[stdout]

starting vdj_asm_asm, mem = 0.01
available mem = 844.18 GB
/scratch/etanis/software/cellranger-6.1.2/lib/bin/cr_vdj martian assembly main /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk057-ucc6a7a72ce /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk057-ucc6a7a72ce/files /scratch/etanis/ST-118/multi/dimitri-multi/journal/SC_MULTI_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ.fork0.chnk057.ucc6a7a72ce
n50_n50_rpu = 288

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.0 = CTTGGCTTCCGGGTGT-1

using 3968 reads

====================================================================================

graph has 2434 edges initially, 60 edges after simplification

total ucounts = 879
nonsolo ucounts = 369[2^184, 3^80, 4^39, 5^21, 6^15, 7^5, 8^4, 9^2, 10^3, 11^2, 12, 13, 15, 43, 88, 107, 117, 141, 185, 234, 236, 261, 321, 589]
surviving nonsolo ucounts = 10[43, 88, 107, 117, 141, 234, 236, 261, 321, 589]
ids = [339, 166, 735, 876, 645, 788, 27, 606, 322, 350]

====================================================================================

UMI info for barcode CTTGGCTTCCGGGTGT-1 contig 1 = AGACCCAGTC...
umi AACTACGTCT = 235 reads: +385 validated
umi CCTCAACCCG = 318 reads: +385 validated
umi GTTCCACCTT = 263 reads: +385 validated

UMI info for barcode CTTGGCTTCCGGGTGT-1 contig 2 = AGTGACTCCT...
umi ATAATGCACC = 73 reads: +460 validated
umi CCTTTATGCA = 41 reads: -6 +357 -97 non-validated
umi CGAGCCCCTA = 596 reads: -238 +222 non-validated
umi TACTTCGCAA = 139 reads: -393X +4 -3XX +2 -3XX +1 -5XX +49 invalidated
umi TTAATCACGA = 190 reads: +460 validated
umi TTTTTCCCGT = 114 reads: -400X +2 -3XX +1 -5XX +49 invalidated

GOOD CONTIGS

TIG 1[bases=541]
0-20 ==> 161-181 on |232|IGKV1-5|5'UTR| [len=181] (mis=0)
20-371 ==> 0-351 on |233|IGKV1-5|L-REGION+V-REGION| [len=351] (mis=2)
366-405 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=2)
405-541 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 3 umis using 133 reads
cdr3 = CQQYNSYCSF at 347, score = 8 + 7
umis assigned: [27, 322, 606]
of which 3 are surviving nonsolos
reads assigned: 809
start codons at 20, 26, 82, 95, 327, 447
confident = true

TIG 2[bases=582]
0-20 ==> 0-20 on |97|IGHV2-5|5'UTR| [len=20] (mis=0)
20-378 ==> 0-358 on |98|IGHV2-5|L-REGION+V-REGION| [len=358] (mis=0)
395-422 ==> 0-27 on |22|IGHD3-9|D-REGION| [len=27] (mis=6)
429-480 ==> 0-51 on |57|IGHJ5|J-REGION| [len=51] (mis=4)
480-582 ==> 0-102 on |6|IGHD|C-REGION| [len=1289] (mis=0)
junction support: 3 umis using 120 reads
cdr3 = CAHRPSAPRRSVRYFDWFLRREGWFDPW at 365, score = 7 + 7
umis assigned: [166, 339, 350, 645, 788, 876]
of which 6 are surviving nonsolos
reads assigned: 1133
start codons at 20, 64, 243, 246, 326, 335, 498, 559
confident = true
now this is a cell
paired!

TCCGCCCCACGGCGTTCAGTACGATATTTTGACTGGTTCCTTAGGAGGGAGGGGTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> ACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.2 = CTTGGCTTCCTCAATT-1

using 44 reads

====================================================================================

graph has 58 edges initially, 2 edges after simplification

total ucounts = 15
nonsolo ucounts = 4[2^2, 4, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.36 = CTTGGCTTCTTGGGTA-1

using 45 reads

====================================================================================

graph has 117 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 3[2^2, 40]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.39 = CTTTGCGAGAAGGCCT-1

using 356 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[4, 350]
surviving nonsolo ucounts = 1[350]
ids = [2]

====================================================================================

UMI info for barcode CTTTGCGAGAAGGCCT-1 contig 1 = GAAGAGCTGC...
umi GTACTTGCCC = 335 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=513]
0-33 ==> 19-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
33-381 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=10)
380-418 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
418-513 ==> 0-95 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 66 reads
cdr3 = CQQYGSSPLTF at 357, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 327
start codons at 33, 241, 367, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.44 = CTTTGCGAGACTCGGA-1

using 201 reads

====================================================================================

graph has 74 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[198]
surviving nonsolo ucounts = 1[198]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGAGACTCGGA-1 contig 1 = GGGGTCTCAG...
umi ACTCTGGCCA = 193 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-38 ==> 4-42 on |336|IGLV2-11|5'UTR| [len=42] (mis=0)
38-382 ==> 0-344 on |337|IGLV2-11|L-REGION+V-REGION| [len=358] (mis=11)
388-426 ==> 0-38 on |309|IGLJ1|J-REGION| [len=38] (mis=2)
426-538 ==> 0-112 on |305|IGLC1|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 36 reads
cdr3 = CSSYAGSYKYVF at 362, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 191
start codons at 38, 177, 195, 249, 345, 372, 390
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.47 = CTTTGCGAGAGTAATC-1

using 524 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 520]
surviving nonsolo ucounts = 1[520]
ids = [3]

====================================================================================

