IGHV3-30|5'UTR| [len=80] (mis=0)
73-424 ==> 0-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=21)
429-479 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
479-505 ==> 0-26 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 105 reads
cdr3 = CVKEENAFDIW at 415, score = 9 + 8
umis assigned: [506]
of which 1 are surviving nonsolos
reads assigned: 249
start codons at 73, 224, 229, 290, 376, 431, 460
confident = true

REJECT CONTIGS

TIG 1[bases=570]
1-80 ==> 5529-5608 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=2)
35-395 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=6)
396-434 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
434-570 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CWGLLLHASSINSSITF at 355, score = 4 + 8
umis assigned: [132, 167, 239, 283, 311, 408, 431, 494]
of which 8 are surviving nonsolos
reads assigned: 2458
start codons at 35, 68, 104, 155, 192, 354, 374, 476
confident = false
not full
frameshifted full length stopped transcript of length 570
VJ delta = 30
not full

TIG 2[bases=368]
15-211 ==> 155-351 on |124|IGHV3-30|L-REGION+V-REGION| [len=351] (mis=14)
216-266 ==> 0-50 on |53|IGHJ3|J-REGION| [len=50] (mis=3)
266-368 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
cdr3 = CVKEENAFDIW at 202, score = 9 + 8
umis assigned: [95]
of which 1 are surviving nonsolos
reads assigned: 483
start codons at 11, 16, 77, 163, 218, 247, 284, 345
confident = false
VJ delta = 8
not full
not full
now this is a cell
paired!

AACAGCCTGAGAGCTGAAGACACGGCTCTTTACTACTGTGTTAAAGAGGAAAATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCGG <==> GGACTCCAGCCTGACGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAATGTTTGGGTGTTCGGCGGAGGGACCAAACTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.799 = GATCGTACAGCGATCC-1

using 281 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[3, 277]
surviving nonsolo ucounts = 1[277]
ids = [2]

====================================================================================

UMI info for barcode GATCGTACAGCGATCC-1 contig 1 = AGCTGTGGGC...
umi GGGCATCCTT = 261 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=494]
0-40 ==> 0-40 on |356|IGLV3-19|5'UTR| [len=40] (mis=0)
40-377 ==> 0-337 on |357|IGLV3-19|L-REGION+V-REGION| [len=337] (mis=0)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
422-494 ==> 0-72 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 51 reads
cdr3 = CNSRDSSGNHWVF at 355, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 40, 159, 188, 239, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.800 = GATCGTACAGGATTGG-1

using 58 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 8[3, 4^2, 5, 7, 8, 9, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.801 = GATCGTACAGGCGATA-1

using 254 reads

====================================================================================

graph has 68 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[6, 248]
surviving nonsolo ucounts = 1[248]
ids = [0]

====================================================================================

UMI info for barcode GATCGTACAGGCGATA-1 contig 1 = CTGGGCCTCA...
umi TGATTTTGCC = 247 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=624]
0-37 ==> 15-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
37-371 ==> 0-334 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=18)
375-413 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=4)
413-624 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CQAWDSTEVVF at 352, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 244
start codons at 37, 42, 331, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.809 = GATCGTACATCCTAGA-1

using 32300 reads

====================================================================================

graph has 9789 edges initially, 90 edges after simplification

total ucounts = 777
nonsolo ucounts = 424[2^119, 3^69, 4^49, 5^18, 6^12, 7^8, 8^8, 9^7, 10, 11^3, 14^2, 15, 17, 26, 39, 43, 45^3, 50, 58, 72, 79, 91, 95, 96, 97, 99, 104, 112, 116, 118, 128, 139, 144, 161, 167, 172, 175, 180, 182^2, 188^2, 189, 190, 196, 202^2, 203, 207, 212, 216, 220^3, 221, 222^2, 223^3, 228, 231, 235^2, 236, 238^2, 244, 246, 250, 252, 255, 258^2, 260^2, 265, 267, 269, 271, 274, 276, 277, 279, 282, 283^2, 284, 286^2, 289, 290, 293^2, 294, 297^2, 298, 302, 303, 305, 308^2, 313, 314, 318^2, 319, 320, 323^2, 325, 326, 327, 328, 329^2, 332, 334, 337, 339, 344, 346, 347, 352, 355, 357^3, 359, 368, 369, 371, 397, 406, 455, 534]
surviving nonsolo ucounts = 113[95, 96, 97, 99, 104, 112, 116, 128, 139, 144, 161, 172, 175, 180, 182^2, 188^2, 189, 190, 196, 202^2, 203, 207, 212, 216, 220^3, 221, 222^2, 223^3, 228, 231, 235^2, 236, 238^2, 244, 246, 250, 252, 255, 258^2, 260^2, 265, 267, 269, 271, 274, 276, 277, 279, 282, 283^2, 284, 286^2, 289, 290, 293^2, 294, 297^2, 298, 302, 303, 305, 308^2, 313, 314, 318^2, 319, 320, 323^2, 325, 326, 327, 328, 329^2, 332, 334, 337, 339, 344, 346, 347, 352, 355, 357^3, 359, 368, 369, 371, 397, 406, 455, 534]
ids = [122, 290, 624, 304, 719, 313, 156, 705, 86, 551, ...]

