[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 833.05 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk063-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk063-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk063.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.0 = GACTGCGAGGTGTTAA-1

using 1564 reads

====================================================================================

graph has 2104 edges initially, 43 edges after simplification

total ucounts = 732
nonsolo ucounts = 295[2^112, 3^75, 4^40, 5^21, 6^12, 7^16, 8^5, 10^3, 11^3, 12, 13, 14, 15^2, 16, 17, 24]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.5 = GACTGCGAGTGTTAGA-1

using 707 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[703]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.6 = GACTGCGAGTTCGCGC-1

using 147 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[146]
surviving nonsolo ucounts = 1[146]
ids = [1]

====================================================================================

UMI info for barcode GACTGCGAGTTCGCGC-1 contig 1 = GAGAAGAGCT...
umi CGGTCCATGG = 131 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=481]
0-35 ==> 17-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
35-383 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
382-420 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
420-481 ==> 0-61 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 28 reads
cdr3 = CQQYGRTPGTF at 359, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 129
start codons at 35, 243, 246, 369, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.12 = GACTGCGCAATAAGCA-1

using 202 reads

====================================================================================

graph has 69 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 197]
surviving nonsolo ucounts = 1[197]
ids = [2]

====================================================================================

UMI info for barcode GACTGCGCAATAAGCA-1 contig 1 = TGGGTCCAGG...
umi GGGGACCCGG = 191 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=545]
0-34 ==> 9-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
34-371 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=0)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-545 ==> 0-126 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 27 reads
cdr3 = CQSADSSGTYPLVF at 349, score = 8 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 34, 95, 164, 182
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.13 = GACTGCGCAATCAGAA-1

using 227 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 12
nonsolo ucounts = 3[2, 12, 204]
surviving nonsolo ucounts = 1[204]
ids = [2]

====================================================================================

REJECT CONTIGS

TIG 1[bases=513]
0-34 ==> 13-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
0-34 ==> 5966-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=0)
7-59 ==> 5709-5761 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
34-334 ==> 0-300 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=17)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=3)
419-513 ==> 0-94 on |212|IGKC|C-REGION| [len=320] (mis=0)
cdr3 = CQLRRNWPRGTF at 355, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 189
start codons at 34, 239, 461
confident = false
not full
full length stopped transcript of length 513
frameshifted full length stopped transcript of length 513
VJ delta = 13
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.23 = GACTGCGCACGTGAGA-1

using 143 reads

====================================================================================

graph has 92 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 4[3, 7^2, 124]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.25 = GACTGCGCACTGTTAG-1

using 285 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 2[2, 275]
surviving nonsolo ucounts = 1[275]
ids = [3]

====================================================================================

UMI info for barcode GACTGCGCACTGTTAG-1 contig 1 = GCTGGCACCA...
umi CGTCCCTCGG = 261 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=579]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=1)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=20)
384-422 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=4)
422-579 ==> 0-157 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CLLSFSAARRVF at 358, score = 8 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 254
start codons at 34, 242, 341
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.26 = GACTGCGCACTTCTGC-1

using 12 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.28 = GACTGCGCAGATAATG-1

using 48 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[48]
surviving nonsolo ucounts = 1[48]
ids = [0]

====================================================================================

REJECT CONTIGS

TIG 1[bases=321]
2-321 ==> 0-319 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=14)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 33
start codons at 2, 71, 207
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.31 = GACTGCGCAGCGTTCG-1

using 135 reads

====================================================================================

graph has 56 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 3[2^2, 126]
surviving nonsolo ucounts = 1[126]
ids = [6]

====================================================================================

UMI info for barcode GACTGCGCAGCGTTCG-1 contig 1 = GAGCTGCTCA...
umi GGGCTTTCGT = 116 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=507]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=2)
380-418 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
418-507 ==> 0-89 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYGSSSGWTF at 354, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 116
start codons at 30, 238, 364, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.34 = GACTGCGCAGGTGGAT-1

using 389 reads

====================================================================================

graph has 136 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 1[387]
surviving nonsolo ucounts = 1[387]
ids = [2]

====================================================================================

UMI info for barcode GACTGCGCAGGTGGAT-1 contig 1 = GAGTCAGACT...
umi TGCATAATTC = 389 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 156-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=1)
25-376 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=6)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQYNGQSRAF at 352, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 381
start codons at 25, 31, 100, 236, 239, 332, 365, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.49 = GACTGCGGTCAAAGAT-1

using 311 reads

====================================================================================

graph has 100 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[311]
surviving nonsolo ucounts = 1[311]
ids = [0]

====================================================================================

UMI info for barcode GACTGCGGTCAAAGAT-1 contig 1 = AGGAATCAGT...
umi TTTGGTGTAC = 309 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=551]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=6)
377-415 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CLQHKSYPFTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 307
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.51 = GACTGCGGTCACCCAG-1

using 99 reads

====================================================================================

graph has 122 edges initially, 4 edges after simplification

total ucounts = 24
nonsolo ucounts = 21[2^6, 3^7, 4^2, 5^2, 9, 11, 12, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.57 = GACTGCGGTCGCGGTT-1

using 281 reads

====================================================================================

graph has 64 edges initially, 4 edges after simplification

total ucounts = 13
nonsolo ucounts = 6[2, 3, 4, 9, 42, 214]
surviving nonsolo ucounts = 5[2, 4, 9, 42, 214]
ids = [7, 11, 6, 9, 2]

====================================================================================