UMI info for barcode CTTTGCGAGAGTAATC-1 contig 1 = GAGCTGCTCA...
umi GATTTTCTTC = 518 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=551]
0-30 ==> 22-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
30-378 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=18)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=0)
415-551 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 67 reads
cdr3 = CQQYGSSSWTF at 354, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 512
start codons at 30, 364, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.55 = CTTTGCGAGCCTATGT-1

using 243 reads

====================================================================================

graph has 244 edges initially, 2 edges after simplification

total ucounts = 41
nonsolo ucounts = 30[2^4, 3^2, 4^3, 5, 6^4, 8^3, 9, 10^3, 11^4, 12, 13, 14^2, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.63 = CTTTGCGAGGAATGGA-1

using 10170 reads

====================================================================================

graph has 4506 edges initially, 42 edges after simplification

total ucounts = 579
nonsolo ucounts = 271[2^87, 3^48, 4^35, 5^28, 6^8, 7^11, 8^4, 9^6, 10^5, 11^3, 12, 14^2, 15, 93, 140, 187, 192^2, 202, 215, 218, 222, 236^2, 247, 249^2, 258, 261, 271, 283, 285, 292, 297, 300, 336, 338, 342, 349, 354, 361, 362, 372, 432, 544]
surviving nonsolo ucounts = 31[93, 140, 187, 192^2, 202, 215, 218, 222, 236, 247, 249^2, 258, 261, 271, 283, 285, 292, 297, 300, 336, 338, 342, 349, 354, 361, 362, 372, 432, 544]
ids = [69, 16, 280, 136, 504, 366, 378, 493, 501, 436, ...]

====================================================================================

UMI info for barcode CTTTGCGAGGAATGGA-1 contig 1 = TCTGGCACCA...
umi AACGCCCCGG = 414 reads: +385 validated
umi AGTCGCCGTG = 88 reads: +385 validated
umi CAATACTTCA = 292 reads: +385 validated
umi CCTCACTATG = 360 reads: +385 validated
umi CCTTACTCGT = 256 reads: +385 validated
umi CGGCGCCTGA = 357 reads: +385 validated
umi CTTAGCAGTT = 372 reads: +385 validated
umi CTTCTCGCCT = 256 reads: +385 validated
umi GCAACAATTA = 254 reads: +385 validated
umi GGATACCTCT = 357 reads: +385 validated
umi GGGAAATATG = 237 reads: +385 validated
umi GTCGAATGGG = 185 reads: +385 validated
umi GTTTCGGCTG = 345 reads: +385 validated
umi TATTATGGAT = 245 reads: +385 validated
umi TGCTATAACG = 226 reads: +385 validated

UMI info for barcode CTTTGCGAGGAATGGA-1 contig 2 = GGGGCTTTCT...
umi AAACCGTATC = 288 reads: +454 validated
umi AAGCTCCCTC = 142 reads: +454 validated
umi AGCTCTGCAA = 346 reads: +454 validated
umi CATACCACAG = 192 reads: +454 validated
umi CTTTCAGTTG = 171 reads: +454 validated
umi TAATTTTCCC = 301 reads: +454 validated

GOOD CONTIGS

TIG 1[bases=630]
0-34 ==> 0-34 on |387|IGLV7-46|5'UTR| [len=34] (mis=0)
34-385 ==> 0-351 on |388|IGLV7-46|L-REGION+V-REGION| [len=351] (mis=1)
381-419 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=1)
419-630 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
junction support: 14 umis using 699 reads
cdr3 = CLLSYSGARVF at 358, score = 8 + 8
umis assigned: [11, 69, 109, 192, 201, 221, 269, 275, 307, 345] and 5 others
of which 15 are surviving nonsolos
reads assigned: 4184
start codons at 34, 242, 341
confident = true

TIG 2[bases=542]
17-394 ==> 0-377 on |190|IGHV4-39|L-REGION+V-REGION| [len=377] (mis=3)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=1)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 6 umis using 120 reads
cdr3 = CATLPRPGAFLSGDYLDYW at 383, score = 9 + 7
umis assigned: [5, 16, 64, 136, 280, 396]
of which 6 are surviving nonsolos
reads assigned: 1423
start codons at 17, 26, 38, 82
confident = true

REJECT CONTIGS

TIG 1[bases=563]
1-45 ==> 5956-6000 on segment before IGKV3OR2-268 exon 1 [len=6000] (mis=1)
1-45 ==> 5956-6000 on rc of segment after IGKV3-11 exon 1 [len=6000] (mis=1)
18-59 ==> 5709-5750 on segment before IGKV3OR2-5 exon 1 [len=6000] (mis=3)
37-396 ==> 0-359 on |294|IGKV3D-7|L-REGION+V-REGION| [len=359] (mis=1)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=2)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [31, 107, 233, 306, 378, 395, 436, 493, 504, 546]
of which 10 are surviving nonsolos
reads assigned: 2843
start codons at 37, 45, 115, 254, 469
confident = false
did not find CDR3
now this is a cell
paired!

GCTGTGTATTACTGTGCGACTCTACCGCGCCCAGGGGCGTTTCTCTCAGGTGACTACTTGGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> CTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.66 = CTTTGCGAGGATATAC-1

using 205 reads

====================================================================================

graph has 72 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[205]
surviving nonsolo ucounts = 1[205]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGAGGATATAC-1 contig 1 = AGCTCTGAGA...
umi CCCTAGTTGC = 200 reads: +424 validated

GOOD CONTIGS

TIG 1[bases=557]
0-79 ==> 0-79 on |119|IGHV3-21|5'UTR| [len=79] (mis=0)
79-432 ==> 0-353 on |120|IGHV3-21|L-REGION+V-REGION| [len=353] (mis=18)
456-503 ==> 16-63 on |737|IGHJ6|J-REGION| [len=63] (mis=1)
503-557 ==> 0-54 on |43|IGHG2|C-REGION| [len=977] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CARDRAATARLGGMDVW at 421, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 198
start codons at 79, 230, 235, 382, 460
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.68 = CTTTGCGAGGCACATG-1

using 213 reads

====================================================================================

graph has 144 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2, 3, 205]
surviving nonsolo ucounts = 1[205]
ids = [4]

====================================================================================

UMI info for barcode CTTTGCGAGGCACATG-1 contig 1 = AGCTCTGGGA...
umi CTCGCTACGG = 197 reads: +418 validated