====================================================================================

UMI info for barcode GATCGTACATCCTAGA-1 contig 1 = GAGCTACAAC...
umi ACGAATGTCC = 259 reads: +400 validated
umi ACGTGCAACC = 301 reads: +400 validated
umi AGCCAACTCA = 237 reads: +400 validated
umi AGTTACCCTT = 307 reads: +400 validated
umi ATATGAGGGA = 221 reads: +400 validated
umi ATTCCTGTTT = 286 reads: +400 validated
umi ATTCGTCCAA = 231 reads: +400 validated
umi ATTGGTAGTC = 267 reads: +400 validated
umi CAACATTGCA = 401 reads: +400 validated
umi CACACCCCTT = 262 reads: +400 validated
umi CACGTACGGC = 337 reads: +400 validated
umi CACTTTGTAG = 231 reads: +400 validated
umi CAGTCTGTAC = 290 reads: +400 validated
umi CATGACCTAC = 292 reads: +400 validated
umi CATGATTGAT = 276 reads: +400 validated
umi CCAACTATTC = 223 reads: +400 validated
umi CCCATTTATC = 335 reads: +400 validated
umi CCGCCGCACC = 237 reads: +400 validated
umi CCGGCCTTAG = 267 reads: +400 validated
umi CCTACCCGGG = 299 reads: +400 validated
umi CGTACTACAC = 373 reads: +400 validated
umi CGTACTTTCT = 98 reads: +400 validated
umi CGTGCTCGCA = 337 reads: +400 validated
umi CGTTACACTC = 114 reads: +400 validated
umi CGTTATCGGT = 217 reads: +400 validated
umi CTCCACTGCT = 290 reads: +400 validated
umi CTGCGTCTCC = 261 reads: +400 validated
umi CTTGTTCCCC = 324 reads: +400 validated
umi GCGTTCCTAT = 221 reads: +400 validated
umi GTATGACGGT = 322 reads: +400 validated
umi TACAAGCGGG = 214 reads: +400 validated
umi TAGAGCTCCG = 142 reads: +400 validated
umi TCACCTACCA = 295 reads: +400 validated
umi TCAGTAAGCT = 227 reads: +400 validated
umi TCCAACATTG = 223 reads: +400 validated
umi TCCATCCTGT = 256 reads: +400 validated
umi TCCTGCGCCC = 95 reads: +400 validated
umi TCGGGATCGA = 315 reads: +400 validated
umi TCTTCGTGTG = 122 reads: +341 -59 non-validated
umi TCTTTCGACA = 335 reads: +400 validated
umi TCTTTTGCGA = 159 reads: +400 validated
umi TGCGGTGCGC = 260 reads: +400 validated
umi TGGTCGTATC = 308 reads: +400 validated
umi TTCCATATTA = 104 reads: +400 validated
umi TTGTATTCCG = 267 reads: +400 validated
umi TTTCCCCGTC = 284 reads: +400 validated