UMI info for barcode GACTGCGGTCGCGGTT-1 contig 1 = GCTGTGCTGT...
umi GCTGGTGCTA = 199 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=587]
0-43 ==> 0-43 on |362|IGLV3-25|5'UTR| [len=43] (mis=0)
43-380 ==> 0-337 on |363|IGLV3-25|L-REGION+V-REGION| [len=337] (mis=26)
387-425 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
425-587 ==> 0-162 on |306|IGLC2|C-REGION| [len=317] (mis=2)
junction support: 1 umis using 22 reads
cdr3 = CQSVDSSGPYVVF at 358, score = 8 + 7
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 43, 173, 191, 386, 412, 557
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.61 = GACTGCGGTCTTGCGG-1

using 10345 reads

====================================================================================

graph has 3948 edges initially, 46 edges after simplification

total ucounts = 471
nonsolo ucounts = 208[2^75, 3^28, 4^27, 5^10, 6^11, 7^3, 8, 9^4, 10, 11^2, 12, 15, 19, 23, 24, 35, 37, 45, 119, 139, 140, 145^2, 153, 163, 164, 169, 176, 177, 178^2, 179, 195, 210, 217, 221, 231, 238, 244, 246, 262, 269, 281, 282, 283, 287, 293^2, 304, 328, 331, 333, 336, 373, 396, 638]
surviving nonsolo ucounts = 39[37, 45, 119, 139, 140, 145^2, 153, 163, 164, 169, 176, 177, 178, 179, 195, 210, 217, 221, 231, 238, 244, 246, 262, 269, 281, 282, 283, 287, 293^2, 304, 328, 331, 333, 336, 373, 396, 638]
ids = [255, 392, 394, 6, 280, 135, 365, 362, 328, 416, ...]

====================================================================================

UMI info for barcode GACTGCGGTCTTGCGG-1 contig 1 = ATCATCCAAC...
umi AACCAACGGC = 130 reads: +424 validated
umi AACTGGGTTA = 334 reads: +424 validated
umi AATCACGGCC = 270 reads: +424 validated
umi ACAGCTGCTC = 175 reads: +409 -15 non-validated
umi ACCAGTAGGA = 297 reads: +424 validated
umi AGAGCGACGC = 287 reads: +424 validated
umi AGCTAACGGA = 297 reads: +424 validated
umi ATAGGTGTGT = 243 reads: +424 validated
umi CATACACACA = 124 reads: +424 validated
umi CCCTTTCGTC = 280 reads: +420 -4 non-validated
umi CCGACTACCG = 337 reads: +424 validated
umi CGTTGATCCG = 286 reads: +424 validated
umi GAGGTAAGGG = 37 reads: +332 -1 +4 -1 +84 -2 non-validated
umi GCAGTAAGCG = 201 reads: +424 validated
umi GCGCAGACAT = 238 reads: +424 validated
umi GCGCTGCCTG = 144 reads: +424 validated
umi GCGGGCGGCA = 190 reads: +424 validated
umi GGTATCCTCT = 265 reads: +424 validated
umi GTACCATATT = 325 reads: +424 validated
umi GTGTGCTGTA = 175 reads: +424 validated
umi TAGAATCGGG = 146 reads: +409 -1 +14 non-validated
umi TCCGACCTCC = 44 reads: +309 -44 +58 -13 non-validated
umi TCCGATTTAC = 119 reads: +392 -2 +2 -5X +8 -15 invalidated
umi TCTTCCTCAA = 166 reads: +424 validated
umi TTAGGATACG = 178 reads: +424 validated
umi TTTCTTTCAT = 233 reads: +395 -2 +8 -1 +18 non-validated

UMI info for barcode GACTGCGGTCTTGCGG-1 contig 2 = GAGCTACAAC...
umi ACTGATCTCG = 329 reads: +400 validated
umi AGTTACTGGT = 374 reads: +400 validated
umi CTTCTTAGGC = 197 reads: +400 validated
umi GGCGTGCGAA = 176 reads: -366X +2 -2X +5 -2XX +15 -1XX +7 invalidated
umi GTACTCTCAG = 154 reads: +382 -1 +17 non-validated
umi TAACAGACTT = 239 reads: +400 validated
umi TACAGTCTCT = 228 reads: +400 validated
umi TGGTTGTCGG = 291 reads: +400 validated
umi TGTCTGTCTA = 242 reads: +400 validated
umi TGTTAGTCTA = 633 reads: -259X +141 invalidated

GOOD CONTIGS

TIG 1[bases=553]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=0)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=1)
434-482 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
482-553 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 21 umis using 439 reads
cdr3 = CARDRDSGYDPPYFDYW at 400, score = 9 + 7
umis assigned: [6, 15, 29, 42, 49, 62, 66, 91, 135, 165] and 16 others
of which 26 are surviving nonsolos
reads assigned: 5440
start codons at 58, 214, 256, 322, 355
confident = true

TIG 2[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=0)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=0)
393-430 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 8 umis using 363 reads
cdr3 = CQQYYSTPPTF at 369, score = 9 + 8
umis assigned: [54, 81, 230, 310, 328, 351, 357, 437, 438, 439]
of which 10 are surviving nonsolos
reads assigned: 2813
start codons at 30, 99, 352, 472
confident = true
now this is a cell
paired!