GOOD CONTIGS

TIG 1[bases=588]
0-80 ==> 0-80 on |166|IGHV3-73|5'UTR| [len=80] (mis=0)
80-439 ==> 0-359 on |167|IGHV3-73|L-REGION+V-REGION| [len=359] (mis=25)
479-498 ==> 33-52 on |49|IGHJ1|J-REGION| [len=52] (mis=0)
498-588 ==> 0-90 on |45|IGHG3|C-REGION| [len=1130] (mis=0)
junction support: 1 umis using 29 reads
cdr3 = CTRHREFDRTDYW at 428, score = 8 + 6
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 192
start codons at 80, 146, 360, 389
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.79 = CTTTGCGAGTGTACCT-1

using 762 reads

====================================================================================

graph has 250 edges initially, 30 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[284, 476]
surviving nonsolo ucounts = 2[284, 476]
ids = [0, 1]

====================================================================================

UMI info for barcode CTTTGCGAGTGTACCT-1 contig 1 = ATCAGTCCCA...
umi AAAGAGCCGT = 284 reads: +22 -1XX +365 invalidated
umi ACCATTTGCT = 261 reads: +48 -1XX +13 -1XX +26 -1XX +3 -1XX +10 -1XX +5 -1XX +5 -1XX +6 -23 +1 -4XX +3 -2XX +1 -5XX +2 -1XX +1 -1XX +5 -1XX +8 -1XX +20 -1XX +3 -1XX +2 -2XX +3 -1XX +3 -1XX +4 -1XX +6 -1XX +4 -2XX +21 -2XX +14 -2XX +11 -1XX +5 -33X +1 -3XX +1 -3XX +1 -1XX +3 -5XX +3 -1XX +3 -1XX +7 -1XX +20 -1XX +4 -1XX +2 invalidated

GOOD CONTIGS

TIG 1[bases=547]
0-23 ==> 4-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
23-374 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=18)
373-411 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
411-547 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CLQYSSSPWTF at 350, score = 9 + 8
umis assigned: [0, 1]
of which 2 are surviving nonsolos
reads assigned: 528
start codons at 23, 29, 98, 234, 453
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.84 = CTTTGCGCAAGCGATG-1

using 320 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 2[2, 318]
surviving nonsolo ucounts = 1[318]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGCAAGCGATG-1 contig 1 = GGAGGAACTG...
umi AGAGCAGCCT = 254 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=507]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=35)
378-416 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=3)
416-507 ==> 0-91 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CEQYNFWPRTF at 355, score = 8 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 250
start codons at 34, 103, 239, 458
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.88 = CTTTGCGCAATAGCGG-1

using 262 reads

====================================================================================

graph has 132 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[262]
surviving nonsolo ucounts = 1[262]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGCAATAGCGG-1 contig 1 = CTCGGGACGT...
umi CGCGAACGAA = 259 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=613]
17-357 ==> 0-340 on |343|IGLV2-23|L-REGION+V-REGION| [len=340] (mis=24)
374-402 ==> 10-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
402-613 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=1)
junction support: 1 umis using 37 reads
cdr3 = CFSYGTSGRTF at 341, score = 8 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 256
start codons at 17, 225, 351
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.96 = CTTTGCGCACCAGGTC-1

using 34 reads

====================================================================================

graph has 48 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 4[3, 5, 7, 14]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.100 = CTTTGCGCACCTTGTC-1

using 15 reads

====================================================================================

graph has 8 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[15]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.101 = CTTTGCGCACGAAATA-1

using 203 reads

====================================================================================

graph has 118 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[2, 199]
surviving nonsolo ucounts = 1[199]
ids = [2]

====================================================================================

UMI info for barcode CTTTGCGCACGAAATA-1 contig 1 = GGAGGAACTG...
umi CAACAGGTCT = 201 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=555]
0-34 ==> 63-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
34-379 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
382-419 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
419-555 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 37 reads
cdr3 = CQQYNNWPPLTF at 355, score = 9 + 9
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 196
start codons at 34, 103, 239, 461
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.106 = CTTTGCGCAGATTGCT-1

using 298 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[2, 292]
surviving nonsolo ucounts = 1[292]
ids = [3]

====================================================================================

UMI info for barcode CTTTGCGCAGATTGCT-1 contig 1 = ACTGATCAGG...
umi TAGATCACGA = 274 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=514]
0-33 ==> 3-36 on |272|IGKV2D-28|5'UTR| [len=36] (mis=0)
33-393 ==> 0-360 on |273|IGKV2D-28|L-REGION+V-REGION| [len=360] (mis=3)
392-430 ==> 0-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
430-514 ==> 0-84 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 46 reads
cdr3 = CMQALQTLFTF at 369, score = 9 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 268
start codons at 33, 66, 102, 190, 352, 372, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.107 = CTTTGCGCAGCATACT-1

using 273 reads

====================================================================================

graph has 128 edges initially, 2 edges after simplification

total ucounts = 80
nonsolo ucounts = 55[2^11, 3^10, 4^8, 5^10, 6^9, 7^3, 8, 9^2, 13]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.116 = CTTTGCGCAGTGAGTG-1

using 241 reads

====================================================================================

graph has 78 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[241]
surviving nonsolo ucounts = 1[241]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGCAGTGAGTG-1 contig 1 = GGGAATCAGT...
umi AGATCAGTGA = 222 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=480]
0-27 ==> 0-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=1)
27-378 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
377-415 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
415-480 ==> 0-65 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 40 reads
cdr3 = CLQYSSSPWTF at 354, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 220
start codons at 27, 33, 102, 238, 457
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.121 = CTTTGCGCATCCGCGA-1

using 354 reads

====================================================================================

graph has 140 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 3[2, 6, 346]
surviving nonsolo ucounts = 1[346]
ids = [2]

====================================================================================