UMI info for barcode GATCGTACATCCTAGA-1 contig 2 = CAACCACATC...
umi ACTCACACCG = 195 reads: +406 validated
umi ACTCTTGGCT = 315 reads: +406 validated
umi ATGTTATATC = 138 reads: +406 validated
umi CAAACCCAAT = 357 reads: +406 validated
umi CACATACGCA = 91 reads: +406 validated
umi CACCCTTCGT = 177 reads: +406 validated
umi CAGTACGGGG = 327 reads: +406 validated
umi CATCCCCTCT = 123 reads: +375 -31 non-validated
umi CATGTTGGGC = 201 reads: +406 validated
umi CATTACCATA = 187 reads: +406 validated
umi CCGTAGGCTC = 329 reads: +406 validated
umi CCGTTTGTGC = 221 reads: +406 validated
umi CCTGTTATGC = 303 reads: +406 validated
umi CCTTAGTTTC = 250 reads: +406 validated
umi CGAGACCCTA = 214 reads: +406 validated
umi CGCAGCCTCT = 316 reads: +406 validated
umi CGCTTGACTT = 91 reads: -366X +1 -1 +1 -2X +3 -1 +3 -3X +2 -1XX +3 -2XX +17 invalidated
umi CGCTTTCAAG = 352 reads: +406 validated
umi CGTTTAGTTC = 221 reads: +406 validated
umi CTCATCCACG = 336 reads: +406 validated
umi CTCTTGCTCT = 231 reads: +391 -1 +14 non-validated
umi CTGAGATCTG = 271 reads: +406 validated
umi CTGCACCTCA = 404 reads: +406 validated
umi CTGCCAGAGG = 318 reads: +406 validated
umi CTTTTCGAGT = 289 reads: +406 validated
umi GGGAACAACT = 304 reads: +406 validated
umi GTACTTCGCC = 372 reads: +395 -1X +10 invalidated
umi GTATCAGCCG = 356 reads: +406 validated
umi GTCATGTGTA = 292 reads: +406 validated
umi GTCCCCGTTG = 322 reads: +406 validated
umi GTCTCCCTCG = 287 reads: +395 -11 non-validated
umi GTTTCTCCAA = 244 reads: +406 validated
umi TACGGTTGTC = 314 reads: +406 validated
umi TATCCTTGAC = 328 reads: +406 validated
umi TCAACGCCGA = 185 reads: +406 validated
umi TCAACTATTC = 343 reads: +406 validated
umi TCATTACAGC = 147 reads: +406 validated
umi TCCACAGCGG = 299 reads: +404 -1 +1 non-validated
umi TCCACTTAAT = 340 reads: +406 validated
umi TCCATTGCAC = 463 reads: -78X +328 invalidated
umi TCGGTCTCGT = 281 reads: +406 validated
umi TCGGTGCTTC = 269 reads: +406 validated
umi TCTATACTTG = 353 reads: +406 validated
umi TTAAGCCTGA = 299 reads: +406 validated
umi TTAGTCGGCG = 127 reads: +406 validated
umi TTCACCAGCT = 191 reads: +406 validated
umi TTTTACCGCC = 340 reads: +406 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=18)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=3)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 45 umis using 1522 reads
cdr3 = CQQYYTTPFTF at 369, score = 9 + 8
umis assigned: [26, 33, 53, 63, 70, 92, 93, 96, 109, 117] and 36 others
of which 46 are surviving nonsolos
reads assigned: 11554
start codons at 30, 99, 352, 472
confident = true

TIG 2[bases=526]
0-24 ==> 15-39 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
49-402 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=40)
409-455 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=4)
455-526 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 42 umis using 908 reads
cdr3 = CVRNSGLGDYW at 391, score = 8 + 7
umis assigned: [35, 41, 86, 108, 122, 125, 142, 156, 167, 168] and 37 others
of which 47 are surviving nonsolos
reads assigned: 12517
start codons at 49, 200, 247, 252, 256, 284, 313, 346
confident = true

REJECT CONTIGS

TIG 1[bases=559]
3-94 ==> 8876-8967 on segment before IGKV1OR2-3 exon 1 [len=9099] (mis=7)
37-201 ==> 0-164 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=4)
213-386 ==> 178-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=15) [SHIFT!]
386-423 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=2)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQHLNIFPFIF at 362, score = 9 + 8
umis assigned: [6, 58, 123, 134, 282, 412, 450, 537, 664, 738]
of which 10 are surviving nonsolos
reads assigned: 2701
start codons at 37, 43, 99, 246, 465
confident = false
not full
frameshifted full length stopped transcript of length 559
VJ delta = 15
not full
now this is a cell
paired!