GACACGGCCGTGTATTACTGTGCTAGAGATCGGGATAGTGGCTACGACCCCCCCTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.69 = GACTGCGGTGGTAACG-1

using 513 reads

====================================================================================

graph has 198 edges initially, 6 edges after simplification

total ucounts = 9
nonsolo ucounts = 5[2, 3^2, 240, 261]
surviving nonsolo ucounts = 2[240, 261]
ids = [6, 4]

====================================================================================

UMI info for barcode GACTGCGGTGGTAACG-1 contig 1 = AGGACACAGC...
umi GTCGGGTCTT = 237 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=534]
10-361 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=10)
360-398 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=2)
398-534 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 32 reads
cdr3 = CQQYDSFSWTF at 337, score = 8 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 235
start codons at 10, 16, 72, 85, 221, 224, 317, 347, 440
confident = false

REJECT CONTIGS

TIG 1[bases=571]
0-81 ==> 5529-5610 on segment before IGKV2OR2-1 exon 1 [len=6000] (mis=3)
34-394 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=1)
397-435 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
435-571 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 258
start codons at 67, 95, 103, 191, 353, 373, 477
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.70 = GACTGCGGTGGTGTAG-1

using 290 reads

====================================================================================

graph has 94 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[290]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.74 = GACTGCGGTGTTCGAT-1

using 12 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.76 = GACTGCGGTTAAAGAC-1

using 31 reads

====================================================================================

graph has 26 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 2[4, 22]
surviving nonsolo ucounts = 1[22]
ids = [6]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.79 = GACTGCGGTTCGTTGA-1

using 376 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 11
nonsolo ucounts = 4[2^2, 5, 360]
surviving nonsolo ucounts = 1[360]
ids = [3]

====================================================================================

UMI info for barcode GACTGCGGTTCGTTGA-1 contig 1 = AGTCAGTCTC...
umi CGCTCTTCTT = 313 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=502]
24-377 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=29)
375-412 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
412-502 ==> 0-90 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 55 reads
cdr3 = CQQGYSIPLTF at 351, score = 9 + 9
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 308
start codons at 24, 30, 86, 235, 289, 454
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.105 = GACTGCGTCGCCAAAT-1

using 112 reads

====================================================================================

graph has 98 edges initially, 2 edges after simplification

total ucounts = 48
nonsolo ucounts = 20[2^5, 3^6, 4^2, 5^4, 7, 8, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.117 = GACTGCGTCTGCGTAA-1

using 3563 reads

====================================================================================

graph has 2512 edges initially, 52 edges after simplification

total ucounts = 722
nonsolo ucounts = 309[2^128, 3^70, 4^36, 5^24, 6^22, 7^4, 8^5, 9^4, 10, 11^3, 13^2, 14, 32, 153, 157, 180, 188, 245, 253, 430, 463]
surviving nonsolo ucounts = 9[13, 153, 157, 180, 188, 245, 253, 430, 463]
ids = [279, 402, 263, 194, 292, 250, 467, 12, 571]

====================================================================================

UMI info for barcode GACTGCGTCTGCGTAA-1 contig 1 = AAGAACCTGC...
umi CCTGTCCCTT = 157 reads: +379 validated
umi CGGGAAGTAC = 189 reads: +379 validated
umi GCCAAATACT = 152 reads: +379 validated

UMI info for barcode GACTGCGTCTGCGTAA-1 contig 2 = GGTTCCAGCT...
umi CAGTGACAGC = 159 reads: +448 validated
umi CCGTCAGTCT = 250 reads: +448 validated
umi CGATATTCCG = 12 reads: -399 +49 non-validated
umi TCGGTCGGAC = 372 reads: -414X +1 -1XX +1 -8XX +1 -11XX +2 -1XX +1 -6XX +1 invalidated

GOOD CONTIGS

TIG 1[bases=642]
0-52 ==> 0-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
52-398 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=6)
393-431 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
431-642 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 3 umis using 79 reads
cdr3 = CQAWDSSTAWVF at 367, score = 6 + 8
umis assigned: [263, 292, 402]
of which 3 are surviving nonsolos
reads assigned: 491
start codons at 52, 57, 113, 200, 251, 346, 350, 393
confident = true

TIG 2[bases=576]
0-57 ==> 44-101 on |195|IGHV4-61|5'UTR| [len=101] (mis=1)
57-413 ==> 0-356 on |196|IGHV4-61|L-REGION+V-REGION| [len=356] (mis=14)
442-505 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=2)
505-576 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 2 umis using 33 reads
cdr3 = CAREPGPRGIADGDAYYYYYMDVW at 402, score = 9 + 7
umis assigned: [194, 250, 279, 571]
of which 4 are surviving nonsolos
reads assigned: 780
start codons at 13, 57, 101, 436, 442, 462
confident = true

REJECT CONTIGS

TIG 1[bases=409]
2-163 ==> 201-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=7)
160-198 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
198-409 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
cdr3 = CETWDSNSGVF at 137, score = 8 + 8
umis assigned: [12]
of which 1 are surviving nonsolos
reads assigned: 424
start codons at 5, 120
confident = false
not full
VJ delta = 16
not full
now this is a cell
paired!

GCGAGAGAACCTGGACCACGGGGTATAGCAGATGGTGATGCCTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG <==> AGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCATGGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.124 = GAGCAGAAGATCTGCT-1

using 385 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 4[2^2, 4, 373]
surviving nonsolo ucounts = 1[373]
ids = [5]

====================================================================================

UMI info for barcode GAGCAGAAGATCTGCT-1 contig 1 = AGGAATCAGT...
umi CGATGGGGAT = 322 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=479]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=10)
376-415 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
415-479 ==> 0-64 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CQQHNSFPYTF at 354, score = 9 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 316
start codons at 27, 33, 102, 184, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.130 = GAGCAGAAGCGCCTTG-1

using 6515 reads

====================================================================================

graph has 5035 edges initially, 70 edges after simplification

total ucounts = 854
nonsolo ucounts = 408[2^118, 3^55, 4^37, 5^34, 6^32, 7^20, 8^23, 9^23, 10^10, 11^12, 12^8, 13^6, 14^6, 15^3, 16^5, 17^3, 31, 165, 189, 229, 231, 299, 332, 340, 372, 380, 428, 470, 494]
surviving nonsolo ucounts = 12[165, 189, 229, 231, 299, 332, 340, 372, 380, 428, 470, 494]
ids = [400, 628, 406, 763, 25, 459, 160, 315, 787, 313, ...]