UMI info for barcode CTTTGCGCATCCGCGA-1 contig 1 = GAATCAGTCC...
umi TATGTCTTAG = 342 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=549]
0-25 ==> 2-27 on |222|IGKV1-17|5'UTR| [len=27] (mis=0)
25-376 ==> 0-351 on |223|IGKV1-17|L-REGION+V-REGION| [len=351] (mis=19)
375-413 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=1)
413-549 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 48 reads
cdr3 = CLQYSSSPWTF at 352, score = 9 + 8
umis assigned: [2]
of which 1 are surviving nonsolos
reads assigned: 339
start codons at 25, 31, 100, 236, 455
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.129 = CTTTGCGCATTAGGCT-1

using 364 reads

====================================================================================

graph has 168 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[4, 356]
surviving nonsolo ucounts = 1[356]
ids = [5]

====================================================================================

UMI info for barcode CTTTGCGCATTAGGCT-1 contig 1 = GGGGAGGAAC...
umi TCCATTATTC = 359 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=560]
0-36 ==> 11-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=0)
36-381 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=0)
387-424 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
424-560 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 57 reads
cdr3 = CQQRSNWPPGLTF at 357, score = 9 + 9
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 352
start codons at 36, 241, 244, 466
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.136 = CTTTGCGGTAGGAGTC-1

using 159 reads

====================================================================================

graph has 84 edges initially, 2 edges after simplification

total ucounts = 10
nonsolo ucounts = 5[2^3, 4, 144]
surviving nonsolo ucounts = 1[144]
ids = [5]

====================================================================================

UMI info for barcode CTTTGCGGTAGGAGTC-1 contig 1 = AGCTTCAGCT...
umi GCTAATGCCC = 140 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=538]
0-47 ==> 67-114 on |322|IGLV1-44|5'UTR| [len=114] (mis=0)
47-400 ==> 0-353 on |323|IGLV1-44|L-REGION+V-REGION| [len=353] (mis=15)
397-435 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=3)
435-538 ==> 0-103 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CASWDDSLRGRVF at 368, score = 8 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 138
start codons at 47, 201, 351, 376, 381
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.143 = CTTTGCGGTCAAACTC-1

using 18 reads

====================================================================================

graph has 14 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[18]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.162 = CTTTGCGGTGTAAGTA-1

using 693 reads

====================================================================================

graph has 226 edges initially, 14 edges after simplification

total ucounts = 7
nonsolo ucounts = 4[2, 148, 250, 290]
surviving nonsolo ucounts = 3[148, 250, 290]
ids = [6, 0, 5]

====================================================================================

UMI info for barcode CTTTGCGGTGTAAGTA-1 contig 1 = GCTCAGTTAG...
umi TTTCATCACC = 148 reads: +385 validated

UMI info for barcode CTTTGCGGTGTAAGTA-1 contig 2 = TGGGCCTCAG...
umi TGCTCCTCAT = 290 reads: +376 validated

GOOD CONTIGS

TIG 1[bases=546]
0-25 ==> 27-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
25-373 ==> 0-348 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=4)
371-410 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=5)
410-546 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 18 reads
cdr3 = CQQYGSSPVTF at 349, score = 9 + 8
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 146
start codons at 25, 233, 236, 359, 452
confident = false

TIG 2[bases=623]
0-36 ==> 16-52 on |348|IGLV3-1|5'UTR| [len=52] (mis=0)
36-382 ==> 0-346 on |349|IGLV3-1|L-REGION+V-REGION| [len=346] (mis=5)
374-412 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=1)
412-623 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 56 reads
cdr3 = CQAWDSSTAVF at 351, score = 6 + 8
umis assigned: [5]
of which 1 are surviving nonsolos
reads assigned: 287
start codons at 36, 41, 97, 184, 330, 334
confident = false

REJECT CONTIGS

TIG 1[bases=654]
0-51 ==> 0-51 on |320|IGLV1-40|5'UTR| [len=51] (mis=0)
51-407 ==> 0-356 on |321|IGLV1-40|L-REGION+V-REGION| [len=356] (mis=0)
405-443 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=2)
443-654 ==> 0-211 on |307|IGLC3|C-REGION| [len=317] (mis=0)
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 246
start codons at 51, 205, 208, 259, 358, 385
confident = false
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.163 = CTTTGCGGTGTGGTTT-1

using 464 reads

====================================================================================

graph has 156 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 2[34, 428]
surviving nonsolo ucounts = 1[428]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGGTGTGGTTT-1 contig 1 = ACTTTCTGAG...
umi GATAAGATCT = 430 reads: +436 validated

GOOD CONTIGS

TIG 1[bases=542]
0-35 ==> 29-64 on |191|IGHV4-4|5'UTR| [len=64] (mis=2)
35-388 ==> 0-353 on |192|IGHV4-4|L-REGION+V-REGION| [len=353] (mis=1)
391-411 ==> 0-20 on |18|IGHD3-10|D-REGION| [len=27] (mis=0)
423-471 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=0)
471-542 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 1 umis using 33 reads
cdr3 = CARVTYYYGSGTLRGDYFDYW at 377, score = 9 + 7
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 421
start codons at 14, 35, 79, 399
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.165 = CTTTGCGGTGTTTGGT-1

using 11 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[11]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.176 = CTTTGCGTCACATAGC-1

using 313 reads

====================================================================================

graph has 96 edges initially, 2 edges after simplification

total ucounts = 4
nonsolo ucounts = 1[310]
surviving nonsolo ucounts = 1[310]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGTCACATAGC-1 contig 1 = AGGAACTGCT...
umi AGCTGTTGCT = 309 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=550]
32-377 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=17)
375-414 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=4)
414-550 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 49 reads
cdr3 = CQQYNYWPYTF at 353, score = 10 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 303
start codons at 32, 101, 456
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.177 = CTTTGCGTCACCCGAG-1

using 16 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[16]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.178 = CTTTGCGTCACTATTC-1

using 843 reads

====================================================================================

graph has 1338 edges initially, 14 edges after simplification

total ucounts = 381
nonsolo ucounts = 170[2^73, 3^31, 4^30, 5^15, 6^7, 7^3, 8^2, 9, 10^4, 12, 16, 17, 25]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.180 = CTTTGCGTCAGCATGT-1

using 19 reads

====================================================================================

graph has 16 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[19]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.185 = CTTTGCGTCCATTCTA-1

using 220 reads

====================================================================================

graph has 88 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[220]
surviving nonsolo ucounts = 1[220]
ids = [0]