AACAGCCTCAGATCTGACGACACGGCCGTATATTATTGTGTGAGGAACTCAGGATTAGGTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATACTACTCCCTTCACTTTCGGCCCTGGGACCAAAGTGCATATCGAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.812 = GATCGTACATGGGAAC-1

using 111 reads

====================================================================================

graph has 46 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[109]
surviving nonsolo ucounts = 1[109]
ids = [1]

====================================================================================

UMI info for barcode GATCGTACATGGGAAC-1 contig 1 = TCCACCATGG...
umi CGGTCTGTAC = 103 reads: +394 validated

GOOD CONTIGS

TIG 1[bases=483]
6-346 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=6)
362-400 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
400-483 ==> 0-83 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CCSYAGSSTIPYVF at 330, score = 8 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 103
start codons at 6, 207, 214, 340, 364
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.815 = GATCGTAGTACTTAGC-1

using 242 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[236]
surviving nonsolo ucounts = 1[236]
ids = [2]

====================================================================================

UMI info for barcode GATCGTAGTACTTAGC-1 contig 1 = GTCTCAGGAG...
umi CTGCCCCGAC = 221 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=521]
0-35 ==> 128-163 on |346|IGLV2-8|5'UTR| [len=163] (mis=0)
35-389 ==> 0-354 on |347|IGLV2-8|L-REGION+V-REGION| [len=354] (mis=20)
385-423 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
423-521 ==> 0-98 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CNSYAGSDKWVF at 359, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 219
start codons at 35, 192, 236, 243, 342, 369
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.816 = GATCGTAGTAGAGGAA-1

using 193 reads

====================================================================================

graph has 196 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[193]
surviving nonsolo ucounts = 1[193]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.818 = GATCGTAGTCAGAATA-1

using 82 reads

====================================================================================

graph has 84 edges initially, 6 edges after simplification

total ucounts = 14
nonsolo ucounts = 11[2^2, 3^3, 5, 7, 9, 11, 16, 18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.827 = GATCGTAGTGAAAGAG-1

using 234 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 3^2, 223]
surviving nonsolo ucounts = 1[223]
ids = [6]

====================================================================================

UMI info for barcode GATCGTAGTGAAAGAG-1 contig 1 = AGCTTCAGCT...
umi TTACTCCCAA = 208 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=575]
0-46 ==> 10-56 on |326|IGLV1-47|5'UTR| [len=56] (mis=0)
46-397 ==> 0-351 on |327|IGLV1-47|L-REGION+V-REGION| [len=351] (mis=1)
396-434 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
434-575 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CAAWDDSLSGRVF at 367, score = 7 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 206
start codons at 46, 200, 350, 375, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.829 = GATCGTAGTGAGTGAC-1

using 256 reads

====================================================================================

graph has 108 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[253]
surviving nonsolo ucounts = 1[253]
ids = [2]

====================================================================================

UMI info for barcode GATCGTAGTGAGTGAC-1 contig 1 = GTCAGACTCA...
umi CCCTTAACAG = 242 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=495]
0-23 ==> 158-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
23-374 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=5)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
414-495 ==> 0-81 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYNSYSPWTF at 350, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 238
start codons at 23, 29, 85, 98, 234, 237, 330, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.834 = GATCGTAGTGTAAGTA-1

using 248 reads

====================================================================================

graph has 82 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[246]
surviving nonsolo ucounts = 1[246]
ids = [0]

====================================================================================

UMI info for barcode GATCGTAGTGTAAGTA-1 contig 1 = GAAGAGCTGC...
umi CCCATCCCGT = 234 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=458]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
379-418 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
418-458 ==> 0-40 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CQQYGSSPVTF at 357, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 228
start codons at 33, 241, 244, 367
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.843 = GATCGTAGTTCTGAAC-1

using 197 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[197]
surviving nonsolo ucounts = 1[197]
ids = [0]

====================================================================================

UMI info for barcode GATCGTAGTTCTGAAC-1 contig 1 = TGCTTCAGCT...
umi TTTAACTTCG = 192 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=498]
0-47 ==> 4-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
47-403 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=13)
400-438 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
438-498 ==> 0-60 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQSFDRSLSGWVF at 371, score = 6 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 190
start codons at 47, 201, 204, 255, 354
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.862 = GATCGTATCGCACTCT-1

using 269 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[3, 264]
surviving nonsolo ucounts = 1[264]
ids = [2]

====================================================================================

UMI info for barcode GATCGTATCGCACTCT-1 contig 1 = TGGGGGTGCT...
umi TGGGTATGAG = 249 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=481]
21-392 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=8)
409-457 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=4)
457-481 ==> 0-24 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CARAHGDYYTLLDYW at 381, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 247
start codons at 21, 42, 86, 172, 372
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.865 = GATCGTATCGTACCGG-1

using 243 reads

====================================================================================

graph has 66 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 240]
surviving nonsolo ucounts = 1[240]
ids = [2]