====================================================================================

UMI info for barcode GAGCAGAAGCGCCTTG-1 contig 1 = AGAGCTCTGG...
umi AACTCCATTA = 299 reads: +382 validated
umi ATATACCAGT = 342 reads: +382 validated
umi CCCCTGGCTC = 437 reads: +382 validated
umi CTTAACATCG = 337 reads: +363 -1XX +18 invalidated
umi TGCTAATCCC = 229 reads: +382 validated

UMI info for barcode GAGCAGAAGCGCCTTG-1 contig 2 = GGGGAGCTCT...
umi CCCGCATCAC = 341 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +5 -2X +3 -1XX +294 invalidated
umi CCGTCATTCT = 492 reads: +5 -1XX +1 -2XX +119 -1XX +12 -1XX +1 -1XX +5 -2XX +1 -1XX +2 -1XX +2 -2XX +1 -203X +1 -6X +1 -6XX +4 -3XX +1 -4XX +1 -4XX +2 invalidated
umi CGGTGCCCTT = 431 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +6 -1XX +3 -1XX +294 invalidated
umi CGTACACTCT = 154 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +2 -1X +2 -2XX +3 -1XX +294 invalidated
umi CGTCTAGCGC = 207 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +6 -1XX +3 -1XX +294 invalidated
umi GTTCGTGTAT = 164 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +6 -1XX +3 -1XX +294 invalidated
umi TTAAGCCGGG = 339 reads: +29 -1XX +6 -1XX +5 -2XX +13 -1XX +8 -1XX +20 -1XX +3 -1XX +6 -1XX +3 -1XX +294 invalidated

GOOD CONTIGS

TIG 1[bases=562]
0-44 ==> 53-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
44-389 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=15)
387-426 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
426-562 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 4 umis using 203 reads
cdr3 = CQQSNNWPNSF at 365, score = 9 + 7
umis assigned: [25, 160, 313, 459, 763]
of which 5 are surviving nonsolos
reads assigned: 1610
start codons at 44, 113, 249, 468
confident = true

TIG 2[bases=551]
83-436 ==> 0-353 on |159|IGHV3-7|L-REGION+V-REGION| [len=353] (mis=25)
448-480 ==> 14-46 on |54|IGHJ4|J-REGION| [len=46] (mis=0)
480-551 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 159 reads
cdr3 = CVKEGSFA at 425, score = 9 + 6
umis assigned: [315, 345, 397, 400, 406, 628, 787]
of which 7 are surviving nonsolos
reads assigned: 2094
start codons at 83, 239, 300, 318, 380, 386
confident = true
now this is a cell
paired!

ATGCAAATGAACAGCCTGAGAGCCGAAGACACGGCTGTCTATTACTGTGTGAAGGAGGGATCTTTTGCGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ATCAGTAACCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTCTAATAACTGGCCGAACTCTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.132 = GAGCAGAAGCGTGTCC-1

using 49 reads

====================================================================================

graph has 32 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[46]
surviving nonsolo ucounts = 1[46]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.133 = GAGCAGAAGCTCCCAG-1

using 167 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 86
nonsolo ucounts = 27[2^15, 3, 4^2, 5^2, 6^3, 7, 10^2, 12]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.139 = GAGCAGAAGGATGGTC-1

using 327 reads

====================================================================================

graph has 178 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 5[2, 3, 4, 9, 306]
surviving nonsolo ucounts = 1[306]
ids = [5]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.141 = GAGCAGAAGGGATACC-1

using 21 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[21]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.143 = GAGCAGAAGGTGGGTT-1

using 51 reads

====================================================================================

graph has 34 edges initially, 4 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[4, 17, 24]
surviving nonsolo ucounts = 1[24]
ids = [0]

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.152 = GAGCAGAAGTGTGGCA-1

using 76 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 9, 10, 49]
surviving nonsolo ucounts = 1[49]
ids = [0]

====================================================================================

UMI info for barcode GAGCAGAAGTGTGGCA-1 contig 1 = TCTGAGAGTC...
umi AATTTGGTCA = 48 reads: +445 validated

GOOD CONTIGS

TIG 1[bases=461]
10-387 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=6)
392-412 ==> 0-20 on |29|IGHD5-18|D-REGION| [len=20] (mis=2)
409-455 ==> 0-46 on |54|IGHJ4|J-REGION| [len=46] (mis=6)
junction support: 1 umis using 8 reads
cdr3 = CARRFGGYSYGPHDYW at 376, score = 9 + 6
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 48
start codons at 10, 19, 31, 75, 404, 413
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.157 = GAGCAGACAACTTGAC-1

using 300 reads

====================================================================================

graph has 120 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 1[296]
surviving nonsolo ucounts = 1[296]
ids = [0]

====================================================================================