====================================================================================

UMI info for barcode CTTTGCGTCCATTCTA-1 contig 1 = GAGCTACAAC...
umi GATGACGTCA = 221 reads: +400 validated

GOOD CONTIGS

TIG 1[bases=566]
0-30 ==> 145-175 on |295|IGKV4-1|5'UTR| [len=175] (mis=1)
30-393 ==> 0-363 on |296|IGKV4-1|L-REGION+V-REGION| [len=363] (mis=20)
391-430 ==> 0-39 on |214|IGKJ2|J-REGION| [len=39] (mis=6)
430-566 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 42 reads
cdr3 = CQQYYGSPRTF at 369, score = 9 + 8
umis assigned: [0]
of which 1 are surviving nonsolos
reads assigned: 216
start codons at 27, 30, 85, 99, 352, 382, 472
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.189 = CTTTGCGTCCGTACAA-1

using 183 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[2, 4, 175]
surviving nonsolo ucounts = 1[175]
ids = [3]

====================================================================================

UMI info for barcode CTTTGCGTCCGTACAA-1 contig 1 = CTGGGCCTAA...
umi TGTAGGCGGC = 175 reads: +382 validated

GOOD CONTIGS

TIG 1[bases=578]
0-37 ==> 214-251 on |358|IGLV3-21|5'UTR| [len=251] (mis=0)
37-369 ==> 0-332 on |359|IGLV3-21|L-REGION+V-REGION| [len=351] (mis=36)
381-419 ==> 0-38 on |311|IGLJ2|J-REGION| [len=38] (mis=2)
419-578 ==> 0-159 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 1 umis using 34 reads
cdr3 = CQVWDRSRDHVVF at 352, score = 6 + 8
umis assigned: [3]
of which 1 are surviving nonsolos
reads assigned: 172
start codons at 37, 86, 98, 121, 335, 380
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.201 = CTTTGCGTCGTGGGAA-1

using 272 reads

====================================================================================

graph has 260 edges initially, 2 edges after simplification

total ucounts = 96
nonsolo ucounts = 30[2^19, 3^5, 10, 14, 15, 25, 30, 59]
surviving nonsolo ucounts = 7[2^2, 10, 14, 25, 30, 59]
ids = [0, 84, 11, 4, 71, 21, 69]

====================================================================================

UMI info for barcode CTTTGCGTCGTGGGAA-1 contig 1 = GAGGAACTGC...
umi AAAGCATCTC = 2 reads: -208 +1 -1 +94 -75 non-validated
umi ACTACTATCC = 13 reads: +294 -29 +56 non-validated
umi CACAGACCAT = 9 reads: +26 -4 +98 -3 +59 -1 +7 -1 +1 -15 +2 -1 +10 -1 +4 -1 +138 -7 non-validated
umi CCTCACGTTA = 26 reads: +287 -6 +60 -1 +1 -24 non-validated
umi TCATCTCAGC = 58 reads: +379 validated
umi TCGAAATTAC = 22 reads: +119 -16 +116 -1 +5 -30 +92 non-validated
umi TTCCGGTCAA = 2 reads: -263 +96 -20 non-validated

GOOD CONTIGS

TIG 1[bases=475]
0-33 ==> 64-97 on |280|IGKV3-15|5'UTR| [len=97] (mis=0)
33-378 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=10)
374-412 ==> 0-38 on |213|IGKJ1|J-REGION| [len=38] (mis=4)
412-475 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 10 reads
cdr3 = CQHYNKWPSV at 354, score = 9 + 6
umis assigned: [0, 4, 11, 21, 69, 71, 84]
of which 7 are surviving nonsolos
reads assigned: 129
start codons at 33, 102, 238, 454
confident = true
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.211 = GAAACTCAGAGGACGG-1

using 328 reads

====================================================================================

graph has 110 edges initially, 2 edges after simplification

total ucounts = 7
nonsolo ucounts = 1[322]
surviving nonsolo ucounts = 1[322]
ids = [4]

====================================================================================

UMI info for barcode GAAACTCAGAGGACGG-1 contig 1 = GGGAGAGCCC...
umi TCCGTCCTCA = 316 reads: +379 validated

GOOD CONTIGS

TIG 1[bases=489]
0-47 ==> 0-47 on |278|IGKV3-11|5'UTR| [len=47] (mis=2)
47-392 ==> 0-345 on |279|IGKV3-11|L-REGION+V-REGION| [len=345] (mis=5)
389-426 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
426-489 ==> 0-63 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 54 reads
cdr3 = CQQRSKGLTF at 368, score = 9 + 9
umis assigned: [4]
of which 1 are surviving nonsolos
reads assigned: 295
start codons at 47, 252, 255, 468
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.212 = GAAACTCAGAGTACCG-1

using 52 reads

====================================================================================

graph has 64 edges initially, 2 edges after simplification

total ucounts = 13
nonsolo ucounts = 9[2^3, 4^2, 5^2, 7, 17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.213 = GAAACTCAGATCACGG-1

using 83 reads

====================================================================================

graph has 22 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[83]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.217 = GAAACTCAGATGTTAG-1

using 28686 reads

====================================================================================