====================================================================================

UMI info for barcode GATCGTATCGTACCGG-1 contig 1 = GGAGTCAGTC...
umi CACTTGCGCT = 212 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=501]
0-26 ==> 5-31 on |226|IGKV1-33|5'UTR| [len=31] (mis=0)
26-377 ==> 0-351 on |227|IGKV1-33|L-REGION+V-REGION| [len=351] (mis=10)
374-411 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
411-501 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 31 reads
cdr3 = CQQYDSFPLF at 353, score = 9 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 211
start codons at 26, 32, 88, 101, 240, 363, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.868 = GATCGTATCGTGGTCG-1

using 254 reads

====================================================================================

graph has 112 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 3[3, 76, 168]
surviving nonsolo ucounts = 2[76, 168]
ids = [4, 3]

====================================================================================

UMI info for barcode GATCGTATCGTGGTCG-1 contig 1 = TGGGGACCCA...
umi ATGGTGTATG = 163 reads: +436 validated
umi CGTCCGTCCT = 72 reads: +390 -1 +45 non-validated

GOOD CONTIGS

TIG 1[bases=582]
0-59 ==> 0-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=6)
59-412 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
461-495 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
495-582 ==> 0-87 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 2 umis using 22 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 401, score = 7 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 233
start codons at 59, 257, 262, 279, 323, 356, 549
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.869 = GATCGTATCGTTTAGG-1

using 208 reads

====================================================================================

graph has 62 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

UMI info for barcode GATCGTATCGTTTAGG-1 contig 1 = AGCTTCAGCT...
umi CCATTTCAGA = 200 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=646]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-646 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 30 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 200
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.871 = GATCGTATCTCAAACG-1

using 244 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[243]
surviving nonsolo ucounts = 1[243]
ids = [0]

====================================================================================

UMI info for barcode GATCGTATCTCAAACG-1 contig 1 = GGGGGCGCCA...
umi ATCATATCCG = 236 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=566]
0-34 ==> 0-34 on |385|IGLV7-43|5'UTR| [len=34] (mis=3)
34-385 ==> 0-351 on |386|IGLV7-43|L-REGION+V-REGION| [len=351] (mis=7)
387-425 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=0)
425-566 ==> 0-141 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 41 reads
cdr3 = CLLYYGGAANYVF at 358, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 231
start codons at 34, 371, 389, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.875 = GATCGTATCTTCTGGC-1

using 76 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 70]
surviving nonsolo ucounts = 1[70]
ids = [1]

====================================================================================

UMI info for barcode GATCGTATCTTCTGGC-1 contig 1 = GAGGAGTCAG...
umi AGCACTTCGG = 68 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=458]
28-381 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=18)
374-413 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
413-458 ==> 0-45 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CQQSYSTPSF at 355, score = 9 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 67
start codons at 28, 34, 90, 103, 239
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.877 = GATCTAGAGAAACCGC-1

using 1850 reads

====================================================================================

graph has 2486 edges initially, 42 edges after simplification

total ucounts = 655
nonsolo ucounts = 317[2^105, 3^52, 4^49, 5^25, 6^30, 7^9, 8^8, 9^9, 10^4, 11, 12^4, 13^5, 14^3, 15^2, 16^4, 18^4, 19, 20, 26]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.885 = GATCTAGAGATATACG-1

using 323 reads

====================================================================================

graph has 138 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[6, 314]
surviving nonsolo ucounts = 1[314]
ids = [1]

====================================================================================

UMI info for barcode GATCTAGAGATATACG-1 contig 1 = GCTCTGCTTC...
umi CAATACTCCA = 322 reads: +85 -6XX +303 invalidated

GOOD CONTIGS

TIG 1[bases=558]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=12)
407-445 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=1)
445-558 ==> 0-113 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQSYDSSLSGLYVF at 375, score = 7 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 51, 205, 208, 259, 358, 385, 409
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.887 = GATCTAGAGATCCTGT-1

using 236 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 16
nonsolo ucounts = 6[3, 4^2, 5^2, 205]
surviving nonsolo ucounts = 1[205]
ids = [1]

====================================================================================