UMI info for barcode GAGCAGACAACTTGAC-1 contig 1 = AGAGCTGCTC...
umi CCGCACACCG = 280 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=503]
0-31 ==> 21-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
31-379 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=13)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=1)
419-503 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CQQYDSSPALTF at 355, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 276
start codons at 31, 226, 239, 365, 406, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.158 = GAGCAGACAAGAGTCG-1

using 302 reads

====================================================================================

graph has 80 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 296]
surviving nonsolo ucounts = 1[296]
ids = [3]

====================================================================================

UMI info for barcode GAGCAGACAAGAGTCG-1 contig 1 = GGAGTCAGAC...
umi GCTAAGGAAC = 271 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-26 ==> 155-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
26-377 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=27)
376-414 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 53 reads
cdr3 = CQQYNTYIWTF at 353, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 26, 32, 101, 239, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.165 = GAGCAGACACATCTTT-1

using 72 reads

====================================================================================

graph has 44 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[69]
surviving nonsolo ucounts = 1[69]
ids = [0]

====================================================================================

UMI info for barcode GAGCAGACACATCTTT-1 contig 1 = GATCAGGACT...
umi CTACTCCCAG = 70 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=495]
0-30 ==> 0-30 on |266|IGKV2-30|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |267|IGKV2-30|L-REGION+V-REGION| [len=360] (mis=8)
389-427 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
427-495 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 14 reads
cdr3 = CMQGTHWPWTF at 366, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 68
start codons at 30, 63, 91, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.169 = GAGCAGACACGAAGCA-1

using 103 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[6, 96]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.174 = GAGCAGACAGACAAGC-1

using 243 reads

====================================================================================

graph has 90 edges initially, 6 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[8, 234]
surviving nonsolo ucounts = 2[8, 234]
ids = [1, 0]

====================================================================================

UMI info for barcode GAGCAGACAGACAAGC-1 contig 1 = GCTGGGGTCA...
umi ACTTCATTCT = 221 reads: +203 -2XX +3 -1XX +3 -1XX +175 invalidated
umi ATTTCCGCAC = 6 reads: -129 +1 -1X +1 -11X +1 -4X +8 -2X +1 -1X +25 -2 +6 -1 +42 -2XX +8 -1XX +8 -133 invalidated

GOOD CONTIGS

TIG 1[bases=583]
0-41 ==> 121-162 on |342|IGLV2-23|5'UTR| [len=162] (mis=0)
41-381 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=17)
391-429 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
429-583 ==> 0-154 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 35 reads
cdr3 = CCAYAGTTTWVF at 365, score = 8 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 224
start codons at 41, 180, 242, 249, 252, 375
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.175 = GAGCAGACAGAGCCAA-1

using 8287 reads

====================================================================================

graph has 3476 edges initially, 46 edges after simplification

total ucounts = 496
nonsolo ucounts = 214[2^84, 3^42, 4^24, 5^12, 6^9, 7^3, 8^7, 9^4, 10, 11, 12, 15, 16, 17, 22, 190, 197, 223, 228, 239, 247, 249, 274, 278, 288, 295, 307, 308, 315, 322, 360, 381, 382, 393, 424, 683, 702]
surviving nonsolo ucounts = 21[197, 223, 228, 239, 247, 249, 274, 278, 288, 295, 307, 308, 315, 322, 360, 381, 382, 393, 424, 683, 702]
ids = [328, 477, 151, 365, 20, 60, 210, 470, 484, 107, ...]

====================================================================================

UMI info for barcode GAGCAGACAGAGCCAA-1 contig 1 = GGCATCACAT...
umi ACTTGTCCTT = 220 reads: +445 validated
umi ATGACTCGGT = 258 reads: +445 validated
umi CGCTCACGAA = 242 reads: -372X +1 -1XX +4 -8XX +1 -1XX +1 -2XX +2 -2XX +50 invalidated
umi GTCCTGTGTT = 308 reads: +445 validated
umi GTGCAGACGT = 196 reads: +445 validated
umi TAGAGTTCCC = 233 reads: +445 validated
umi TTGCGTATAC = 216 reads: -330 +115 non-validated
umi TTTAACCCTT = 274 reads: +445 validated
umi TTTCCGGCCC = 268 reads: +445 validated

UMI info for barcode GAGCAGACAGAGCCAA-1 contig 2 = AGAGCTCTGG...
umi ACTTTCGGAT = 426 reads: +385 validated
umi ATGTTTGCTG = 705 reads: +385 validated
umi CAATTTCGCT = 317 reads: +385 validated
umi CAGCTACAGT = 228 reads: +385 validated
umi CATTTTTAAG = 382 reads: +385 validated
umi GGCGCGTTAG = 386 reads: +385 validated
umi TAAACCGGCT = 327 reads: +385 validated
umi TAGGTAGGAT = 682 reads: +385 validated
umi TTCATCCGAG = 392 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=577]
0-61 ==> 0-61 on |84|IGHV1-69|5'UTR| [len=61] (mis=1)
61-414 ==> 0-353 on |85|IGHV1-69|L-REGION+V-REGION| [len=353] (mis=4)
456-506 ==> 13-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
506-577 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 8 umis using 169 reads
cdr3 = CAITVTTFYFFDGVSEDTYGMDVW at 403, score = 9 + 7
umis assigned: [60, 107, 210, 325, 328, 365, 477, 484, 489]
of which 9 are surviving nonsolos
reads assigned: 2194
start codons at 61, 212, 259, 358, 437, 463
confident = true

TIG 2[bases=565]
0-44 ==> 8-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
44-392 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=1)
392-429 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
429-565 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 9 umis using 556 reads
cdr3 = CQQYGSSPLTF at 368, score = 9 + 9
umis assigned: [61, 113, 137, 151, 172, 312, 343, 367, 468]
of which 9 are surviving nonsolos
reads assigned: 3785
start codons at 44, 252, 378, 471
confident = true
now this is a cell
paired!