graph has 10694 edges initially, 98 edges after simplification

total ucounts = 1517
nonsolo ucounts = 759[2^224, 3^149, 4^105, 5^57, 6^42, 7^28, 8^14, 9^8, 10^2, 11^4, 12^2, 13^2, 14^2, 15, 16, 17^3, 19^2, 28, 31, 32, 33, 36, 37, 44, 46, 48, 50, 59, 63, 81, 87, 91, 101, 103, 107, 114, 118, 119, 128, 133, 135, 139, 140, 145^2, 149, 155, 156, 163^2, 164, 165, 173, 174, 175, 179, 180, 182, 186, 187, 192, 194, 195^2, 198, 204^2, 205, 206^2, 208, 214, 215, 219, 220^2, 221, 224, 227, 228, 229^2, 232, 235^3, 241, 245, 248^2, 250, 252, 258, 262, 263, 267, 268, 270, 271, 283, 288, 289^2, 292, 294, 296^3, 298, 301, 308^2, 309, 314^2, 318^2, 321, 328, 333, 341, 355, 360, 364, 379, 570, 625, 715, 717, 738]
surviving nonsolo ucounts = 99[32, 36, 63, 87, 101, 103, 107, 114, 118, 119, 128, 133, 135, 139, 140, 145^2, 149, 155, 156, 163^2, 165, 173, 174, 175, 179, 180, 186, 187, 192, 194, 195^2, 198, 204^2, 205, 206^2, 208, 215, 219, 220^2, 221, 224, 227, 228, 229^2, 232, 235^3, 241, 245, 248^2, 250, 252, 258, 262, 263, 267, 268, 270, 271, 283, 288, 289^2, 292, 294, 296^3, 298, 301, 308^2, 309, 314^2, 318^2, 321, 328, 333, 341, 355, 360, 364, 379, 570, 625, 715, 717, 738]
ids = [1416, 1112, 199, 1308, 772, 424, 463, 1132, 1148, 540, ...]

====================================================================================

UMI info for barcode GAAACTCAGATGTTAG-1 contig 1 = TGGGGAGCAG...
umi ACACGCTTAG = 263 reads: +400 validated
umi ACGACTCGCC = 269 reads: +400 validated
umi ACTCTGATAG = 172 reads: +400 validated
umi ACTTCCTAGC = 32 reads: -372 +1 -4X +2 -4X +1 -9XX +1 -4XX +2 invalidated
umi AGCGATACGG = 196 reads: +400 validated
umi AGGGTAAGTT = 63 reads: +400 validated
umi ATCGTGCCGG = 165 reads: +400 validated
umi ATCGTTAGGG = 231 reads: +400 validated
umi ATTCTCATTA = 304 reads: +400 validated
umi ATTGTATCAG = 26 reads: -388 +1 -1X +10 invalidated
umi CAAGTTCCTA = 174 reads: +400 validated
umi CACGTGTGTA = 48 reads: -366X +1 -4XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated
umi CCAGACGTCT = 224 reads: +400 validated
umi CCCTTTGCTT = 219 reads: +400 validated
umi CGACCGGCCG = 7 reads: -393X +1 -4X +2 invalidated
umi CTTGGGCCAC = 190 reads: +400 validated
umi TACTCAATTT = 35 reads: -231 +169 non-validated
umi TCAGTAGGGT = 273 reads: +400 validated
umi TGACCCTCAC = 208 reads: +400 validated
umi TGACCTGCAC = 50 reads: -366X +1 -4XX +2 -4XX +2 -4XX +1 -9XX +1 -4XX +2 invalidated

UMI info for barcode GAAACTCAGATGTTAG-1 contig 2 = GGAGTCTCCC...
umi AACAATCAGT = 151 reads: +414 -13 non-validated
umi AAGCTAAGAC = 242 reads: +427 validated
umi ACAGTAATTG = 254 reads: +427 validated
umi ACCATGCGCT = 236 reads: +427 validated
umi ACCCCATAGG = 158 reads: +427 validated
umi ACGCGGGCAC = 289 reads: +427 validated
umi ACTCTTATCG = 204 reads: +427 validated
umi AGGCGCGGAA = 227 reads: +421 -6 non-validated
umi AGGTATATGC = 128 reads: +375 -11 +4 -3 +2 -1 +3 -1 +3 -1 +8 -1 +2 -1 +5 -2 +4 non-validated
umi ATCCGGGGGT = 228 reads: +85 -1XX +304 -37 invalidated
umi CACGCCGAAT = 157 reads: +427 validated
umi CACGGAGAGT = 602 reads: +427 validated
umi CACTATGCGG = 223 reads: +427 validated
umi CATACGGAGA = 102 reads: +370 -1 +36 -1 +4 -1 +1 -1X +12 invalidated
umi CCAAGCCCTG = 203 reads: +427 validated
umi CCAGCGTATA = 108 reads: +427 validated
umi CCGCGACCGC = 137 reads: +427 validated
umi CCGTGTTCAT = 225 reads: +427 validated
umi CCTCCGTTTG = 120 reads: +423 -4 non-validated
umi CGAGACCGAA = 266 reads: +427 validated
umi CGCTCTACCA = 287 reads: +427 validated
umi CTCATGGGAC = 307 reads: +427 validated
umi CTCCAGCACC = 287 reads: +427 validated
umi CTCTTGCTCC = 225 reads: +427 validated
umi CTGTATCCTT = 364 reads: +427 validated
umi CTGTATGGGA = 139 reads: +427 validated
umi CTTGAAACTA = 316 reads: +427 validated
umi CTTGCTCCGC = 99 reads: +327 -2 +98 non-validated
umi CTTTCCGTGC = 205 reads: +397 -30 non-validated
umi GACGGTCACC = 167 reads: +427 validated
umi GAGTTAATCC = 157 reads: +427 validated
umi GATAAAGGCG = 252 reads: +427 validated
umi GATCACTGTC = 319 reads: +425 -2 non-validated
umi GATGAGTTCC = 191 reads: +163 -1XX +250 -13 invalidated
umi GATTGGAATG = 286 reads: +421 -6 non-validated
umi GATTGTCCGT = 317 reads: +427 validated
umi GCCAACCTTA = 289 reads: +427 validated
umi GCCGTATCGT = 273 reads: +427 validated
umi GCCTCTACGG = 198 reads: +427 validated
umi GCGGCCGTCT = 135 reads: +309 -8 +59 -1 +50 non-validated
umi GCTATAACCT = 296 reads: +427 validated
umi GGCCCTGCAT = 252 reads: +401 -2 +3 -2 +7 -1 +5 -1 +5 non-validated
umi GGGCAAGGCA = 328 reads: +427 validated
umi GTTCCACCGT = 356 reads: +427 validated
umi TACGATAGGT = 247 reads: +427 validated
umi TAGTCACAGT = 114 reads: +427 validated
umi TATATCTTCG = 111 reads: +412 -15 non-validated
umi TATCACCCTT = 204 reads: +427 validated
umi TATCACTTTC = 286 reads: +427 validated
umi TATCCACTTT = 292 reads: +427 validated
umi TATGCGGTTA = 236 reads: +369 -18 +40 non-validated
umi TCAAGCTGTT = 196 reads: +427 validated
umi TCCATTTCAG = 175 reads: +427 validated
umi TCGGTTTCTC = 230 reads: +427 validated
umi TGACTTTTCT = 86 reads: +418 -8 +1 non-validated
umi TGAGATAGGT = 178 reads: +427 validated
umi TGCTATATGC = 304 reads: +427 validated
umi TGGTGCAAAT = 186 reads: +410 -2 +1 -1 +3 -10 non-validated
umi TGTACGAATG = 222 reads: +409 -1 +12 -5 non-validated
umi TGTGTCTCAT = 592 reads: +122 -2XX +3 -3XX +1 -4XX +1 -4XX +1 -3XX +1 -81XX +1 -2XX +2 -1XX +1 -2XX +1 -4XX +1 -1XX +1 -4XX +2 -4XX +174 invalidated
umi TGTTGAGCAG = 313 reads: +427 validated
umi TTGCTCATTC = 241 reads: +427 validated
umi TTGTGAAGCG = 293 reads: +427 validated
umi TTTTCTAATA = 147 reads: +357 -1 +60 -9 non-validated