UMI info for barcode GATCTAGAGATCCTGT-1 contig 1 = ACCCAAAAAC...
umi ACCCGGGGTG = 199 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=510]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
490-510 ==> 0-20 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 1 umis using 22 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 194
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.891 = GATCTAGAGCCCGAAA-1

using 513 reads

====================================================================================

graph has 154 edges initially, 4 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[3, 4, 136, 366]
surviving nonsolo ucounts = 2[136, 366]
ids = [1, 6]

====================================================================================

UMI info for barcode GATCTAGAGCCCGAAA-1 contig 1 = AGTGACTCCT...
umi AACCGTCATC = 129 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=461]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=7)
387-435 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=2)
435-461 ==> 0-26 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 20 reads
cdr3 = CAHCTSIDYLVYW at 365, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 127
start codons at 20, 64, 243, 246, 326, 335
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.892 = GATCTAGAGCTAGTCT-1

using 219 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[3, 212]
surviving nonsolo ucounts = 1[212]
ids = [3]

====================================================================================

UMI info for barcode GATCTAGAGCTAGTCT-1 contig 1 = TGGGGGCTGG...
umi CTCTCACCTC = 3 reads: -96 +10 -1 +14 -1 +8 -1X +1 -1X +8 -1X +4 -3X +2 -240X invalidated
umi GGGCCAGTTC = 207 reads: +391 validated

GOOD CONTIGS

TIG 1[bases=578]
46-397 ==> 0-351 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=3)
399-437 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=0)
437-578 ==> 0-141 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 39 reads
cdr3 = CSSYTSSSTDVVF at 370, score = 8 + 8
umis assigned: [1, 3]
of which 1 are surviving nonsolos
reads assigned: 208
start codons at 46, 203, 247, 254, 257, 398
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.895 = GATCTAGAGGCAATTA-1

using 327 reads

====================================================================================

graph has 180 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 4[2^2, 3, 312]
surviving nonsolo ucounts = 1[312]
ids = [7]

====================================================================================

UMI info for barcode GATCTAGAGGCAATTA-1 contig 1 = GGAGTCAGAC...
umi CCTCATCGGT = 286 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=465]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-465 ==> 0-51 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 43 reads
cdr3 = CQQYNTYIWTF at 353, score = 9 + 8
umis assigned: [7]
of which 1 are surviving nonsolos
reads assigned: 280
start codons at 26, 32, 101, 239, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.897 = GATCTAGAGGGTCGAT-1

using 133 reads

====================================================================================

graph has 28 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[131]
surviving nonsolo ucounts = 1[131]
ids = [1]

====================================================================================

UMI info for barcode GATCTAGAGGGTCGAT-1 contig 1 = TGGGGACTCC...
umi CTATCGGTCG = 125 reads: +415 validated

GOOD CONTIGS

TIG 1[bases=487]
21-379 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=35)
385-436 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=5)
436-487 ==> 0-51 on |40|IGHG1|C-REGION| [len=884] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CAYRLHHTELDPW at 366, score = 7 + 7
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 125
start codons at 21, 65, 244, 327, 336
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 64.900 = GATCTAGAGTAGTGCG-1

using 178 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[3, 172]
surviving nonsolo ucounts = 1[172]
ids = [2]

====================================================================================

UMI info for barcode GATCTAGAGTAGTGCG-1 contig 1 = ACCCAAAAAC...
umi AGTTTCATCT = 167 reads: +436 validated
umi ATTTTAATCT = 2 reads: -178 +3 -3 +1 -2 +8 -2 +5 -2X +1 -2X +1 -1 +3 -1 +5 -3 +6 -1 +1 -2 +3 -202 invalidated

GOOD CONTIGS

TIG 1[bases=493]
0-54 ==> 5-59 on |64|IGHV1-18|5'UTR| [len=59] (mis=1)
54-407 ==> 0-353 on |65|IGHV1-18|L-REGION+V-REGION| [len=353] (mis=22)
456-490 ==> 12-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
junction support: 1 umis using 16 reads
cdr3 = CARDKHFRDPYYHYSGALDHW at 396, score = 7 + 7
umis assigned: [2, 3]
of which 1 are surviving nonsolos
reads assigned: 164
start codons at 54, 252, 257, 274, 318, 351
confident = false
NOT paired!
sorting bam, mem = 0.09
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk064-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk064-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

60.872 seconds used processing barcodes, peak mem = 0.23