GCGATTACGGTGACTACGTTTTACTTTTTCGATGGAGTATCCGAGGACACCTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> ATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.185 = GAGCAGACAGTTCCCT-1

using 115 reads

====================================================================================

graph has 50 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[5, 110]
surviving nonsolo ucounts = 1[110]
ids = [0]

====================================================================================

UMI info for barcode GAGCAGACAGTTCCCT-1 contig 1 = AGAACACTTA...
umi CAGACATCAT = 100 reads: +403 validated

GOOD CONTIGS

TIG 1[bases=451]
16-384 ==> 0-368 on |390|IGLV8-61|L-REGION+V-REGION| [len=368] (mis=7)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
419-451 ==> 0-32 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 12 reads
cdr3 = CVLYLGSFSWVF at 355, score = 7 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 98
start codons at 16, 31, 40, 43, 68, 335, 338
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.186 = GAGCAGACATCACGTA-1

using 299 reads

====================================================================================

graph has 122 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 294]
surviving nonsolo ucounts = 1[294]
ids = [2]

====================================================================================

UMI info for barcode GAGCAGACATCACGTA-1 contig 1 = CAGTCTCAGT...
umi ATTTATGTTA = 296 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=545]
0-21 ==> 26-47 on |230|IGKV1-39|5'UTR| [len=47] (mis=0)
21-372 ==> 0-351 on |231|IGKV1-39|L-REGION+V-REGION| [len=351] (mis=11)
371-409 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=0)
409-545 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CQQSYRRPITF at 348, score = 8 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 290
start codons at 21, 27, 83, 96, 232, 331, 451
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.187 = GAGCAGACATGGTCTA-1

using 985 reads

====================================================================================

graph has 1437 edges initially, 44 edges after simplification

total ucounts = 463
nonsolo ucounts = 185[2^76, 3^51, 4^16, 5^14, 6^5, 7^3, 8^4, 9^6, 10, 11^2, 12, 13^3, 14, 15, 19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.191 = GAGCAGACATTAGGCT-1

using 110 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[110]
surviving nonsolo ucounts = 1[110]
ids = [0]

====================================================================================

UMI info for barcode GAGCAGACATTAGGCT-1 contig 1 = GTGGGGTCTC...
umi GATATTCGTC = 109 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=455]
40-384 ==> 0-344 on |339|IGLV2-14|L-REGION+V-REGION| [len=361] (mis=20)
390-428 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=4)
junction support: 1 umis using 20 reads
cdr3 = CSSYISSTTLGF at 364, score = 8 + 9
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 105
start codons at 40, 248, 251
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.200 = GAGCAGAGTATATCCG-1

using 319 reads

====================================================================================

graph has 106 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[3, 4, 309]
surviving nonsolo ucounts = 1[309]
ids = [5]

====================================================================================

UMI info for barcode GAGCAGAGTATATCCG-1 contig 1 = GAATCAGACC...
umi GTTACTGTAT = 308 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |245|IGKV1D-16|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |246|IGKV1D-16|L-REGION+V-REGION| [len=351] (mis=0)
376-413 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNSYPLTF at 352, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 305
start codons at 25, 31, 87, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.205 = GAGCAGAGTCAATGTC-1

using 8451 reads

====================================================================================

graph has 3880 edges initially, 62 edges after simplification

total ucounts = 617
nonsolo ucounts = 248[2^82, 3^72, 4^22, 5^21, 6^9, 7^4, 8^6, 9, 10, 11, 12, 13, 15, 27, 69, 105, 136, 150, 151, 219, 234, 243^2, 249, 252, 254, 261, 297, 305, 306, 308, 313, 320, 325, 333, 384, 543, 592, 690]
surviving nonsolo ucounts = 23[69, 136, 151, 219, 234, 243^2, 249, 252, 254, 261, 297, 305, 306, 308, 313, 320, 325, 333, 384, 543, 592, 690]
ids = [410, 308, 36, 581, 459, 301, 598, 30, 507, 240, ...]

====================================================================================

UMI info for barcode GAGCAGAGTCAATGTC-1 contig 1 = GGTGCAGGAG...
umi AACTGCTAGT = 253 reads: +391 validated
umi CGAGCTGGGC = 310 reads: -358 +1 -1XX +2 -1XX +5 -1XX +9 -1XX +4 -1XX +7 invalidated
umi CTGCTTTGGT = 308 reads: +391 validated
umi GAGGGTCTAC = 392 reads: +391 validated
umi GCAAACGCTT = 576 reads: -353X +1 -2XX +3 -1XX +2 -1XX +5 -1XX +5 -4XX +8 -1XX +4 invalidated
umi GGCAACGCAC = 304 reads: +391 validated
umi TGCTCTCCTC = 337 reads: +391 validated
umi TTGCTCACTC = 247 reads: +391 validated

UMI info for barcode GAGCAGAGTCAATGTC-1 contig 2 = AGTGCTTTCT...
umi AAGCGACCAA = 151 reads: +448 validated
umi CACGGTTCGG = 307 reads: +448 validated
umi CTGTAAGACC = 249 reads: +448 validated
umi CTTACTGATC = 139 reads: +448 validated
umi GCCAGCGGAC = 318 reads: +448 validated
umi GGTTGAGAGG = 265 reads: +448 validated
umi GTTGCTCTCC = 288 reads: -431 +17 non-validated
umi TATGTTTTCC = 240 reads: +448 validated
umi TCTATCAGGG = 253 reads: +448 validated
umi TGAAGGCTAC = 315 reads: +448 validated
umi TTCAATTTTC = 215 reads: +448 validated