GOOD CONTIGS

TIG 1[bases=641]
30-392 ==> 0-362 on |372|IGLV4-60|L-REGION+V-REGION| [len=362] (mis=0)
392-430 ==> 0-38 on |313|IGLJ3|J-REGION| [len=38] (mis=0)
430-641 ==> 0-211 on |306|IGLC2|C-REGION| [len=317] (mis=0)
junction support: 15 umis using 493 reads
cdr3 = CETWDSNTHWVF at 366, score = 7 + 8
umis assigned: [60, 112, 134, 149, 176, 199, 269, 271, 315, 322] and 10 others
of which 20 are surviving nonsolos
reads assigned: 3103
start codons at 30, 194, 234, 349
confident = true

TIG 2[bases=557]
0-59 ==> 0-59 on |202|IGHV5-51|5'UTR| [len=59] (mis=1)
59-412 ==> 0-353 on |203|IGHV5-51|L-REGION+V-REGION| [len=353] (mis=1)
438-486 ==> 0-48 on |55|IGHJ4|J-REGION| [len=48] (mis=5)
486-557 ==> 0-71 on |60|IGHM|C-REGION| [len=1358] (mis=0)
junction support: 47 umis using 844 reads
cdr3 = CARRGGSRYYDSSDPDYW at 401, score = 8 + 7
umis assigned: [5, 22, 69, 85, 90, 117, 135, 194, 202, 262] and 54 others
of which 64 are surviving nonsolos
reads assigned: 14706
start codons at 59, 233, 257, 392, 429
confident = true

REJECT CONTIGS

TIG 1[bases=553]
5-77 ==> 5665-5737 on segment before IGKV1OR2-6 exon 1 [len=5879] (mis=1)
29-382 ==> 0-353 on |251|IGKV1D-37|L-REGION+V-REGION| [len=353] (mis=1)
389-417 ==> 10-38 on |215|IGKJ3|J-REGION| [len=38] (mis=0)
417-553 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
umis assigned: [6, 105, 337, 445, 482, 847, 1024, 1127, 1161, 1192] and 4 others
of which 14 are surviving nonsolos
reads assigned: 5098
start codons at 29, 35, 91, 339, 372, 459
confident = false
did not find CDR3
now this is a cell
paired!

ACCGCCATGTATTACTGTGCGAGACGAGGCGGGAGTAGATACTATGATAGTAGTGACCCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG <==> TCCAACCTCCAGTTTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCATTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.224 = GAAACTCAGCGTCTAT-1

using 93 reads

====================================================================================

graph has 18 edges initially, 2 edges after simplification

total ucounts = 2
nonsolo ucounts = 1[92]
surviving nonsolo ucounts = 1[92]
ids = [1]

====================================================================================

REJECT CONTIGS

TIG 1[bases=495]
0-61 ==> 243-304 on |76|IGHV1-46|5'UTR| [len=304] (mis=1)
0-79 ==> 10061-10140 on rc of segment before IGHV1-18 exon 2 [len=10140] (mis=11)
61-325 ==> 0-264 on |77|IGHV1-46|L-REGION+V-REGION| [len=351] (mis=13)
286-335 ==> 0-49 on |56|IGHJ5|J-REGION| [len=49] (mis=25)
335-495 ==> 0-160 on |1|IGHA1|C-REGION| [len=1058] (mis=0)
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 88
start codons at 61, 217, 259, 389
confident = false
full length transcript of length 495
did not find CDR3
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.227 = GAAACTCAGCTCAACT-1

using 388 reads

====================================================================================

graph has 108 edges initially, 10 edges after simplification

total ucounts = 5
nonsolo ucounts = 3[36, 101, 249]
surviving nonsolo ucounts = 3[36, 101, 249]
ids = [0, 3, 4]

====================================================================================

UMI info for barcode GAAACTCAGCTCAACT-1 contig 1 = ATCATCCAAC...
umi ATGTAACGGT = 18 reads: -26X +1 -1XX +1 -1XX +5 -1XX +2 -4XX +1 -1XX +3 -1XX +1 -6XX +2 -1XX +22 -1XX +2 -1XX +8 -1XX +5 -1XX +4 -2XX +2 -2XX +5 -316 invalidated
umi CGCCAATCAC = 242 reads: +430 validated