GOOD CONTIGS

TIG 1[bases=559]
32-385 ==> 0-353 on |253|IGKV1D-39|L-REGION+V-REGION| [len=353] (mis=15)
384-423 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=3)
423-559 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 6 umis using 302 reads
cdr3 = CQQSYSSPPYTF at 359, score = 9 + 8
umis assigned: [30, 250, 299, 335, 345, 381, 547, 598]
of which 8 are surviving nonsolos
reads assigned: 2671
start codons at 32, 38, 94, 107, 243, 465
confident = true

TIG 2[bases=625]
17-388 ==> 0-371 on |186|IGHV4-34|L-REGION+V-REGION| [len=371] (mis=19)
423-465 ==> 21-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
465-625 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
junction support: 10 umis using 261 reads
cdr3 = CARGVTHSNGRLYYGLDVW at 377, score = 9 + 6
umis assigned: [36, 196, 301, 308, 352, 397, 417, 459, 507, 522] and 1 others
of which 11 are surviving nonsolos
reads assigned: 2681
start codons at 17, 38, 168, 417, 519
confident = true
now this is a cell
paired!

GCTGTATATTATTGTGCGAGAGGGGTGACCCACAGTAACGGGCGACTCTACTATGGTCTGGACGTCTGGGGCCAAGGGACCACGGTCATCGTCTCCTCAG <==> AGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTAGTCCTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.209 = GAGCAGAGTCGAAAGC-1

using 12782 reads

====================================================================================

graph has 4638 edges initially, 70 edges after simplification

total ucounts = 490
nonsolo ucounts = 220[2^83, 3^35, 4^20, 5^12, 6^3, 7^9, 8^4, 9^2, 10^2, 11^3, 12, 14, 15, 21, 33, 40, 74, 85, 100, 109^2, 116, 117, 121, 152, 176, 185, 198, 199, 204, 222, 232, 233, 255, 278, 284, 286^2, 303, 310, 318, 321, 325, 326, 332, 337^2, 341, 361, 364, 372, 373, 374, 540, 660, 716, 751]
surviving nonsolo ucounts = 41[40, 74, 85, 100, 109^2, 116, 121, 152, 176, 185, 198, 199, 204, 222, 232, 233, 255, 278, 284, 286^2, 303, 310, 318, 321, 325, 326, 332, 337^2, 341, 361, 364, 372, 373, 374, 540, 660, 716, 751]
ids = [295, 25, 163, 356, 266, 372, 432, 338, 228, 433, ...]

====================================================================================

UMI info for barcode GAGCAGAGTCGAAAGC-1 contig 1 = TGAGCGCAGA...
umi CGGCTATTAA = 59 reads: +11 -5XX +5 -1 +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +226 -1X +71 -1 +52 invalidated
umi CTGCTTCCGT = 141 reads: +31 -3X +1 -1X +1 -6XX +351 invalidated
umi GATGCACGCA = 155 reads: +394 validated
umi GGCTGCTCGC = 108 reads: +394 validated
umi GTTTCTCTCG = 316 reads: +394 validated
umi TCAGTGCCCC = 209 reads: +394 validated
umi TCTGTCGCAG = 289 reads: +394 validated
umi TGCTATCTAC = 48 reads: -394 non-validated
umi TGGCATGGCT = 303 reads: +394 validated
umi TTACATACAG = 161 reads: +24 -1X +1 -1X +2 -5XX +1 -1XX +1 -6XX +351 invalidated
umi TTATTCGCCT = 89 reads: +18 -2X +1 -1XX +1 -2XX +1 -2XX +1 -5XX +1 -1XX +1 -6XX +343 -1 +7 invalidated
umi TTGTTCACAT = 257 reads: +394 validated

UMI info for barcode GAGCAGAGTCGAAAGC-1 contig 2 = GGGGGAGAGG...
umi TACTTTTCGT = 234 reads: +442 validated
umi TCGCAATCCC = 661 reads: -145X +297 invalidated
umi TCTGGAATGG = 107 reads: -392 +4 -3X +15 -1X +27 invalidated
umi TTACGGCAAT = 285 reads: +442 validated
umi TTATTTCTCT = 178 reads: +442 validated
umi TTCTACCCTT = 171 reads: -379 +17 -3XX +15 -1XX +27 invalidated

GOOD CONTIGS

TIG 1[bases=641]
0-36 ==> 0-36 on |330|IGLV1-51|5'UTR| [len=36] (mis=0)
36-389 ==> 0-353 on |331|IGLV1-51|L-REGION+V-REGION| [len=353] (mis=0)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 11 umis using 277 reads
cdr3 = CGTWDSSLSAGNWVF at 357, score = 7 + 8
umis assigned: [163, 183, 228, 266, 304, 341, 374, 399, 405, 423] and 2 others
of which 12 are surviving nonsolos
reads assigned: 2091
start codons at 36, 190, 241, 365
confident = true