GOOD CONTIGS

TIG 1[bases=501]
0-58 ==> 246-304 on |78|IGHV1-46|5'UTR| [len=304] (mis=1)
58-411 ==> 0-353 on |79|IGHV1-46|L-REGION+V-REGION| [len=353] (mis=20)
440-488 ==> 13-61 on |58|IGHJ6|J-REGION| [len=61] (mis=1)
junction support: 1 umis using 27 reads
cdr3 = CARGDRRAAAFYYHYMDVW at 400, score = 8 + 7
umis assigned: [3, 4]
of which 2 are surviving nonsolos
reads assigned: 257
start codons at 58, 214, 256, 322, 355, 445
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.232 = GAAACTCAGGCTAGAC-1

using 17 reads

====================================================================================

graph has 10 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[17]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.237 = GAAACTCAGTAGGTGC-1

using 364 reads

====================================================================================

graph has 154 edges initially, 2 edges after simplification

total ucounts = 9
nonsolo ucounts = 3[2, 45, 311]
surviving nonsolo ucounts = 1[311]
ids = [6]

====================================================================================

UMI info for barcode GAAACTCAGTAGGTGC-1 contig 1 = AAGAGCTGCT...
umi GTCTTTTTTT = 290 reads: +388 validated

GOOD CONTIGS

TIG 1[bases=495]
0-32 ==> 20-52 on |282|IGKV3-20|5'UTR| [len=52] (mis=0)
32-353 ==> 0-321 on |283|IGKV3-20|L-REGION+V-REGION| [len=348] (mis=12)
383-420 ==> 0-37 on |216|IGKJ4|J-REGION| [len=37] (mis=0)
420-495 ==> 0-75 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 50 reads
cdr3 = CQQYGSSPLLTF at 356, score = 8 + 9
umis assigned: [6]
of which 1 are surviving nonsolos
reads assigned: 285
start codons at 32, 240, 355, 366, 462
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.248 = GAAACTCCAAGAAGAG-1

using 402 reads

====================================================================================

graph has 150 edges initially, 4 edges after simplification

total ucounts = 5
nonsolo ucounts = 2[26, 373]
surviving nonsolo ucounts = 2[26, 373]
ids = [0, 1]

====================================================================================

UMI info for barcode GAAACTCCAAGAAGAG-1 contig 1 = GATCAGGACT...
umi CCACGTCATG = 382 reads: +397 validated

GOOD CONTIGS

TIG 1[bases=563]
0-30 ==> 0-30 on |264|IGKV2-28|5'UTR| [len=30] (mis=0)
30-390 ==> 0-360 on |265|IGKV2-28|L-REGION+V-REGION| [len=360] (mis=2)
389-427 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=3)
427-563 ==> 0-136 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 68 reads
cdr3 = CMQALQTRETF at 366, score = 9 + 8
umis assigned: [1]
of which 1 are surviving nonsolos
reads assigned: 371
start codons at 30, 63, 99, 187, 349, 369, 469
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.250 = GAAACTCCAAGCGAGT-1

using 177 reads

====================================================================================

graph has 104 edges initially, 8 edges after simplification

total ucounts = 6
nonsolo ucounts = 2[6, 167]
surviving nonsolo ucounts = 2[6, 167]
ids = [1, 4]

====================================================================================

UMI info for barcode GAAACTCCAAGCGAGT-1 contig 1 = GACGGAACCA...
umi CATAAATCTG = 6 reads: +14 -1X +36 -74X +22 -2X +4 -1X +16 -1X +1 -2X +7 -40 +9 -1X +38 -1XX +23 -2X +2 -1X +8 -60 +19 invalidated
umi TTCCCACCGA = 148 reads: +385 validated

GOOD CONTIGS

TIG 1[bases=492]
9-354 ==> 0-345 on |281|IGKV3-15|L-REGION+V-REGION| [len=345] (mis=0)
356-394 ==> 0-38 on |217|IGKJ5|J-REGION| [len=38] (mis=1)
394-492 ==> 0-98 on |212|IGKC|C-REGION| [len=320] (mis=0)
junction support: 1 umis using 21 reads
cdr3 = CQQYNNWPSITF at 330, score = 9 + 8
umis assigned: [1, 4]
of which 2 are surviving nonsolos
reads assigned: 151
start codons at 9, 78, 214, 436
confident = false
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.253 = GAAACTCCAATGTAAG-1

using 1155 reads

====================================================================================

graph has 1444 edges initially, 18 edges after simplification

total ucounts = 561
nonsolo ucounts = 206[2^83, 3^41, 4^29, 5^16, 6^13, 7^7, 8^9, 9, 10, 11^2, 18, 19^3]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.263 = GAAACTCCACGGCCAT-1

using 136 reads

====================================================================================

graph has 60 edges initially, 2 edges after simplification

total ucounts = 3
nonsolo ucounts = 2[4, 131]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.265 = GAAACTCCACTGAAGG-1

using 357 reads

====================================================================================

graph has 70 edges initially, 2 edges after simplification

total ucounts = 6
nonsolo ucounts = 3[2^2, 350]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

BARCODE 57.266 = GAAACTCCACTTAAGC-1

using 9 reads

====================================================================================

graph has 6 edges initially, 2 edges after simplification

total ucounts = 1
nonsolo ucounts = 1[9]
surviving nonsolo ucounts = 0[]
ids = []

====================================================================================
NOT paired!
sorting bam, mem = 0.08
running samtools sort -l 8G -o /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk057-ucc6a7a72ce/files/contig_bam_sorted.bam /scratch/etanis/ST-118/multi/dimitri-multi/SC_MULTI_CS/SC_MULTI_CORE/MULTI_GEM_WELL_PROCESSOR/VDJ_B_GEM_WELL_PROCESSOR/SC_VDJ_CONTIG_ASSEMBLER/ASSEMBLE_VDJ/fork0/chnk057-ucc6a7a72ce/files/contig_bam.bam

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

11.032 seconds used processing barcodes, peak mem = 0.23