TIG 2[bases=588]
75-428 ==> 0-353 on |128|IGHV3-33|L-REGION+V-REGION| [len=353] (mis=2)
429-450 ==> 0-21 on |33|IGHD6-19|D-REGION| [len=21] (mis=3)
454-517 ==> 0-63 on |737|IGHJ6|J-REGION| [len=63] (mis=0)
517-588 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 4 umis using 129 reads
cdr3 = CARDPYSSGWSPYYYYYYGMDVW at 417, score = 9 + 7
umis assigned: [316, 359, 372, 425, 433, 446]
of which 6 are surviving nonsolos
reads assigned: 1608
start codons at 75, 226, 231, 289, 292, 378, 474
confident = true

REJECT CONTIGS

TIG 1[bases=568]
22-63 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
49-396 ==> 0-347 on |288|IGKV3D-11|L-REGION+V-REGION| [len=347] (mis=2)
395-432 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
432-568 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [20, 23, 25, 119, 120, 129, 154, 198, 200, 219] and 8 others
of which 18 are surviving nonsolos
reads assigned: 5769
start codons at 49, 254, 257, 474
confident = false
did not find CDR3

TIG 2[bases=372]
52-209 ==> 0-157 on rc of segment before IGHJ3P exon 1 [len=157] (mis=0)
207-270 ==> 0-63 on |59|IGHJ6|J-REGION| [len=63] (mis=0)
270-372 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
umis assigned: [13, 208, 295, 297]
of which 4 are surviving nonsolos
reads assigned: 1283
start codons at 59, 93, 132, 187, 227, 288, 349
confident = false
did not find CDR3
now this is a cell
paired!

TGTGCGAGAGACCCGTATAGCAGTGGCTGGTCCCCATATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG <==> CAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGCAATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.211 = GAGCAGAGTCGAATCT-1

using 59 reads

====================================================================================

graph has 38 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 2[3, 50]
surviving nonsolo ucounts = 1[50]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=374]
0-303 ==> 37-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=28)
319-357 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=6)
cdr3 = CCSEAGGGVPGLLF at 287, score = 7 + 9
umis assigned: [0, 1, 5]
of which 1 are surviving nonsolos
reads assigned: 46
start codons at 117
confident = false
not full
VJ delta = 6
not full
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.217 = GAGCAGAGTGACAAAT-1

using 427 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 8
nonsolo ucounts = 6[3^4, 5, 408]
surviving nonsolo ucounts = 1[408]
ids = [4]

====================================================================================

UMI info for barcode GAGCAGAGTGACAAAT-1 contig 1 = GCATCACCCA...
umi GATTCTATCT = 403 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=555]
0-60 ==> 4-64 on |66|IGHV1-2|5'UTR| [len=64] (mis=0)
60-413 ==> 0-353 on |67|IGHV1-2|L-REGION+V-REGION| [len=353] (mis=7)
436-484 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=6)
484-555 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 44 reads
cdr3 = CARSLVSYSSSWIFDYW at 402, score = 8 + 7
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 400
start codons at 60, 258, 263, 295, 324, 357
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.218 = GAGCAGAGTGATAAAC-1

using 214 reads

====================================================================================

graph has 90 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[2, 209]
surviving nonsolo ucounts = 1[209]
ids = [2]

====================================================================================

UMI info for barcode GAGCAGAGTGATAAAC-1 contig 1 = GTGGGCTCAG...
umi CGGGGTCCAA = 201 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=539]
0-35 ==> 0-35 on |350|IGLV3-10|5'UTR| [len=35] (mis=0)
35-382 ==> 0-347 on |351|IGLV3-10|L-REGION+V-REGION| [len=347] (mis=16)
382-420 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=5)
420-539 ==> 0-119 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CYSTDNSGRHSGMF at 350, score = 6 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 197
start codons at 35, 96, 183, 230, 234, 333, 386
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.223 = GAGCAGAGTTCAACCA-1

using 1570 reads

====================================================================================

graph has 478 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[266, 374, 927]
surviving nonsolo ucounts = 3[266, 374, 927]
ids = [0, 1, 3]

====================================================================================

UMI info for barcode GAGCAGAGTTCAACCA-1 contig 1 = AGGAACTGCT...
umi TACACCCCGC = 335 reads: +382 validated

UMI info for barcode GAGCAGAGTTCAACCA-1 contig 2 = AGCTTCAGCT...
umi ATCCGAGGAT = 260 reads: +388 validated
umi TCACCTGTCT = 154 reads: +131 -12XX +1 -6XX +1 -5XX +1 -6XX +1 -224XX invalidated

GOOD CONTIGS

TIG 1[bases=482]
0-32 ==> 65-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=7)
377-414 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
414-482 ==> 0-68 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 45 reads
cdr3 = CQQYNYWPLTF at 353, score = 9 + 9
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 330
start codons at 32, 101, 237, 456
confident = false

TIG 2[bases=559]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-559 ==> 0-124 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 45 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [0, 3]
of which 2 are surviving nonsolos
reads assigned: 411
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 63.224 = GAGCAGAGTTCCATGA-1

using 369 reads

====================================================================================

graph has 134 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[2, 366]
surviving nonsolo ucounts = 1[366]
ids = [1]

====================================================================================

UMI info for barcode GAGCAGAGTTCCATGA-1 contig 1 = GGAGTCAGTC...
umi GACGTTCAGC = 331 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=509]
0-26 ==> 32-58 on |238|IGKV1-9|5'UTR| [len=58] (mis=0)
26-377 ==> 0-351 on |239|IGKV1-9|L-REGION+V-REGION| [len=351] (mis=0)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
414-509 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQLNSYPRTF at 353, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 328
start codons at 26, 32, 88, 237, 456
confident = false
NOT paired!
sorting bam, mem = 0.05
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk063-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk063-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

12.213 seconds used processing barcodes, peak mem = 0.23
